FIELD OF THE INVENTION

The present invention relates to inactivated ApxIA, ApxllA and ApxlllA toxins, vaccines comprising said inactivated toxins and the use thereof for the immunization and protection of mammals.

BACKGROUND OF THE INVENTION

Actinobacillus pleuropneumoniae (APP) is a Gram-negative bacterium and a member of the family Pasteurellaceae. APP is the etiological agent of porcine pleuropneumonia, a severe pulmonary disease of pigs that causes high economic losses in pig production worldwide. The disease is characterized by hemorrhagic, fibrinous and necrotic lung lesions. Pigs surviving the disease often become asymptomatic carriers of APP and are the main cause of bacterial dissemination.

To date, 18 serotypes have been identified on the basis of the antigenic properties of capsular polysaccharides (CPS) and as result of genotypic analysis. Main virulence factors of APP are exotoxins, CPS, lipopolysaccharides (LPS) and membrane proteins. The most important virulence factors are Apx-exotoxins which belong to the pore-forming repeats in toxin (RTX) family. The toxins are known to be highly immunogenic and are very important to obtain a protective immunity against APP related pleuropneumonia. At least four different Apx toxins are produced by APP, designated Apxl, Apxll, Apxlll and ApxIV. Apxl shows strong and Apxll shows low hemolytic activity. Both are cytotoxic and active against a broad range of cells of different host species. Apxlll is non hemolytic but strongly cytotoxic with porcine alveolar macrophages and neutrophils as major targets. ApxIV shows no cytotoxic and only week hemolytic activity. No serotype of APP produces all four Apx toxins. The majority of serotypes produce three Apx toxins. The pattern of Apx toxin production is associated with virulence, with serotypes 1, 5, 9 and 11 producing Apxl and Apxll being the most virulent.

At least four genes are responsible for production and secretion of active Apx toxins. Gene A encodes the structural toxin and gene C encodes an acyltransferase, mandatory for post translational activation of the toxin. Genes B and D encode two membrane proteins that are required for secretion of the mature toxin. The Apx genes are organized as operons. Operons of Apxl and Apxlll toxins consist of genes CABD whilst Apxll operon contains only the genes CA. Secretion of ApxllA therefore depends on active genes B and D of the Apxl operon.

Presently, pleuropneumonia resulting from APP infection of pigs is usually treated with antibiotics. However, it has been found that APP often exhibits antibiotic resistance against at least one of the antibiotics commonly used to treat APP infection.

Vaccination against APP is a promising prophylactic strategy to prevent pleuropneumonia. Several vaccines have been commercialized. Commercially available vaccines are either chemically inactivated whole cell vaccines or subunit vaccines or a combination of both. The immunological reaction of animals vaccinated with whole cell vaccines is directed mainly against surface structures such as CPS and LPS. The absence of secreted proteins such as Apx toxins which are known to be highly immunogenic and essential for protection explains the limited protection observed with bacterins. Furthermore APP whole cell vaccines confer only homologous protection against the serotype used to prepare the vaccine.

The commercially available subunit vaccine (patent EP0453024 Bl) contains chemically inactivated ApxA toxins as well as an outer membrane protein. The inactivation of ApxA toxins with denaturizing substances such as formaldehyde potentially leads to a decreased immunogenicity of the toxoids. The disadvantages of such a vaccine are the insufficient protection due to denaturizing toxins as well as concomitant serious side reactions probably due to remaining toxicity, due to incomplete inactivation of ApxA toxins. Subsequently, due to decreased immunogenicity after inactivation higher amounts of toxins need to be used that result in increased amounts of contaminating LPS in the vaccines. High LPS content can cause side effects as seen with commercial APP subunit vaccines.

It can be concluded, that current commercially available vaccines do not possess satisfactory safety and/or efficacy profiles against APP infection.

Furthermore there are some other experimental approaches for APP vaccines.

Patent application W02004045639 (Al) discloses a live attenuated vaccine against porcine pleuropneumonia containing an APP strain which is modified in transmembrane domains of genes encoding the toxins ApxIA and ApxllA. To test the degree of attenuation three months old pigs were inoculated with modified live APP strains. Seven days after the inoculation the animals were sacrificed and macroscopic lesions in the respiratory organs were recorded. All animals showed a modification of their behavior and lung lesions at necropsy. The efficacy of such a live vaccine was not examined. Patent application EP0810283 (A2) and patent EP0861319 (Bl) describe live attenuated APP strains having deletions in ApxA activator genes apxC. The modified APP strain does not produce the activator protein ApxC in a functional form and therefore the toxins ApxIA and ApxllA were not activated by acylation. Mice were vaccinated with a AapxC strain and challenged with virulent APP field strains. Vaccinated mice were protected against homologous challenge and partially protected against heterologous challenge. One study in pigs was performed. 1 out of 6 vaccinated pigs had lung lesions after heterologous challenge and necropsy. These attenuated live vaccines seem to be efficacious but this vaccine bears a safety risk. The vaccine strains produce Apx toxins which are not activated by acylation, due to lacking apxC. However these toxins have the original amino acid sequence of toxic ApxA. Very likely heterologous acyltransferase can acylate the ApxA converting it into its active, toxic form. In most of pig farms worldwide there are asymptotic carriers of virulent APP strains as well as pigs infected with low virulent APP strains. If such pigs were vaccinated with a AapxC vaccine strain the non-activated ApxA toxins of the vaccine strain could be activated by functional ApxC proteins of field strains. Furthermore there is the possibility to complementation of the apxC deletion by uptake of functional apxC genes. There is the possibility that the attenuated strain revert to a pathogenic one resulting in disease of inoculated animals.

Until today no attenuated live vaccines are commercially available.

Accordingly, there is the need for improved vaccines against APP which are safe and able to induce cross protection against all relevant serotypes in pigs and/or young piglets.

It is therefore an object of the present invention to provide inactivated ApxIA, ApxllA and ApxlllA toxins and the use of these toxoids in safe and efficacious subunit and live vaccines against porcine pleuropneumonia.

SUMMARY

The present invention discloses modifications of the acylation sides of the ApxIA, ApxllA and ApxlllA toxins to create inactive but fully immunogenic toxoid forms of these proteins. The replacement of both amino acids of the two acylation sides by another one prevents them from being acylated. Subsequently, these modified Apx toxins cannot initiate the binding to the target cell membrane and have no cytotoxic or haemolytic activity. The toxins do not need to be chemically inactivated resulting in highly immunogenic proteins. The required amount of these proteins for production of an efficacious subunit vaccine is relatively low. Therefore the content of contaminating LPS is also relatively low resulting in minor side effects such as fewer and vomiting and apathy. Due to better immunogenicity compared to chemically inactivated Apx subunits, subunit vaccines according to the present invention provide a better safety profile.

Furthermore, the invention can be used in live vaccines as the replacement of the two amino acids is based on genetic modification of the apxA genes. Thus, it can be transferred to APP strains that subsequently produce inactivated and highly immunogenic Apx proteins. These strains can be used as live vaccines which produce ApxA toxoids as well as a broad spectrum of other APP proteins. Those vaccines induce a complex immune response and cross protection against a broad range of APP serotypes. Due to genetic modification of the apxA genes the produced Apx toxoids cannot be activated by heterologous acyltransferases. There are some more advantages when using a live APP vaccine strain. The influence of maternal antibodies on the vaccine is expected to be lower when using live vaccines compared to subunit vaccines consisting of highly immunogenic antigens. Accordingly, with a high likelihood, the vaccine can be used in piglets before the age of 6 weeks and the existing immunological gap of available vaccines can be avoided. Additional gene knock outs can be used to achieve an even more attenuated vaccine strain and to use gene knock outs as marker for differentiating of infected from vaccinated animals (DIVA), e.g. by deletion of apxIVA gene. Hence, this invention provides a better safety and efficacy profile than all known vaccine approaches. As APP is strongly adapted to pigs, an attenuated APP vaccine strain could also be used as a vector for antigens of other pathogens that are relevant to pigs.

The invention is defined by the appended claims.

Disclosed are ApxIA, ApxllA or ApxlllA polypeptides of Actinobacillus pleuropneumoniae wherein a. the wild type amino acid sequence of

i. ApxIA as set forth SEQ ID NO:l is modified in at least one amino acid selected from the group consisting of K560 and K686,

ii. ApxllA as set forth SEQ ID NO:2 is modified in at least one amino acid

selected from the group consisting of K557 and N687, and

iii. ApxlllA as set forth SEQ ID NO: 3 is modified in at least one amino acid

selected from the group consisting of K571 and K702, and the at least one amino acid is exchanged by an amino acid not susceptible to acylation; or

b. an analogue or a fragment of the modified amino acid sequence as defined under a. which is at least 90% homologous to the modified amino acid sequence as defined under a. and a fragment comprises at least 50% of the consecutive amino acids of the modified amino acid sequence as defined under a. , and the analogue or fragment comprises the amino acid not susceptible to acylation as defined under a; or

c. the wild type amino acid sequence of

i. ApxIA as set forth SEQ ID NO:l containing deletions comprising at least one amino acid selected from the group consisting of K560 and K686, ii. ApxllA as set forth SEQ ID NO:2 containing deletions comprising at least one amino acid selected from the group consisting of K557 and N687, and iii. ApxlllA as set forth SEQ ID NO:3 containing deletions comprising at least one amino acid selected from the group consisting of K571 and K702, wherein the deletions do not delete more than 50% of the wild type amino acid sequence;

d. an analogue of the amino acid sequence comprising deletions as defined under c. which is at least 90% homologous to the amino acid sequence comprising deletions as defined under c.

