David, Debet
Martine, Gidley
Michael
John, Jobling
Stephen
Alan, Safford
Richard, Sidebottom
Christopher
Michael, Westcott
Roger
John
David, Debet
Martine, Gidley
Michael
John, Jobling
Stephen
Alan, Safford
Richard, Sidebottom
Christopher
Michael, Westcott
Roger
John
| 1. | Starch extracted from a potato plant and having an amylose content of at least 35 % , as judged by the iodometric assay method of Morrison & Laignelet (1983 J. Cereal Science 1, 920). |
| 2. | Starch according to claim 1, having an amylose content of at least 37%, as judged by the method defined in claim 1. |
| 3. | Starch according to claim 1, having an amylose content of at least 40% , as judged by the method defined in claim 1. |
| 4. | Starch according to claim 1 , having an amylose content of at least 50% , as judged by the method defined in claim 1. |
| 5. | Starch according to claim 1, having an amylose content of at least 66%, as judged by the method defined in claim 1. |
| 6. | Starch according to any one of claims 15, having an amylose content of 35 66%, as judged by the method defined in claim 1. |
| 7. | Starch which as extracted from a potato plant by wet milling at ambient temperature has a viscosity onset temperature in the range 70 95°C, as judged by viscoamylograph of a 10% w/w aqueous suspension thereof, performed at atmospheric pressure using the Newport Scientific Rapid Nisco Analyser 3C with a heating profile of holding at 50°C for 2 minutes, heating from 50 to 95°C at a rate of 1.5°C per minute, holding at 95°C for 15 minutes, cooling from 95 to 50°C at a rate of 1.5°C per minute, and then holding at 50°C for 15 minutes. |
| 8. | Starch which as extracted from a potato plant by wet milling at ambient temperature has peak viscosity in the range 500 12 stirring number units (SΝUs), as judged by viscoamylograph conducted according to the protocol defined in claim 7. 59 . |
| 9. | Starch which as extracted from a potato plant by wet milling at ambient temperature has a pasting viscosity in the range 214 434 SNUs, as judged by viscoamylograph conducted according to the protocol defined in claim 7. |
| 10. | Starch which as extracted from a potato plant by wet milling at ambient temperature has a setback viscosity in the range 450 618 SNUs, as judged by viscoamylograph conducted according to the protocol defined in claim 7. |
| 11. | Starch which as extracted from a potato plant by wet milling at ambient temperature has a setback viscosity in the range 14 192 SNUs, as judged by viscoamylograph conducted according to the protocol defined in claim 7. |
| 12. | Starch which as extracted from a potato plant by wet milling at ambient temperature has a peak viscosity in the range 200 500 SNUs and a setback viscosity in the range 275618 SNUs as judged by viscoamylograph according to the protocol defined in claim 7. |
| 13. | Starch which as extracted from a potato plant by wet milling at ambient temperature has a viscosity which does not decrease between the start of the heating phase (step 2) and the start of the final holding phase (step 5) and has a setback viscosity of 303 SNUs or less as judged by viscoamylograph according to the protocol defined in claim 7. |
| 14. | Starch which as extracted from a potato plant by wet milling at ambient temperature displays no significant increase in viscosity as judged by viscoamylograph conducted according to the protocol defined in claim 7. |
| 15. | Starch which as extracted from a potato plant by wet milling at ambient temperature, is in accordance with claim 7 and in accordance with any one of claims 8 to 14. |
| 16. | Starch according to any one of claims 7 to 15. having an amylose content in the range 35 66% , as judged by the method of Morrison & Laignelet defined in claim 1. 60 . |
| 17. | Starch which as extracted from a potato plant, has a phosphorus content in excess of 200mg/100grams dry weight starch. |
| 18. | Starch according to claim 17, having a phosphorus content in the range 200 240mg/100grams dry weight starch. |
| 19. | Starch according to claim 17 or 18, further in accordance with any one of claims 1 to 16. |
| 20. | Starch prepared by physical, chemical and/or enzymatic treatment of a starch initially having properties in accordance with any one of claims 119. |
| 21. | Starch according to claim 20, being resistant starch prepared by physical, chemical and/or enzymatic treatment of a starch initially having properties in accordance with any one of claims 119. |
| 22. | Starch according to claim 21, comprising in excess of 5% total dietary fibre, as determined according to the method of Prosky et al., (1985 J. Assoc. Off. Anal. Chem. 68, 677). |
| 23. | Use of starch according to any one of claims 122 in the preparation or processing of a foodstuff. |
| 24. | Use of starch according to claim 23, wherein the starch is used to provide a film, barrier, coating or as a gelling agent. |
| 25. | Use of starch according to claim 23, to prepare resistant starch compositions. |
| 26. | Use of starch according to any one of claims 122 in the preparation or processing of corrugating adhesives, biodegradable products, packaging, glass fibers and textiles. |
| 27. | A nucleotide sequence encoding an effective portion of a class A starch branching 61 enzyme (SBE) obtainable from potato plants. |
| 28. | A nucleotide sequence according to claim 27. encoding a polypeptide comprising substantially the amino acid sequence of residues 49 to 882 of the sequence shown in Figure 5. |
| 29. | A nucleotide sequence according to claim 27 or 28, comprising substantially the sequence of nucleotides 289 to 2790 of the sequence shown in Figure 5, or a functional equivalent thereof. |
| 30. | A nucleotide sequence according to claim 29, further comprising the sequence of nucleotides 145 to 288 of the sequence shown in Figure 5, or a functional equivalent thereof. |
| 31. | A nucleotide sequence according to claim 27, comprising the sequence of nucleotides 228 to 2855 of the sequence labelled psbe2con.seq in Figure 8, or a functional equivalent thereof. |
| 32. | A nucleotide sequence according to claim 27, comprising the sequence of nucleotides 57 to 2564 of the sequence labelled as psbe2con.seq in Figure 12, or a functional equivalent thereof. |
| 33. | A nucleotide sequence according to any one of claims 27 to 32, comprising an in frame ATG start codon, and optionally including a 5' and/or a 3' untranslated region. |
| 34. | A nucleotide sequence according to claim 27, comprising the sequence of nucleotides 45 to 3200 of the sequence labelled as psbe2con.seq in Figure 8, or a functional equivalent thereof. |
| 35. | A nucleic acid construct comprising a sequence in accordance with any one of claims 27 to 34. 62 . |
| 36. | An expression vector comprising a nucleic acid construct according to claim 35. |
| 37. | A host cell into which has been introduced a sequence in accordance with any one of claims 27 to 36. |
| 38. | An effective portion of a class A SBE polypeptide obtainable from potato plants and encoded by a nucleotide sequence in accordance with any one of claims 27 to 36. |
| 39. | A polypeptide according to claim 38, comprising substantially the sequence of amino acids 49 to 882 of the sequence shown in Figure 5, or a functional equivalent thereof. |
| 40. | A polypeptide according to claim 38 or 39, comprising the sequence of amino acids 1 to 48 of the sequence shown in Figure 5. |
| 41. | A polypeptide in accordance with any one of claims 38, 39 or 40 in substantial isolation from other plantderived constituents. |
| 42. | A method of altering the characteristics of a plant, comprising introducing into the plant a portion of a nucleotide sequence in accordance with any one of claims 27 to 36, operably linked to a suitable promoter active in the plant, so as to affect the expression of a gene present in the plant. |
| 43. | A method according to claim 42, wherein the nucleotide sequence is operably linked in the antisense orientation to a suitable promoter active in the plant. |
| 44. | A method according to claim 42, wherein the introduced sequence comprises one or more of the following operably linked in the sense orientation to a promoter active in the plant, so as to cause sense suppression of an enzyme naturally expressed in the plant: a 5' untranslated region, a 3' untranslated region, or a coding region of the potato SBE class A starch branching enzyme. |
| 45. | A method according to any one of claims 42. 43 or 44, further comprising 63 introducing into the plant one or more further sequences. |
| 46. | A method according to claim 45, wherein one or more of the further sequences are operably linked in the antisense orientation to a suitable promoter active in the plant. |
| 47. | A method according to claim 45 or 46, wherein the further sequence comprises a portion of a class B SBE nucleotide sequence. |
| 48. | A method according to any one of claims 42 to 47, effective in altering the starch composition of a plant. |
| 49. | A plant or plant cell having characteristics altered by the method of any one of claims 42 to 48, or the progeny of such a plant, or part of such a plant. |
| 50. | A plant according to claim 49, selected from one of the following: potato, pea, tomato, maize, wheat, rice, barley, sweet potato, and cassava. |
| 51. | A tuber or other storage organ from a plant according to claim 49 or 50. |
| 52. | Use of a tuber or other storage organ according to claim 51, in the preparation and/or processing of a foodstuff. |
| 53. | A plant according to claim 49 or 50, containing starch which, as extracted from the plant by wet milling at ambient temperature, has an elevated viscosity onset temperature as judged by viscoamylograph conducted according to the protocol defined in claim 7, compared to starch extracted from a similar, but unaltered, plant. |
| 54. | A plant according to claim 53, wherein the viscosity onset temperature is elevated by an amount in the range of 10 to 25°C. |
| 55. | A plant according to claim 49 or 50, containing starch which, as extracted from the plant by wet milling at ambient temperature, has a decreased peak viscosity as judged by 64 viscoamylograph conducted according to the protocol defined in claim 7, compared to starch extracted from a similar, but unaltered, plant. |
| 56. | A plant according to claim 55, wherein the peak viscosity is decreased by an amount in the range of 240 to 700 SNUs. |
| 57. | A plant according to claim 49 or 50, containing starch which, as extracted from the plant by wet milling at ambient temperamre, has an increased pasting viscosity as judged by viscoamylograph conducted according to the protocol defined in claim 7, compared to starch extracted from a similar, but unaltered, plant. |
| 58. | A plant according to claim 57, wherein the pasting viscosity is increased by an amount in the range of 37 to 260 SNUs. |
| 59. | A plant according to claim 49 or 50, containing starch which, as extracted from the plant by wet milling at ambient temperamre, has an increased setback viscosity as judged by viscoamylograph conducted according to the protocol defined in claim 7, compared to starch extracted from a similar, but unaltered, plant. |
| 60. | A plant according to claim 59, wherein the setback viscosity is increased by an amount in the range of 224 to 313 SNUs. |
| 61. | A plant according to claim 49 or 50, containing starch which, as extracted from the plant by wet milling at ambient temperamre, has a decreased setback viscosity as judged by viscoamylograph conducted according to the protocol defined in claim 7, compared to starch extracted from a similar, but unaltered, plant. |
| 62. | A plant according to claim 49 or 50, containing starch which, as extracted from the plant by wet milling at ambient temperamre, has an elevated apparent amylose content as judged by iodometric assay according to the method of Morrison & Laignelet, compared to starch extracted from a similar, but unaltered, plant. 65 . |
| 63. | A plant according to claim 49 or 50, containing starch which, as extracted from the plant, has a phosphorus content in excess of 200mg/100grams dry weight starch. |
| 64. | Starch obtainable from a plant according to any one of claims 49, 50 or 53 63. |
| 65. | Starch according to claim 64 and further in accordance with any one of claims 1 22. |
| 66. | A method of modifying starch in vitro, comprising treating starch under suitable conditions with an effective amount of a polypeptide in accordance with any one of claims 38 to 41. |
| 67. | A potato plant or part thereof which, in its wild type possesses an effective SBE A gene, but which plant has been altered such that there is no effective expression of an SBE A polypeptide within the cells of at least part of the plant. |
| 68. | A potato plant according to claim 67, wherein the alteration is effected by a method according to any one of claims 4248. |
Field of the Invention
This invention relates to novel nucleotide sequences, polypeptides encoded thereby, vectors and host cells and host organisms comprising one or more of the novel sequences, and to a method of altering one or more characteristics of an organism. The invention al;so relates to starch having novel properties and to uses thereof.
Background of the Invention
Starch is the major form of carbon reserve in plants, constituting 50% or more of the dry weight of many storage organs - e.g. tubers, seeds of cereals. Starch is used in numerous food and industrial applications. In many cases, however, it is necessary to modify the native starches, via chemical or physical means, in order to produce distinct properties to suit particular applications. It would be highly desirable to be able to produce starches with the required properties directly in the plant, thereby removing the need for additional modification. To achieve this via genetic engineering requires knowledge of the metabolic pathway of starch biosynthesis. This includes characterisation of genes and encoded gene products which catalyse the synthesis of starch. Knowledge about the regulation of starch biosynthesis raises the possibility of "re-programming" biosynthetic pathways to create starches with novel properties that could have new commercial applications.
The commercially useful properties of starch derive from the ability of the native granular form to swell and absorb water upon suitable treatment. Usually heat is required to cause granules to swell in a process known as gelatinisation. which has been defined (W A Atwell et al, Cereal Foods World 33, 306-311 , 1988) as "... the collapse (disruption) of molecular orders within the starch granule manifested in irreversible changes in properties such as granular swelling, native crystallite melting, loss of birefringence, and starch solubilisation. The point of initial gelatinisation and the range over which it occurs is governed by starch concentration, method of observation, granule type, and heterogeneities within the granule population under observation" . A number of techniques are available
for the determination of gelatinisation as induced by heating, a convenient and accurate method being differential scanning calorimetry, which detects the temperature range and enthalpy associated with the collapse of molecular orders within the granule. To obtain accurate and meaningf l results, the peak and/or onset temperature of the endotherm observed by differential scanning calorimetry is usually determined.
The consequence of the collapse of molecular orders within starch granules is that the granules are capable of taking up water in a process known as pasting, which has been defined (W A Atwell et al. Cereal Foods World 33, 306-311, 1988) as "... the phenomenon following gelatinisation in the dissolution of starch. It involves granular swelling, exudation of molecular components from the granule, and eventually, total disruption of the granules". The best method of evaluating pasting properties is considered to be the viscoamylograph (Atwell et al, 1988 cited above) in which the viscosity of a stirred starch suspension is monitored under a defined time/temperature regime. A typical viscoamylograph profile for potato starch shows an initial rise in viscosity, which is considered to be due to granule swelling. In addition to the overall shape of the viscosity response in a viscoamylograph, a convenient quantitative measure is the temperature of initial viscosity development (onset). Figure 1 shows such a typical viscosity profile for potato starch, during and after cooking, and includes stages A-D which correspond to viscosity onset (A), maximum viscosity (B), complete dispersion (C) and reassociation of molecules (or retrogradation, D). In the figure, the dotted line represents viscosity (in stirring number units) of a 10% w/w starch suspension and the unbroken line shows the temperature in degrees centigrade. At a certain point, defined by the viscosity peak, granule swelling is so extensive that the resulting highly expanded structures are susceptible to mechanically-induced fragmentation under the stirring conditions used. With increased heating and holding at 95 °C, further reduction in viscosity is observed due to increased fragmentation of swollen granules. This general profile has previously always been found for native potato starch.
After heating starches in water to 95 °C and holding at that temperature (for typically 15 minutes), subsequent cooling to 50°C results in an increase in viscosity due to the process of retroεradation or set-back. Retrogradation (or set-back) is defined (Atwell et al.. 1988
cited above) as "...a process which occurs when the molecules comprising gelatinised starch begin to reassociate in an ordered structure... " . At 50 °C, it is primarily the amylose component which reassociates, as indicated by the increase in viscoamylograph viscosity for starch from normal maize (21.6% amylose) compared with starch from waxy maize (1.1 % amylose) as shown in Figure 2. Figure 2 is a viscoamylograph of 10%w/w starch suspensions from waxy maize (solid line), conventional maize (dots and dashes), high amylose variety (hylon 5. dotted line) and a very high amylose variety (hylon 7, crosses). The temperature profile is also shown by a solid line, as in Figure 1. The extent of viscosity increase in the viscoamylograph on cooling and holding at 50 °C depends on the amount of amylose which is able to reassociate due to its exudation from starch granules during the gelatinisation and pasting processes. A characteristic of amylose-rich starches from maize plants is that very little amylose is exuded from granules by gelatinisation and pasting up to 95 °C, probably due to the restricted swelling of the granules. This is illustrated in Figure 2 which shows low viscosities for a high amylose (44.9%) starch (Hylon 5) from maize during gelatinisation and pasting at 95 °C and little increase in viscosity on cooling and holding at 50°C. This effect is more extreme for a higher amylose content (58%, as in Hylon 7), which shows even lower viscosities in the viscoamylograph test (Figure 2). For commercially-available high amylose starches (currently available from maize plants, such as those described above), processing at greater than 100°C is usually necessary in order to generate the benefits of high amylose contents with respect to increased rates and strengths of reassociation, but use of such high temperatures is energetically unfavourable and costly. Accordingly, there is an unmet need for starches of high amylose content which can be processed below 100°C and still show enhanced levels of reassociation, as indicated for example by viscoamylograph measurements.
