BOSANAC TODD (US)
BREARLEY ANDREW SIMON (GB)
DEVRAJ RAJESH (US)
HUGHES ROBERT OWEN (US)
WO2006017844A1 | 2006-02-16 |
US9328104B2 | 2016-05-03 | |||
US8835458B2 | 2014-09-16 | |||
US9192610B2 | 2015-11-24 |
Claims 1. A compound of Formula I: I or a pharmaceutically acceptable salt thereof, wherein: X is N or C-Rx; Rx is selected from the group consisting of hydrogen, halogen, and optionally substituted C1-6 aliphatic; Ra is selected from the group consisting of hydrogen, halogen, CN, CF3, C1-3 aliphatic, and – C(O)N(Ra*)2; Ra* is selected from hydrogen and C1-3 aliphatic; R1 is selected from the group consisting of hydrogen, halogen, N(R)2, OR, C1-6 aliphatic, a 3- to 7-membered monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 7- to 8-membered bridged bicyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein each of C1-6 aliphatic, monocyclic or bridged bicyclic heterocyclic ring, and heteroaryl ring is optionally substituted with 1-3 R1* groups; R1* is selected from oxo, halogen, N(R)2, OR, C(O)R, S(O)2R, C(O)OR, C(O)N(R)2, optionally substituted C1-6 aliphatic, and an optionally substituted 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R is selected from the group consisting of hydrogen, an optionally substituted C1-6 aliphatic, and an optionally substituted 3- to 7-membered saturated monocyclic ring having 0-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or: two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 6-membered heterocyclic ring containing 0-1 additional heteroatom selected from nitrogen, oxygen, or sulfur; R2 is selected from the group consisting of hydrogen, halogen, S(O)2R, C(O)OR, C(O)N(R)2, and an optionally substituted group selected from C1-6 aliphatic, a 3- to 7-membered heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and R3 is selected from the group consisting of hydrogen, halogen, CN, CF3, C1-3 aliphatic, and – C(O)N(Ra*)2. 2. The compound according to claim 1, wherein Ra is CN. 3. The compound according to claim 2, wherein the compound is a compound of Formula I- a or I-b: or a pharmaceutically acceptable salt thereof. . 4. The compound according to claim 3, wherein Rx is halogen. 5. The compound according to claim 3, wherein Rx is hydrogen. 6. The compound according to claim 5, wherein the compound is a compound of Formula I- c: or a pharmaceutically acceptable salt t 7. The compound according to any one of claims 1-6, wherein R1 is selected from 8. The compound according to any one of claims 1-6, wherein R1 is N(R)2. 9. The compound according to claim 8, wherein each R is hydrogen. 10. The compound according to claim 8, wherein each R is –CH3. 11. The compound according to claim 8, wherein R1 is –NHCH3. 12. The compound according to claim 8, wherein R 13. The compound according to claim 8, wherein R1 is 14. The compound according to any one of claims 1-6, wherein R1 is -OR. 15. The compound according to claim 14, wherein R is hydrogen. 16. The compound according to claim 14, wherein R is –CH3. 17. The compound according to any one of claims, 1-16, wherein R2 is halogen. 18. The compound according to claim 17, wherein R2 is chloro. 19. The compound according to claim 17, wherein R2 is bromo. 20. The compound according to claim 17, wherein R2 is fluoro. 21. The compound according to any one of claims, 1-20, wherein R2 is –CH3. 22. The compound according to any one of claims, 1-20, wherein R2 is hydrogen. 23. The compound according to any one of claims, 1-22, wherein R3 is hydrogen. 24. The compound according to any one of claims, 1-22, wherein R3 is halogen. 25. The compound according to claim 24, wherein R3 is chloro. |
[0088] In some embodiments, R 1 is OR. In some embodiments, R 1 is OR, wherein R is optionally substituted C 1-6 aliphatic. In some such embodiments, R 1 is OCH 3 . [0089] In some embodiments, R 1 is C 1-6 aliphatic optionally substituted with 1-3 R 1* groups. In some such embodiments, R 1 is cyclopropyl. [0090] In some embodiments, R 1 is a 3- to 7-membered monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-3 R 1* groups. In some embodiments, R 1 is a 4- membered monocyclic heterocyclic ring having 1 heteroatom independently selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1 R 1* group. In some embodiments, R 1 is or [0091] In some embodiments, s a -membe e o ocyclic heterocyclic ring having 1- 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-3 R 1* groups. In some embodiments, R 1 is a 5-membered monocyclic heterocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-2 R 1* groups. In some embodiments, R 1 is a 5-membered monocyclic heterocyclic ring having 1 nitrogen atom, wherein the heterocyclic ring is optionally substituted with 1 R 1* group. In some embodiments, R 1 is selected from [0092] In some embodiments, R 1 is a 6-membered monocyclic heterocyclic ring having 1- 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-3 R 1* groups. In some embodiments, R 1 is a 6-membered monocyclic heterocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-2 R 1* groups. In some embodiments, R 1 is a 6-membered monocyclic heterocyclic ring having 2 heteroatoms selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-2 R 1* groups. [0093] In some embodiments, R 1 is selected from [0094] In some embodiments, R 1 is a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heteroaryl ring is optionally substituted with 1-3 R 1* groups. In some embodiments, R 1 is a 5-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heteroaryl ring is optionally substituted with 1-3 R 1* groups. In some embodiments, R 1 is a 5-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heteroaryl ring is optionally substituted with 1-2 R 1* groups. In some embodiments R 1 is selected from [0095] In some embodiments, R 1 is a 6-membered heteroaryl ring having 1-2 nitrogen atoms, wherein the heteroaryl ring is optionally substituted with 1-3 R 1* groups. In some embodiments, R 1 is [0096] In some embodiments, R 1 is a 7- to 8-membered bridged bicyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the bridged bicyclic heterocyclic ring is optionally substituted with 1-3 R 1* groups. In some embodiments, R 1 is a 7- to 8-membered bridged bicyclic heterocyclic ring having 1-2 nitrogen atoms, wherein the bridged bicyclic heterocyclic ring is optionally substituted with 1-2 R 1* groups. [0097] In some embodiments, R 1 is selected from [0098] As defined generally above, R 1* is selected from oxo, halogen, N(R) 2 , OR, C(O)R, S(O) 2 R, C(O)OR, C(O)N(R) 2 , optionally substituted C 1-6 aliphatic, and an optionally substituted 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R 1* is oxo. In some embodiments, R 1* is optionally substituted C 1-6 aliphatic. In some such embodiments, R 1* is -CH3 or -CH 2 CH 3 . In some embodiments, R 1* is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 OR°. In some such embodiments, R° hydrogen. Accordingly, in some such embodiments, R 1* is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 