DETAILED DESCRIPTION

The following headings merely serve to organize the disclosure, but should not be considered as separating one section of the disclosure from a further section of the disclosure. The features of each section can be combined with the features of any further section.

GENERAL DEFINITIONS

The term "fragment or analogue" as used herein is defined as follows:

An "analogue" can be regarded as an amino acid sequence exhibiting a level of homology of at least 60%, 70%, 80%, 85%, 90%, 95% or 97% to the original amino acid sequence. Homology, as used herein, means identity. As such, the sequences might differ from each other based on conservative substitution, deletion or insertion.

The degree of identity can be determined with the protein blast program using the blastp algorithm with default parameters which are, for example, Expect threshold: 10, Word size: 3, Matrix: BLOMSUM62, Gap Costs: Existence: 11 Extension: 1 and Compositional adjustments: Conditional compositional score matrix adjustment (BLAST is a registered trademark of the National Library of Medicine). The program can be used to search a protein database using a protein query. Identity reports the exact matches between aligned query and database sequences.

Preferably, conservative amino acid "substitutions" are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements. Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

"Insertions" or "deletions" are typically in the range of about 1, 2 or 3 amino acids. The variation allowed may be experimentally determined by systematically introducing insertions or deletions of amino acids in a protein using recombinant DNA techniques and assaying the resulting recombinant variants for activity. This does not require more than routine experiments for a skilled person.

A "fragment" of a polypeptide comprises at least 50%, 60%, 70%, 80%, 90%, 95%, or 97% of the original polypeptide. These fragments may be used as the exclusive active ingredient in a vaccine according to the present invention.

An APP "toxin" is a polypeptide that consists of the amino acid sequence of ApxIA, ApxllA, or ApxlllA (e.g. as set forth in SEQ ID NO: 1-3) and exhibits a cytotoxic and/or hemolytic activity. A "toxoid" in this disclosure is a polypeptide that is a modified form of the "toxin" wherein the modification is achieved by the replacement or deletion of an amino acid that is susceptible to acylation in vivo in APP and does not exhibit any cytotoxic or hemolytic activity.

The term "comprising" as used herein in the context of the vaccine composition means that further active or immunogenic components can be present. "Consisting of" means that no further components are present and "essentially consisting of" means that specific further components can be present, namely those not materially affecting the essential characteristics of the vaccine (i.e. inactive or not immunogenic ingredients).

The genus Actinobacillus comprises Gram-negative, nonspore-forming and predominantly encapsulated bacteria species that colonize the mucosal surface of the respiratory and urogenital tracts. Relevant veterinary species are for example A. pleuropneumoniae, A. suis, A. equuli and A. lignieresii which are the preferred Actinobacillus spp. of this disclosure . Actinobacillus spp. normally show strong host specificity. Preferred APP serotypes are serotypes 1, 5, 7, 8, 9 and 11.

POLYPEPTIDES

The disclosure relates to ApxIA, ApxllA or ApxlllA polypeptides (hereafter exchangeably designated ApxA polypeptides for brevity) wherein the wildtype ApxIA, ApxllA or ApxlllA polypeptides have been modified by amino acid substitution or deletion at the position of the amino acids susceptible to acylation in the wild type polypeptide. The amino acid substitution introduces an amino acid that is not susceptible to acylation. It has been surprising found that ApxIA, ApxllA or ApxlllA polypeptides modified in the above described manner no longer exhibit any hemolytic and/or cytotoxic activity. Thus, they may exhibit less side effects when being used to vaccinated a mammal while conferring immunological protection against APP. Accordingly, they can be considered as inactivated toxins, i.e. toxoids. Therefore, the polypeptides of the disclosure can be used safely in vaccines for immunizing subjects, in particular, mammals, against APP infection.

Polypeptides comprising substitutions at the position of the amino acids susceptible to acylation in the wild type polypeptide

In particular, the disclosure relates to an ApxIA, ApxllA or ApxlllA polypeptide of Actinobacillus pleuropneumoniae wherein

a. the wild type amino acid sequence of

i. ApxIA as set forth SEQ ID NO: 1 is modified in at least one amino acid selected from the group consisting of K560 and K686, ii. ApxllA as set forth SEQ ID NO: 2 is modified in at least one amino acid

selected from the group consisting of K557 and N687, and

iii. ApxlllA as set forth SEQ ID NO: 3 is modified in at least one amino acid

selected from the group consisting of K571 and K702, and the at least one amino acid is exchanged by an amino acid not susceptible to acylation.

The polypeptides can induce a humoral or /and cellular immunological response against one or more serotypes of APP in a mammal, in particular, a pig when being administered to said mammal. The polypeptides can induce a humoral or /and cellular immunological response against one strains of APP, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 strains of APP in a mammal, in particular, a pig when being administered to said mammal. Preferably, the polypeptides induce a sterile immunity against APP, APP strains, or APP serotypes. Each of ApxIA, ApxllA or ApxlllA comprises two amino acids which are susceptible to acylation. The modifications can affect one or both said amino acids.

The disclosure also relates to an analogue or/and a fragment of the modified amino acid sequence as defined above which is at least 90% homologous to the modified amino acid sequence as defined above and a fragment comprises at least 50% of the consecutive amino acids of the modified amino acid sequence as defined above and the analogue or fragment comprises the amino acid not susceptible to acylation as defined above.

As defined above the analogue can differ from the wild type by deletions or conservative substitutions. However, the analogue always comprises those amino acids replacing the amino acids susceptible to acylation.

Since the modified polypeptide does not contain the amino acids susceptible to acylation the modified polypeptide cannot be acylated. Polypeptides modified in this way cannot be acylated by any endogenous or exogenous acyltransferase (e.g. an ApxC of Actinobacillus pleuropneumoniae). As experimentally shown below those modified polypeptides no longer exhibit substantial pathological effects and can thus be safely used in vaccine compositions. These modified polypeptides are safer to use in vaccine compositions than vaccines where the acyltransferase ApxC is deleted because they remain pathological even if a acyltransferase is provided exogenously, either by a naturally occurring strain of APP or any other source of an acyltransferase in vivo. The same considerations apply to the following polypeptides in which the one or two amino acids of APP which are susceptible to acylation are deleted.

Polypeptides comprising deletions at the position of the amino acids susceptible to acylation in the wild type polypeptide

Instead of substituting the amino acids susceptible to acylation in the wild type polypeptide the amino acids can also be deleted to abolish the pathological effects of the wild type polypeptide.

Therefore, the disclosure also relates to an ApxIA, ApxllA or ApxlllA polypeptide of Actinobacillus pleuropneumoniae wherein the wild type amino acid sequence of i. ApxIA as set forth SEQ ID NO:l contains deletions comprising at least one amino acid selected from the group consisting of K560 and K686, ii. ApxllA as set forth SEQ ID NO:2 containing deletions comprising at least one amino acid selected from the group consisting of K557 and N687, and iii. ApxlllA as set forth SEQ ID NO:3 containing deletions comprising at least one amino acid selected from the group consisting of K571 and K702.

The polypeptides can induce a humoral or /and cellular immunological response against one or more serotypes of APP in a mammal, in particular, a pig when being administered to said mammal. The polypeptides can induce a humoral or /and cellular immunological response against one strains of APP, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 strains of APP in a mammal, in particular, a pig when being administered to said mammal. Preferably, the polypeptides induce a sterile immunity against APP, APP serotypes, APP strains, or APP serotypes.

As stated above, each of ApxIA, ApxllA or ApxlllA comprises two amino acids which are susceptible to acylation. The deletion of said amino acids can comprise one or both of said amino acids.

Thus, the deletions can comprise point deletions where only either the one or the two amino acids susceptible to acylation in each wildtype sequence are deleted. It is also disclosed that the deletions also delete amino acids in an area adjacent to the one or two amino acids susceptible to acylation. Thus, the respective deletions may comprise a 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, 300, 350, 400 amino acids as long as the deletion comprises one of the two amino acids susceptible to acylation. The size of the deletion for each amino acid susceptible to acylation can be independent from each other of have the same size. Deletions which cover a consecutive stretch of amino acids between the two amino acids susceptible to acylation are also disclosed.

The deletions do not delete more than 50% of the wild type amino acid sequence.

The disclosure also relates to an analogue of the modified amino acid sequence as defined above which is at least 90% homologous to the modified amino acid sequence as defined above and the analogue does not comprise the amino acid not susceptible to acylation as defined above. Such an analogue can comprise conservative substitutions and deletions as defined in the section relating to the general definitions. Thus, the polypeptide may comprise further deletions outside the deleted region comprising the one or two amino acids susceptible to acylation, but these deletions will only delete 1, 2, 3 amino acids.

AMINO ACIDS NOT BEING SUSCEPTIBLE TO ACYLATION

Amino acids susceptible to acylation are naturally occurring amino acids, e.g., lysine and/or asparagine. Amino acids not susceptible to acylation are known to the skilled person and can be used to substitute one or both of the amino acids susceptible to acylation. For example, the amino acid not susceptible to acylation can be independently selected from the group consisting of alanine, glycine, isoleucine, leucine, methionine, valine, serine, threonine, asparagine, glutamine, aspartic acid, histidine, aspartic acid, cysteine, proline, phenylalanine, tyrosine, tryptophan and glutamic acid. In particular, the amino acid not susceptible to acylation can be independently selected from the group consisting of alanine, glycine, serine, threonine, valine, isoleucine and leucine.

Moreover, the amino acid not susceptible to acylation can be independently selected from the group consisting of alanine, glycine, and serine. The most preferred amino acid amino acid not susceptible to acylation is alanine.