The properties of potato starch are useful in a variety of both food and non-food (paper, textiles, adhesives etc.) applications. However, for many applications, properties are not optimum and various chemical and physical modifications well known in the art are undertaken in order to improve useful properties. Two types of property manipulation which would be of use are: the controlled alteration of gelatinisation and pasting temperatures; and starches which suffer less granular fragmentation during pasting than
conventional starches.
Currently the only ways of manipulating the gelatinisation and pasting temperatures of potato starch are by the inclusion of additives such as sugars, polyhydroxy compounds of salts (Evans & Haisman. Starke 34. 224-231. 1982) or by extensive physical or chemical pre-treatments (e.g. Stute, Starke 44. 205-214, 1992). The reduction of granule fragmentation during pasting can be achieved either by extensive physical pretreatments (Stute, Starke 44, 205-214, 1992) or by chemical cross-linking. Such processes are inconvenient and inefficient. It is therefore desirable to obtain plants which produce starch which intrinsically possesses such advantageous properties.
Starch consists of two main polysaccharides, amylose and amylopectin. Amylose is a generally linear polymer containing α-1,4 linked glucose units, while amylopectin is a highly branched polymer consisting of a α-1.4 linked glucan backbone with α-1,6 linked glucan branches. In most plant storage reserves amylopectin constitutes about 75% of the starch content. Amylopectin is synthesized by the concerted action of soluble starch synthase and starch branching enzyme [c.-l,4 glucan: α-1,4 glucan 6-glycosyltransferase, EC 2.4.1.18]. Starch branching enzyme (SBE) hydrolyses α-1,4 linkages and rejoins the cleaved glucan, via an -1 ,6 linkage, to an acceptor chain to produce a branched structure. The physical properties of starch are strongly affected by the relative abundance of amylose and amylopectin, and SBE is therefore a crucial enzyme in determining both the quantity and quality of starches produced in plant systems.
In most plants studied to date e.g. maize (Boyer & Preiss, 1978 Biochem. Biophys. Res. Comm. 80, 169-175), rice (Smyth. 1988 Plant Sci. 57, 1-8) and pea (Smith, Planta 175, 270-279), two forms of SBE have been identified, each encoded by a separate gene. A recent review by Burton et al., (1995 The Plant Journal 7, 3-15) has demonstrated that the two forms of SBE constitute distinct classes of the enzyme such that, in general, enzymes of the same class from different plants may exhibit greater similarity than enzymes of different classes from the same plant. In their review, Burton et al. termed the two respective enzyme families class "A" and class "B", and the reader is referred thereto (and to the references cited therein) for a detailed discussion of the distinctions
between the two classes. One general distinction of note would appear to be the presence, in class A SBE molecules, of a flexible N-terminal domain, which is not found in class B molecules. The distinctions noted by Burton et al. are relied on herein to define class A and class B SBE molecules, which terms are to be interpreted accordingly.
However in potato, only one isoform of the SBE molecule (belonging to class B) has thus far been reported and only one gene cloned (Blennow & Johansson, 1991 Phytochem. 30, 437-444, and Kofimann et al. , 1991 Mol. Gen. Genet. 230, 39-44). Further, published attempts to modify the properties of starch in potato plants (by preventing expression of the single known SBE) have generally not succeeded (e.g. Mϋller-Rober & Kofimann 1994 Plant Cell and Environment 17, 601-613).
Summary of the Invention
In a first aspect the invention provides a nucleotide sequence encoding an effective portion of a class A starch branching enzyme (SBE) obtainable from potato plants.
Preferably the nucleotide sequence encodes a polypeptide comprising an effective portion of the amino acid sequence shown in Figure 5 (excluding the sequence MNKRIDL, which does not represent part of the SBE molecule), or a functional equivalent thereof (which term is discussed below). The amino acid sequence shown in Figure 5 (Seq ID No. 15) includes a leader sequence which directs the polypeptide. when synthesised in potato cells, to the amyloplast. Those skilled in the art will recognise that the leader sequence is removed to produce a mature enzyme and that the leader sequence is therefore not essential for enzyme activity. Accordingly, an "effective portion" of the polypeptide is one which possesses sufficient SBE activity to complement the branching enzyme mutation in E. coli KN 832 cells (described below) and which is active when expressed in E. coli in the phosphorylation stimulation assay. An example of an incomplete polypeptide which nevertheless constitutes an "effective portion" is the mature enzyme lacking the leader sequence. By analogy with the pea class A SBE sequence, the potato class A sequence shown in Figure 5 probably possesses a leader sequence of about 48 amino acid residues, such that the Ν terminal amino acid sequence is thought to commence around the glutamic acid residue (E) at position 49 (EKSSYΝ... etc.). Those skilled in the an will appreciate
that an effective portion of the enzyme may well omit other pans of the sequence shown in the figure without substantial detrimental effect. For example, the C-terminal glutamic acid-rich region could be reduced in length, or possibly deleted entirely, without abolishing class A SBE activity. A comparison with other known SBE sequences, especially other class A SBE sequences (see for example, Burton et al. 1995 cited above), should indicate those portions which are highly conserved (and thus likely to be essential for activity) and those portions which are less well conserved (and thus are more likely to tolerate sequence changes without substantial loss of enzyme activity).
Conveniently the nucleotide sequence will comprise substantially nucleotides 289 to 2790 of the DNA sequence (Seq ID No. 14) shown in Figure 5 (which nucleotides encode the mature enzyme) or a functional equivalent thereof, and may also include further nucleotides at the 5' or 3' end. For example, for ease of expression, the sequence will desirably also comprise an in-frame -\TG start codon, and may also encode a leader sequence. Thus, in one embodiment, the sequence further comprises nucleotides 145 to 288 of the sequence shown in Figure 5. Other embodiments are nucleotides 228 to 2855 of the sequence labelled "psbe2con.seq" in Figure 8, and nucleotides 57 to 2564 of the sequence shown in Figure 12 (preferably comprising an in-frame ATG start codon, such as the sequence of nucleotides 24 to 56 in the same Figure), or functional equivalents of the aforesaid sequences.
The term "functional equivalent" as applied herein to nucleotide sequences is intended to encompass those sequences which differ in their nucleotide composition to that shown in Figure 5 but which, by virtue of the degeneracy of the genetic code, encode polypeptides having identical or substantially identical amino acid sequences. It is intended that the term should also apply to sequences which are sufficiently homologous to the sequence of the invention that they can hybridise to the complement thereof under stringent hybridisation conditions - such equivalents will preferably possess at least 85% , more preferably at least 90%, and most preferably at least 95% sequence homology with the sequence of the invention as exemplified by nucleotides 289 to 2790 of the DNA sequence shown in Figure 5. It will be apparent to those skilled in the art that the nucleotide sequence of the invention may also find useful application when present as an "antisense"
sequence. Accordingly, functionally equivalent sequences will also include those sequences which can hybridise, under stringent hybridisation conditions, to the sequence of the invention (rather than the complement thereof). Such "antisense" equivalents will preferably possess at least 85%, more preferably at least 90% . and most preferably 95% sequence homology with the complement of the sequence of the invention as exemplified by nucleotides 289 to 2790 of the DNA sequence shown in Figure 5. Particular functional equivalents are shown, for example, in Figures 8 and 10 (if one disregards the various frameshift mutations noted therein).
The invention also provides vectors, particularly expression vectors, comprising the nucleotide sequence of the invention. The vector will typically comprise a promoter and one or more regulatory signals of the type well known to those skilled in the art. The invention also includes provision of cells transformed (which term encompasses transduction and transfection) with a vector comprising the nucleotide sequence of the invention.
The invention further provides a class A SBE polypeptide, obtainable from potato plants. In particular the invention provides the polypeptide in substantially pure form, especially in a form free from other plant-derived (especially potato plant-derived) components, which can be readily accomplished by expression of the relevant nucleotide sequence in a suitable non-plant host (such as any one of the yeast strains routinely used for expression purposes, e.g. Pichia spp. or Saccharomyces spp). Typically the enzyme will substantially comprise the sequence of amino acid residues 49 to 882 shown in Figure 5 (disregarding the sequence MNKRIDL, which is not part of the enzyme), or a functional equivalent thereof. The polypeptide of the invention may be used in a method of modifying starch in vitro, comprising treating starch under suitable conditions (e.g. appropriate temperature, pH, etc) with an effective amount of the polypeptide according to the invention.
The term "functional equivalent", as applied herein to amino acid sequences, is intended to encompass amino acid sequences substantially similar to that shown in Figure 5. such that the polypeptide possesses sufficient activity to complement the branching enzyme mutation in E. coli KV 832 cells (described below) and which is active in E. coli in the
phosphorylation stimulation assay. Typically such functionally equivalent amino acid sequences will preferably possess at least 85 % , more preferably at least 90%, and most preferably at least 95 % sequence identity with the amino acid sequence of the mature enzyme (i.e. minus leader sequence) shown in Figure 5. Those skilled in the art will appreciate that conservative substitutions may be made generally throughout the molecule without substantially affecting the activity of the enzyme. Moreover, some non- conservative substitutions may be tolerated, especially in the less highly conserved regions of the molecule. Such substitutions may be made, for example, to modify slightly the activity of the enzyme. The polypeptide may, if desired, include a leader sequence, such as that exemplified by residues 1 to 48 of the amino acid sequence shown in Figure 5, although other leader sequences and signal peptides and the like are known and may be included.
A portion of the nucleotide sequence of the invention has been introduced into a plant and found to affect the characteristics of the plant. In particular, introduction of the sequence of the invention, operably linked in the antisense orientation to a suitable promoter, was found to reduce the amount of branched starch molecules in the plant. Additionally, it has recently been demonstrated in other experimental systems that "sense suppression" can also occur (i.e. expression of an introduced sequence operably linked in the sense orientation can interfere, by some unknown mechanism, with the expression of the native gene), as described by Matzke & Matzke (1995 Plant Physiol. 107, 679-685). Any one of the methods mentioned by Matzke & Matzke could, in theory, be used to affect the expression in a host of a homologous SBE gene.
It is believed that antisense methods are mainly operable by the production of antisense mRNA which hybridises to the sense mRNA, preventing its translation into functional polypeptide, possibly by causing the hybrid RNA to be degraded (e.g. Sheehy et al. , 1988 PNAS 85, 8805-8809: Van der Krol et al., Mol. Gen. Genet. 220, 204-212). Sense suppression also requires homology between the introduced sequence and the target gene, but the exact mechanism is unclear. It is apparent however that, in relation to both antisense and sense suppression, neither a full length nucleotide sequence, nor a "native" sequence is essential. Preferably the "effective portion" used in the method will comprise
at least one third of the full length sequence, but by simple trial and error other fragments (smaller or larger) may be found which are functional in altering the characteristics of the plant.
Thus, in a fuπher aspect the invention provides a method of altering the characteristics of a plant, comprising introducing into the plant an effective portion of the sequence of the invention operably linked to a suitable promoter active in the plant. Conveniently the sequence will be linked in the anti-sense orientation to the promoter. Preferably the plant is a potato plant. Conveniently, the characteristic altered relates to the starch content and/or starch composition of the plant (i.e. amount and/or type of starch present in the plant). Preferably the method of altering the characteristics of the plant will also comprise the introduction of one or more further sequences, in addition to an effective portion of the sequence of the invention. The introduced sequence of the invention and the one or more further sequences (which may be sense or antisense sequences) may be operably linked to a single promoter (which would ensure both sequences were transcribed at essentially the same time), or may be operably linked to separate promoters (which may be necessary for optimal expression). Where separate promoters are employed they may be identical to each other or different. Suitable promoters are well known to those skilled in the art and include both constitutive and inducible types. Examples include the CaMN 35S promoter (e.g. single or tandem repeat) and the patatin promoter. Advantageously the promoter will be tissue-specific. Desirably the promoter will cause expression of the operably linked sequence at substantial levels only in the tissue of the plant where starch synthesis and/or starch storage mainly occurs. Thus, for example, where the sequence is introduced into a potato plant, the operably linked promoter may be tuber-specific, such as the patatin promoter.
Desirably, for example, the method will also comprise the introduction of an effective portion of a sequence encoding a class B SBE, operably linked in the antisense orientation to a suitable promoter active in the plant. Desirably the further sequence will comprise an effective portion of the sequence encoding the potato class B SBE molecule. Conveniently the further sequence will comprise an effective portion of the sequence described by Blennow & Johansson (1991 Phytochem. 30, 437-444) or that disclosed in
WO92/11375. More preferably, the further sequence will comprise at least an effective portion of the sequence disclosed in International Patent Application No. WO 95/26407. Use of antisense sequences against both class A and class B SBE in combination has now been found by the present inventors to result in the production of starch having very greatly altered properties (see below). Those skilled in the art will appreciate the possibility that, if the plant already comprises a sense or antisense sequence which efficiently inhibits the class B SBE activity, introduction of a sense or antisense sequence to inhibit class A SBE activity (thereby producing a plant with inhibition of both class A and class B activity) might alter greatly the properties of the starch in the plant, without the need for introduction of one or more further sequences. Thus the sequence of the invention is conveniently introduced into plants already having low levels of class A and/or class B SBE activity, such that the inhibition resulting from the introduction of the sequence of the invention is likely to have a more pronounced effect.
The sequence of the invention, and the one or more further sequences if desired, can be introduced into the plant by any one of a number of well-known techniques (e.g. Agrobacterium-mediated transformation, or by "biolistic" methods). The sequences are likely to be most effective in inhibiting SBE activity in potato plants, but theoretically could be introduced into any plant. Desirable examples include pea, tomato, maize, wheat, rice, barley, sweet potato and cassava plants. Preferably the plant will comprise a natural gene encoding an SBE molecule which exhibits reasonable homology with the introduced nucleic acid sequence of the invention.
In another aspect, the invention provides a plant cell, or a plant or the progeny thereof, which has been altered by the method defined above. The progeny of the altered plant may be obtained, for example, by vegetative propagation, or by crossing the altered plant and reserving the seed so obtained. The invention also provides parts of the altered plant, such as storage organs. Conveniently, for example, the invention provides tubers comprising altered starch, said tubers being obtained from an altered plant or the progeny thereof. Potato tubers obtained from altered plants (or the progeny thereof) will be particularly useful materials in certain industrial applications and for the preparation and/or processing of foodstuffs and may be used, for example, to prepare low-fat waffles and
chips (amylose generally being used as a coating to prevent fat uptake), and to prepare mashed potato (especially "instant" mashed potato) having particular characteristics.
In particular relation to potato plants, the invention provides a potato plant or part thereof which, in its wild type possesses an effective SBE A gene, but which plant has been altered such that there is no effective expression of an SBE A polypeptide within the cells of at least part of the plant. The plant may have been altered by the method defined above, or may have been selected by conventional breeding to be deleted for the class A SBE gene, presence or absence of which can be readily determined by screening samples of the plants with a nucleic acid probe or antibody specific for the potato class A gene or gene product respectively.
The invention also provides starch extracted from a plant altered by the method defined above, or the progeny of such a plant, the starch having altered properties compared to starch extracted from equivalent, but unaltered, plants. The invention further provides a method of making altered starch, comprising altering a plant by the method defined above and extracting therefrom starch having altered properties compared to starch extracted from equivalent, but unaltered, plants. Use of nucleotide sequences in accordance with the invention has allowed the present inventors to produce potato starches having a wide variety of novel properties.
In particular the invention provides the following: a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has an elevated endotherm peak temperature as judged by DSC, compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has an elevated viscosity onset temperature (conveniently elevated by 10 - 25°C) as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has a decreased peak viscosity (conveniently decreased by 240 - 700SNUs) as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method
defined above, containing starch which, when extracted from the plant, has an increased pasting viscosity (conveniently increased by 37 - 260SNUs) as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has an increased set-back viscosity (conveniently increased by 224 - 313 SNUs) as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has a decreased set-back viscosity as judged by viscoamylograph compared to starch extracted from a similar, but unaltered, plant; and a plant (especially a potato plant) altered by the method defined above, containing starch which, when extracted from the plant, has an elevated amylose content as judged by iodometric assay (i.e. by the method of Morrison & Laignelet 1983, cited above) compared to starch extracted from a similar, but unaltered, plant. The invention also provides for starch obtainable or obtained from such plants as aforesaid.