OH. In some embodiments, R 1* is –CH 2 OH. [0099] In some embodiments, R 1* is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0- 4 C(O)N(R°) 2 . In some such embodiments, R° hydrogen. Accordingly, in some such embodiments, R 1* is C 1-6 aliphatic optionally substituted with –(CH 2 )0-4C(O)NH2. In some embodiments, R 1* is –CH 2 CH 2 C(O)NH 2 . [0100] In some embodiments, R 1* is N(R) 2 . In some such embodiments, R is selected from hydrogen and optionally substituted C 1-6 aliphatic. In some embodiments, R 1* is NH2. In some embodiments, R 1* is NHR, wherein R is optionally substituted C 1-6 aliphatic. In some embodiments, R 1* is NHR, wherein R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 OR°. In some such embodiments, R° hydrogen. Accordingly, in some such embodiments, R 1* is NHR, wherein R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 OH. In some embodiments, R 1* is –NHCH 2 CH 2 OH. [0101] In some embodiments, R 1* is –OR. In some such embodiments, R is hydrogen or optionally substituted C 1-6 aliphatic. In some embodiments, R 1* is -OH or -OCH 3 . [0102] In some embodiments, R 1* is C(O)N(R) 2 . In some such embodiments, each R is selected from hydrogen and optionally substituted C 1-6 aliphatic. In some embodiments, R 1* is selected from –C(O)NH 2 , -C(O)NHCH 3 , and C(O)N(CH 3 )2. [0103] In some embodiments, R 1* is C(O)R. In some such embodiments, R is optionally substituted C 1-6 aliphatic. In some embodiments, R 1* is –C(O)CH 3 . [0104] In some embodiments, R 1* is S(O) 2 R. In some such embodiments, R is optionally substituted C 1-6 aliphatic. In some embodiments, R 1* is –S(O) 2 CH 3 . [0105] In some embodiments, R 1* is an optionally substituted 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R 1* is an optionally substituted 5-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R 1* is an optionally substituted 5-membered heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R 1* is [0106] In some embodiments, R 1* is selected from oxo, -CH 3 , -CH 2 CH 3 , -CH 2 OH, - CH 2 CH 2 C(O)NH 2 , -OH, -OCH 3 , –NH 2 , –NHCH 2 CH 2 OH, –C(O)NH 2 , -C(O)NHCH 3 , [ s e ne genera y a ove, s se ected from the group consisting of hydrogen, , optionally substituted C 1-6 aliphatic, and an optionally substituted 3- to 7-membered saturated monocyclic ring having 0-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or: two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 6-membered heterocyclic ring containing 0-1 additional heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, R is hydrogen. In some embodiments, R is optionally substituted C 1-6 aliphatic or an optionally substituted 3- to 7-membered saturated monocyclic ring having 0-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. or: two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 6-membered heterocyclic ring containing 0-1 additional heteroatom selected from nitrogen, oxygen, or sulfur. [0108] In some embodiments, R is hydrogen or C 1-6 aliphatic. In some such embodiments, R is hydrogen or –CH 3 . In some embodiments, R is hydrogen or optionally substituted C 1-6 aliphatic. [0109] In some embodiments, R is C 1-6 aliphatic. In some embodiments, R is –CH3. In some embodiments, R is cyclopropyl. [0110] In some embodiments, R is C 1-6 aliphatic optionally substituted with a group selected from –(CH 2 )0-4R°, –(CH 2 )0-4OR°,–(CH 2 )0-4C(O)N(R°)2, and –(CH 2 )0-4N(R°)C(O)N(R°)2. In some such embodiments, R° is selected from hydrogen, C 1-6 aliphatic, a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8- to 10-membered bicyclic aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R° is substituted with a group selected from –(CH 2 ) 0–2 R o , –(CH 2 ) 0–2 OH, –(CH 2 ) 0–2 O R ● , and –(CH 2 ) 0–2 C(O)NH 2 , wherein R ● is C 1–4 aliphatic. [0111] In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is C1–6 aliphatic, a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8- to 10- membered bicyclic aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. [0112] In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is a 5-membered heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is a 5- membered heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is a 5-membered heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, wherein R° is substituted with –(CH 2 )0–2R ^ . In some embodiments, R is C 1-6 aliphatic optionally substituted with [0113] In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is a 6-membered heteroaryl ring having 1-2 nitrogen atoms. In some embodiments, R is C 1-6 aliphatic optionally substituted with . [0114] In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 )0-4R°, wherein R° is a 5- to 6-membered saturated ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is a 6-membered saturated ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is a 6-membered saturated ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, wherein R° is substituted with –(CH 2 ) 0–2 R ^ . In some embodiments, R is C 1-6 aliphatic optionally substituted with [0115] In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is phenyl. In some such embodiments, R° is substituted with –(CH 2 ) 0–2 C(O)NH 2 . In some embodiments, R is C 1-6 aliphatic optionally substituted w [0116] In some embodiments, R is C 1-6 aliphatic optio nally substituted with –(CH 2 )0-4R°, wherein R° is an 8- to 10-membered bicyclic aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 R°, wherein R° is a 9-membered bicyclic aryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some such embodiments, R° is substituted with –(CH 2 )0–2R ^ . In some embodiments, R is C 1-6 aliphatic optionally s [0117] In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 OR°, wherein R° is hydrogen or C1–6 aliphatic. In some embodiments, R is C 1-6 aliphatic optionally substituted with –OR°, wherein R° is hydrogen or C1–6 aliphatic. In some embodiments, R is C 1-6 aliphatic optionally substituted with –OH. [0118] In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0- 4C(O)N(R°)2. In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 )0- 4C(O)N(R°)2, wherein R° is hydrogen or C1–6 aliphatic. In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 C(O)N(R°) 2 , wherein R° is hydrogen or C 1–6 aliphatic optionally substituted with –(CH 2 )0–2OR ^ . In some embodiments, R is C 1-6 aliphatic optionally substituted with –C(O)N(R°)2, wherein R° is hydrogen or C1–6 aliphatic optionally substituted with –(CH 2 ) 0–2 OR ^ . In some embodiments, R is C 1-6 aliphatic optionally substituted with – C(O)NHCH 2 CH 2 OCH3. In some embodiments, R is C 1-6 aliphatic optionally substituted with – C(O)NHCH3. [0119] In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0- 4 N(R°)C(O)N(R°) 2 . In some embodiments, R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0- 4N(R°)C(O)N(R°)2, wherein R° is hydrogen or C1–6 aliphatic. In some embodiments, R is C 1-6 aliphatic optionally substituted