APXIA, APXIIA OR APXIIIA POLYPEPTIDE WITH TWO MODIFIED AM INO ACIDS

Preferably, two amino acids susceptible to acylation are modified in each of ApxIA, ApxllA or ApxlllA.

Thus, the wild type sequence of ApxIA as set forth SEQ ID NO:l is modified at K560 and K686. Thus, the wild type sequence of ApxllA as set forth SEQ ID NO:2 is modified at K557 and N687. Thus, the wild type sequence of ApxlllA as set forth SEQ ID NO: 3 is modified at K571 and K702.

Disclosed is also that said two amino acids susceptible to acylation in each of ApxIA, ApxllA or ApxlllA are modified to alanine.

Thus, the disclosed modified polypeptide can have the sequence set forth in SEQ ID NO: 4, 5, or 6 or be an analog or fragment thereof as defined above.

NUCLEIC ACIDS

Nucleic Acids comprising a nucleic acid sequence capable of coding for the above described polypeptides are also disclosed. The disclosed nucleic acid can be cDNA, DNA, RNA, cRNA or PNA (peptide nucleic acid). The term "nucleic acid sequence" refers to a heteropolymer of nucleotides of the sequence of these nucleotides. The nucleic acid can comprise a nucleic acid as set forth in SEQ ID NO: 10, 11, or 12.

The nucleic acid can be comprised in a vector suitable for cloning or expressing the nucleic acids of the disclosure. Exemplary vectors are pEX-A258 (SEQ ID NO: 19), pQE-80L (SEQ ID NO: 20), or pQE-60

(SEQ ID NO: 21). The nucleic acids or vectors may comprise additional regulatory non coding elements like inducible or non-inducible promoters, operators (e.g. lac-operator) or nucleic acids coding for other AP proteins. Further it is preferred that a vaccine composition, according to the present invention, is further characterized by the polynucleotide integrated into a vector, wherein the polynucleotide is operably linked to an expression control region of the vector. Thus, expression vector are also disclosed, wherein the expression vector preferably comprises one or more regulatory sequences in addition to the nucleic acid sequences coding for modified forms of ApxA. The term "expression vector" generally refers to a plasmid or phage or virus or vector, for expressing a polypeptide from a DNA (RNA) sequence. An expression vector can comprise a transcriptional unit comprising an assembly of (1) a genetic element or elements having a regulatory role in gene expression, for example, promoters or enhancers, (2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and (3) appropriate transcription initiation and termination sequences. Structural units intended for use in yeast or eukaryotic expression systems preferably include a leader sequence enabling extracellular secretion of translated protein by a host cell. Alternatively, where recombinant protein is expressed without a leader or transport sequence, it may include an N-terminal methionine residue. This residue may or may not be subsequently cleaved from the expressed recombinant protein to provide a final product.

MICROORGANISMS

Also disclosed are microorganisms comprising the disclosed nucleic acids or/and vectors described above. The microorganism may be an Escherichia coli (E. coli), an E. coli strain, e.g. E. coli ToplOF' strain or Actinobacillus pleuropneumoniae, an Actinobacillus pleuropneumoniae strain, e.g. ST2 (e.g. APP23), ST2 (e.g. 07/07), ST5 (e.g. DZY47), ST7 (e.g. DZY33), or ST8 (e.g. DZY49). The microorganisms also comprise nucleic acids or/and vectors coding for other genes.

VACCINE COMPOSITION

Disclosed is also a vaccine composition comprising at least one modified ApxIA, ApxllA or ApxlllA polypeptide as defined above, the nucleic acid molecule as defined above or the vector as defined above, or a microorganism as defined above. The vaccine composition may comprise at least a pharmaceutical carrier, a diluent, or/and an adjuvant.

The preparation of the vaccine composition according to the invention is known in the art, and is described in handbooks known to the person skilled in the art. For the production of the vaccine composition according to the present invention pharmaceutically acceptable carriers, diluents or adjuvants which comprise but are not limited to the following: mineral salt adjuvants (e.g., alum-, calcium-, iron-, zirconium-based), tensoactive adjuvants (e.g., Quil A, QS-21, other saponins), bacteria-derived adjuvants (e.g., N-acetyl muramyl-L-alanyl-D-isoglutamine (MDP), lipopolysaccharides (LPS), monophosphoryl lipid A, trehalose dimycolate (TDM), DNA, CpGs, bacterial toxins), adjuvant emulsions (e.g., FIA, Montanide, Adjuvant 65, Lipovant), liposome adjuvants, polymeric adjuvants and carriers, cytokines (e.g., Granulocyte-macrophage colony stimulating factor), carbohydrate adjuvants, living antigen delivery systems (e.g., bacteria especially modified APP). Furthermore carriers can also comprise dry formulations such as coated patches made from titan or polymer. Techniques for formulation and administration of the vaccines of the present application may also be found in "Remington, The Science and Practice of Pharmacy", 22nd edition.

The vaccine composition as a unit composition may comprise 0.01 -2.0 mg of protein, 0.01 -2.0 mg of nucleic acid, or 0.5 -200 mg ( or lxlO ⁴ CFU-lxl0 ¹⁰ CFU, colony forming units) of microorganism. The required active amount of the protein, nucleic acid or microorganisms can be determined by routine testing methods by the skilled person, e.g. in pigs or piglets.

The vaccine composition comprising the at least one ApxIA, ApxllA or ApxlllA polypeptide as described above may be a subunit vaccine. The subunit vaccine may comprise further APP polypeptides.

It also contemplated that the vaccine substantially only contains a nucleic acid or vector, for example, is a DNA vaccine. DNA vaccines are third generation vaccines. Nucleic acid or DNA vaccines contain DNA/nucleic acids that codes for specific proteins (ApxAs) from APP. The DNA/nucleic acid is injected into the body of the mammal and taken up by cells, whose normal metabolic processes synthesize proteins based on the genetic code in the nucleic acid that they have taken up. Because these proteins contain regions of amino acid sequences that are characteristic of APP, they are recognized as foreign and when they are processed by the host cells and displayed on their surface, the immune system is alerted, which then triggers immune responses.

Alternatively, the nucleic acid may be encapsulated in protein to facilitate cell entry. If this capsid protein is included in the nucleic acid, the resulting vaccine can combine the potency of a live vaccine without reversion risks.

The microorganism as described above in the vaccine composition may be an Actinobacillus species, for example, Actinobacillus pleuropneumoniae, Actinobacillus suis, an Actinobacillus species strain, for example, a strain of Actinobacillus pleuropneumoniae, Actinobacillus suis, or a particular serotype of a strain of an Actinobacillus species. The vaccine composition may comprise at least 1, for example, 1, 2, 3, 4, 5, 6, or 7 Actinobacillus species strains or serotypes of an Actinobacillus species strain. Each of the Actinobacillus species, strains, or serotypes may code for at least one polypeptide as defined above.

The microorganism as described above in the vaccine composition may not comprise APP nucleic acids coding for APP proteins that are different from the disclosed modified ApxIA, ApxllA or ApxlllA polypeptides. For example, the microorganism may comprise deletions of the the apxlV gene or/and the sxy gene.

In addition, at least one of the Actinobacillus pleuropneumoniae in the vaccine composition may comprise one or at least two of the following modifications (e.g. single or multiple deletions): AtbpA, AtonB2, AsodC, AdsbA, Afur, AmlcA, AmglA, AexbB, AureC, double mutant AexbB AureC, AfhuA, AhlyX, double mutant AapxIC and AapxllC, triple mutant AapxIC AapxllC Aorfl, hexa mutant AapxllA AureC AdmsA AhybB AaspA Afur, double mutant AapxlllB AapxlllD, double mutant AclpP and AapxllC, AznuA, AapfA, double mutant AapxllA and AureC, penta mutant AapxIC AapxllC Aorfl AcpxAR AarcA, double mutant AapxIC AompP2, double mutant AapxllC AapxIVA, inactivated apxllC, , inactivated apxIC, Alip40, AcpxA/cpxR, ApotD2, AtolC2, AsapA, or APdxS/PdxT.

The toxoid form of ApxIA as well as the vaccine composition comprising the at least one ApxIA, ApxllA or ApxlllA polypeptide as disclosed above exhibits remarkably increased immunogenicity and protective efficacy. The toxoid form of ApxIA as well as the vaccine composition comprising the at least one ApxIA, ApxllA or ApxlllA polypeptide as disclosed above exhibits no cytotoxic effect and no hemolytic effect, and do not cause a significant increase of body temperature after immunization, which might occur after a conventional immunization.