In particular the invention provides for starch which, as extracted from a potato plant by wet milling at ambient temperature, has one or more of the following properties, as judged by viscoamylograph analysis performed according to the conditions defined below: viscosity onset temperature in the range 70-95°C (preferably 75-95°C); peak viscosity in the range 500 - 12 stirring number units; pasting viscosity in the range 214 - 434 stirring number units; set-back viscosity in the range 450 - 618 or 14 - 192 stirring number units; or displays no significant increase in viscosity during viscoamylograph. Peak, pasting and set-back viscosities are defined below. Viscosity onset temperature is the temperature at which there is a sudden, marked increase in viscosity from baseline levels during viscoamylograph, and is a term well-known to those skilled in the art.
In other particular embodiments, the invention provides starch which as extracted from a potato plant by wet milling at ambient temperature has a peak viscosity in the range 200 - 500 SNUs and a set-back viscosity in the range 275-618 SNUs as judged by viscoamylograph according to the protocol defined below; and starch which as extracted from a potato plant by wet milling at ambient temperature has a viscosity which does not decrease between the start of the heating phase (step 2) and the start of the final holding
phase (step 5) and has a set-back viscosity of 303 SNUs or less as judged by viscoamylograph according to the protocol defined below.
For the purposes of the present invention, viscoamylograph conditions are understood to pertain to analysis of a 10% (w/w) aqueous suspension of starch at atmospheric pressure, using a Newport Scientific Rapid Visco Analyser with a heating profile of: holding at 50°C for 2 minutes (step 1), heating from 50 to 95°C at a rate of 1.5°C per minute (step 2), holding at 95°C for 15 minutes (step 3), cooling from 95 to 50°C at a rate of 1.5°C per minute (step 4), and then holding at 50°C for 15 minutes (step 5). Peak viscosity may be defined for present purposes as the maximum viscosity attained during the heating phase (step 2) or the holding phase (step 3) of the viscoamylograph. Pasting viscosity may be defined as the viscosity attained by the starch suspensions at the end of the holding phase (step 3) of the viscoamylograph. Set-back viscosity may be defined as the viscosity of the starch suspension at the end of step 5 of the viscoamylograph.
In yet another aspect the invention provides starch from a potato plant having an apparent amylose content (% w/w) of at least 35%, as judged by iodometric assay according to the method described by Morrison & Laignelet (1983 J. Cereal Science 1, 9-20). Preferably the starch will have an amylose content of at least 40% , more preferably at least 50% , and most preferably at least 66% . Starch obtained directly from a potato plant and having such properties has not hitherto been produced. Indeed, as a result of the present invention, it is now possible to generate in vivo potato starch which has some properties analogous to the very high amylose starches (e.g. Hylon 7) obtainable from maize.
Starches with high (at least 35%) amylose contents find commercial application as, amongst other reasons, the amylose component of starch reassociates more strongly and rapidly than the amylopectin component during retrogradation processes. This may result, for example, in pastes with higher viscosities, gels of greater cohesion, or films of greater strength for starches with high (at least 35%) compared with normal (less than 35%) amylose contents. Alternatively, starches may be obtained with very high amylose contents, such that the granule structure is substantially preserved during heating, resulting in starch suspensions which demonstrate substantially no increase in viscosity during
cooking (i.e. there is no significant viscosity increase during viscoamylograph conditions defined above). Such starches typically exhibit a viscosity increase of less than 10% (preferably less than 5%) during viscoamylograph under the conditions defined above.
In commerce, these valuable properties are currently obtained from starches of high amylose content derived from maize plants. It would be of commercial value to have an alternative source of high amylose starches from potato as other characteristics such as granule size, organoleptic properties and textural qualities may distinguish application performances of high amylose starches from maize and potato plants.
Thus high amylose starch obtained by the method of the present invention may find application in many different technological fields, which may be broadly categorised into two groups: food products and processing; and "Industrial" applications. Under the heading of food products, the novel starches of the present invention may find application as, for example, films, barriers, coatings or gelling agents. In general, high amylose content starches absorb less fat during frying than starches with low amylose content, thus the high amylose content starches of the invention may be advantageously used in preparing low fat fried products (e.g. potato chips, crisps and the like). The novel starches may also be employed with advantage in preparing confectionery and in granular and retrograded "resistant" starches. "Resistant" starch is starch which is resistant to digestion by α-amylase. As such, resistant starch is not digested by α-amylases present in the human small intestine, but passes into the colon where it exhibits properties similar to soluble and insoluble dietary fibre. Resistant starch is thus of great benefit in foodstuffs due to its low calorific value and its high dietary fibre content. Resistant starch is formed by the retrogradation (akin to recrystallization) of amylose from starch gels. Such retrogradation is inhibited by amylopectin. Accordingly, the high amylose starches of the present invention are excellent starting materials for the preparation of resistant starch. Suitable methods for the preparation of resistant starch are well-known to those skilled in the art and include, for example, those described in US 5,051,271 and US 5,281.276. Conveniently the resistant starches provided by the present invention comprise at least 5% total dietary fibre, as judged by the method of Prosky et al., (1985 J. Assoc. Off. Anal. Chem. 68, 677), mentioned in US 5,281, 276.
Under the heading of "Industrial" applications, the novel starches of the invention may be advantageously employed, for example, in corrugating adhesives, in biodegradable products such as loose fill packaging and foamed shapes, and in the production of glass fibers and textiles.
Those skilled in the art will appreciate that the novel starches of the invention may, if desired, be subjected in vitro to conventional enzymatic, physical and/or chemical modification, such as cross-linking, introduction of hydrophobic groups (e.g. octenyl succinic acid, dodecyl succinic acid), or derivatization (e.g. by means of esterification or etherification).
In yet another aspect the invention provides high (35 % or more) amylose starches which generate paste viscosities greater than those obtained from high amylose starches from maize plants after processing at temperatures below 100°C. This provides the advantage of more economical starch gelatinisation and pasting treatments through the use of lower processing temperatures than are currently required for high amylose starches from maize plants.
The invention will now be further described by way of illustrative example and with reference to the drawings, of which:
Figure 1 shows a typical viscoamylograph for a 10% w/w suspension of potato starch;
Figure 2 shows vsicoamylographs for 10% suspensions of starch from various maize varieties;
Figure 3 is a schematic representation of the cloning strategy used by the present inventors;
Figure 4a shows the amino acid alignment of the C-terminal portion of starch branching enzyme isoforms from various sources: amino acid residues matching the consensus
sequence are shaded;
Figure 4b shows the alignment of DNA sequences of various starch branching enzyme isoforms which encode a conserved amino acid sequence;
Figure 5 shows the DNA sequence (Seq ID No. 14) and predicted amino acid sequence (Seq ID No. 15) of a full length potato class A SBE cDNA clone obtained by PCR;
Figure 6 shows a comparison of the most highly conserved part of the amino acid sequences of potato class A (uppermost sequence) and class B (lowermost sequence) SBE molecules;
Figure 7 shows a comparison of the amino acid sequence of the full length potato class A (uppermost sequence) and pea (lowermost sequence) class A SBE molecules;
Figure 8 shows a DNA alignment of various full length potato class A SBE clones obtained by the inventors;
Figure 9 shows the DNA sequence of a potato class A SBE clone determined by direct sequencing of PCR products, together with the predicted amino acid sequence;
Figure 10 is a multiple DNA alignment of various full length potato SBE A clones obtained by the inventors;
Figure 11 is a schematic illustration of the plasmid pSJ64;
Figure 12 shows the DNA sequence and predicted amino acid sequence of the full length potato class A SBE clone as present in the plasmid pSJ90: and
Figure 13 shows viscoamylographs for 10% w/w suspensions of starch from various transgenic potato plants made by the relevant method aspect of the invention.
Examples
Example 1
Cloning of Potato class A SBE
The strategy for cloning the second form of starch branching enzyme from potato is shown in Figure 3. The small arrowheads represent primers used by the inventors in PCR and RACE protocols. The approximate size of the fragments isolated is indicated by the numerals on the right of the Figure. By way of explanation, a comparison of the amino acid sequences of several cloned plant starch branching enzymes (SBE) from maize (class A), pea (class A), maize (class B), rice (class B) and potato (class B), as well as human glycogen branching enzyme, allowed the inventors to identify a region in the carboxy-terminal one third of the protein which is almost completely conserved (GYLNFMGNEFGHPEWIDFPR) (Figure 4a). A multiple alignment of the DNA sequences (human, pea class A, potato class B, maize class B, maize class A and rice class B, respectively) corresponding to this region is shown in Figure 4b and was used to design an oligo which would potentially hybridize to all known plant starch branching enzymes: AATTT(C/T)ATGGGIAA(C/T)GA(A/G)TT(C/T)GG (Seq ID No. 20).
Library PCR
The initial isolation of a partial potato class A SBE cDNA clone was from an amplified potato tuber cDNA library in the λZap vector (Stratagene). One half μL of a potato cDNA library (titre 2.3 x 10 9 pfu/mL) was used as template in a 50 μL reaction containing 100 pmol of a 16 fold degenerate POTSBE primer and 25 pmol of a T7 primer (present in the λZap vector 3' to the cDNA sequences - see Figure 3), 100 μM dNTPs, 2.5 U Taq polymerase and die buffer supplied with the Taq polymerase (Stratagene). All components except the enzyme were added to a 0.5 mL microcentrifuge tube, covered with mineral oil and incubated at 94°C for 7 minutes and then held at 55°C. while the Taq polymerase was added and mixed by pipetting. PCR was then performed by incubating for 1 min at 94°C, 1 min at 58°C and 3 minutes at 72°C. for 35 cycles. The PCR products were extracted with phenol/chloroform, ethanol precipitated and resuspended in TE pH 8.0 before cloning into the T/A cloning vector pT7BlueR (Invitrogen).
Several fragments between 600 and 1300 bp were amplified. These were isolated from an agarose gel and cloned into the pT7BlueR T/A cloning vector. Restriction mapping of 24 randomly selected clones showed that they belonged to several different groups (based on size and presence/absence of restriction sites). Initially four clones were chosen for sequencing. Of these four, two were found to correspond to the known potato class B SBE sequence, however the other two, although homologous, differed significantly and were more similar to the pea class A SBE sequence, suggesting that they belonged to the class A family of branching enzymes (Burton et al., 1995 The Plant Journal, cited above). The latter two clones ( ~- 800bp) were sequenced fully. They both contained at d e 5' end the sequence corresponding to the degenerate oligonucleotide used in the PCR and had a predicted open reading frame of 192 amino acids. The deduced amino acid sequence was highly homologous to that of the pea class A SBE.
The - 800 bp PCR derived cDNA fragment (corresponding to nucleotides 2281 to 3076 of the psbe2 con. seq sequence shown in Figure 8) was used as a probe to screen the potato tuber cDNA library. From one hundred and eighty thousand plaques, seven positives were obtained in the primary screen. PCR analysis showed that five of these clones were smaller than the original 800 bp cDNA clone, so these were not analysed further. The two other clones (designated 3.2.1 and 3.1.1) were approximately 1200 and 1500 bp in length respectively. These were sequenced from their 5' ends and the combined consensus sequence aligned with the sequence from the PCR generated clones. The cDNA clone 3.2.1 was excised from the phage vector and plasmid DNA was prepared and the insert fully sequenced. Several attempts to obtain longer clones from the library were unsuccessful, therefore clones containing the 5' end of the full length gene were obtained using RACE (rapid amplification of cDNA ends).
Rapid Amplification of cDNA ends (RACE) and PCR conditions
RACE was performed essentially according to Frohman (1992 Amplifications 11-15). Two μg of total RNA from mature potato tubers was heated to 65 °C for 5 min and quick cooled on ice. The RNA was then reverse transcribed in a 20 μL reaction for 1 hour at 37 °C using BRL's M-MLV reverse transcriptase and buffer with 1 mM DTT, 1 mM dNTPs, 1 U/μL RNAsin (Promega) and 500 pmol random hexamers (Pharmacia) as
primer. Excess primers were removed on a Centricon 100 column and cDNA was recovered and precipitated with isopropanol. cDNA was A-tailed in a volume of 20 μl using 10 units terminal transferase (BRL), 200 μM dATP for 10 min at 37°C, followed by 5 min at 65 °C. The reaction was then diluted to 0.5 ml with TE pH 8 and stored at 4°C as the cDNA pool. cDNA clones were isolated by PCR amplification using the primers R o R-dT--,, R o and POTSBE24. The PCR was performed in 50 μL using a hot start technique: 10 μL of the cDNA pool was heated to 94°C in water for 5 min with 25 pmol POTSBE24, 25 pmol R„ and 2.5 pmol of R o R*dT 17 and cooled to 75°C. Five μL of 10 x PCR buffer (Stratagene), 200 μM dNTPs and 1.25 units of Taq polymerase were added, the mixture heated at 45 °C for 2 min and 72°C for 40 min followed by 35 cycles of 94°C for 45 sec, 50 °C for 25 sec, 72 °C for 1.5 min and a final incubation at 72 °C for 10 min. PCR products were separated by electrophoresis on 1 % low melting agarose gels and the smear covering the range 600-800 bp fragments was excised and used in a second PCR amplification with 25 pmol of R- and POTSBE25 primers in a 50 μL reaction (28 cycles of 94°C for 1 min, 50°C 1 min, 72°C 2 min). Products were purified by chloroform extraction and cloned into pT7 Blue. PCR was used to screen the colonies and the longest clones were sequenced.
The first round of RACE only extended the length of the SBE sequence approximately 100 bases, therefore a new A-tailed cDNA library was constructed using the class A SBE specific oligo POTSBE24 (10 pmol) in an attempt to recover longer RACE products. The first and second round PCR reactions were performed using new class A SBE primers (POTSBE 28 and 29 respectively) derived from the new sequence data. Conditions were as before except that the elongation step in the first PCR was for 3 min and the second PCR consisted of 28 cycles at 94 °C for 45 seconds, 55 °C for 25 sec and 72 °C for 1 min 45 sec.
Clones ranging in size from 400 bp to 1.4 kb were isolated and sequenced. The combined sequence of the longest RACE products and cDNA clones predicted a full length gene of about 3150 nucleotides, excluding the poly(A) tail (psbe 2con.seq in Fig. 8).
As the sequence of the 5' half of the gene was compiled from the sequence of several
RACE products generated using Taq polymerase, it was possible that the compiled sequence did not represent that of a single mRNA species and/or had nucleotide sequence changes. The 5' 1600 bases of the gene was therefore re-isolated by PCR using Ultma, a thermostable DNA polymerase which, because it possesses a 3 ' -5 ' exonuclease activity, has a lower error rate compared to Taq polymerase. Several PCR products were cloned and restriction mapped and found to differ in the number of Hind III. Ssp I, and EcoR I sites. These differences do not represent PCR artefacts as they were observed in clones obtained from independent PCR reactions (data not shown) and indicate that there are several forms of the class A SBE gene transcribed in potato tubers.
In order to ensure that the sequence of the full length cDNA clone was derived from a single mRNA species it was therefore necessary to PCR the entire gene in one piece. cDNA was prepared according to the RACE protocol except that the adaptor oligo R o R-dTπ (5 pmol) was used as a primer and after synthesis the reaction was diluted to 200 μL with TE pH 8 and stored at 4°C. Two μL of the cDNA was used in a PCR reaction of 50 μL using 25 pmol of class A SBE specific primers PBER1 and PBERT (see below), and thirty cycles of 94° for 1 min, 60°C for 1 min and 72°C for 3 min. If Taq polymerase was used the PCR products were cloned into pT7Blue whereas if Ultma polymerase was used the PCR products were purified by chloroform extraction, ethanol precipitation and kinased in a volume of 20 μL (and then cloned into pBSSK IIP which had been cut with EcoRV and dephosphorylated). At least four classes of cDNA were isolated, which again differed in the presence or absence of Hind HI, Ssp I and EcoR I sites. Three of these clones were sequenced fully, however one clone could not be isolated in sufficient quantity to sequence.