with –NHC(O)N(CH 3 ) 2 . [0120] In some embodiments, R is C 1-6 aliphatic optionally substituted with –OH and a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is C 1-6 aliphatic optionally substituted with –OH and –(CH 2 ) 0-4 C(O)N(R°) 2 . [0121] In some embodiments, R is an optionally substituted 3- to 7-membered saturated monocyclic ring having 0-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is a 7-membered saturated monocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur. In some such embodiments, R is substituted on a carbon atom with =O. In some embodiments, R [0122] In some embodiments, R is an optionally substituted 3- to 7-membered saturated monocyclic ring having 0-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is a 6-membered saturated monocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur. In some such embodiments, R is substituted with –(CH 2 ) 0-4 C(O)NR° 2 . In some embodiments, R is a 6-membered saturated monocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur, substituted with –C(O)NH 2 . In some embodiments, [0123] In some embodiments, R is a 6-membered saturated monocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur, wherein R is substituted with –(CH 2 ) 0-4 R°. In some such embodiments, R° is C 1-6 aliphatic substituted with –(CH 2 ) 0-2 R ● , wherein R ● is a 3- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is [0124] In some embodiments, R is a 5-membered saturated monocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur. In some such embodiments, R is substituted with =O and –(CH 2 ) 0-4 R°. In some embodiments, R [0125] In some embodiments, R is selected from hy drogen, C 1-6 aliphatic optionally substituted with one or more groups selected from –OH, –NHC(O)N(CH 3 ) 2 , –C(O)NHCH 3 , –
[0126] In some embodiments, R 1 is selected from the group consisting of hydrogen, halogen, -NH 2 , -OCH 3 ,
[0127] As defined generally above, R 2 is selected from the group consisting of hydrogen, halogen, S(O) 2 R, C(O)OR, C(O)N(R) 2 , and an optionally substituted group selected from C 1-6 aliphatic, a 3- to 7-membered heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R 2 is hydrogen. In some embodiments, R 2 is selected from the group consisting of halogen, S(O) 2 R, C(O)OR, C(O)N(R) 2 , and an optionally substituted group selected from C 1-6 aliphatic, a 3- to 7-membered heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [0128] In some embodiments, R 2 is halogen. In some such embodiments, R 2 is fluoro, chloro or bromo. [0129] In some embodiments, R 2 is optionally substituted C 1-6 aliphatic. In some such embodiments, R 2 is -CH 3 or -CH 2 CH 3 . In some embodiments, R 2 is cyclopropyl. In some embodiments, R 2 is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 OR°. In some such embodiments, R° is hydrogen. Accordingly, in some embodiments, R 2 is C 1-6 aliphatic optionally substituted with –(CH 2 )0-4OH. In some embodiments, R 2 is –C(OH)(CH3)2. [0130] In some embodiments, R 2 is C(O)OR. In some such embodiments, R is hydrogen. Accordingly, in some embodiments, R 2 is C(O)OH. [0131] In some embodiments, R 2 is S(O) 2 R. In some such embodiments, R is optionally substituted C 1-6 aliphatic. In some embodiments, R2 is –S(O) 2 CH 3 . [0132] In some embodiments, R 2 is C(O)N(R) 2 . In some such embodiments, each R is selected from hydrogen and optionally substituted C 1-6 aliphatic. In some embodiments, R 2 is C(O)NH 2 . In some embodiments, R 2 is C(O)NHR, wherein R is optionally substituted C 1-6 aliphatic. In some embodiments, R 2 is C(O)NHR, wherein R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 OR°. In some embodiments, R 2 is C(O)NHR, wherein R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 OR° and R° is hydrogen. In some embodiments, R 2 is C(O)NHR, wherein R is C 1-6 aliphatic optionally substituted with –(CH 2 ) 0-4 OH. In some embodiments, R 2 is –C(O)NHCH 2 CH 2 OH. [0133] In some embodiments, R 2 is C(O)N(R) 2 , wherein two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 6-membered heterocyclic ring containing 0-1 additional heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, R 2 is C(O)N(R) 2 , wherein two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 6-membered heterocyclic ring containing 0-1 additional heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, [0134] I n some embodiments, R 2 is an optionally substituted 3- to 7-membered heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R2 is a 4- to 6-membered heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R 2 is a 4- membered heterocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur. In some such embodiments, R 2 is oxetanyl. In some embodiments, R 2 is a 5-membered heterocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur. In some such embodiments, R 2 is tetrahydrofuranyl. In some embodiments, R 2 is a 6-membered heterocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur. In some such embodiments, R 2 is morpholinyl. [0135] In some embodiments, R 2 is an optionally substituted 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R 2 is a 5-membered heteroaryl ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R 2 is pyrazolyl. In some such embodiments, R 2 is 3-methyl-1H-pyrazol-4-yl. In some embodiments, R 2 is 1-methyl-1H-pyrazol- 4-yl. In some embodiments, R 2 is 1H-pyrazol-4-yl. [0136] In some embodiments, R 2 is an optionally substituted 6-membered heteroaryl ring having 1-3 nitrogen atoms. In some embodiments, R 2 is pyridin-3-yl. In some embodiments, R 2 is 2-methyl-pyridin-3-yl. [0137] In some embodiments, R 2 is selected from the group consisting of hydrogen, halogen, -CH 3 , CH 2 CH 3 , cyclopropyl, -C(OH)(CH 3 ) 2 , -C(O)OH, -S(O) 2 CH 3 , -C(O)NH 2 , - C(O)NHCH 3 , -C(O)N(CH 3 ) 2 , –C(O)NHCH 2 CH 2 OH, or a group selected from [0138] As defined generally above, R 3 is selected from the group consisting of hydrogen, halogen, CN, CF 3 , C 1-3 aliphatic, and –C(O)N(R a* ) 2 . In some embodiments, R 3 is hydrogen. In some embodiments, R 3 is halogen, CN, CF 3 , C 1-3 aliphatic, and –C(O)N(R a* ) 2 . In some embodiments, R 3 is halogen. In some such embodiments, R 3 is fluoro or chloro. [0139] In some embodiments, R 3 is CN. In some embodiments, R 3 is CF3. In some embodiments, R 3 is C 1-3 aliphatic. In some such embodiments, R 3 is –CH 3 , -CH 2 CH 3 , -CH(CH 3 ) 2 , or cyclopropyl. In some embodiments, R 3 is –C(O)N(R a* ) 2 . In some embodiments, R 3 is – C(O)NH 2 . In some embodiments, R 3 is –C(O)NHCH 3 . In some embodiments, R 3 is – C(O)N(CH 3 ) 2 . [0140] In some embodiments of Formulae I-a, I-b, and I-c, R 3 is hydrogen. Accordingly, in some embodiments, the present disclosure provides a compound of Formula I-a-i, I-b-i, and I- c-i: or a pharmaceutically acceptable salt thereof, wherein each of R 1 , R 2 , and R x is as defined above and described in classes and subclasses herein. [0141] In some embodiments of Formulae I-a-i, I-b-i, and I-c-i, R 2 is chloro. Accordingly, in some embodiments, the present disclosure provides a compound of Formula I-a-ii, I-b-ii, and I-c-ii: I-a-ii I-b-ii I-c-ii or a pharmaceutically acceptable salt thereof, wherein each of R 1 and R x is as defined above and described in classes and subclasses herein. [0142] In some embodiments, a compound of Formula I is selected from:
[0143] In some embodiments, the present disclosure provides compounds having a structure as set forth in Formula II: or a pharmaceutically acceptable salt the , X is N or C-R x ; R x is selected from the group consisting of hydrogen, halogen, and optionally substituted C 1-6 aliphatic; R 1 is selected from the group consisting of a 3- to 7-membered monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5- to 6- membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 7- to 8-membered bridged bicyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein each of C 1-6 aliphatic, monocyclic or bridged bicyclic heterocyclic ring, and heteroaryl ring is optionally substituted with 1-3 R 1* groups; R 1* is selected from oxo, halogen, N(R) 2 , OR, C(O)R, S(O) 2 R, C(O)OR, C(O)N(R) 2 , and C 1-6 aliphatic; R is selected from the group consisting of hydrogen and optionally substituted C 1-6 aliphatic, or: two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 6-membered heterocyclic ring containing 0-1 additional heteroatom selected from nitrogen, oxygen, or sulfur; R 2 is selected from the group consisting of hydrogen, halogen, S(O) 2 R, C(O)OR, C(O)N(R) 2 , and an optionally substituted group selected from C 1-6 aliphatic, a 3- to 7-membered heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and R 3 is selected from the group consisting of hydrogen, halogen, CN, CF3, C 1-3 aliphatic, and – C(O)N(R a* ) 2 . [0144] In some embodiments, the present disclosure provides compounds having a structure as set forth in Formulae II-a, II-b, and II-c: -a - -c or a pharmaceutically acceptable salt thereof, wherein each of R 1 , R 2 , R 3 , and R x is as defined above for Formula II and as described in classes herein, supra. Enumerated Embodiments. [0145] Embodiment 1. A compound of Formula I: I or a pharmaceutically acceptable salt thereof, wherein: X is N or C-R x ; R x is selected from the group consisting of hydrogen, halogen, and optionally substituted C 1-6 aliphatic; R a is selected from the group consisting of hydrogen, halogen, CN, CF 3 , C 1-3 aliphatic, and – C(O)N(R a* ) 2 ; R a* is selected from hydrogen and C 1-3 aliphatic; R 1 is selected from the group consisting of hydrogen, halogen, N(R) 2 , OR, C 1-6 aliphatic, a 3- to 7-membered monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 7- to 8-membered bridged bicyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein each of C 1-6 aliphatic, monocyclic or bridged bicyclic heterocyclic ring, and heteroaryl ring is optionally substituted with 1-3 R 1* groups; R 1* is selected from oxo, halogen, N(R) 2 , OR, C(O)R, S(O) 2 R, C(O)OR, C(O)N(R) 2 , optionally substituted C 1-6 aliphatic, and an optionally substituted 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R is selected from the group consisting of hydrogen, an optionally substituted C 1-6 aliphatic, and an optionally substituted 3- to 7-membered saturated monocyclic ring having 0-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or: two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 6-membered heterocyclic ring containing 0-1 additional heteroatom selected from nitrogen, oxygen, or sulfur; R 2 is selected from the group consisting of hydrogen, halogen, S(O) 2 R, C(O)OR, C(O)N(R) 2 , and an optionally substituted group selected from C 1-6 aliphatic, a 3- to 7-membered heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and R 3 is selected from the group consisting of hydrogen, halogen, CN, CF 3 , C 1-3 aliphatic, and – C(O)N(R a* )2. [0146] Embodiment 2. The compound according to embodiment 1, wherein R a is CN. [0147] Embodiment 3. The compound according to embodiment 2, wherein the compound is a compound of Formula I-a or I-b: I-a I-b or a pharmaceutically acceptable salt thereof. . [0148] Embodiment 4. The compound according to embodiment 3, wherein R x is halogen. [0149] Embodiment 5. The compound according to embodiment 3, wherein R x is hydrogen. [0150] Embodiment 6. The compound according to embodiment 5, wherein the compound is a compound of Formula I-c: or a pharmaceutically acceptable salt ther eo . [0151] Embodiment 7. The compound according to any one of embodiments 1-6, wherein R 1 is a 3- to 7-membered monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-3 R 1* groups. [0152] Embodiment 8. The compound according to embodiment 7, wherein R 1 is a 5- membered monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-3 R 1* groups. [0153] Embodiment 9. The compound according to embodiment 8, wherein R 1 is a 5- membered monocyclic heterocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-2 R 1* groups. [0154] Embodiment 10. The compound according to embodiment 9, wherein R 1 is a 5- membered monocyclic heterocyclic ring having 1 nitrogen atom, wherein the heterocyclic ring is optionally substituted with 1 R 1* group. [0155] Embodiment 11. The compound according to embodiment 10, wherein R 1 is selected from [0156] Embodiment 12. The compound according to embodiment 7, wherein, R 1 is a 6- membered monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-3 R 1* groups. [0157] Embodiment 13. The compound according to embodiment 12, wherein R 1 is a 6- membered monocyclic heterocyclic ring having 1 heteroatom selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-2 R 1* groups. [0158] Embodiment 14. The compound according to embodiment 13, wherein R 1 is a 6- membered monocyclic heterocyclic ring having 2 heteroatoms selected from nitrogen, oxygen, and sulfur, wherein the heterocyclic ring is optionally substituted with 1-2 R 1* groups. [0159] Embodiment 15. The compound according to embodiment 14, wherein R 1 is selected from