The above modifications are disclosed in:

Baltes, Nina; Hennig-Pauka, Isabel; Gerlach, Gerald-F (2002): Both transferrin binding proteins are virulence factors in Actinobacillus pleuropneumoniae serotype 7 infection. In FEMS microbiology letters 209 (2), pp. 283-287,

Sheehan, B. J.; Bosse, J. T.; Beddek, A. J.; Rycroft, A. N.; Kroll, J. S.; Langford, P. R. (2003): Identification of Actinobacillus pleuropneumoniae Genes Important for Survival during Infection in Its Natural Host. In Infection and immunity 71 (7), pp. 3960-3970. DOI: 10.1128/IAI.71.7.3960- 3970.2003, Baltes, N.; Tonpitak, W.; Gerlach, G. F.; Hennig-Pauka, I.; Hoffmann-Moujahid, A.; Ganter, M.; Rothkotter, H. J. (2001): Actinobacillus pleuropneumoniae iron transport and urease activity. Effects on bacterial virulence and host immune response. In Infection and immunity 69 (1), pp. 472-478. DOI: 10.1128/IAI.69.1.472-478.2001,

Jacques, Mario (2004): Surface polysaccharides and iron-uptake systems of Actinobacillus pleuropneumoniae. In Canadian journal of veterinary research = Revue canadienne de recherche veterinaire 68 (2), pp. 81-85,

Baltes, Nina; N'diaye, Mohamed; Jacobsen, Use D.; Maas, Alexander; Buettner, Falk F. R.; Gerlach, Gerald-F (2005): Deletion of the anaerobic regulator HlyX causes reduced colonization and persistence of Actinobacillus pleuropneumoniae in the porcine respiratory tract. In Infection and immunity 73 (8), pp. 4614-4619. DOI: 10.1128/IAI.73.8.4614-4619.2005,

Lin, Liwen; Bei, Weicheng; Sha, Yonggang; Liu, Jinlin; Guo, Yi; Liu, Weihong et al. (2007): Construction and immunogencity of a DeltaapxIC/DeltaapxllC double mutant of Actinobacillus pleuropneumoniae serovar 1. In FEMS microbiology letters 274 (1), pp. 55-62. DOI: 10.1111/j.1574-6968.2007.00813.x,

Yuan, Fangyan; Liu, Jinlin; Guo, Yi; Tan, Chen; Fu, Shulin; Zhao, Jin et al. (2011): Influences of ORF1 on the virulence and immunogenicity of Actinobacillus pleuropneumoniae. In Current microbiology 63 (6), pp. 574-580. DOI: 10.1007/s00284-011-0016-0,

Maas, Alexander; Jacobsen, Use D.; Meens, Jochen; Gerlach, Gerald-F (2006): Use of an Actinobacillus pleuropneumoniae multiple mutant as a vaccine that allows differentiation of vaccinated and infected animals. In Infection and immunity 74 (7), pp. 4124-4132. DOI: 10.1128/IAI.00133-06,

Park, Changbo; Fla, Yooncheol; Kim, Soohee; Chae, Chanhee; Ryu, Doug-Young (2009): Construction and characterization of an Actinobacillus pleuropneumoniae serotype 2 mutant lacking the Apx toxin secretion protein genes apxlllB and apxlllD. In The Journal of veterinary medical science 71 (10), pp. 1317-1323,

Xie, Fang; Li, Gang; Zhou, Long; Zhang, Yanhe; Cui, Ning; Liu, Siguo; Wang, Chunlai (2017): Attenuated Actinobacillus pleuropneumoniae double-deletion mutant S-8AclpP/apxllC confers protection against homologous or heterologous strain challenge. In BMC veterinary research 13 (1), p. 14. DOI: 10.1186/S12917-016-0928-9,

Yuan, Fangyan; Liao, Yonghong; You, Wujin; Liu, Zewen; Tan, Yongqiang; Zheng, Chengkun et al. (2014): Deletion of the znuA virulence factor attenuates Actinobacillus pleuropneumoniae and confers protection against homologous or heterologous strain challenge. In Veterinary microbiology 174 (3-4), pp. 531-539. DOI: 10.1016/j.vetmic.2014.10.016,

Zhou, Yang; Li, Lu; Chen, Zhaohui; Yuan, Hong; Chen, Huanchun; Zhou, Rui (2013): Adhesion protein ApfA of Actinobacillus pleuropneumoniae is required for pathogenesis and is a potential target for vaccine development. In Clinical and vaccine immunology: CVI 20 (2), pp. 287-294. DOI: 10.1128/CVI.00616-12,

Tonpitak, Walaiporn; Baltes, Nina; Hennig-Pauka, Isabel; Gerlach, Gerald F. (2002): Construction of an Actinobacillus pleuropneumoniae serotype 2 prototype live negative-marker vaccine. In Infection and immunity 70 (12), pp. 7120-7125, Yuan, Fangyan; Liu, Jinlin; You, Wujin; Bei, Weicheng; Wang, Chunlai; Zhao, Jin et al. (2018): Generation, safety and immunogenicity of an Actinobacillus pleuropneumoniae quintuple deletion mutant SLW07 (AapxICAapxllCAorflAcpxARAarcA). In Vaccine 36 (14), pp. 1830-1836. DOI: 10.1016/j. vaccine.2018.02.083,

Liu, Qjong; Gong, Yuheng; Cao, Yuqin; Wen, Xintian; Huang, Xiaobo; Yan, Qjgui et al. (2013): Construction and immunogenicity of a AapxlC/ompP2 mutant of Actinobacillus pleuropneumoniae and Haemophilus parasuis. In The Onderstepoort journal of veterinary research 80 (1), p. 519. DOI: 10.4102/ojvr.v80il.519,

Liu, Jinlin; Chen, Xia; Lin, Liwen; Tan, Chen; Chen, Yan; Guo, Yi et al. (2007): Potential use an Actinobacillus pleuropneumoniae double mutant strain DeltaapxllCDeltaapxIVA as live vaccine that allows serological differentiation between vaccinated and infected animals. In Vaccine 25 (44), pp. 7696-7705. DOI: 10.1016/j.vaccine.2007.07.053,

Bei, Weicheng; He, Qigai; Yan, Lin; Fang, Liurong; Tan, Yadi; Xiao, Shaobo et al. (2005): Construction and characterization of a live, attenuated apxIICA inactivation mutant of Actinobacillus pleuropneumoniae lacking a drug resistance marker. In FEMS microbiology letters 243 (1), pp. 21-27. DOI: 10.1016/j.femsle.2004.11.033,

Xu, Fu-Zhou; Shi, Ai-Hua; Chen, Xiao-Ling; Yang, Bing; Wang, Jin-Luo (2007): Construction and immunogenicity of an attenuated mutant of Actinobacillus pleuropneumoniae by insertional inactivation of apxIC. In Wei sheng wu xue bao = Acta microbiologica Sinica 47 (5), pp. 923-927, Prideaux, C. T.; Lenghaus, C; Krywult, J.; Hodgson, A. L. (1999): Vaccination and protection of pigs against pleuropneumonia with a vaccine strain of Actinobacillus pleuropneumoniae produced by site- specific mutagenesis of the Apxll operon. In Infection and immunity 67 (4), pp. 1962-1966,

Liu, 2018 Outer Membrane Lipoprotein Lip40 Modulates Adherence, Colonization, and Virulence of Actinobacillus pleuropneumoniae. Front Microbiol. 2018 Jul 3;9:1472. doi: 10.3389/fmicb.2018.01472,

Li, 2018 The CpxA/CpxR Two-Component System Affects Biofilm Formation and Virulence in Actinobacillus pleuropneumoniae. Front Cell Infect Microbiol. 2018 Mar 20;8:72. doi: 10.3389/fcimb.2018.00072, Zhu 2017 Polyamine-binding protein PotD2 is required for stress tolerance and virulence in Actinobacillus pleuropneumoniae. Antonie Van Leeuwenhoek. 2017 Dec;110(12):1647-1657. doi: 10.1007/S10482-017-0914-7,

Li 2017 TolC2 is required for the resistance, colonization and virulence of Actinobacillus pleuropneumoniae. J Med Microbiol. 2017 Jul 31. doi: 10.1099/jmm.0.000544, Xie 2017 The SapA Protein Is Involved in Resistance to Antimicrobial Peptide PR-39 and Virulence of Actinobacillus pleuropneumoniae. Front Microbiol. 2017 May 10;8:811. doi: 10.3389/fmicb.2017.00811, and

Xie 2017 Pyridoxal phosphate synthases PdxS/PdxT are required for Actinobacillus pleuropneumoniae viability, stress tolerance and virulence. PLoS One. 2017 Apr 27;12(4):e0176374. doi: 10.1371/journal.pone.0176374.

It is expected that the combination of the modified polypeptides as disclosed herein with the additional known modifications listed above will result in a synergistic attenuation of Actinobacillus pleuropneumoniae.

MEDICAL USE OR METHOD

The disclosed vaccine composition can be used in the prophylactic, metaphylactic or therapeutic treatment of a pneumonia, a pleurisy or a pleuropneumonia, in particular, of a pneumonia, a pleurisy or a pleuropneumonia caused by Actinobacillus pleuropneumoniae in a subject. The subject to be treated can be a mammal, in particular, a pig. The vaccine composition can be administered intramuscularly, intradermally, intravenously, subcutaneously, or by mucosal application (e.g. intranasally).

The vaccine composition can be administered via at least one, for example, one or two administrations using a unit composition as described above. In particular, the composition can be administered for the first time on the day of the birth, within 3 days, 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 10 weeks or 12 weeks of the birth of the subject. Accordingly, the vaccine can be advantageously administered at an early point in time of the mammal. However, it is also disclosed that the vaccine can be administered at any time point of the life of the mammal.

The vaccine composition can be administered for a second time, wherein the time period between two administrations can be between 1 and 4 weeks, 1 and 3 weeks , or 1 and 2 weeks. Preferably, a vaccine composition comprising a microorganism is to be administered only once.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 illustrates the establishment of a cytotoxicity assay with BL-3 cells and ApxA toxins isolated from APP supernatants.

Figure 2 illustrates a cytotoxic assay with BL-3 cells and genetically modified ApxIA and wild type ApxIA toxin (A) and genetically modified ApxlllA and wild type ApxlllA toxin (B).

Figure 3 illustrates the establishment of a hemolytic assay with sheep blood and ApxA toxins isolated from APP supernatants. Figure 4 illustrates a hemolytic assay with sheep blood and genetically modified ApxIA and wild type ApxIA toxin.