The sequence of one of the clones (number 19) is shown in Figure 5. The first med ionine (initiation) codon starts a short open reading frame (ORF) of 7 amino acids which is out of frame with the next predicted ORF of 882 amino acids which has a molecular mass (Mr) of approximately 100 Kd. Nucleotides 6-2996 correspond to SBE sequence - the rest of the sequence shown is vector derived. Figure 6 shows a comparison of the most highly conserved part of the amino acid sequence of potato class A SBE (residues 180-871, top, row) and potato class B SBE (bottom row, residues 98-792); the middle row indicates the
degree of similarity, identical residues being denoted by the common letter, conservative changes by two dots and neutral changes by a single dot. Dashes indicate gaps introduced to optimise the alignment. The class A SBE protein has 44% identity over the entire length with potato class B SBE, and 56% identity therewith in the central conserved domain (Figure 6), as judged by the "Megalign" program (DNASTAR). However. Figure 7 shows a comparison between potato class A SBE (top row, residues 1-873) and pea class A SBE (bottom row, residues 1-861). from which it can be observed that cloned potato gene is more homologous to the class A pea enzyme, where the identity is 70 % over nearly the entire length, and this increases to 83 % over the central conserved region (starting at IPPP at position " 170). It is clear from this analysis that this cloned potato SBE gene belongs to the class A family of SBE genes.
An E. coli culture, containing the plasmid pSJ78 (which directs the expression of a full length potato SBE Class A gene), has been deposited (on 3rd January 1996) under the terms of the Budapest Treaty at The National Collections of Industrial and Marine Bacteria Limited (23 St Machar Drive, Aberdeen, AB2 1RY, United Kingdom), under accession number NCIMB 40781. Plasmid pSJ78 is equivalent to clone 19 described above. It represents a full length SBE A cDNA blunt-end ligated into the vector pBSSKLIP.
Polymorphism of class A SBE genes
Sequence analysis of the other two full lengm class A SBE genes showed that they contain frameshift mutations and are therefore unable to encode full lengd proteins and indeed they were unable to complement the branching enzyme deficiency in the KV832 mutant (described below). An alignment of the full length DNA sequences is shown in Figure 8: "lOcon.seq" (Seq ID No. 12), "19con.seq" (Seq ID No. 14) and "llcon.seq" (Seq ID No. 13) represent the sequence of full length clones 10, 19 and 11 obtained by PCR using the PBER1 and PBERT primers (see below), whilst "psbe2con.seq" (Seq ID No. 18) represents the consensus sequence of the RACE clones and cDNA clone 3.2.1. Those nucleotides which differ from the overall consensus sequence (not shown) are shaded. Dashes indicate gaps introduced to optimise the alignment. Apart from the frameshift mutations these clones are highly homologous. It should be noted that the 5' sequence of psbe2con is longer because this is the longest RACE product and it also contains several
changes compared to the other clones. The upstream methionine codon is still present in this clone but the upstream ORF is shortened to just 3 amino acids and in addition there is a 10 base deletion in the 5' untranslated leader.
The other significant area of variation is in the carboxy terminal region of the protein coding region. Closer examination of this area reveals a GAA trinucleotide repeat structure which varies in length between the four clones. These are typical characteristics of a microsatellite repeat region. The most divergent clone is #11 which has only one GAA triplet whereas clone 19 has eleven perfect repeats and the other two clones have five and seven GAA repeats. All of these deletions maintain the ORF but change the number of glutamic acid residues at the carboxy terminus of the protein.
Most of the other differences between the clones are single base changes. It is quite possible that some of these are PCR errors. To address this question direct sequencing of PCR fragments amplified from first strand cDNA was performed. Figure 9 shows the DNA sequence, and predicted amino acid sequence, obtained by such direct sequencing. Certain restriction sites are also marked. Nucleotides which could not be unambiguously assigned are indicated using standard IUPAC notation and, where this uncertainty affects the predicted amino acid sequence, a question mark is used. Sequence at the extreme 5' and 3' ends of the gene could not be determined because of the heterogeneity observed in the different cloned genes in these regions (see previous paragraph). However this can be taken as direct evidence that these differences are real and are not PCR or cloning artefacts.
There is absolutely no evidence for the frameshift mutations in the PCR derived sequence and it would appear that these mutations are an artefact of the cloning process, resulting from negative selection pressure in E. coli. This is supported by the fact that it proved extremely difficult to clone the full length PCR products intact as many large deletions were seen and the full length clones obtained were all cloned in one orientation (away from the LacZ promoter), perhaps suggesting that expression of the gene is toxic to the cells. Difficulties of this nature may have been responsible, at least in part, for the previous failure of other researchers to obtain the present invention.
A comparison of all the full length sequences is shown in Figure 10. In addition to clones 10, 11 and 19 are shown the sequences of a Bgl II - Xho I product cloned directly into the QE32 ej\pression vector ("86CON.SEQ", Seq ID No. 16) and the consensus sequence of the directly sequenced PCR products ("pcrsbe2con.seq", Seq ID No. 17). Those nucleotides which differ from the consensus sequence (not shown) are shaded. Dashes indicate gaps introduced to optimise the alignment. There are 11 nucleotide differences predicted to be present in the mRNA population, which are indicated by asterisks above and below the sequence. The other differences are probably PCR artefacts or possibly sequencing errors.
Complementation of a branching enzyme deficient E. coli mutant
To determine if the isolated SBE gene encodes an active protein i.e. one that has branching enzyme activity, a complementation test was performed in the E. coli strain KV832. This strain is unable to make bacterial glycogen as the gene for the glycogen branching enzyme has been deleted (Keil et al., 1987 Mol. Gen. Genet. 207, 294-301). When wild type cells are grown in the presence of glucose they synthesise glycogen (a highly branched glucose polymer) which stains a brown colour with iodine, whereas the KV832 cells make only a linear chain glucose polymer which stains blueish green with iodine. To determine if the cloned SBE gene could restore the ability of the KV832 cells to make a branched polymer, the clone pSJ90 (Seq ID No. 19) was used and constructed as below. The construct is a PCR-derived, substantially full length fragment (made using primers PBE 2B and PBE 2X, detailed below), which was cut with Bgl II and Xho I and cloned into the BamΑ \ I Sai l sites of the His-tag expression vector pQE32 (Qiagen). This clone, pSJ86, was sequenced and found to have a frameshift mutation of two bases in the 5' half of the gene. This frameshift was removed by digestion with Nsi I and Sna I and replaced with the corresponding fragment from a Taq-generated PCR clone to produce the plasmid pSJ90 (sequence shown in Figure 12; the first 10 amino acids are derived from the expression vector). The polypeptide encoded by pSJ90 would be predicted to correspond to amino acids 46-882 of the full SBE coding sequence. The construct pSJ90 was transformed into the branching enzyme deficient KN832 cells and transformants were grown on solid PYG medium (0.85 % KH 2 PO 4 , 1.1 % K 2 HPO 4 , 0.6% yeast extract) containing 1.0% glucose. To test for complementation, a loop of cells was
scraped off and resuspended in 150μl of water, to which was added 15μl Lugol's solution (2g KI and lg I 2 per 300ml water). It was found that the potato SBE fragment- transformed KV832 cells now stained a yellow-brown colour with iodine whereas control cells containing only the pQE32 vector continued to stain blue-green.
Expression of potato class A SBE in E. coli
Single colonies of KV832, containing one of the plasmids pQE32, pAGCRl or pSJ90, were picked into 50ml of 2xYT medium containing carbenicillin, kanamycin and streptomycin as appropriate (100, 50 and 25 mg/L, respectively) in a 250ml flask and grown for 5 hours, with shaking, at 37°C. IPTG was then added to a final concentration of ImM to induce expression and the flasks were further incubated overnight at 25°C. The cells were harvested by centrifugation and resuspended in 50 mM sodium phosphate buffer (pH 8.0), containing 300mM NaCl, lmg/ml lysozyme and ImM PMSF and left on ice for 1 hour. The cell lysates were then sonicated (3 pulses of 10 seconds at 40% power using a microprobe) and cleared by centrifugation at 12,000g for 10 minutes at 4°C. Cleared lysates were concentrated approximately 10 fold in a Centricon™ 30 filtration unit. Duplicate lOμl samples of the resulting extract were assayed for SBE activity by the phosphorylation stimulation method, as described in International Patent Application No. PCT/GB95/00634. In brief, the standard assay reaction mixture (0.2ml) was 200mM 2- (N-morpholino) ethanesulphonic acid (MES) buffer pH6.5, containing lOOnCi of 1 C glucose- 1 -phosphate at 50mM, 0.05 mg rabbit phosphorylase A, and E. coli lysate. The reaction mixture was incubated for 60 minutes at 30°C and the reaction terminated and glucan polymer precipitated by the addition of 1ml of 75% (v/v) methanol, 1 % (w/v) potassium hydroxide, and then 0.1ml glycogen (lOmg/ml). The results are presented below:
The potato class A SBE activity is 7-8 fold above background levels. It was concluded therefore that the potato class A SBE gene was able to complement the BE mutation in the
phosphorylation stimulation assay and that the cloned gene does indeed code for a protein with branching enzyme activity.
Oligonucleotides
The following synthetic oligonucleotides (Seq ID No.s 1-11 respectively) were used:
RoR,dT. 7 AAGGATCCGTCGACATCGATAATACGACTCACTATAGGGA(T) 17
Ro AAGGATCCGTCGACATC
R, GACATCGATAATACGAC
POTSBE24 CATCCAACCACCATCTCGCA
POTSBE25 TTGAGAGAAGATACCTAAGT
POTSBE28 ATGTTCAGTCCATCTAAAGT
POTSBE29 AGAACAACAATTCCTAGCTC
PBER 1 GGGGCCTTGAACTCAGCAAT
PBERT CGTCCCAGCATTCGACATAA
PBE 2B CTTGGATCCTTGAACTCAGCAATTTG
PBE 2X TAACTCGAGCAACGCGATCACAAGTTCGT
Example 2
Production of Transgenic Plants
Construction of plant transformation vectors with antisense starch branching enzyme genes
A 1200 bp Sac I - Xho I fragment, encoding approximately the -COOH half of the potato class A SBE (isolated from the rescued λZap clone 3.2.1), was cloned into the Sac I - Sal I sites of the plant transformation vector pSJ29 to create plasmid pSJ64, which is illustrated schematically in Figure 11. In the figure, the black line represents the DNA sequence. The broken line represents the bacterial plasmid backbone (containing the origin of replication and bacterial selection marker), which is not shown in full. The filled triangles on the line denote the T-DNA borders (RB = right border, LB = left border). Relevant restriction sites are shown above the black line, with the approximate distances (in kilobases) between the sites (marked by an asterisk) given by the numerals below die
line. The thinnest arrows indicate polyadenylation signals (pAnos = nopaline synthase, pAg7 = Agrobacterium gene 7), the arrows intermediate in thickness denote protein coding regions (SBE II = potato class A SBE. HYG = hygromycin resistance gene) and the thickest arrows represent promoter regions (P-2x35 = double CaMV 35S promoter, Pnos = nopaline synthase promoter). Thus pSJ64 contained d e class A SBE gene fragment in an antisense orientation between the 2X 35S CaMV promoter and the nopaline synthase polyadenylation signal.
For information, pSJ29 is a derivative of the binary vector pGPTV-HYG (Becker et al., 1992 Plant Molecular Biology 20, 1195-1197) modified as follows: an approximately 750 bp (Sac I, T4 DNA polymerase blunted - Sal I) fragment of pJIT60 (Guerineau et al., 1992 Plant Mol. Biol. 18, 815-818) containing the duplicated cauliflower mosaic virus (CaMV) 35S promoter (Cabb-JI strain, equivalent to nucleotides 7040 to 7376 duplicated upstream of 7040 to 7433, Frank et al, 1980 Cell 21, 285-294) was cloned into the Hind III (Klenow polymerase repaired) - Sal I sites of pGPTV-HYG to create pSJ29.
Plant transformation
Transformation was conducted on two types of potato plant explants; either wild type untransformed minitubers (in order to give single transformants containing me class A antisense construct alone) or minitubers from three tissue culture lines (which gave rise to plants #12, #15, #17 and #18 indicated in Table 1) which had already been successfully transformed with the class B (SBE I) antisense construct containing the tandem 35S promoter (so as to obtain double transformant plants, containing antisense sequences for both the class A and class B enzymes).
Details of the method of Agrobacterium transformation, and of the growth of transformed plants, are described in International Patent Application No. WO 95/26407, ejXcept that the medium used contained 3 % sucrose (not 1 %) until the final transfer and that the initial incubation with Agrobacterium (strain 3850) was performed in darkness. Transformants containing the class A antisense sequence were selected by growth in medium containing 15mg/L hygromycin (the class A antisense construct comprising the HYG gene, i.e. hygromycin phosphotransferase).
Transformation was confirmed in all cases by production of a DNA fragment from d e antisense gene after PCR in the presence of appropriate primers and a crude extract of genomic DNA from each regenerated shoot.
Characterisation of starch from potato plants
Starch was extracted from plants as follows: potato tubers were homogenised in water for 2 minutes in a Waring blender operating at high speed. The homogenate was washed and filtered (initially through 2mm, then through 1mm filters) using about 4 litres of water per lOOgms of tubers (6 extractions). Washed starch granules were finally extracted with acetone and air dried.
Starch extracted from singly transformed potato plants (class A/SBE II antisense, or class B/SBE I antisense), or from double transformants (class A/SBE II and class B/SBE I antisense), or from untransformed control plants, was partially characterised. The results are shown in Table 1. The table shows the amount of SBE activity (units/gram tissue) in tubers from each transformed plant. The endod erm peak temperature (°C) of starch extracted from several plants was determined by DSC, and die onset temperature (°C) of pasting was determined by reference to a viscoamylograph ("RVA"), as described in WO 95/26407. The viscoamylograph profile was as follows: step 1 - 50°C for 2 minutes; step 2 - increase in temperamre from 50°C to 95°C at a rate of 1.5°C per minute; step 3 - holding at 95°C for 15 minutes; step 4 - cooling from 95°C to 50°C at a rate of 1.5°C per minute; and finally, step 5 - holding at 50°C for 15 minutes. Table 1 shows the peak, pasting and set-back viscosities in stirring number units (SNUs), which is a measure of the amount of torque required to stir the suspensions. Peak viscosity may be defined for present purposes as the maximun viscosity attained during the heating phase (step 2) or the holding phase (step 3) of the viscoamylograph. Pasting viscosity may be defined as the viscosity attained by the starch suspensions at the end of the holding phase (step 3) of the viscoamylograph. Set-back viscosity may be defined as the viscosity of the starch suspension at the end of step 5 of the viscoamylograph.
A determination of apparent amylose content (% w/w) was also performed, using the iodometric assav method of Morrison & Laignelet (1983 J. Cereal Sci. 1, 9-20). The
results (percentage apparent amylose) are shown in Table 1. The untransformed and transformed control plants gave rise to starches having apparent amylose contents in die range 29(+/-3)%.
Generally similar values for amylose content were obtained for starch extracted from most of die singly transformed plants containing the class A (SBE II) antisense sequence. However, some plants (#152, 249) gave rise to starch having an apparent amylose content of 37-38%, notably higher than the control value. Starch extracted from these plants had markedly elevated pasting onset temperatures, and starch from plant 152 also exhibited an elevated endodierm peak temperature (starch from plant 249 was not tested by DSC).
Table 1
RVA profile S0-C (2 min).50-95-C (1 5*C mkι), β*S*C (15 min).95 S0*C (1 5*C mln), 50*C (IS min)
Pasting viscosity (47 mm) at end of 50*C Pmln). 50-95*C (1 5*C/mln). 95"C (IS min)
Set back viscosity (82 in) at end of profile
SBE Starch Branching Enzyme
SNU Instrument "Stirring Number Units" (arbitrary units) nd not determined
Table 1
RVA profile 50 * C (2 min). 50-05 * 0 (1.5 * C min). 05*0 (15 min). 95-50 * 0 (1.5°C/mιn). 50 * 0 (15 min
Pasting viscosity (47 min) at end of 50 * C (2min). 50-05*C (1.5 * C/min). 05 * 0 (15 min)
Set-back viscosity (92 min) at end of profile
SBE Starch Branching Enzyme
SNU Instrument "Stirring Number Units" (arbitrary units) nd not determined
30
It should be noted that, even if other single transformants were not to provide starch with an altered amylose/amylopectin ratio, the starch from such plants might still have different properties relative to starch from conventional plants (e.g. different average molecular weight or different amylopectin branching patterns), which might be useful.