[0160] Embodiment 16. The compound according to any one of embodiments 1-6, wherein R 1 is a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heteroaryl ring is optionally substituted with 1-3 R 1* groups. [0161] Embodiment 17. The compound according to embodiment 16, wherein R 1 is a 5- membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heteroaryl ring is optionally substituted with 1-3 R 1* groups. [0162] Embodiment 18. The compound according to embodiment 17, wherein R 1 is a 5- membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the heteroaryl ring is optionally substituted with 1-2 R 1* groups. [0163] Embodiment 19. The compound according to embodiment 18, wherein R 1 is selected from [0164] Embodiment 20. The compound according to embodiment 16, wherein R 1 is a 6- membered heteroaryl ring having 1-2 nitrogen atoms, wherein the heteroaryl ring is optionally substituted with 1-3 R 1* groups. [0165] Embodiment 21. The compound according to embodiment 20, wherein R 1 is [ 0 66] mbodiment 22. The compound according to any one of embodiments 1-6, wherein R 1 is a 7- to 8-membered bridged bicyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the bridged bicyclic heterocyclic ring is optionally substituted with 1-3 R 1* groups. [0167] Embodiment 23. The compound according to embodiment 22, wherein R 1 is a 7- to 8-membered bridged bicyclic heterocyclic ring having 1-2 nitrogen atoms, wherein the bridged bicyclic heterocyclic ring is optionally substituted with 1-2 R 1* groups. [0168] Embodiment 24. The compound according to embodiment 23, wherein R 1 is selected from [0169] Embodiment 25. The compound according to any one of embodiments 7-24, wherein R 1* is N(R) 2 . [0170] Embodiment 26. The compound according to any one of embodiments 7-24, wherein R 1* is C(O)N(R) 2 . [0171] Embodiment 27. The compound according to any one of embodiments 7-24, wherein R 1* is OR. [0172] Embodiment 28. The compound according to any one of embodiments 7-24, wherein R 1* is C(O)R. [0173] Embodiment 29. The compound according to any one of embodiments 7-24, wherein R 1* is S(O) 2 R. [0174] Embodiment 30. The compound according to embodiments 25 or 26, wherein R is selected from hydrogen and optionally substituted C 1-6 aliphatic. [0175] Embodiment 31. The compound according to embodiment 30, wherein each R is hydrogen. [0176] Embodiment 32. The compound according to embodiment 30, wherein each R is –CH 3 . [0177] Embodiment 33. The compound according to embodiment 30, wherein one R is hydrogen and one R is optionally substituted C 1-6 aliphatic. [0178] Embodiment 34. The compound according to embodiment 27, wherein R is hydrogen. [0179] Embodiment 35. The compound according to any one of embodiments 27-29, wherein R is –CH 3 . [0180] Embodiment 36. The compound according to any one of embodiments 7-24, wherein R 1* is C 1-6 aliphatic. [0181] Embodiment 37. The compound according to embodiment 36, wherein R 1* is – CH 3 . [0182] Embodiment 38. The compound according to any one of embodiments 7-24, wherein R 1 is selected from
[0183] Embodiment 39. The compound according to any one of embodiments 1-6, wherein R 1 is N(R) 2 . [0184] Embodiment 40. The compound according to embodiment 39, wherein each R is hydrogen. [0185] Embodiment 41. The compound according to embodiment 39, wherein each R is –CH 3 . [0186] Embodiment 42. The compound according to embodiment 39, wherein R 1 is – NHCH 3 . [0187] Embodiment 43. The compound according to embodiment 39, wherein R 1 is . [0188] Embodiment 44. The compound according to embodiment 39, wherein R 1 is . [0189] Embodiment 45. The compound according to any one of embodiments 1-6, wherein R 1 is -OR. [0190] Embodiment 46. The compound according to embodiment 45, wherein R is hydrogen. [0191] Embodiment 47. The compound according to embodiment 45, wherein R is –CH 3 . [0192] Embodiment 48. The compound according to any one of embodiments, 1-47, wherein R 2 is halogen. [0193] Embodiment 49. The compound according to embodiment 48, wherein R 2 is chloro. [0194] Embodiment 50. The compound according to embodiment 48, wherein R 2 is bromo. [0195] Embodiment 51. The compound according to embodiment 48, wherein R 2 is fluoro. [0196] Embodiment 52. The compound according to any one of embodiments, 1-47, wherein R 2 is –CH 3 . [0197] Embodiment 53. The compound according to any one of embodiments, 1-47, wherein R 2 is hydrogen. [0198] Embodiment 54. The compound according to any one of embodiments, 1-53, wherein R 3 is hydrogen. [0199] Embodiment 54. The compound according to any one of embodiments, 1-53, wherein R 3 is halogen. [0200] Embodiment 55. The compound according to embodiment 54, wherein R 3 is chloro. [0201] Embodiment 56. The compound according to embodiment 55, wherein the compound a compound of Formula I-a-ii, I-b-ii, or I-c-ii: I-a-ii I-b-ii I-c-ii or a pharmaceutically acceptable salt thereof. [0202] Embodiment 57. The compound according to embodiment 1, wherein the compound is a compound of Formula II: II or a pharmaceutically acceptable salt thereof, wherein: X is N or C-R x ; R x is selected from the group consisting of hydrogen, halogen, and optionally substituted C 1-6 aliphatic; R 1 is selected from the group consisting of a 3- to 7-membered monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5- to 6- membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 7- to 8-membered bridged bicyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein each of C 1-6 aliphatic, monocyclic or bridged bicyclic heterocyclic ring, and heteroaryl ring is optionally substituted with 1-3 R 1* groups; R 1* is selected from oxo, halogen, N(R) 2 , OR, C(O)R, S(O) 2 R, C(O)OR, C(O)N(R) 2 , and C 1-6 aliphatic; R is selected from the group consisting of hydrogen and optionally substituted C 1-6 aliphatic, or: two R groups, together with the nitrogen atom to which they are attached, form an optionally substituted 3- to 6-membered heterocyclic ring containing 0-1 additional heteroatom selected from nitrogen, oxygen, or sulfur; R 2 is selected from the group consisting of hydrogen, halogen, S(O) 2 R, C(O)OR, C(O)N(R) 2 , and an optionally substituted group selected from C 1-6 aliphatic, a 3- to 7-membered heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5- to 6-membered heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and R 3 is selected from the group consisting of hydrogen, halogen, CN, CF 3 , C 1-3 aliphatic, and – C(O)N(R a* )2. [0203] Embodiment 58. The compound according to embodiment 57, wherein the compound is a compound of Formula II-a, II-b, or II-c: II-a II-b II-c or a pharmaceutically acceptable salt thereof. Compositions [0204] In some embodiments, a compound of Formula I or Formula II may be provided in a composition, e.g., in combination (e.g., admixture) with one or more other components. [0205] In some embodiments, the present disclosure provides compositions that comprise and/or deliver a compound of Formula I or Formula II, or an active metabolite thereof, e.g., when contacted with or otherwise administered to a system or environment e.g., which system or environment may include SARM1 NADase activity; in some embodiments, administration of such a composition to the system or environment achieves inhibition of SARM1 activity as described herein. [0206] In some embodiments, a provided composition as described herein may be a pharmaceutical composition in that it comprises an active agent and one or more pharmaceutically acceptable excipients; in some such embodiments, a provided pharmaceutical composition comprises and/or delivers a compound of Formula I or Formula II, or an active metabolite thereof to a relevant system or environment (e.g., to a subject in need thereof) as described herein. [0207] In some embodiments, one or more compounds of Formula I or Formula II is provided and/or utilized in a pharmaceutically acceptable salt form. [0208] Among other