Figure 5: Rectal body temperatures 6 hours after first vaccination (A) and second vaccination (B). Each dot represents the rectal body temperature of an individual animal. Bars represent medians with 95% confidence interval. Dunn ^' s multiple comparison test; * = p < 0.05; ** = p < 0.01. Figure 6: Quantification of ApxIA-, ApxllA- and Apxl I IA-specific IgG in serum of pigs. IgG binding to the different antigens was quantified using ELISA. Serum from pigs of different groups before vaccination (dO), 2 weeks after first vaccination (dl4) and 2 weeks after second vaccination (d28) were analyzed. Quantified mean group IgG values of each time point were compared to the corresponding time point of group 1. Dunn ^' s multiple comparison test; * = p < 0.05; ** = p < 0.01. Bars represent medians. AU: arbitrary unit.

Figure 7: Serum neutralization assay with 6 pg active ApxIA toxin and sera from pigs two weeks after second vaccination. Viability of cells was assessed using WST-1 which is metabolized by metabolic active cells. The legend displays animal numbers and ApxIA-specific IgG ELISA data in brackets (A). X- values (serum concentrations) of ymax/2 were calculated by nonlinear regression curves (B). Dunn ^' s multiple comparison test; ** = p < 0.01; n.s. = not significant. Bars represent medians. AU: arbitrary unit.

Figure 8: Accumulated clinical scores after challenge with APP serovar 9 of the three groups receiving "Vaccine 1 (Group 1), Porcilis ^® APP (Group 2) or placebo (Group 3). Accumulated clinical scores were compared to the corresponding clinical score of group 3. Dunn ^' s multiple comparison test; * = p < 0.05; ** = p < 0.01. Bars represent medians.

Figure 9: Survival of pigs after challenge with APP serovar 9 of the three groups receiving "Vaccine 1" (Group 1), Porcilis ^® APP (Group 2) or placebo (Group 3). Percentage survival is 100% for group 1 and group 2, whereas 37.5% of animals in group 3 died or had to be euthanized due to animal welfare reasons due to severe symptoms caused by APP.

Figure 10: Lung lesion scores after challenge with APP serovar 9 of the three groups receiving "Vaccine 1" (Group 1), Porcilis ^® APP (Group 2) or placebo (Group 3). Lung lesion scores of group 1 and group 2 were compared to the corresponding lung lesion score control group (group 3). Dunn ^' s multiple comparison test; * = p < 0.05; ** = p < 0.01. Bars represent medians.

EXAMPLES

The following examples provide experimental data explain the present invention and shall only be understood as illustrating the invention. In particular, it contemplated that each specific feature disclosed in the examples can be combined with the features of the anteceding part of the description.

EXAMPLE 1: CLONING OF WILD TYPE AND MODIFIED APXIA, APXIIA, OR APXIIIA IN PEX-A258

Protein sequences of the wild types of ApxIA-ApxlllA were obtained from the data base uniprot, i.e. ApxIA APP ST5b (uniprot: A3N292), ApxllA APP ST3 (uniprot B0BPP0, with modification S148G), and ApxlllA ST8 (uniprot: P55131). In addition, protein sequences were provided comprising the following modifications:

Table 1

Acylation site 1 Acylation site 2

ApxIA (110 kDa) K560A K686A

Apxl lA (102 kDa) K557A N687A

Apxl llA (112 kDa) K571A K702A

The nucleic acids were derived from the protein sequences wherein the nucleic acid sequences were codon optimized and synthetically manufactured (Eurofins Genomics) without the start codon. Each nucleic acid sequence was provided in plasmid pEX-A258 (SEQ ID NO: 19) flanked by restriction sites BamHI at the 5' end and Sad at the 3' end.

EXAMPLE 2: CLONING AND EXPRESSION OF WILD TYPE AND MODIFIED APXIA-APXIIIA IN PQE-80L (SEQ ID NO: 20)

1 pg of pEX-A258 comprising the respective ApxIA-ApxlllA was restricted with BamHI FD (ThermoFisher) and Sad FD (ThermoFisher) according to the instructions of the manufacturer and resolved over a 1% agarose gel. Nucleic acid fragments of the appropriate size were extracted from the agarose gel (QUIAEX-II). pQE-80L was restricted with BamHI FD (ThermoFisher) and Sacl FD (ThermoFisher) according to the instructions of the manufacturer. Ligation of pQE-80L and the respective nucleic acid fragment in a ratio of 1:5 was performed over night at room temperature using T4-DNA ligase (ThermoFisher). The ligated DNA was electroporated into E. coli TopflOF' and the successful cloning of wildtype and modified forms of ApxIA-ApxlllA was confirmed by restriction analysis and sequencing. pQE-80L comprises a ampicillin resistance.

EXAMPLE 3: CLONING OF APXIC, APXIIC, AND APXIIIC GENES IN PQE-60 apxIC-IIIC genes were amplified from APP-DNA via polymerase chain reaction (PCR) using the primers indicated in table 2 and subsequently purified.

The PCR fragments comprising the respective apxIC-IIIC nucleic acids and pQE-60 were restricted with the restriction enzymes indicated in table 2 below according to the instructions of the respective manufacturer and resolved over a 1% agarose gel. Table 2 primer oder plasmid Sequence Restriction enzyme apxlc_for_pqe60 5' GCATCATG AGTAAAAAAATTAATG G ATTTG AG G (SEQ Pagl

ID NO: 23)

apxlc_rev_pqe60 5' G GT AGATCTTT AG CT ATTT A CTA ATG A A A ATTT A A (SEQ Bgll l

ID NO: 24)

apxl lc_for_pqe60 5' G C A ACATGTT AAAAAATG ATTTT A AC GT ATT G G (SEQ ID Pcil

NO: 25)

apxl lc_rev_pqe60 5' GGTAGATCTTTATTGTAGAGCTGTTATTAACT (SEQ ID Bgll l

NO: 26)

apxl llc_for_pqe60 5' GCATCATGAGTTATAAAAATGTT A A A A ATTT A A C A (SEQ Pagl

ID NO: 27)

apxl llc_rev_pqe60 5' GGTAGATCTTTATCCTCTTACAAT I I I I I I GTG (SEQ ID Bgll l

NO: 28)

pQE-60 (SEQ I D NO: 21) Ncol and Bgll l

Nucleic acid fragments of the appropriate size were extracted from the agarose gel (QUIAEX-II). Ligation of pQE-60 and the respective nucleic acid fragment in a ratio of 1:5 was performed over night at room temperature using T4-DNA ligase (ThermoFisher).

The ligated DNA was electroporated into E. coli TopflOF' and the successful cloning was confirmed by restriction analysis and sequencing.

EXAMPLE 4: CLONING AND EXPRESSION OF APXIC, APXIIC, AND APXIIIC GENES IN PACYC184

The respective apxIC, apxllC, and apxlllC genes were amplified from the respective pQE-60 vectors of example 2 using the primers indicated in table 3 below.

Table 3 primer oder plasmid Sequence Restriction enzyme apxlc_for_pacycl84 5' G CATCTAG AAAATC ATAAAA AATTT ATTTG CTTT (SEQ ID Xbal

NO: 29)

apxlc_rev_pacycl84 5' AG CTCGCGATT A G CT ATTT ACTA ATG A A A ATTT A (SEQ Nrul

ID NO: 30)

apxl lc_for_pacycl84 5' G CA ATCG ATAAATC ATAAAA AATTT ATTTG CTTT (SEQ ID Clal/Bscl

NO: 31)

apxl lc_rev_pacycl84 5' AGCTCGCGATTATTGTAGAGCTGTTATTAACT (SEQ ID Nrul

NO: 32)

apxl llc_for_pacycl84 5' G CATCTAG AAAATC ATAAAA AATTT ATTTG CTTT (SEQ ID Xbal

NO: 33)

apxl llc_rev_pacycl84 5' AG CTCGCGATT AT CCT CTT ACAATTTTTTTGT (SEQ ID Nrul

NO: 34)

PACYC184 (SEQ I D NO: 22) Xbal and Nrul (apxIC and apxlllC);

Clal/Bscl and Nrul ( apxllC ) In this way the promoter/lac-operator and the ribosomal binding site were also contained in the amplicons (SEQ ID NO: 16, 17, and 18).

The respective PCR products were restricted using the restriction enzymes indicated in table 3 and cloned into pACYC184 via restriction sites Xbal and Nrul (apxIC and apxlllC) or Clal / Bscl and Nrul (apxllC) using the same method and conditions as indicated above. pACYC184 comprises a chloramphenicol resistance.

The ligated DNA was electroporated into E. coli TopflOF' and the successful cloning was confirmed by restriction analysis and sequencing.

EXAMPLE 5: CO-TRANSFORMATION OF PACYC184 COMPRISING APXIC, APXIIC, OR APXIIIC GENES AND PQE-80L COMPRISING APXIA, APXIIA, OR APXIIIA

ApxC is required for the activation of ApxA toxins. Accordingly, pACYC184 comprising the respective apxIC, apxllC, or apxlllC genes obtained in example 4 were cotransformed with a pQE-80L comprising the respective apxIA, apxllA, or apxlllA gene into E. coli TopflOF' and successful co-transformation was selected on LB agar plates comprising 50 pg/ml ampicillin and 15 pg/ml chloramphenicol. Successful transformation was confirmed by restriction analysis.