Double transformant plants, containing antisense sequences for both the class A and class B enzymes, had greatly reduced SBE activity (units/gm) compared to untransformed plants or single anti-sense class A transformants, (as shown in Table 1). Moreover, certain of the double transformant plants contained starch having very significantly altered properties. For example, starch extracted from plants #201, 202, 208, 208a, 236 and 236a had drastically altered amylose/amylopectin ratios, to the extent that amylose was the main constituent of starch from these plants. The pasting onset temperatures of starch from these plants were also the most greatly increased (by about 25-30°C). Starch from plants such as #150, 161, 212, 220 and 230a represented a range of intermediates, in that such starch displayed a more modest rise in both amylose content and pasting onset temperature. The results would tend to suggest that there is generally a correlation between % amylose content and pasting onset temperature, which is in agreement with the known behaviour of starches from other sources, notably maize.
The marked increase in amylose content obtained by inhibition of class A SBE alone, compared to inhibition of class B SBE alone (see PCT/GB95/00634) might suggest that it would be advantageous to transform plants first with a construct to suppress class A SBE expression (probably, in practice, an antisense construct), select those plants giving rise to starch with the most altered properties, and then to re-transform with a construct to suppress class B SBE expression (again, in practice, probably an antisense construct), so as to maximise the degree of starch modification.
In addition to pasting onset temperatures, other features of the viscoamylograph profile e.g. for starches from plants #149, 150, 152. 161, 201, 236 and 236a showed significant differences to starches from control plants, as illustrated in Figure 13. Referring to Figure 13, a number of viscoamylograph traces are shown. The legend is as follows: shaded box - normal potato starch control (29.8% amylose content): shaded circle - starch from plant
31
149 (35.6% amylose); shaded triangle, pointing upwards - plant 152 (37.5%); shaded triangle, pointing downwards - plant 161 (40.9%); shaded diamond - plant 150 (53.1 %); unshaded box - plant 236a (56.7%); unshaded circle - plant 236 (60.4%); unshaded triangle, pointing upwards - plant 201 (66.4%); unshaded triangle, pointing downwards - Hylon V starch, from maize (44.9 % amylose). The thin line denotes the heating profile.
With increasing amylose content, peak viscosities during processing to 95°C decrease, and the drop in viscosity from the peak until the end of the holding period at 95°C also generally decreases (indeed, for some of the starch samples there is an increase in viscosity during this period). Both of these results are indicative of reduced granule fragmentation, and hence increased granule stability during pasting. This property has not previously been available in potato starch without extensive prior chemical or physical modification. For applications where a maximal viscosity after processing to 95 °C is desirable (i.e. corresponding to the viscosity after 47 minutes in the viscoamylograph test), starch from plant #152 would be selected as starches with both lower (Controls, #149) and higher (#161, #150) amylose contents have lower viscosities following this gelatinisation and pasting regime (Figure 13 and Table 1). It is believed that the viscosity at this stage is determined by a combination of the extent of granule swelling and the resistance of swollen granules to mechanical fragmentation. For any desired viscosity behaviour, one skilled in the art would select a potato starch from a range containing different amylose contents produced according to the invention by performing suitable standard viscosity tests.
Upon cooling pastes from 95 °C to 50 °C, potato starches from most plants transformed in accordance with the invention showed an increase in viscoamylograph viscosity as expected for partial reassociation of amylose. Starches from plants #149, 152 and 161 all show viscosities at 50 °C significantly in excess of those for starches from control plants (Figure 13 and Table 1). This contrasts with the effect of elevated amylose contents in starches from maize plants (Figure 2) which show very low viscosities throughout the viscoamylograph test. Of particular note is the fact that, for similar amylose contents, starch from potato plant 150 (53% amylose) shows markedly increased viscosity compared with Hylon 5 starch (44.9% amylose) as illustrated in Figure 13. This demonstrates that
32 useful properties which require elevated (35 % or greater) amylose levels can be obtained by processing starches from potato plants below 100°C, whereas more energy-intensive processing is required in order to generate similarly useful properties from high amylose starches derived from maize plants.
Final viscosity in the viscoamylograph test (set-back viscosity after 92 minutes) is greatest for starch from plant #161 (40.9% amylose) amongst those tested (Figure 13 and Table 1). Decreasing final viscosities are obtained for starches from plant #152 (37.5% amylose), #149 (35.6% amylose) and #150 (53.1 % amylose). Set-back viscosity occurs where amylose molecules, exuded from the starch granule during pasting, start to re¬ associate outside the granule and form a viscous gel-like substance. It is believed that the set-back viscosity values of starches from transgenic potato plants represent a balance between the inherent amylose content of the starches and the ability of the amylose fraction to be exuded from the granule during pasting and therefore be available for the reassociation process which results in viscosity increase. For starches with low amylose content, increasing the amylose content tends to make more amylose available for re¬ association, thus increasing the set-back viscosity. However, above a threshold value, increased amylose content is thought to inhibit granule swelling, thus preventing exudation of amylose from the starch granule and reducing the amount of amylose available for re¬ association. This is supported by the RVA results obtained for the very high amylose content potato starches seen in the viscoamylograph profiles in Figure 13. For any desired viscosity behaviour following set-back or retrogradation to any desired temperature over any desired timescale, one skilled in the art would select a potato starch from a range containing different amylose contents produced according to the invention by performing standard viscosity tests.
Further experiments with starch from plants #201 and 208 showed that this had an apparent amylose content of over 62% (see Table 1). Viscoamylograph studies showed that starch from these plants had radically altered properties and behaved in a manner similar to hylon 5 starch from maize plants (Figure 13). Under the conditions employed in the viscoamylograph, this starch exhibited ejXtremely limited (nearly undetectable) granule swelling. Thus, for example, unlike starch from control plants, starch from plants
33
201, 208 and 208a did not display a clearly defined pasting viscosity peak during the heating phase. Microscopic analysis confirmed that the starch granule structure underwent only minor swelling during the experimental heating process. This property may well be particularly useful in certain applications, as will be apparent to those skilled in the art.
Some re-grown plants have so far been found to increase still fuπher the apparent amylose content of starch extracted therefrom. Such increases may be due to:- i) Growth and development of the first generation transformed plants may have been affected to some degree by the exogenous growth hormones present in the tissue culture system, which exogenoous hormones were not present during growth of the second generation plants; and ii) Subsequent generations were grown under field conditions, which may allow for attainment of greater maturity than growth under laboratory conditions, it being generally held that amylose content of potato starch increases with maturity of the potato tuber. Accordingly, it should be possible to obtain potato plants giving rise to tubers with starch having an amylose content in excess of the 66% level so far attained, simply by analysing a greater number of transformed plants and/or by re-growing transgenic plants through one or more generations under field conditions.
Table 1 shows that another characteristic of starch which is affected by the presence of anti-sense sequences to SBE is the phosphorus content. Starch from untransformed control plants had a phosphorus content of about 60-70mg/100gram dry weight (as determined according to the AOAC Official Methods of Analysis, 15th Edition, Method 948.09 "Phosphorus in Flour"). Introduction into the plant of an anti-sense SBE B sequence was found to cause a modest increase (about two-fold) in phosphorus content, which is in agreement with the previous findings reported at scientific meetings. Similarly, anti-sense to SBE A alone causes only a small rise in phosphorus content relative to untransformed controls. However, use of anti-sense to both SBE A and B in combination results in up to a four-fold increase in phosphorus content, which is far greater than any in planta phosphorus content previously demonstrated for potato starch.
This is useful in that, for certain applications, starch must be phosphorylated in vitro by
34 chemical modification. The ability to obtain potato starch which, as extracted from the plant, already has a high phosphorus content will reduce the amount of in vitro phosphorylation required suitably to modify the starch. Thus, in another aspect the invention provides potato starch which, as extracted from the plant, has a phosphorus content in excess of 200mg/100gram dry weight starch. Typically the starch will have a phosphorus content in the range 200 - 240mg/100gram dry weight starch.
35
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: National Starch and Chemical Investment
Holding Corporation
(B) STREET: 501 Silverside Road. Suite 27
(C) CITY: Wilmington
(D) STATE: Delaware
(E) COUNTRY: United States of America
(F) POSTAL CODE (ZIP): 19809
(11) TITLE OF INVENTION: Improvements In or Relating to Plant Starch Composition
(111) NUMBER OF SEQUENCES: 20
(iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0. Version #1.30 (EPO)
(2) INFORMATION FOR SEQ ID NO: 1:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 57 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: AAGGATCCGT CGACATCGAT AATACGACTC ACTATAGGGA TTTTTTTTTT IIIIIM 57
(2) INFORMATION FOR SEQ ID NO: 2:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: AAGGATCCGT CGACATC 17
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs
36
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: GACATCGATA ATACGAC 17
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: CATCCAACCA CCATCTCGCA 20
(2) INFORMATION FOR SEQ ID NO: 5:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: TTGAGAGAAG ATACCTAAGT 20
(2) INFORMATION FOR SEQ ID NO: 6:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: ATGTTCAGTC CATCTAAAGT 20
(2) INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
37 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: AGAACAACAA TTCCTAGCTC 20
(2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: GGGGCCTTGA ACTCAGCAAT 20
(2) INFORMATION FOR SEQ ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: CGTCCCAGCA TTCGACATAA 20
(2) INFORMATION FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: CTTGGATCCT TGAACTCAGC AATTTG 26
(2) INFORMATION FOR SEQ ID NO: 11:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 11 : TAACTCGAGC AACGCGATCA CAAGTTCGT 29
3 8 (2) INFORMATION FOR SEQ ID NO : 12 :
( 1 ) SEQUENCE CHARACTERISTICS :
(A) LENGTH : 3003 base pai rs
(B) TYPE : nucl ei c aci d
(C) STRANDEDNESS : si ngl e
(D) TOPOLOGY : l i near
(xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 12 :
GATGGGGCCT TGAACTCAGC AATTTGACAC TCAGTTAGTT ACACTGCCAT CACTTATCAG 60
ATCTCTATTT TTTCTCTTAA TTCCAACCAA GGAATGAATA AAAAGATAGA TTTGTAAAAA 120
CCCTAAGGAG AGAAGAAGAA AGATGGTGTA TACACTCTCT GGAGTTCGTT TTCCTACTGT 180
TCCATCAGTG TACAAATCTA ATGGATTCAG CAGTAATGGT GATCGGAGGA ATGCTAATAT 240
TTCTGTATTC TTGAAAAAAC ACTCTCTTTC ACGGAAGATC TTGGCTGAAA AGTCTTCTTA 300
CAAπCCGAA TCCCGACCπ CTACAAπGC AGCATCGGGG AAAGTCCTTG TGCCTGGAAT 360
CCAGAGTGAT AGCTCCTCAT CCTCAACAGA TCAATTTGAG πCGCTGAGA CATCTCCAGA 420
AAATTCCCCA GCATCAACTG ATGTAGATAG πCAACAATG GAACACGCTA GCCAGATTAA 480
AACTGAGAAC GATGACGπG AGCCGTCAAG TGATCTTACA GGAAGTGHG AAGAGCTGGA 540
TTTTGCTTCA TCACTACAAC TACAAGAAGG TGGTAAACTG GAGGAGTCTA AAACATTAAA 600
TACπCTGAA GAGACAATTA πGATGAATC TGATAGGATC AGAGAGAGGG GCATCCCTCC 660
ACCTGGACπ GGTCAGAAGA TTTATGAAAT AGACCCCCTT πGACAAACT ATCGTCAACA 720
CCTTGATTAC AGGTAπCAC AGTACAAGAA ACTGAGGGAG GCAATTGACA AGTATGAGGG 780
TGGπTGGAA GCTTTπCTC GTGGTTATGA AAGAATGGGT πCACTCGTA GTGCTACAGG 840
TATCACTTAC CGTGAGTGGG CTCCTGGTGC CCAGTCAGCT GCCCTCAπG GGGATTTCAA 900
CAAπGGGAC GCAAATGCTG ACITTATGAC TCGGAATGAA πTGGTGTCT GAGAGATTπ 960
TCTGCCAAAT AATGTGGATG GπCTCCTGC AAπCCTCAT GGGTCCAGAG TGAAGATACG 1020
TATGGACACT CCATCAGGTG πAAGGAπC CAπCCTGCT TGGATCAACT ACTCTTTACA 1080
GCπCCTGAT GAAAπCCAT ATAATGGAAT ATAπATGAT CCACCCGAAG AGGAGAGGTA 1140
TATCπCCAA CACCCACGGC CAAAGAAACC AAAGTCGGTG AGAATATATG AATCTCATAT 1200
TGGAATGAGT AGTCCGGAGC CTAAAAπAA CTCATACGTG AATπTAGAG ATGAAGπCT 1260
TCCTCGCATA AAAAAAGCπ GGGTACAATG CGGTGCAAAT TATGGCTAπ CAAGAGCAπ 1320
CπAπATGC TAGTTTTGGT TATCATGTCA CAAA M I I M TGCACCAAGC AGCCGTπTG 1380
εooε 339
OOOC V3913311W 931V93V999 1331W3319 1V111W91V 931WW191 V1V3WWY3
01762 W913919W 91V9V9V333 V1V1V93W3 319V19V11V 13V3311131 1W39U-199
0882 V3W3V9191 V3111W993 9911319V.Li V3311V1W3 99131V133V 9113J-139V9
0282 V1V3V3393V V9111V9WV 9.-193931V3 19113W93V V91W9W9V V9V19V19V1
09Z2 9W9W9V19 V19V39V19V V9W3W9W 9W9W9W9 VW3V9V19V 13V391V131
00Z2 9919V39V3V V9V19V133V 391V131991 V11W3JJ-93 1331931V31 V91V1991V9
Ot92 9W911133V 3111V1W93 331W1V31V 9.UW9V999 3113991991 1LLL3V331V
0892 91V9V313V9 9113391199 W3V1WW9 91339W913 391399V1V3 931V13V9V3
02S2 11V1399WV V3V9913V31 1HW1LL31 9U-1119V13 3VW99WW V9111V1911
09172 V91V99V1V9 V99W91V99 VW93V31V1 V3119V33V3 W9V3113V9 1V1119V91V
00τ2 1VW1V9W9 1131V19V39 1V1399933V 9111W9W3 9119991933 V1V9W111V
0t7G2 1W9V391V9 V999133V91 11V9V993V9 V391VW1V9 1V119V311V V33VW9V33
0822 311W19V31 3991V91313 133V3W3W 913999V133 3111V911V9 919V91333V
0222 33993-LLW9 1VW9991V3 111WV133V 1999W9V99 V99V11V999 1V13W1911
0912 399V11V91V 9W3V3V11V 39V1V99919 31V9V1W11 V31V3W319 33V9V1V991
0012 313991V111 1V91V191V1 V99W3V991 V9139913J.1 V39V1V13W W1V919931
0i702 9V13139W3 1V91V319W V91393V1V3 11191919W W9931991V 9W9V1VW3
0861 V913V3V1V3 11911V1V91 99919V9V99 11V99V91V9 993WV9W3 139119V911
026T V991VW1V9 13911W399 1V1V391399 31V13V9111 399-U-91999 991V9W311
0981 9333119191 111V3V9339 1W9939V11 31V9W9199 11V33V11W 391V9V3331
0081 11139991V3 11V1131V93 W31991391 V9131V1919 1191391V99 191V913W3
Ot I 3313V99111 3V1W99V93 V13W99913 V311V99919 931V11V993 V33V313V19
0891 191V91 31 V3V9191991 V9111V9V11 1V991V9J_11 VW3119V91 V991199199
029T 1V9V9391W V313131131 V199V113V1 99V99913W V991V13W1 1131339331
0991 11V999191V 9911V31V11 39193133V9 911LDV1LLL 3V119119V1 V9V3V3993V
OOSI 911191V3W 913V991V9V 1113V1W1V W31V391V3 39V3V31131 1V3V331V31 mi 311911911V V99V139V91 V3139WV1V 911V911131 9W1133V33 V933393W9
6 ε
SZ.0I0/96aO/X3J 896fr£/96 0ΛV
0881 911119339V 39W33V331 111111VW3 V3191V31V1 19911119V1 391V11V113
02CT 11V39V9W3 .-1V10991V1 1VV9391393 91W3V1999 1139VVWW 1V39313311
0921 3119W91V9 V9V1111W9 193V1V313V VHWW133 9V993319V1 9V91W99J-1
0021 V1V3131W3 1V1V1W9V9 139319VW3 3VW9VW33 993V333V3V V331131V1V
Ot/TT 199V9V99V9 W9333V331 V91V11V1V1 W991W1V1 V3311WV91 V9133.L139V
0801 3VU-1313V1 3W31V9911 3913311V33 11V99W119 199V31V331 3V3V991V19
020 T 3V1V9W919 V9V3319991 V313311W3 9133131199 1V99191W1 VW3391311 096 1JJLV9V9991 319199111V V91W99313 V91V11V3V9 1391WV333 V999J-1W3V 006 V31J-1V9V99 1LV3133391 39V319V333 9199133139 9919V91933 V113V31V19 0178 9V3V13919V 19313V3111 9991WWW 91VJ-199193 13111139W 9911199199 08Z 9V91V19W3 V911W39 . 9V 999V913WV 9W3V19V3V 311V199V3V 11V91133V3 02Z W31931V13 VW3V911J_L 33333V9V1V W91V111V9 W9V31991L 3V99133V33 099 13331V3999 9V9V9V9V31 V99V1V9131 W91V911V1 1W3V9V9W 913-LL3V1W 009 V11V3WW1 319V99V991 3VW199199 W9W3V13V V3V13V31V3 1139U11V9 Ot 9 9139V9W91 1919W99V3 V1131V919V V319339V91 193V91V93V V9V913WW 08fr 11V9V339V1 393V3W991 W3W3119V 1V9V191V91 3W31V39V3 33311WW9 0217 V33131V3V9 V913V3119V 9111W33V9 V3W31331V 3133139V1V 919V9V333V 098 V991339191 13319VW99 9931V39V39 119V3V1311 33V93311W 93311W3V1
008 1311319VW V913991131 V9W993V31 1131313V39 VWW91131 1V19131119 0172 1W1391W9 9V9931V919 91W19V39V 311V991W1 31VW3V191 9V31V33119 08T 13V1331111 93119V9913 1313V1V1V1 91991V9VW 9W9W9V9V 99W1333W
021 VW19U-1V9 V1V99WW1 W91W9999 V33W3311V V113131ULL 11V13131V9
09 V31V113V31 V13313V3V1 19V119V313 V3V9111W3 9V313W911 339991V911
• 81 ON 01 03S * N0Ildia3S-.α 33N3n03S ( PO ueθU L L : λ9010d01 (0)
Θ L6U LS : SS N03αNVyi (3) p pe o .Lθ nu : 3 λl (8) L9d aseq g/62 : H19N31 (V)
: S3IlSI -1313VyVH3 33N3H03S A )
■ £l : 0N 01 Q3S a03 NOIIVW-JOJNI ( 2)
O v
SZ,OIO/96a9/X3d 896W960ΛV
5Z62 339V3 913311W93 1V93V99913 91W93191V
01762 H1W91V93 1WW191V1 V3VW3W31 3919W91V9 V9V393V1V1 V933V3319V
0882 19V11V13V3 31113119V3 911199W3V V3V9191V39 11W993991 1319V31V3V
0282 91131139V9 V1V3V331V3 199H3VH3 3W9111V9V W91193931 V919113W9
09Z2 3W91W9W 9.-1V333W9 W9V19V19V 39V19W9V1 3VW3V9V19 V13V391V13
00Z2 19919V39V3 W9V19V133 V391V19199 1VJJ.W3119 11331931V9 1V91V1931V
01792 99W913133 V3111V1W9 3391W1V31 V311W9V99 9311399199 I M M 3V331
08S2 V91V9V313V 9911319119 9W3V1WW 991339W91 3391399V1V 3931V13V9V
02S2 31LV139V1V W3V9913V3 1111W1113 193HJ.19V1 33VW99V9V W9JJ.1V191
09172 1V91V99V1V 9V99W91V9 9VW93V31V 1V3119V33V 3W9V3113V 91V1119V91
00172 V1WV1V9W 91131V19V3 91V1399913 V9111W9W 3V119991V3 3V1V9W1LL
01782 V1W9V391V 9V999133V9 JJLLV9V993V 9V391VW1V 91V119V3JLL W33VW993
0822 3311W19V3 13991V9131 1133V3V339 V913999V13 33111V911V 9919V91333
0222 V0399311W 91VW9991V 3111VW133 V1999W9V9 9V99V11V99 91V13W191
09T2 1399V11V91 V9W3V3911 V39V1V9991 931V9V1W1 1V31V3W33 933V9V1V99
0012 1313991V11 11V91V191V 1V99W3V99 1V91399131 1V39V1V13V WV1V91993
01702 19V13139W 31V91V319V W91393V1V 311191919V VW9931991 V9W9V1WV
0861 3V913V3V1V 311911V1V9 199919V9V9 9.L1V99V91V 9993VW9W 3139119V91
0261 1V991VW1V 913911W39 91V1V39139 931V13V3U 1399119199 9991V9W31
0981 1933311V19 1111V3V933 91W9939V1 191V9W919 911V33V11V V391V9V333
0081 1111399V1V 311V1131V9 3W3199139 1V9131V131 91191391V9 9191V913W
OUl 39313V9911 13V1W99V9 3V13W9991 3V311V9991 9931V11V99 3V33V313V1
0891 V191V91VV3 1V3V919199 1V9311V9V1 11V991V911 1VW3119V9 1V99119919
0291 91V9V9331V W31313113 1V199V113V 199V99913V W991V13W 1113133933
0991 11V999191V 9911V31V11 99193139V9 31313V3111 3V119119V1 V933V3993V
0091 911191V3W 913V991V9V 1LL3V1W1V W31V391V3 39V3V31193 1V3V991V31
O i 311911911V V99V139V91 V3139VW1V 911V931131 9W1133V93 V933393W9 τf
SLOlθmϋ.D/JDd 896f£/96 OΛV
42 (2) INFORMATION FOR SEQ ID NO: 14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3033 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION:145..2790
(xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 14 : πGATGGGGC CπGAACTCA GCAATπGAC ACTCAGπAG πACACTCCT ATCACπATC 60
AGATCTCTAT ππTCTCπ AAπCCAACC AAGGAATGAA TAAAAGGATA GATπGTAAA 120
AACCCTAAGG AGAGAAGAAG AAAG ATG GTG TAT ACA CTC TCT GGA Gπ CGT 171
Met Val Tyr Thr Leu Ser Gly Val Arg 1 5 πr ccT ACT Gπ CCA TCA GTG TAC AM TCT AAT GGA πc AGC AGT AAT 219
Phe Pro Thr Val Pro Ser Val Tyr Lys Ser Asn Gly Phe Ser Ser Asn 10 15 20 25
GGT GAT CGG AGG AAT GCT AAT Gπ TCT GTA πC πG AM MG CAC TCT 267 Gly Asp Arg Arg Asn Ala Asn Val Ser Val Phe Leu Lys Lys His Ser 30 35 40
Cπ TCA CGG MG ATC πG GCT GM MG TCT TCT TAC MT TCC GM πC 315 Leu Ser Arg Lys He Leu Ala ' Glu Lys Ser Ser Tyr Asn Ser Glu Phe 45 50 55
CGA CCT TCT ACA Gπ GC.A GCA TCG GGG AM GTC Cπ GTG CCT GGA ACC 363 Arg Pro Ser Thr Val Ala Ala Ser Gly Lys Val Leu Val Pro Gly Thr 60 65 70
CAG AGT GAT AGC TCC TCA TCC TCA ACA GAC CM Tπ GAG πc ACT GAG 411 Gin Ser Asp Ser Ser Ser Ser Ser Thr Asp Gin Phe Glu Phe Thr Glu 75 80 85
ACA TCT CCA GM MT TCC CCA GCA TCA ACT GAT GTA GAT AGT TCA ACA 459 Thr Ser Pro Glu Asn Ser Pro Ala Ser Thr Asp Val Asp Ser Ser Thr 90 95 100 105
ATG GM CAC GCT AGC CAG Aπ AM ACT GAG AAC GAT GAC Gπ GAG CCG 507 Met Glu His Ala Ser Gin He Lys Thr Glu Asn Asp Asp Val Glu Pro 110 115 120
TCA AGT GAT Cπ ACA GGA AGT Gπ GM GAG CTG GAT Tπ GCT TCA TCA 555 Ser Ser Asp Leu Thr Gly Ser Val Glu Glu Leu Asp Phe Ala Ser Ser 125 130 135
s η JΛI Θ I 5JV nθη Z22I VW IVl VIV V9V 913 srø O sεε oεε
JΘS s η OJd s/η s η OJd β JV OJd SLH UL9 L)d ΘLI J-Vi βj V ΠLO n[ 6ZII 9319W V33 VW 9W V33993 V330V3 W331131V IVl 99V 9V99V9
n[9 OJd OJ dsv nθη lεiT W9333 V331V9 113 oτε soε ooε
UL9 nθη JΘS Jλ USV ΘLI dJX BL 0J d 3 LI JΘS dsv s η L ^L9 J S 8801 9V3 Vll 1313V13W 31V 99113913311V 3311V99W 119199 V31
562 062 582
OJd Ji|i dsv I W JV LI sλη LBΛ JV JΘS X " L9 LH O d ΘLI BLV OJd SεOI V3313V 3V991V 193 VIV 9W 919 V9V 3319991V313311V V39133
082 SZ2 0Z2
JΘS L9 dsv LBΛ usv u v OJd nθη θu,d ΘLI n L9 d j . L Aχ9 θ d nL9 Z86 1311991V9919 IW IW V33913 ILL J-1V 9V9991319199111 W9
592 092 SS2 0S2 usv β J JILL 19W Θ LI dsv BLV USV LV d v Ji usv usv θi) dsv ^L9
686 IW 99313V 91V J1V 3V9139 IW V393V9991 IW 3W 3111V9 V99
Sfr2 0172 _, sε
ΘLI nθη BLV BLV JΘS UL9 BLV 9 nθη BLV dJi n[9 BJV JΛl Jt|χ ΘLI 168 J1V 313 . 339139 V319V33391991131399919V91933V113V 31V
082 522 022 9 JL|1 LV Jθs β V JLIl θMd ^L9 -19W s η nL9 J/Cχ CL9 β JV JΘS θL|d ε 8 199 V3V 13319V 19313V 31119991V VW W9 IVl 199193131111
512 012 502