things, the present disclosure provides compositions comprising a compound of Formula I or Formula II, or a pharmaceutically acceptable salt or derivative thereof, and a pharmaceutically acceptable carrier, adjuvant, or vehicle. The amount of compound in provided compositions is such that is effective to measurably inhibit axonal degeneration in a biological sample or in a patient. In certain embodiments, a provided compound or composition is formulated for administration to a patient in need of such composition. The compounds and compositions, according to the methods of the present disclosure, may be administered using any amount and any route of administration effective for treating or lessening the severity of any disease or disorder described herein. Provided compounds are preferably formulated in dosage unit form for ease of administration and uniformity of dosage. The expression "dosage unit form" as used herein refers to a physically discrete unit of agent appropriate for the patient to be treated. It will be understood, however, that the total daily usage of the provided compounds and compositions will be decided by the attending physician within the scope of sound medical judgment. The specific effective dose level for any particular patient or organism will vary from subject to subject, depending on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed and its route of administration; the species, age, body weight, sex and diet of the patient; the general condition of the subject; the time of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed, and the like. [0209] Provided compositions may be administered orally, parenterally, by inhalation or nasal spray, topically (e.g., as by powders, ointments, or drops), rectally, buccally, intravaginally, intraperitoneally, intracisternally or via an implanted reservoir, depending on the severity of the condition being treated. Preferably, the compositions are administered orally, intraperitoneally or intravenously. In certain embodiments, provided compounds are administered orally or parenterally at dosage levels of about 0.01 mg/kg to about 50 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic effect. [0210] The term "parenteral" as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques. Sterile injectable forms of provided compositions may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non- toxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer’s solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. [0211] For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, such as carboxymethyl cellulose or similar dispersing agents that are commonly used in the formulation of pharmaceutically acceptable dosage forms including emulsions and suspensions. Other commonly used surfactants, such as Tweens, Spans and other emulsifying agents or bioavailability enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for the purposes of formulation. [0212] Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. [0213] In order to prolong the effect of a provided compound, it is often desirable to slow the absorption of the compound from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the compound then depends upon its rate of dissolution that, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form is accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of compound to polymer and the nature of the particular polymer employed, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues. [0214] Pharmaceutically acceptable compositions described herein may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, aqueous suspensions or solutions. In such solid dosage forms the active compound may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose.When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, flavoring or coloring agents may also be added. [0215] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar--agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and/or i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents. The active compounds can also be in micro-encapsulated form with one or more excipients as noted above. [0216] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings (i.e. buffering agents) and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. [0217] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. [0218] Alternatively, pharmaceutically acceptable compositions described herein may be administered in the form of suppositories for rectal or vaginal administration. These can be prepared by mixing the compounds of the present disclosure with suitable non-irritating excipients or carriers that are solid at room temperature but liquid at body (e.g. rectal or vaginal) temperature and therefore will melt in the rectum or vaginal cavity to release the active compound. Such materials include cocoa butter, a suppository wax (e.g., beeswax) and polyethylene glycols. [0219] Pharmaceutically acceptable compositions described herein may also be administered topically, especially when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, or the lower intestinal tract. Topical application for the lower intestinal tract can be effected in a rectal suppository formulation (see above) or in a suitable enema formulation. [0220] Dosage forms for topical or transdermal administration of a provided compound include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants or patches. The active component is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required. Ophthalmic formulations, ear drops, and eye drops are also contemplated as being within the scope of this disclosure. Additionally, the present disclosure contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms can be made by dissolving or dispensing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel. [0221] For topical applications, provided pharmaceutically acceptable compositions may be formulated in a suitable ointment containing the active component suspended or dissolved in one or more carriers. Carriers for topical administration of compounds of this disclosure include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compound, emulsifying wax and water. Alternatively, provided pharmaceutically acceptable compositions can be formulated in a suitable lotion or cream containing the active components suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water. [0222] For ophthalmic use, provided pharmaceutically acceptable compositions may be formulated as micronized suspensions in isotonic, pH adjusted sterile saline, or, preferably, as solutions in isotonic, pH adjusted sterile saline, either with or without a preservative such as benzylalkonium chloride. Alternatively, for ophthalmic uses, the pharmaceutically acceptable compositions may be formulated in an ointment such as petrolatum. [0223] Pharmaceutically acceptable compositions of this disclosure may also be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other