EXAMPLE 6: EXPRESSION AND ISOLATION OF APXA, IN PARTICULAR, APXIA, TOXINS AND TOXOIDS

An E. coli colony as obtained in Example 5 and comprising pACYC184 and pQE-80L coding for the respective ApxA and ApxC genes was used to inoculate 40 ml LB-medium (100 pg/ml ampicillin and 30 pg/ml chloramphenicol). The culture was incubated under shaking at 30°C over night. On the next day the overnight culture was inoculated in 400 ml LB medium (100 pg/ml ampicillin and 30 pg/ml chloramphenicol) such that at optical density of 0.1 (optical density at 600 nm = OD600) was achieved. The obtained culture was incubated under shaking until an OD600 of 0.5 was obtained. To induce expression of recombinant protein 1 mM IPTG (Isopropyl b-D-l-thiogalactopyranoside) was added. The culture was incubated under shaking at 30°C for an additional 4 hours. Subsequently, the culture was centrifuged at 7000 g for 10 minutes. After removal of the supernatant the bacteria pellet was resuspended in LEW buffer (50 mM NaH ₂ P0 ₄ , 300 mM NaCI in Aqua dest.; pH 8.0) with 5 ml LEW buffer per 1 g bacteria pellet and stored at -20°C. 1 ml lOx Bug Buster (Novagen), 5 pi Benzoase (25 U/mI, Novagen) and 10 mg lysozyme were added to 10 ml of resuspended bacteria pellet. The obtained suspension was rotated slowly at room temperature for 20 minutes. After centrifugation at 4°C and 15000 g for 60 minutes the pellet was washed in LEW buffer (10 ml LEW buffer per 1 mg of pellet) and centrifuged (4 °C, 15000 g, 60 min). The washed pellet was resuspended in 2 ml denaturing solubilization buffer (8 M urea in LEW buffer; pH=8.0) per 1 g of pellet and subsequently 1 ml Bug Buster (Novagen) per 10 ml of resuspended pellet. The suspension was incubated at 4°C for 1 hour and subsequently centrifuged (4 °C, 18000 g, 15 min). The protein containing supernatant was utilized in the subsequent steps for column protein purification.

According to the instructions of the manufacturer the columns (Protino Ni-IDA 2000 columns, Machery-Nagel) were equilibrated with 4 ml of equilibration buffer (8 M urea in LEW buffer; pH=8.0). Subsequently, the column was loaded with half of the protein containing supernatant and washed twice with 4 ml of equilibration buffer (total 8 ml buffer). Proteins were eluted twice with 3 ml elution buffer (equilibration buffer with 250 mM imidazol, total 6 ml buffer). The procedure was repeated with the second half of the protein containing supernatant. The protein containing elutions were pooled and dialyzed in PBS, pH 8.0 containing 1 M urea at 4°C over night. The dialysis buffer was exchanged with 0.5 M urea in PBS (pH 8.0) and dialysis was continued for additional 4 hours. Subsequently, the buffer was exchanged with PBS (pH 8.0) without urea and dialyzed for additional 4 hours. The protein concentration was determined with the Pierce BCA Protein Assay Kit (ThermoFisher) according to the instructions of the manufacturer. The protein was stored at -80°C until usage.

EXAMPLE 7: ISOLATION OF APXA TOXINS FROM APP

Solution APPVX contains 1 g D(+)-Glucose, monohydrate, 0.1 g L-glutamine, 0.362 g L-cysteine hydrochloride monohydrate and 10 mL nuclease-free H ₂ 0. APP isolates were plated onto chocolate agar comprising IsovitaleX and incubated at 37°C over night. Three APP colonies were combined and used to inoculate 3 ml Columbia medium (10 mM Ca ²⁺ , 0.2 mg/mL NAD, 1 % APPVX) and the obtained culture was incubated at 37°C under shaking for 5 hours. Subsequently, the culture was centrifuged at 3200 g and 4°C for 20 minutes. The clear supernatant was transferred into a new tube and 44.05 g ammonia sulfate were gradually added and mixed until the ammonia sulfate completely dissolved. Subsequently, the solution was incubated at 4°C over night. Precipitated proteins were centrifuged at 3200 g and 4°C for 3 hours and the supernatant was removed. The protein pellet was air dried and subsequently suspended in 1 mL PBS comprising 6 M urea. To remove residual buffer, the obtained protein solution was purified via gel filtration on PDMidiTrap G25 columns (GE Healthcare). After equilibration with PBS comprising 6 M urea 1 ml of the protein solution was loaded onto the gel filtration column and subsequently eluted with 1.5 ml PBS comprising 6 M urea. Subsequently, the eluted proteins were stored at -20°C. Identity of the eluted proteins was confirmed via SDS-PAGE.

EXAMPLE 8: ESTABLISHMENT OF A CYTOTOXICITY ASSAY

To analyze the cytotoxic activity of recombinant ApxA proteins (wild type and toxoid forms), a cytotoxicity assay using BL3 cells (BL3.1 CRL-2306) as target cells. BL3 cells were obtained from bovine B-cells and it is known that they can be lysed by ApxA toxins (Tu, A. H.; Hausler, C; Young, R.; Struck, D. K. (1994): Differential expression of the cytotoxic and hemolytic activities of the ApxllA toxin from Actinobacillus pleuropneumoniae. In Infection and immunity 62 (5), pp. 2119-2121). ApxA toxins as obtained in Example 7 were used as a positive control and PBS comprising 6 M urea served as negative control.

BL3-cells were cultivated in medium (DMEM containing 100 U/mL penicillin, 100 pg/mL streptomycin, 10 % FCS und lx non-essential amino acids) at 37 °C and 5 % C0 ₂ . T75 flasks with 25 ml of the medium were used for cultivation. BL3 cells were passaged weekly with 50,000 cells/cm ² used to seed a new flask.

For utilization in the cytotoxicity assay 50 pi BL3 cells in medium were transferred into a well of 96 well plate. Recombinant proteins and controls were diluted in DM EM. 50 pi of the diluted recombinant proteins and controls were added to each well comprising the cells. Subsequently, the plate was incubated at 37°C and 5% C0 ₂ for 24 hours. After assessing the cell morphology microscopically 10 mI of WST-1 (Sigma Aldrich) was added to each well and the plate was incubated at 37°C and 5% C0 ₂ for a further 24 hours.

Subsequently, absorption is determined with an ELISA reader at 450 nm. WST-1 is cleaved by a complex cellular mechanism on the cell surface of viable cells to a soluble formazan. Accordingly, the amount of formed formazan dye and the extinction read in the ELISA reader directly correlate with the number of metabolically active cells in culture. EXAMPLE 9: ESTABLISHMENT OF A HEMOLYTIC ASSAY

To analyze the hemolytic activity of recombinant ApxA proteins (wild type and toxoid forms), a hemolytic assay was established. Cell culture plates comprising Columbia agar with 5% sheep blood (Bection Dickinson) were used. Holes with a diameter of 3 mm were punched out of the cell culture plates. 10 pi of the respective recombinant protein and control samples were filled into the hole and the plates was incubated at 37°C overnight. ApxA toxins as obtained in Example 7 were used as a positive control and PBS comprising 6 M urea served as negative control.

Hemolytic activity is considered to present when the sheep blood agar decolorizes and thus appears whitish.

EXAMPLE 10: ISOLATION OF APXA TOXINS FROM APP

APP strains ST2, ST5, ST7, and ST8 were used to isolate supernatants comprising ApxA toxins using the expression and isolation method described in example 7. SDS-PAGE revealed that the supernatants contained bands at the expected molecular weight positions corresponding to ApxIA, ApxllA, ApxlllA, and ApxIVA (data not shown). Thus, each of the obtained supernatants of respective strains ST2, ST5, ST7, and ST8 comprises a mixture of ApxIA, ApxllA, ApxlllA, and ApxIVA.

EXAMPLE 11: CYTOTOXICITY OF APXA FROM APP IN BL-3 CELLS

Using the method of example 8 50 mI of the ApxA toxins of example 7 obtained from APP (APP strains ST2, ST5, ST7, and ST8) were tested in increasing dilutions in DMEM (1:8, 1:16, 1:32; 1:64, 1:128; 1:256, 1:512; 1:1024, 1:2048, 1:4096).

A cytotoxic effect of the APP supernatants was observed that decreased with increasing dilutions (see figure 1). Isolated toxins of ST8 exhibited the highest cytotoxicity whereas isolated toxins of ST7 showed the lowest toxicity. No correlation of LPS in the ApxA preparation on cytotoxicity could be observed (data not shown).

EXAMPLE 12: CYTOTOXICITY OF RECOM BINANT FORMS OF APXIA AND APXIIIA IN BL-3 CELLS

Using the method of example 8 the following samples were tested Table 4

50 mI of each sample was tested in increasing dilutions in DMEM (1:2, 1:4, 1:8, 1:16, 1:32; 1:64, 1:128; 1:256, 1:512).

The control with cells used dilutions of PBS to evaluate an influence of PBS. No effect was found (see figure 2). The results are illustrated in figure 2. As illustrated in figure 2 A the cytotoxicity assay demonstrated that recombinant wild type ApxIA lysed BL3 cells and thus was active. Starting with a dilution of 1:64 (13.1 pg/ml wildtype ApxIA toxin) the values for the viability of the cells were comparable to those to the PBS control. The viability of BL3 cells that had been incubated with the ApxIA toxoid form were comparable to that of the PBS control. This also applied to the cell morphology (data not shown).

Since the toxoid form of ApxIA had the same effect on cell viability and morphology as the PBS control while the wildtype ApxIA form had a strong cytotoxic effect on BL3 cells it can be concluded that the toxoid form of ApxIA has no cytotoxic effect. Similar results were obtained with regard to the toxoid forms of ApxllA (data not shown) and ApxlllA (figure 2 B).