BLV nL9 nθη Λ~L9 9 n L9 J^l s η dsv ΘLI BLV nL9 BJV θη s η Cη 56Z 339 W99111991999V9 IVl 9W 3V911V V399V999V 913 VW 9W
002 S6I 061
J/χ UL9 JΘS " χ BJV J-1 dsv nθη SLH UL9 β JV J^X sv M1 nθη nθη Z17Z 3V19V3 V31 IVl 99V 3V11V91133V3 W3193 IVl 3W V3V 911113
581 081 SZI 0ZI
OJd dsv ΘLI nL3 J χ ΘLI S/Cη UL9 A 9 neη /CL9 OJ O d O ΘLI A 9
669 3333V9 VIV W9 IVl 11V 9W 9V3199113 V99133 V3313331V 399
S9I 091 SSI fiJV ΠLS β JV ΘLI BJV dsv JΘS nL9 dsv ΘLI ΘLI J-ll L9 ΠLD JΘS Ji|χ IS9 99V 9V9 V9V 31V 99V 1V9131 W91V911V 11V V3V 9V9 W913113V
usv nθη JL)χ ULD nθη
809 XW VXX V3V VW 1319V99V9913 VW 199199 W9 W3 V13 W3 V13
SL010I96QO/L3d 896f €/96 OΛV
6681
S9S 095 555 θi|d JMX OJd Iθw ^L9 ΘS LBΛ s L9 ^L9 ΘLI J 1 ΘLI e LV sv OJd
IS8I XXX V3V 9333XV V9939V 1131V9 W9199 JLLV 33V XXV V391V9 V33
θMd nθη A ~ L9 LBΛ BLV ε08I 311113999 1X9 X39 sεs oεs S2S dsv L Λ dsv JL)X BLV nθη χ9 θμd Jλl n[9 nL9 J χ usv A9 JUX θi|d
SSZI XV99191V9 X3V V39313 V991113V1 W99V93V13W 99913V 311
025 SIS 015
A 9 LBΛ JΘS nθη /CL9 SLH SLH ΘLI -! 1ΘW 1ΘW JΘS JM1 L Λ L9 dsv
ZOZI V99919931 Vll V993V33V311V IVl 91V 91V V31 V3V 9191991V9
6S9I
JΘ nθη nθη j/χ A9 usv θij θη 6JV
IT9T V31313113 IVl V99 IVl 3W 111313393
ΘS dsv dX S
89SI 3311V9991 191
JΘS dsv nθ X " 9 dsv nθη usv usv JΘS SISI 19V 1V9 913 V991V9 Vll 13V IW IW V31
BLV nθη ΠL9 SLH
L9H V391V339V 3V311911V 3V991V 31311911911V V99 V139V91V3 s η nθη dsv dsv OJd Jill λ " L9 θi| BJV
61H 3W 1133V93V333393V V9911119339V
JΘS OJ BLV θLLd J**l IZεi 39V V33 V39111 IVl oδε
JθS SLH L3 nθη s η ε εi 1311V39V9 W311V 139 D V 11V W3913939 IW 3V1 XX39W szε ozε S9ε s η ΘLI BJV OJ nθη LBΛ rug dsv β JV θi|d usv LB - 1 JΘS usv ΘLI
SZ2I VW VIV 393133113119 W91V9 V9V ILL IW 9193V1 V313W 11V v
SΔOIO /96ffO/X3d 896N7960ΛV
508 008 S6Z nθη BLV L e Λ sλη JΛ ' X sλη ^L9 O d sλη nθη S/Q BLV ΘLI βj V J Λ" l dsv I S2 9XX 3391139W 3V1 VW V991339W 913331339 VIV 393 IVl 3V9
06Z S8Z ' 08Z
JΘS Jλx JΘS sλη JU dJX SLH ΘI^ USV θL|d L Λ θu,d L e Λ nθη usv A9 8252 V3X XVI 39V VW V3V 9913V3 ill IW 111319111119 V133W V99
SZZ OZZ S9Z s η ΠL) θd LB ΘLI 1 9 H JV dsv L9 n L9 dv sCη BJV Jθs ΘLI θu. 9L Z VW W9111 V19 J1V 91V 99V 1V9 V99 W91V99VV V93 V31 VIV 311
09Z SSZ OSZ
UL9 SLH L9 JΘS JUX }ΘW θi|d nL9 Jλx S/Cη dsv nL9 nθη j/Cχ UL3 q.θW Z2172 9V33V3 W9 V3113V 31V 1119V9 IVl VW 1V9 W9 X13 IVl 9V391V
6Z82
S2Z 02Z SIZ
Aχ9 nθη dsv θi| β JV JV JV sλQ sλη dsv JΛ " X JΘS θu,d UL9 USV 9 iεε2 V999X33V9111 V9V 993 V9V 391 VW 1V9 IVl 19V 311 W33W V99
OIZ SOZ 00Z
OJ ΘLI L p Λ JΘS *L9 dsv JΘS nθη SLH UL9 rU9 BLV β JV OJ θitø dsv 8822 33331V V19 V313991V91313133V3 W3 W913999V 1333111V9
S69 069 589
ΘLI dJX nL9 Od SLH ^L9 ΘMd nL9 usv L9 lew θM usv nθη j/Cχ /CL9 582 11V 991.9V91333V3399311 W9 IW V9991V 311 IW V133V1999
089 SZ9 0Z9 nL9 A3 ^L9 θη λL31B\ JU LBΛ nθη BJV ΘLI }ΘH s/η SLH nθη LV Z8I2 W9 V99 V99 Vll V9991V 13V V1911399V 11V 91V 9W 3V3911 V39
599 - 099 SS9 059
ΘLI ^L9 δJV dsv ΘLI nθη JΘS J 1 JΘS °Jd β JV dsv naη LV }ΘW θi|d
6812 VIV 9991931V9 VIV Vll V31 V3V V31933 V3V 1V391313991V XXX
dsv - 1 αθW dsv *L9 1602 1V9 IVl 91V 1V9 199
0ε9 S29 029
L nθη BLV UL9 dsv SLH Jes nL9 LV ^i JΘS L Λ sλo sλη nL3 JΘS 8170 319 V13133 W31V31V319V W91393V1 V311131919W W9931
SI9 019 S09 jx BJV BJV usv JL|χ nθη JLJX SLH L Λ ΘLI dsv 3 LB β JV dJX dsv 5661 991 V9V V9V IW V3V 313 V3V 1V3119 H 1V9 X99919 V9V 9911V9
009 S6S 06S nL9 dsv βV sλη sλη nθη nθη ΠLD ΘLI β JV sλη dsv BLV ΘLI BLV IΘW L 61 9V91V9993 VW 9W 3133119V9 J1V 993 VW 1V9133 JLLV V3391V
SM0/961LDIJDd 896t /960Λ\
56 06 58
OJd JΘS usv L9 OJd JΘS J-U n L3 J-U 9 Md n L9 θu,d U L9 Q SV J u;χ JΘS
08 SZ 0Z S9
JΘS JΘS JΘS JΘS dsv JΘS UL9 JM1 A9 OJd L nθη LBΛ sλη Λ ' L3 JΘS
09 SS OS
BLV BLV LBΛ J 1 JΘS OJd β V Θ n L9 JΘS usv - 1 JΘS JΘS sλη ΠL3
BLV nθη ΘLI Λ JΘS L Λ
usv BLV JΘS sλη j λx
SI 01 S I
L Λ JΘS OJ LBΛ J l OJd θi| β V LBΛ L9 JΘS nθη Ji|χ j λx LBΛ Iθμ
• SI -ON 01 Q3S *NOUdiyθS..α 33N3H03S (!*x) ULθ 0Jd :3dλl 310.331014 (LL)
JBΘULL :λ9010d01 (0) ppB OULLUB :3 λl (8) sppB OULLUB 288 : H19N31 (V) : S3IlSiy313VdVH333N3HD3S (!■)
• 91 : ON QI D3S UOJ NOIlVWrOJNI (2)
εεoε 13119V113333V 999993399V 3913311W931V93V9991
0662 391W93191 V1XXW91V931WW191V 1V3VW3W913919W91V 9V9V393V1V
0862 1V93W3319 V19VJ1V13V 33111311W 3911199W3 V3V9191V3111W993991
0Z82 1319V31V3911V1W399131V193V91131139V9V1V 3V1393W31 J1V9VW911
088 SZ8 nL9 L9 nL9 LBΛ L Λ L nL9 n^ L BΛ 0182 93331V319113W93W91 W9 W9 W9 V19 V19 V19 W9 W9 V19
0Z8 598 098
BLV LV LBΛ nL9 nL3 nL9 Π 9 L9 nL9 ΠL9 ΠLS nL9 ΠL9 ΠL9 sλη dsv ε9Z2 V39 V33 V19 W9 W9 W9 W9 W9 W9 W9 W9 W9 W9 W9 WV 3V9
958 0S8 9-178
LBΛ nθη BLV J-Cχ L Λ LBΛ eLV JM1 sλη sλo OJ BLV JCχ L Λ 1ΘW ΘLI SIZ2 V19 V13 V33 IVl 319919 V39 V3V VW 131133 V39 IVl 91991V 11V
JΘS θi|d Jλx ΠL3 BLV Z992 V31 311 IVl W9333
528 028 SI8 018 usv SLH sv LI β JV ^L9 θi|d 9 ^L9 θij nθη OJd dsv sv J S dsv
6192 IW 1V31V3 XXV V3V 9993113391991X1113 V331V31V9 V313V3
S,OIO/96a9/X3J 896*ε/960ΛV
47
Ala Ser Thr Asp Val Asp Ser Ser Thr Met Glu His Ala Ser Gin He 100 105 110
Lys Thr Glu Asn Asp Asp Val Glu Pro Ser Ser Asp Leu Thr Gly Ser 115 120 125
Val Glu Glu Leu Asp Phe Ala Ser Ser Leu Gin Leu Gin Glu Gly Gly 130 135 140
Lys Leu Glu Glu Ser Lys Thr Leu Asn Thr Ser Glu Glu Thr He He 145 150 155 160
Asp Glu Ser Asp Arg He Arg Glu Arg Gly He Pro Pro Pro Gly Leu 165 170 175
Gly Gin Lys He Tyr Glu He Asp Pro Leu Leu Thr Asn Tyr Arg Gin 180 185 190
His Leu Asp Tyr Arg Tyr Ser Gin Tyr Lys Lys Leu Arg Glu Ala He 195 200 205
Asp Lys Tyr Glu Gly Gly Leu Glu Ala Phe Ser Arg Gly Tyr Glu Lys 210 215 220
Met Gly Phe Thr Arg Ser Ala Thr Gly He Thr Tyr Arg Glu Trp Ala 225 230 235 240
Leu Gly Ala Gin Ser Ala Ala Leu He Gly Asp Phe Asn Asn Trp Asp 245 250 255
Ala Asn Ala Asp He Met Thr Arg Asn Glu Phe Gly Val Trp Glu He 260 265 270
Phe Leu Pro Asn Asn Val Asp Gly Ser Pro Ala He Pro His Gly Ser 275 280 285
Arg Val Lys He Arg Met Asp Thr Pro Ser Gly Val Lys Asp Ser He 290 295 300
Pro Ala Trp He Asn Tyr Ser Leu Gin Leu Pro Asp Glu He Pro Tyr 305 310 315 320
Asn Gly He His Tyr Asp Pro Pro Glu Glu Glu Arg Tyr He Phe Gin 325 330 335
His Pro Arg Pro Lys Lys Pro Lys Ser Leu Arg He Tyr Glu Ser His 340 345 350
He Gly Met Ser Ser Pro Glu Pro Lys He Asn Ser Tyr Val Asn Phe 355 360 365
Arg Asp Glu Val Leu Pro Arg He Lys Lys Leu Gly Tyr Asn Ala Leu 370 375 380
Gin He Met Ala He Gin Glu His Ser Tyr Tyr Ala Ser Phe Gly Tyr 385 390 395 400
48
His Val Thr Asn Phe Phe Ala Pro Ser Ser Arg Phe Gly Thr Pro Asp 405 410 415
Asp Leu Lys Ser Leu He Asp Lys Ala His Glu Leu Gly He Val Val 420 425 430
Leu Met Asp He Val His Ser His Ala Ser Asn Asn Thr Leu Asp Gly 435 440 445
Leu Asn Met Phe Asp Cys Thr Asp Ser Cys Tyr Phe His Ser Gly Ala 450 455 460
Arg Gly Tyr His Trp Met Trp Asp Ser Arg Leu Phe Asn Tyr Gly Asn 465 470 475 480
Trp Glu Val Leu Arg Tyr Leu Leu Ser Asn Ala Arg Trp Trp Leu Asp 485 490 495
Ala Phe Lys Phe Asp Gly Phe Arg Phe Asp Gly Val Thr Ser Met Met 500 505 510
Tyr He His His Gly Leu Ser Val Gly Phe Thr Gly Asn Tyr Glu Glu 515 520 525
Tyr Phe Gly Leu Ala Thr Asp Val Asp Ala Val Val Tyr Leu ' Met Leu 530 535 540
Val Asn Asp Leu He His Gly Leu Phe Pro Asp Ala He Thr He Gly 545 550 555 560
Glu Asp Val Ser Gly Met Pro Thr Phe Cys He Pro Val Gin Glu Gly 565 570 575
Gly Val Gly Phe-Asp Tyr Arg Leu His Met Ala He Ala Asp Lys Arg 580 585 590
He Glu Leu Leu Lys Lys Arg Asp Glu Asp Trp Arg Val Gly Asp He 595 600 605
Val His Thr Leu Thr Asn Arg Arg Trp Ser Glu Lys Cys Val Ser Tyr 610 615 620
Ala Glu.Ser His Asp Gin Ala Leu Val Gly Asp Lys Thr He Ala Phe 625 630 635 640
Trp Leu Met Asp Lys Asp Met Tyr Asp Phe Met Ala Leu Asp Arg Pro 645 650 655
Ser Thr Ser Leu He Asp Arg Gly He Ala Leu His Lys Met He Arg 660 665 670
Leu Val Thr Met Gly Leu Gly Gly Glu Gly Tyr Leu Asn Phe Met Gly 675 680 685
Asn Glu Phe Gly His Pro Glu Trp He Asp Phe Pro Arg Ala Glu Gin 690 695 700
OOε 9V3V1131V919W319339 V91193V91V 33W9V913V WVXXV9V33 9V1333V3W
OPZ 931W3W3119V1V9V191 V913W31V33V333311W W9V33131V 3V9V913V31
081 19V9111W3 3WV3W313 31V3133139 V1V919V9V3 33W99133919113319W
021 V999931V39 V39119V3V131133V93311W93311W 3V11311319 WW913991
09 131V9991V3 3V31V33V31 V33V3131V33V9V91VI3V VXXVW9V99 V9VW11V31
• 91 : 0N 01 03S : N0UdId3S3α 33N3H03S (PO
JBΘULL :λ9010d01 (0) θLfiup :sS3N03QNVyiS (3)
PLOB DpL nu :3dλl (8)
SJLBd θSBq 9Z92 -H19N31 (V)
: S3USiy313VyVH333N3H03S (10
-91 : 0N QI 03S ^03 NOUV yOJNI (2)
nL9 nL9
088 SZ8 0Z8 598 L9 LBΛ L Λ L Λ nL9 nL9 L Λ BLV BLV LBΛ L9 ΠL3 ΠL9 ΠL9 ΠL9 ΠL9
098 9S8 058 L9 nL9 ΠL9 nL9 nL9 sλη dsv LB nθ BLV Jλx L Λ LBΛ LV JM1 sλη
sλo OJ BLV dJX λL3
088 528 028 nL3 θL|d JLIl θL|d JΛJ. nL9 BLV usv SLH dsv ΘLI β JV *L9 i|d *L9 ^L9
518 018 S08 θ| nθη OJ dsv dsv JΘS d v nθη BLV LBΛ sλη jλx sλη λL3 OJd sλη
008 S6Z 06Z S8Z nθη sλo LV ΘLI BJV Jλx dsv JΘS J/χ JΘS sλη ji|χ dJX SLH ΘMd usv
08Z SZZ 0ZZ
ΘMd LB Md L Λ nθη usv ^L9 sλη ΠL9 i|d LB ΘLI 1 Θ W β J dsv L9
S9Z 09Z SSZ nL9 dsv sλη βj v JΘS ΘLI ΘMd UL9 SLH L9 JΘS JMX }ΘW d n[9 Jλx
0SZ S17Z OVl sλη dsv nL9 nθη j λx UL3 W O d β JV dsv ΘMd nL9 UL3 nθη λL9 BJV sεz oεz S2Z j λx BJV nθη jλx ΠL3 BLV dsv A3 n3 3 dsv θi|d J V J V β V λ sλη
02Z SIZ OIZ SOZ dsv - 1 J9S θμd UL9 usv ^L9 OJd ΘLI L JΘS Λ " L9 dsv JΘS neη SLH βf
51010/9680/13-1 896W/960ΛV
0861 91V3J11VW 133V1399W 9V99V99VXX V9991V13W 1911399VJ1 V91V9W3V3
0261 9.L1V39V1V9 991931V9V1 W11V31V3V V33933V3V1 V391313991 VU11V91V1
0981 91V1V99W3 V391V91339 1311V39V1V 13WW1V91 99313V1313 3W31V91V3
0081 19VW91393 V1V3U1319 19WW9931 991V9W9V1 VW3V913V3 V1V311911V
Ot ZT 1V9199919V 9V3911V99V 91V9993WV 9W3139119 V9X1V991W V1V913311V
0891 V3991V1V39 X39931V13V 3111333119 1399991V9V V311333311 V191X11V3V
0291 93391W993 9VJ191V9W 919911V33V X1W391V9V 3331111339 91V3J1V113
0951 1V93W3199 1331V3131V 1919119139 1V99191V91 3W39313V9 9U13V1W9
OOSI 9V93V13W9 9913V311V3 3919931V11 V993V33V31 3V1V191V91 W31V3V919
0W7T 1991V9U1V 9VU1V991V 9111WV311 9V91V99119 91991V9V93 31VW31313
08εi 1131V199V1 13V133V999 13VW991V1 3WU11133 933311V999 191V99J1V3
0281 1VJ1991931 39V991313V 3U13V1191 19V1V933V3 993V31J131 V3W913V99
0921 1V9V1113V1 W1WV31V3 91V333V3V3 U911V3V99 1V313119J1 911W99V13
0021 9V91V3139V W1V9XXV91 J1319W113 3V93V93339 3W99XU19 339V39W33
Ofrϊϊ VD911LLLLL VW3V3191V 31V1199111 19V1391V11 VJ1311V33V 9W3J1V139
0801 91V11VW39 139391W3V 19991139W WW1V3931 33-U3J19W 91V9V9V111
0201 1W9193V1V 313W11WV V1339V3933 13V19V91W 9911V1V313 1W91V1V1V
096 V9V9139319 VW33WV3V W33393V33 3V3W33113 1V1V139V9V 99V9W9333
006 V331V91VJ1 V1V1W991V V1V1V3311V W91V91331 133V3V1313 V13W31V39
0178 113913311V 33JLLV99W1 19199V31V3 313V3V991V 193V1V3W3 19V9V33199
08Z 91V313311V V391331311 391V99191V V1VW33913 I 1 1 1 I V9V99 9131319911
02Z 1W91W993 13V91V11V3 V31391VW3 93V99911W 3W3J11V9V 9911V31333
099 3139V319V3 3391991331 399919V919 33V113V31V 199V3V1331 9V19313V31
009 119991WW W91V11991 3313111113 3W99XJ199 X999V91V19 W3V911W3
O ^ 99V999V913 WV9W3V19 V3V3XXV139 V3V11V9113 3V3W31331 V13VW3V91
0817 XXX33333V3 V1VW31V11 1V9W3V313 9H3V39133 V3313331V3 9999V9V9V9
0217 V31V99V1V9 131W31V91 1V11W3V9V 9W9X3113V 1WVJ1V3W W1319V99V
098 9913VW139 199W9W3V 13W3V13V3 1V31139111 1V99133V3V V311919W9