conventional solubilizing or dispersing agents. [0224] Most preferably, pharmaceutically acceptable compositions of this disclosure are formulated for oral administration. Identification and/or Characterization of Compounds and/or Compositions [0225] Among other things, the present disclosure provides various technologies for identification and/or characterization of compounds and/or compositions as described herein. For example, the present disclosure provides various assays for assessing SARM1 inhibitory activity, and specifically for assessing SARM1 inhibitory activity. [0226] In some embodiments, performance of one or more compounds or compositions of interest in an assay as described herein is compared with that of an appropriate reference. For example, in some embodiments, a reference may be absence of the relevant compound or composition. Alternatively or additionally, in some embodiments, a reference may be presence of an alternative compound or composition, e.g., which alternative compound or composition has known performance (e.g., as a positive control or a negative control, as is understood in the art) in the relevant assay. In some embodiments, a reference may be an alternative but comparable set of conditions (e.g., temperature, pH, salt concentration, etc.). In some embodiments, a reference may be performance of the compound or composition with respect to a SARM1 variant. [0227] Still further alternatively or additionally, in some embodiments, performance of one or more compounds or compositions of interest in an assay as described herein may be assessed in the presence of an appropriate reference compound or composition, for example, so that ability of the compound or composition to compete with the reference is determined. [0228] In some embodiments, a plurality of compounds or compositions of interest may be subjected to analysis in a particular assay and/or compared with the same reference. In some embodiments, such a plurality of compounds or compositions may be or include a set of compounds or compositions that is considered to be a “library” because multiple members share one or more features (e.g., structural elements, source identity, synthetic similarities, etc.). [0229] Certain exemplary assays that may be useful in the practice of the present disclosure are exemplified in the Examples below. Those skilled in the art, reading the present disclosure, will be aware that useful or relevant systems for identifying and/or characterizing compounds and/or compositions in accordance with the present disclosure are not limited to those included in the Examples, or otherwise discussed below. [0230] In some embodiments, compounds and/or compositions may be identified based on and/or characterized by one or more activities or characteristics such as, for example: promoting axonal integrity, cytoskeletal stability, and/or neuronal survival. In some embodiments, provided SARM1 inhibitors inhibit catabolism of NAD+ to by SARM1. In some embodiments, provided SARM1 inhibitors slow the rate of NAD+ catabolism. [0231] In some embodiments, provided SARM1 inhibitors reduce or inhibit binding of NAD+ by SARM1. In some embodiments, provided SARM1 inhibitors bind to SARM1 within a pocket comprising one or more catalytic residues (e.g., a catalytic cleft of SARM1). Examples of such catalytic residues include the glutamic acid at position 642 (E642). [0232] In some embodiments, provided SARM1 inhibitors disrupt and/or prevent multimerization of the TIR1 domain of SARM1. In some embodiments, provided SARM1 inhibitors disrupt the multimerization of the SAM domains. In some embodiments, provided SARM1 inhibitors disrupt the axonal signaling cascade that leads to depletion of NAD+. [0233] In some embodiments, the present disclosure provides assays useful for identifying and/or characterizing one or more activities and/or characteristics of compound and/or compositions of interest. For example, in some embodiments, the present disclosure provides in vitro, cellular, and/or in vivo systems for assessing one or more such activities and/or characteristics. SARM1 Activity Assays [0234] In some embodiments, a method of identifying a SARM1 inhibitor comprises: a) providing a mixture comprising i) a mutant or fragment of SARM1, ii) NAD+ and iii) a candidate inhibitor, wherein the mutant or fragment has constitutive activity; b) incubating the mixture; c) quantifying NAD+ in the mixture after the incubating; and d) identifying the candidate inhibitor compound as an inhibitor if the amount of NAD+ is greater than that of a control mixture that does not contain the candidate inhibitor. [0235] In some embodiments, provided are methods of identifying a SARM1 inhibitor, comprising: a) providing a mixture comprising i) a full-length SARM1, ii) NAD+ and iii) a candidate inhibitor, wherein the full-length SARM1 has constitutive activity; b) incubating the mixture; c) quantifying NAD+ and ADPR (or cADPR) in the mixture after the incubating; d) determining the molar ratio of NAD+: ADPR (or cADPR); and e) identifying the candidate inhibitor compound as an inhibitor if the molar ratio is greater than that of a control mixture that does not contain the candidate inhibitor. [0236] In some embodiments, provided are methods of identifying a SARM1 inhibitor, comprising: a) providing a mixture comprising a solid support to which is bound i) a full-length SARM1 and at least one tag, ii) NAD+, and iii) a candidate inhibitor; b) incubating the mixture; c) quantifying the NAD+ after the incubating; and d) identifying the candidate inhibitor compound as a SARM1 inhibitor if the concentration of NAD+ is greater than that of a control. SARM1 Binding Assays [0237] In some embodiments, the efficacy of provided SARM1 inhibitors can be determined according to, e.g., the assays described in WO 2018/057989, published on March 29, 2018, which is hereby incorporated by reference in its entirety. In some embodiments, the provided SARM1 inhibitors can be applied to a solution containing SARM1 or a fragment thereof. In some embodiments, the provided SARM1 inhibitors can be applied to an in vitro system. In some embodiments, the provided SARM1 inhibitors can be applied to an in vivo. In some embodiments, the provided SARM1 inhibitors can be applied to a patient. In some embodiments, a SARM1 inhibitor can be mixed with SARM1 or fragment thereof that has been labeled with an epitope tag. In some embodiments, the amount of bound SARM1 inhibitor can be compared to the amount of unbound SARM1 inhibitor, yielding the affinity for the SARM1 inhibitor. [0238] In some embodiments, the mutant or fragment of SARM1 is a SAM-TIR fragment having constitutive activity. Fragments of SARM1 having constitutive activity include, for example and without limitation, a SARM1 with the autoinhibitory domain deleted; at least one point mutation of SARM1 that renders the autoinhibitory domain inactive; a fragment of SARM1 containing a