EXAMPLE 13: HEMOLYTIC ACTIVITY OF APXA FROM APP

Using the method of example 9 10 pi of the ApxA toxins of example 7 obtained from APP (APP strains ST2, ST5, and ST8) were tested.

The results are illustrated in figure 3. Strain ST8 exhibited a strong hemolysis, ST5 a moderate hemolysis and ST2 no hemolysis as can be inferred from the decreasing whitish color from left to right in figure 3. It is known that not each of ApxIA, ApxllA and ApxllA is capable of lysing erythrocytes. Since different strains secret different amounts of the respective ApxA forms the supernatants from the respective strains which comprise mixtures of the different ApxA forms can exhibit different hemolytic activity. In sum, it can be demonstrated that hemolytic activity of ApxA toxins can be demonstrated in a method involving the use of Columbia agar comprising 5% sheep blood as described in example 9.

EXAMPLE 14: HEMOLYTIC ACTIVITY OF RECOM BINANT FORMS OF APXIA

Using the method of example 9 the following samples were tested

Table 5

The results are illustrated in figure 4. While the ApxIA wildtype form lyses erythrocytes the ApxIA toxoid form does not lyse erythrocytes. ApxlllA wildtype form showed no hemolytic activity as it is also described in literature. Since the toxoid form of ApxIA had the same, i.e. absent, hemolytic effect as the PBS control while the wildtype ApxIA form had a strong hemolytic effect on sheep erythrocytes it can be concluded that the toxoid for of ApxIA has no hemolytic effect. Similar results were obtained with regard to the toxoid forms of ApxllA (data not shown).

EXAMPLE 15: IMMUNOGENICITY OF APXIA, APXIIA AND APXIIIA POLYPEPTIDES OF THE INVENTION IN SWINE

(1) Preparation of antigens and vaccine formulation

Nucleic acids coding for modified ApxIA (SEQ ID NO: 4), ApxllA (SEQ ID NO: 5) and ApxlllA (SEQ ID NO: 6) codon optimized for expression in E. coli were synthetically manufactured (Eurofins Genomics) and the sequence provided in plasmid pEX-A258 (SEQ ID NO: 19) flanked by restriction sites BamHI at 5' and Sad at the 3' end. 1 pg of pEX-A258 comprising the respective ApxIA and ApxlllA was restricted with BamHI FD (ThermoFisher) and Sad FD (ThermoFisher) according to the instructions. Nucleotides coding for AA 439-801 of ApxllA were amplified by PCR using pEX-A258 (SEQ ID NO: 19) containing gene for ApxllA and primers (forward: GCAGGATCCCAGGGGTATGATTCACGC and revers GGTGAGCTCTTAGGTGATGGAGTCGTTGCC) introducing a BamHI at the 5' and a Sad restriction site at the 3' end. PCR product was purified using QIAquick PCR Purification Kit 250 (Qiagen) and restricted with BamHI FD (ThermoFisher) and Sacl FD (ThermoFisher) according to the manufacturer's instruction. Restricted ApxIA, ApxllA (truncated) and ApxlllA were resolved over 1% agarose gel. Nucleic acid fragments of the appropriate size were extracted from the agarose gel (QUIAEX-II). pQE- 80L was restricted with BamHI FD (ThermoFisher) and Sacl FD 10 (ThermoFisher) according to the instructions of the manufacturer. Ligation of pQE-80L and the respective nucleic acid fragment in a ratio of 1:5 was performed over night at room temperature using T4-DNA ligase (ThermoFisher). The ligated DNA was electroporated into E. coli TopflOF' and the successful cloning of modified forms of ApxIA, ApxllA (truncated) or ApxlllA was confirmed by restriction analysis and sequencing. pQE-80L comprises an ampicillin resistance. The respective pQE-80L coding for modified ApxIA, ApxllA (truncated) or ApxlllA was co-transformed in E. coli TopflOF' with pACYC184 plasmid coding for the respective apxIC, apxllC and apxlllC deriving from EXAMPLE 4 according to method described in EXAMPLE 5. After co-transformation E. coli TopflOF' were selected on LB agar plates comprising 50 pg/ml ampicillin and 15 pg/ml chloramphenicol. E. coli colonies as obtained comprising pQE-80L coding for modified ApxIA and pACYC184 coding for ApxIC

PQE-80L coding for truncated ApxllA (truncated) and pACYC184 coding for ApxllC pQE-80L coding for modified ApxlllA and pACYC184 coding for ApxlllC

were used to inoculate 40 ml LB-medium (supplemented with 100 pg/ml ampicillin 30 pg/ml chloramphenicol). The culture was incubated under shaking at 30°C over night. The overnight culture was inoculated in 400 ml LB medium (supplemented with 100 pg/ml ampicillin 30 pg/ml chloramphenicol) such that an optical density of 0.1 (optical density at 600 nm = OD600) was achieved. The obtained culture was further incubated under shaking until an OD600 of 0.5 was obtained. To induce expression of recombinant protein 1 mM IPTG (Isopropyl b-D-l- thiogalactopyranoside) was added. The culture was incubated under shaking at 30°C for an additional 4 hours. Subsequently, the culture was centrifuged at 7,000 g for 10 minutes. After removal of the supernatant the bacteria pellet was resuspended in LEW buffer (50 mM NaH2P04, 300 mM NaCI in Aqua dest.; pH 8.0) with 5 ml LEW buffer per 1 g bacteria pellet and stored at -20°C. 1 ml lOx Bug Buster (Novagen), 5 pi Benzoase (25 U/pl, Novagen) and 10 mg lysozyme were added to 10 ml of resuspended bacteria pellet. The obtained suspension was rotated slowly at room temperature for 20 minutes. After centrifugation at 4°C and 15,000 g for 60 minutes the pellet was washed in LEW buffer (10 ml LEW buffer per 1 mg of pellet) and centrifuged (4 °C, 15000 g, 60 min). The washed pellet was resuspended in 2 ml denaturing solubilization buffer (8 M urea in LEW buffer; pH=8.0) per 1 g of pellet and subsequently 1 ml Bug Buster (Novagen) per 10 ml of resuspended pellet. The suspension was incubated at 4°C for 1 hour and subsequently centrifuged (4 °C, 18,000 g, 15 min). The protein containing supernatant was utilized in the subsequent steps for column protein purification. According to the instructions of the manufacturer the columns (Protino Ni-IDA 2000 columns, Machery-Nagel) were equilibrated with 4 ml of equilibration buffer (8 M urea in LEW buffer; pH=8.0). Subsequently, the column was loaded with half of the protein containing supernatant and washed twice with 4 ml of equilibration buffer (total 8 ml buffer). Proteins were eluted twice with 3 ml elution buffer (equilibration buffer with 250 mM imidazol, total 6 ml buffer). The procedure was repeated with the second half of the protein containing supernatant. The protein containing elutions fractions were pooled and dialyzed in PBS, pH 8.0 containing 1 M urea at 4°C over night. The dialysis buffer was exchanged with 0.5 M urea in PBS (pH 8.0) and dialysis was continued for additional 4 hours. Subsequently, the buffer was exchanged with PBS (pH 8.0) without urea and dialyzed for additional 4 hours. The protein concentration was determined with the Pierce BCA Protein Assay Kit (ThermoFisher) according to the instructions of the manufacturer. The respective ApxA antigens were sterile filtered (0.2 pm) and stored at 4°C till formulation.

Montanide ISA 201 VG (lot 36075M, Seppic) was used according to manufacturer's instruction to formulate test batches with the respective modified ApxIA, ApxllA(truncated) and ApxlllA (Table 6).

Briefly adjuvant and antigen was pre-warmed to 31°C in a water bath. Volume of antigen(s) was brought to the equal amount as the adjuvant (50:50, w/v) by addition of sterile PBS and further kept at 31°C. Montanide ISA 201 VG was slowly stirred in a beaker. Subsequently the antigen was added to the adjuvant and further stirred at 31°C for 5 min. The formulation was stored for lh at 20°C, filled in glass vials and further stored at 4°C until use.

Table 6: Formulation of the different test batches for immunogenicity study

(2) Animal Study (immunogenicity) The immunogenicity of the vaccine formulations was determined by quantification of ApxIA-, ApxllA- and Apxll IA-specific IgG antibodies in ELISA and assessment of ApxIA-neutralizing properties in blood serum after vaccination of 8 week old pigs.

Animals

Pigs of both sexes (male [neutered] and female) were obtained from a commercial pig breeder (BHZP, 21337 LOneburg, Zuchtbetrieb Garlitz (DE-LWL 1051)). Each pig was identified with a unique ear tag number and subjected to a veterinary inspection for compliance with the inclusion/exclusion criteria specified in the study protocol. All animals showed no clinical signs of APP infection and animals were free of clinical signs (dyspnea, coughing, diarrhea, lameness) at the beginning of the study. Animals were confirmed to be seronegative in a commercially available APP-ApxlV ELISA (IDEXX) before inclusion in the study. Pigs were kept in a closed containment at the animal facilities at IDT Biologika GmbH, Am Pharmapark, D-06861 ϋq553u-bobΐ3u (Germany). Within the unit there were two separate rooms/pens of equal space on solid floor. Straw was used for bedding and was changed daily. The pigs were fed (with pellets - commercial mixture) ad libitum using manually filled dry feeder. Water of tap water quality was supplied via tap and nipple drinkers. All facilities were cleaned daily. Study design

In total, 25 8-week old pigs, were randomly allocated to 5 groups, consisting of 5 animals per group. Three groups were intramuscularly treated 2 times at an interval of 14 days with either 1.5 mL "Vaccine 1", "Vaccine 2" or "Vaccine 3". One group of five animals received 2 ml of a commercially available vaccine against Actinobacillus Pleuropneumoniae (Porcilis ^® APP, MSD Animal Health, Batch: A784A01) twice at an interval of 14 days and served as positive control. Another group received a placebo vaccine and served as negative control. An overview of groups and treatments is provided in Table 7. Table 7: Study groups and treatment

* pig no. 5670 (groi was excluded from the study on study day 14 due to an infection not related to the test vaccines Serum specimens were collected at study day 0 (day of first vaccination), 14 (day of second vaccination) and 28 (end of study) from each of the animals.