O S
S .0I0/96aθ/XD«I 896W796 0ΛV
08Z 9V3319991V 313311W33 1331311991 V99191W1V W33913ULL 11V9V99913
02Z 1 91 991 1 I W 91W99313V 91V11V3V91 331VW333V 99911W3W 3111V3V991
099 1V31333313 3V319V3333 1991331399 919V91933V 113V31V199 V3V13319V1
009 9313V3U13 391WWW9 1V11991931 31111133W 3311199199 9V91V19W3
0175 V3XXW399V 999V313VW 9W3VI3V3V 311V139V3V 11V31133V3 W31331V13
0817 VW3V9XJ1X 33333V9VXV W91V111V9 W9V313911 3V99X33V33 13331V3999
0217 9V9V9V9V31 V99V1V9131 W91V9XXVX XW3V9V9W 913113V1W V11V3WW1
09ε 319V99V991 3VW199199 W9W3V13V V3V13V31V3 J1331111V9 9139V9W91
00ε 1919W99V3 V1131V919V V319333V91 193V91V93V V9V913WW 11V9V339V1
0172 393V3W991 W3W3119V 1V9V191V91 3W31V39V3 333-LLWW9 V33131V3V9
081 V913V3119V 9ULLW33V9 V3W31331V 3133133V1V 919V9V33AV V991339191
021 13319WV99 9931V39V39 XX9V3V13J1 33V93331W 933J1W3V1 13J1319VW
09 V91399XX3X V9W993V31 J131313V33 VWW91131 1V1913JLL19 1W1391V99
■ -ON αi 03s -Noiidiπosaα 333HD3S (P
JBΘULL :λ3010d01 (Q)
ΘLBULS :sS3Nα30NVyiS (3) ppB opL^nu : 3 λl (8) s j LBd θSBq 5252 : H19N31 (V)
■ S0IlSIH31DVaVHD 33N3R03S ( )
: ZI : ON 01 Q3S d03 NOUVWaOJNI (2)
9ZS2 919113 W93W91W 9W9W9VX9 V19V19W9V V9V19V19V3 9V19W9W9
02S2 W9W9W9V V9W9W9W 9W9WV3V3 V13V13V331 V1319919V3 9V3W9V191
09172 133V391V19 1991V11W3 1193133133 1V91V91V19 91V99W911 133V3111V1
00172 W93391W1 V31V911W9 V999311333 133 I M I I 3V 331V91V9V3 13V9911339
01782 1199W3V1V VW391339V V913391399 V1V3331V13 V3V311V133 VWW3V991
0822 3V31-UL1W1 i n i l I I I 9V133VW99 VWW3111V 1311V91V99 V1V9V99W9
0222 1V99VW93V 31V1V3113V 33V3W9V31 13V31V1J19 V91V1VW1V 9W9J131V1
0912 9V391V1333 933V9111W 9W3911999 1933V1V9W 111V1W9V3 91V3V99913
0012 3V3111V3V9 93V3V391W V1V91V119V 311W33WV 3333311W1 9V313V91V9
Ot 02 1313133V3V V3W313999 V1333111V9 X1V9919V91 333V339931 1W91WV99 τs
S/OIO/96aD/13c[ 896f €/96 OΛV
09172 3V19V133V391V191991V 11W311931331931V31V 91V1931V99 W913133V3
00t?2 U1V1W93331W1V31V3 J1W9V9993 X1399199111113V331V91V9V313V99
017C2 113991199V V3V1WW391339W913331399V1V3931V13V9V311V139V1VW
0822 3V9913V31111W111319111119V133 VW99VdVW 9111V19J1V 91V99V1V9V
0222 99W91V99V W93V31V1V 3119V33V3V V3V3113V31 V1119V91V1 VW1V9W91
0912 131V19V391 V1339933V9111W9W33119991V33V 1V9W111V1 W9V391V9V
0012 999133V9111V9V993V3V 391VW1V91 V119V3X1W 33WV9933311W19V313
01702 991V91313133V3W3W913999VI333111V911V9919V91333V3399311W91
0861 WV999XV3111VW133V1999W9V99V 99VJ1V9991 V13W19XX399V11V91V9
0261 W3V3911V39V1V9991931V9V1W11V 3AV3W3A933V9V1V991313991V1111
0981 V91V191V1V 99W3V991V 9133313A1V 33V1V13VW V1V9199319 VX3139W31
0081 V91V319WV 91393W1V311191919VW V9931991V9 W9V1VW3V 913V3V1V31
OfrZI 1911V1V9199919V9V9911V99V91V9993VW9W3139119V9XXV 991VW1V91
0891 39-LLW3991 V1V39139931V13V9U13991191999991V9W3J1933311V19-LL
0291 11V3V93331 W9939V1191V9W919911V33V-UW391V9V333J1 J139993V31
09SI 1V1131V93V V31991391V 9131V19191191391V99191V913W39313V991113
00SI V1W99V93V 13W99913V 311V99919931V11V993V 33V313V1V191V91W31V
0W 3V9191991V 9U1V9VU1 V991V9111V W3119V91V 99J1991991 V9V9391VW
08CI 313131131V 199VJ13V199V99913VW 991V13W1113133933311V999191V9
0281 911V31V1199193139V991313V31113 V119J19V1V 9V3V3993V9 U191V3W3
0921 13V991V9V1 XX3V1W1W V31V391V333V3V3119J1 V3V991V313119J1911W
0021 99V139V91V 3139VW1V911V9X1X319 W1133V33V 933393W99 U119339V3
OHI 3W33V39J1 J1111WV3V 3191V31V113911119V1391V11V11311V33V9W31
0801 1V13991V11 VW39199331W3V1999113SVWWV1 V333133113119W91V9V
0201 9V1XXXW9193V1V313W 11WW1333 V993313V19 V91W99J1V 1V3131W91
096 V1V1W9V9139313VW33 VW9WV33993V333V3W 33H31dlVl 99V9V99V9V
006 V9333V331V 91V11V1V1V V991W1V1V 3311VW31V 91331139V3 VU1313V13
018 W31V39X13313311V3311V39W119199V31V3313 V3V991VA93 V1V9W919V
Z
St.OIO/96a9/XD<I 896KV960ΛV
0921 13VW33WV 3VW33333V 333V3W33113191V199V 9V99V9W93 33V331V91V
0021 J1V1V1W991W1V1V3311VW31V913 31139V3V111313V13W31V99113913
Oτ/TT 311V3311V99W119199V 31V3113V3V 991V333V1V 9W919V9V3 319991V313
0801 311W331331311391V99191W1VW3 331311111V 3V9991313199111W91V
0201 V99313V91V 11V3V31331 VW333V99911W3W3111V9V9911V313139139V3
096 19V33331331331399919 V91933V113. V31V199V3V 13313V13313V31119991
006 VWVW91V11991931311 U139W991 X1991999V9 XV19W3V311W399V999
0178 V91WW9W 3V19V3V311 VX99V3VXXV 31133V3W31931V13VW 3V9U11333 08Z 33V9V1WV9 XVJ11V9W9 V3199113V99133V33133 31V39999V9 V9V9V31V99 02Z V1V9131W91V911V11W 3V9V9W913113V1VW11 V3WW1313 V99V9913W 099 V199199W9 W3V13W3V 13V31V3113 91111V99119V9W9J1919W99V3VXX 009 3XV919W319333V9XX93 V91V93W9V 913WWJ1V 9V339V1393 V3W991W3
0179 W3119V1V99191V913W 31V39V333311WW9V33139V3V9V913V3119V911 0817 1W33V9V3V V31331V313 3139V1V919 V9V331W99133V19113319VW99993 0217 1V39V39113 V3V13JLL33V 93331W93311V93V11311319WW913991131V9V 098 V993V3-LLL31313V39VW W91L311V191311191W 1391W99V9931V91991V OOε V19V39V311 V991W131V W3V1919V31V33J1913V 133111193119V9913131 0172 3V3V1V191991V9VW9W 9W9V9V99V V9111V9V11 V9WW11W 91W99W33 081 W33J1W11313111111V 13131V9V31 V313V31V13 313V3V119V 119V313V3V 021 31XXW39V313W9113339991131311333V311313131313131V 999J1319V3 09 13V33133133VWW1111 ll l l ll l lll 111 I IV999V 1V13V313V93V1W111V9
: 8I : 0N 01 D3S : N0IldId3S3α 33N3H03S (PO
JBΘULL :A9010d01 (0)
ΘLBULS :SS3Nα30NVyiS (3) ppB OLθL nu :3dAl (8)
SJLBd θSBq l£2C :H19N31 (V)
: S3USId313V-JVH333N3I103S (!■)
: 8I : 0N 01 Q3S dOJ NOUVWϋOJNI (2)
6252 11W9W9N
0252 N933NW9W 3W9W9W9 VN9W9V1NV W3V9V19V13V391V1313919V39V3W εs
SZ,0l0/96aθ/X3d 896*ε/960ΛV
0176 9XX319V31V 3911V1W39 9131V193V9 XX31139V9V 1V3V1393W 9111V9VW9
0882 J193931V31 3113W93W 91W9W9W 3V13V19V19 W9W9V19V 19V39V19W
0282 3W3W3W3 W3W9WV3 V9V19V13V3 31V1313919 V33V3W9V1 9V133V391V
09Z2 191991V11V V311931331 931V91V91V 1991V99W9 1U33V3111 91W33391V
00Z2 V1V31V311V V3V3993113 9919911111 3V331V31V9 V313V99113 391199W3V
0^9 1WW99133 9W9139913 99V1V3331V 13V9V311V1 33VWW3V9 913V31111V
08S2 VXX1313111 XX3V133VW 99WVW9XX 1V1911V91V 99V1V9V99V V91V99VW9
02S2 3V31V1V311 9V33V3W9V 3113V31V11 13V31V1VW 1V9W9J131 V19V391V13
09172 93933V9111 W9W39119 991933V1V9 WJ-XXV1W9 V391V9V999 133V9XJ1V9
00172 V993V9V331 VW1V91V11 9V3J1W33V W9933311V V13V313991 V91313133V
01782 3W3W3133 39V1333111 V911V9919V 91333V3339 311W91WV 9991V3U1V
0822 W133V1999 W9V99V99V X1V9991V13 WX9XX399V 11V91V9W3 V3911V39V1
0222 V9991931V9 V1WJ1V31V 3W31933V3 V1V9911139 91V1111V91 V191V1V99V
0912 V3V991V913 991311V39V 1V13WW1V 9199319V13 139W31V91 V319VW913
0012 93V1V3U19 1919WW99 31991V9W9 V1VW3V313 V3V1V3-LL91 1V1V919991
0t 02 9V9V9911V9 9V91V9993V W9W31331 19V9X1V991 VW1V91391 1W3991V1V
0861 33139931V1 3V91113991 191999991V 9W3119333 J1V191LLLV 3V93391W9
0261 939V1191V9 W9199J1V3 3VJ1W391V 9V33311113 9991V3J1V1 131V93W33
0981 991391V913 1V19193391 D91V9H191V 913W33313 V991113V1V V99V93V13V
0081 V39913V311 V99919931V 11V993V33V 313V1V191V 91W31V3V9 191991V911
QUl 1V9V111V93 1-.9-LLLVW3 919V91V991 1991991V9V 9331VW313 131131V199
0891 VU3V199V9 9913VW991 V13W11131 33933311V9 99191V9911 V31VJ19919
0291 3139V99131 3V31113V11 9119V1V9V3 V3993V9U1 31V3W913V 991V9VU13
0951 VXW1WV31 V331V339V3 V311911V3V 331V313119 11911W99V 139V91V313
0051 9VW1V9J1V 9X11319W1 X33V93V933 393W33X.-1 19333V39W 33V391XXXX
Om J1VW3V313 1V31V11991 X119V1331V 11V11311V3 3V9W311V1 3991V11VW
08εi 33139391W 3V19991133 WWW1V33 3133113119 W91V9V9V1 J11W9193V
0281 1V313WX1V VW1339V99 3319V19V91 W99 V1V3 131W31V1V 1W9V91333 v
SLOlO HOIJ d 896K7960ΛV
0801 VJ1VW3319 9391W3V13 991133WW W1V393133 113113W31 V9V9V11HV
0201 V9193V1V31 3W11WW1 339V993313 V19V91W99 11V1V3131V V91V1V1W9
096 V9139313W V33VW9WV 33333V333V 3W331131V 1V199V9V99 V9W9333V3
006 31V91V11V1 V1W991W1 V1V3311VW 91V9133.L13 3V3V311313 V13W31V99
0178 113913311V 3311V39W1 19199V31V3 313V3V991V 193V1V3W3 19V9V33199
08Z 91V313311V V3313313.1 991V99191V V1VW33913 I 1 I I I V9V99 9131919911
02Z 1W91W993 13V31V11V3 V31331VW3 93V99911W 3W3U1V3V 9911V31333
099 9139V319V3 3331991331 399919V919 33V113V31V 133V3V1331 9V19313V31
009 119991WW W91V11991 9313111113 9W9911199 1999V91V19 W3V311W3
0175 99V999V913 VW9W3V13 V3V311V199 V3V11V3113 3V3W31931 V13VW3V91
0817 1X133333V9 V1WV91V11 1V9W9V319 9113V99133 V3313331V3 9999V9V9V9
0217 V31V99V1V9 131W91V91 1V11W3V9V 9W913113V 1VW11V3W W1319V99V 09ε 9913VW199 199W9W3V 13W3V13V3 1V31139111 1V99139V9V V9XX9X9W9
008 9V3VJ131V3 19W319339 V91193V91V 93W9V913V WV11V9V33 9V1393V3W 0172 991W3W31 19V1V9V191 V913W31V3 9V3333-LLW W9V33131V 3V9V913V31 081 19V9111W3 3VW3W313 31V3133139 V1V919V9V3 33W991339 19113319W 021 V999931V39 V39119V3V1 31133V9331 1W93311W 3VJ131L319 WW913991
09 131V9991V3 3V31V33V31 V33V3131V9 9V9V91V13V V11VW3V99 V9VWJ1V31
■ 61 : 0N 01 03S : N0IldId3S3α 33N3I1Q3S ( PO
J BΘU L L * A9010d01 (0 ) θ Lfiu LS : S 3Nα 0NVyiS (3) p pB O Lθ Lonu : 3dλl (8)
SJ LBd θSBq 8ZS2 : H19N31 (V)
• S3IlSId313VdVH3 33N3003S Q )
: 6I : 0N 01 D3S d03 NOUVWUOJNI (2)
IC2C 3 V9313VWW VWWWWV VNNNN33NW 111131V31V V131V91391
08iε 9V1VW991V VW1V33W1 W3WWW1 33V9V9191V 11W31WV9 V13V3339V3
0218 V191VNV111 3131V31311 VW1313113 V3I9VJ1391 11199V33V3 1139993V99 090ε 91391W931 31V111W31 V331WW19 1V1V3VW3V V313319W9 1V9V9V333V 000ε 1V1V93W33 19V19VX1V1 3V33111311 W39U199V VW3V3131V 3111W9939
S S
St.0I0/96aD/X3d 896H7960ΛV
8ZS2 919X13W 33W91W9V V9W9V19V1 9V19W9W9 V19V19V39V 19W9W9W
0252 9W9W9W3 W9W9W9V V9VW3V9V1 9V13V331V1 313919V33V 3W9V19113
09 72 3V391V1913 9XV11W311 931331931V 31V91V1991 V99W91J13 3V3111V1W
00172 33391W1V3 1V911W9V9 9931139919 9 I I I M 3V33 1V91V9V313 V99J1339J1
0frε2 99W3V1VW V991333W3 13331399V1 V3931V13V9 V3J1V139W WV3V9913V
0822 3JLLLLWU1 319UJL119V 133VW99W WV9111V19 -LLV91V99V1 V9V99W91V
0222 99VW93V31 V1V3113V33 V3W9V3113 V91V1LL9V9 1V1VW1V9V V91131V19V
0912 391V139993 3V9U1W9V V391199919 33V1V3W11 1V1W9V391 V9V999133V
0012 9U1V9V993 V9V391VW1 V91V119V31 1W33WV99 33311W19V 313V91V913
01702 13133V3W3 W913399V1 333U1V9-LL V9919V9133 3V3399311V V91VW9991
0861 V3JJLLVW13 3V1999W9V 99V99V11V9 991V13W19 11399V11V9 1V9W3V391
0261 1V39V1V999 1931V9V1W 11V31V3W3 3933V3V1V3 31313991V1 J11V91V191
0981 V1V99W3V9 91V9139913 11V39V1V13 WW1V9199 319V13139V V31V91V319
0081 VW91393V1 V3U191919 WW993199 1V9W9V1W V3V913V3V1 V311911V1V
017ZI 9199919V9V 99J1V99V91 V9993VW9V V3139119V9 11V991VW1 V9139JLLW3
0891 991V1V3913 3931V13V91 1139911919 99991V9W3 11933311V1 9UJ1V3V93
0291 391W9933V J191V9W91 9911V33V11 W391V9V33 3111133391 V311V1131V
09SI 33W319913 91V9131V13 191191391V 99191V913V V39313V391 X13V1W99V
0051 93V13W399 13V311V399 19931V11V9 93V33V313V 1V191V91W 31V3V31919
O i 91V9J11V9V U1V991V91 11VW3119V 91V9911991 991V9V9331 VW3131311
08εi 31V199V113 V199V99313 VW991V13V VXXXX13333 3311V33919 1V99.-XV31V
02εi 1199193133 V391313V31 J1DVJ19119 V1V933V333 3V91J131V3 W913V991V
0921 9V1113V1W 1WV31V331 V339V3V311 9J1V3V331V 313.191191 1W99V139V
0021 9XV3139VW 1V911V91X1 319WJ133V 93V333333V V331111933 9V33W33V3
OH I 9 I I I 1 I I 1W V3V3191V31 VH991LL19 V1331V11V1 1311V33V3V V3J1V13991 ss
St.O Ϊ O/96af>/XDd S96W960/A
57 (2) INFORMATION FOR SEQ ID NO: 20:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20: MTπYATGG GNMYGARπ YGG 23