Local and systemic reactions related to vaccination were assessed once per study day beginning 1 day before until 3 days after each of the two vaccinations. For evaluation of local reactions redness and swelling at the injection sites were assessed. Rectal body temperatures were measured once a day beginning 1 day before until 3 days after each of the two vaccinations. On the day of vaccination the temperature was measured before and 6 h after vaccination. Results of the body temperatures are shown in table 8 and figure 5. Results:

Table 8: Mean rectal body temperatures per group (increased temperatures are marked)

(3) Serological data (ELISA)

ELISAs were established for quantification of either ApxIA-, ApxllA- or Apxll IA-specific IgG-antibodies in pig sera. Briefly ApxIA-, ApxllA- or ApxlllA were expressed, purified and quantified as described in EXAMPLE 5. Respective ApxA was diluted in lx ELISA coating buffer (120125; Candor Bioscience) to a final concentration of 5 pg/mL. 100 pi of the respective ApxA in ELISA coating buffer are given in each well of a 96-well plate (Nunc MaxiSorb ELISA plate (44-2404-21, ThermoFisher) and incubated at 4°C over night. Subsequently coating buffer is removed and plates are washed 3 times with washing buffer (PBS, 0.05% TWEEN 20 (v/v)). The plates are blocked using blocking solution containing PBS with 10% (v/v) FCS for 1 h at room temperature (RT) on a shaker. Subsequently blocking solution is removed and all wells are washed 3 times with washing buffer. Pig sera are pre-diluted 1:100 in blocking solution and a 1:5 dilution series is prepared in blocking solution (comprising dilutions 1:100-1:312,500). 50 pi of each dilution is pipetted to one well of the ELISA plate. A hyperimmune serum obtained from an animal infected with A. pleuropneumoniae several times, serves as positive control and is diluted as previously described. After 1 h of incubation at RT on a shaker, serum dilutions are removed and each well washed 3x with wash buffer. Goat IgG anti-Swine IgG (H+L)- HRPO, MinX none (Dianova) serves as secondary antibody and is diluted 1:4,000 in blocking buffer and 50 mI are given to each well of the 96-well plate. After 1 h of incubation at RT on a shaker, secondary antibody dilution is removed and each well washed 3x with wash buffer. Subsequently 50 mI of TMB substrate (555214, BD) are given into each well of the ELISA-plate and incubated for 6 minutes at RT in the dark. Reaction is stopped by addition of 20 mί 2N H2S04 (X873.1, Roth) per well. Absorption of each well at 450 nm wavelength is measured in an ELISA reader. Absorption data are processed using GraphPad Prism 8.0 with logarithmical transformation of absorbance values and nonlinear regression with sigmoidal dose-response. For statistical analysis results of ELISA were analyzed using Kruskal-Wallis test and Dunn ^' s multiple comparison test. The data of each group were compared to the corresponding data of the placebo group (group 1). A p-value less or equal 0.05 was considered as significant. Results are shown in figure 6.

(4) Serological data (neutralization assay)

The neutralization assay allows quantification of the recombinant WT ApxIA-neutralizing capacity of respective pig sera.

BL3 cells (BL3.1 CRL-2306) are employed as target cells. BL3 cells were obtained from bovine B-cells and lysis of this cell line by ApxIA toxins was described (Tu, A. H.; Hausler, C; Young, R.; Struck, D. K. (1994)). BL3-cells were cultivated in medium (DMEM containing 100 U/mL penicillin, 100 pg/mL, streptomycin, 10 % FCS und lx non-essential amino acids) at 37 °C and 5 % C02. T75 flasks with 25 ml of the medium were used for cultivation. BL3 cells were passaged weekly with 50,000 cells/cm2 used to seed a new flask. For utilization in the neutralization assay 50 pi BL3 cells in medium were transferred into each well of 96-well plate.

Sera of pigs are heat inactivated at 56°C for 30 min. Subsequently a 2-fold dilution series of sera in DMEM is prepared comprising dilutions. Recombinant WT ApxIA (active toxin) is prepared according to EXAMPLE 7 and diluted to a final concentration of 240 pg/mL. 70 pi of each serum dilution are mixed to 30 pi of WT ApxIA-dilution (final ApxIA amount per well: 6 pg) on a 96-well plate (resulting in a serum dilution of 1:2 - 1:256) and incubated for 1 h at 37°C. 50 pi of the content of each well is transferred to a round-bottom 96-well plate containing 50,000 BL3 cells/cm ² in 50 pL DMEM), resulting in a final serum dilution of 1:4 - 1:512. Plates are incubated for 24 h at 37°C in an atmosphere containing 5% C0 ₂ and 100% humidity. After 24 h WST-1 substrate (Sigma) is added to each well of the plate according to the manufacturer's instruction. The plates are incubated for another 24 h at 37°C in an atmosphere containing 5% C0 ₂ and 100% humidity. Subsequently, absorption is determined with an ELISA reader at 450 nm. WST-1 is cleaved by a complex cellular mechanism on the cell surface of viable cells to a soluble formazan. Accordingly, the amount of formed formazan dye and the extinction read in the ELISA reader directly correlates with the number of metabolically active cells in culture. The neutralization assay was employed for sera obtained on day 28 of the serological study of animals in groups 1, 2 and 3. Results are shown in figure 7. EXAMPLE 16: EFFICACY OF APXIA, APXIIA AND APXIIIA POLYPEPTIDES OF THE INVENTION IN SWINE (1) Preparation of antigens and vaccine formulation

Preparation of antigen and formulation was conducted as described in EXAM PLE 15. Table 9 summarizes the formulation of the different vaccine test batches.

(2) Animal study (efficacy)

The objective of this study was to evaluate the protective efficacy obtained by vaccination using recombinantly expressed modified ApxIA, ApxllA and ApxlllA vaccine formulation against Actinobacillus pleuropneumoniae (APP) serovar 9 challenge in pigs.

Animals

Pigs of both sexes (male [neutered] and female) were obtained from a commercial pig breeder (Dalmandi Mezogazdasagi Zrt, 7211 Dalmand, Felszabadulas u. 42). Each pig was identified with a unique ear tag number and subjected to a veterinary inspection for compliance with the inclusion/exclusion criteria specified in the study protocol.

The source (herd) was free of APP and Mycoplasma. The piglets derived from sows that were not vaccinated against APP to avoid interference of maternally derived antibodies with the vaccination. Animals were free of clinical signs (dyspnea, coughing, diarrhea, lameness). Furthermore, animals were seronegative in the commercially available APP-ApxlV ELISA (IDEXX) before inclusion to the study. Piglets were fully developed, healthy without any dysfunctions and free of congenital malformations.

Animals were kept in a closed containment at the animal facilities at PROPHYL Ltd, Top. No.: 045/7,

Bar H-7711, Hungary). The pigs were fed (with shred - commercial mixture) ad libitum using manually filled dry feeder. Water of tap water quality was supplied via tap and nipple drinkers. All facilities were cleaned daily.

Study design

The efficacy induced by a vaccine containing 25 pg of each modified ApxIA, ApxllA (truncated) and ApxlllA formulated with Montanide ISA 201 VG (lot 36075M, Seppic) towards intranasal APP serovar 9 challenge was compared to the one induced by a registered APP vaccine (Porcilis ^® APP, MSD Animal Health, lot: A739A01) and a placebo group receiving PBS. An overview of groups and treatments is provided in Table 10.

Table 10: Overview of groups and treatment

At 42-45 days of age all pigs were intramuscularly vaccinated with 2.0 ml of the respective vaccine according to treatment group (study day 0). 28 days later the pigs received a 2 ^nd vaccination with the respective vaccine (study day 28) using intramuscular route. Two weeks after 2 ^nd vaccination an intranasal challenge with an APP serovar 9 (5xl0 ⁷ CFU/pig) was administered to all animals (study day 42).

Clinical examination was conducted daily for 7 days, starting at the day of challenge. Each of the examinations resulted in a score depending on the clinical observations and in accordance with table 11. Clinical scores are accumulated for each animal over time and the mean score per group over the complete observation period was calculated. For statistical analysis results of Clinical scores were analyzed using Kruskal-Wallis test and Dunn ^' s multiple comparison test. The data of each group were compared to the corresponding data of the placebo group (group 3). A p-value less or equal 0.05 was considered as significant. Results are shown in figure 8. The results for survival of animals after challenge are shown in figure 9. Table 11: Score for clinical examination

7 days after challenge all remaining animals were humanly euthanized and subjected to post-mortem examination. Lungs of all animals were subjected to necropsy to observe lesions caused by APP. Evaluation of lungs were done in accordance with the scoring system provided in table 12. Lung lesions were scored as from 0 to 5 per lobe according to percentage of consolidated lung masses. Results of lung scoring were expressed as cumulated lung scores (range 0 to 35) for each pig. Cumulated lung scores were analyzed using Kruskal-Wallis test and Dunn ^' s multiple comparison test. The data of each group were compared to the corresponding data of the placebo group (group 3). A p- value less or equal 0.05 was considered as significant. Results are shown in figure 10.

Table 12: Evaluation of lung lesions