TIR domain; or a fragment of SARM1 consisting of SAM and TIR domains. In some embodiments a SARM1 polypeptide can include one or more additional amino acid sequences that can act as tags, such as a His tag, a streptavidin tag, or a combination thereof. In some embodiments a SARM1 polypeptide can include a tag at the amino terminus, at the carboxy terminus, or a combination thereof. In some embodiments, SARM1 or fragment thereof labeled with an epitope tag can be used to measure the binding efficacy of provided SARM1 inhibitors. Purification of SARM1-TIR domains [0239] In some embodiments, a SARM1-TIR domain can be engineered with various protein, or epitope, tags that can be useful, for example, in purification. In some embodiments, the present disclosure also provides for a NRK1-HEK293T cell line comprising HEK293T cells transformed with a Nicotinamide Riboside Kinase 1 (NRK1). In some embodiments, HEK293T cells transformed or transfected with a DNA sequence encoding Nicotinamide Riboside Kinase 1 (NRK1). In some embodiments, the DNA encoding NRK1 can be genomic or cDNA. In some embodiments, HEK293T cells are stably or transiently transfected with DNA encoding NRK1 from a source exogenous to the host cell. In some embodiments, HEK293T cells are stably or transiently transfected with DNA encoding NRK1 such that the cells express NRK1 at an elevated level compared to control cells. In some embodiments, DNA encoding NRK1 is under the control of one or more exogenous regulatory DNA sequences such as a promoter, an enhancer or a combination thereof. In some embodiments, a combination of a DNA sequences encoding NRK1 and regulatory sequences is a non-naturally occurring combination. In some embodiments, DNA encoding NRK1, either genomic or cDNA, comprises an expression vector such as an FCIV expression vector. In some embodiments, DNA encoding NRK1 is derived from genomic DNA or cDNA from a vertebrate or invertebrate species such as, but not limited to, human, mouse, zebrafish or a Drosophila. In some configurations, the NRK1 DNA is a human NRK1 DNA. Applications and Uses [0240] The present disclosure provides a variety of uses and applications for compounds and/or compositions as described herein, for example in light of their activities and/or characteristics as described herein. In some embodiments, such uses may include therapeutic and/or diagnostic uses. Alternatively, in some embodiments such uses may include research, production, and/or other technological uses. [0241] In one aspect, the present disclosure provides methods comprising administering one or more compounds of Formula I or Formula II to a subject, e.g., to treat, prevent, or reduce the risk of developing one or more conditions characterized by axonal degeneration. In some such embodiments, the compound of Formula I or Formula II is a SARM1 inhibitor. [0242] Another embodiment of the present disclosure relates to a method of inhibiting SARM1 activity in a patient comprising steps of administering to said patient a provided compound, or a composition comprising said compound. [0243] Inhibition of enzymes in a biological sample is useful for a variety of purposes that are known to one of skill in the art. Examples of such purposes include, but are not limited to biological assays, gene expression studies, and biological target identification. [0244] In certain embodiments, the present disclosure relates to a method of treating axonal degeneration in a biological sample comprising the step of contacting said biological sample with a compound or composition of Formula I or Formula II. In some embodiments, one or more compounds and/or compositions as described herein are useful, for example as a method of for inhibiting the degradation of neurons derived from a subject. In some embodiments, one or more compounds and/or compositions as described herein, are useful for inhibiting the degeneration of a neuron, or portion thereof, cultured in vitro. In some embodiments, one or more compounds and/or compositions as described herein, are useful as stabilizing agents to promote in vitro neuronal survival. [0245] In some embodiments, provided compounds and/or compositions inhibit NADase activity of SARM1. Alternatively or additionally, in some embodiments, provided compounds alleviate one or more attributes of neurodegeneration. In some embodiments, the present disclosure provides methods of treating a neurodegenerative disease or disorder associated with axonal degeneration. [0246] In some embodiments, one or more compounds and/or compositions as described herein are useful, for example, in the practice of medicine. In some embodiments, one or more compounds and/or compositions as described herein are useful, for example, to treat, prevent, or ameliorate axonal degeneration (e.g., one or more features or characteristics thereof).In some embodiments, one or more compounds and/or compositions as described herein are useful, for example to inhibit axonal degeneration, including axonal degeneration that results from reduction or depletion of NAD+. In some embodiments, one or more compounds and/or compositions as described herein are useful, for example to prevent the axon distal to an axonal injury from degenerating. [0247] In some embodiments, one or more compounds and/or compositions as described herein are useful, for example as a method for inhibiting the degradation of a peripheral nervous system neuron or a portion thereof. In some embodiments, one or more compounds and/or compositions as described herein are useful, for example as a method for inhibiting or preventing degeneration of a central nervous system (neuron) or a portion thereof. In some embodiments, one or more compounds or compositions as described herein is characterized that, when administered to a population of subjects, reduces one or more symptoms or features of neurodegeneration. For example, in some embodiments, a relevant symptom or feature may be selected from the group consisting of extent, rate, and/or timing of neuronal disruption. [0248] In certain embodiments, the present disclosure provides compounds that are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents in accordance with the present disclosure. Compounds provided by this disclosure are also useful for the study of SARM1 activity in biological and pathological phenomena and the comparative evaluation of new SARM1 activity inhibitors in vitro or in vivo. In certain embodiments, the present disclosure provides assays for identifying and/or characterizing compounds and/or compositions provided herein. In some embodiments, provided assays utilize particular reagents and/or systems (e.g., certain vector constructs and/or polypeptides) useful in assaying SARM1 activity. For example, in some embodiments, provided assays may utilize, for example, a SAM- TIR in which the SARM1 N-terminal auto-inhibitory domain is deleted, and/or one or more tagged versions of a TIR domain. [0249] In some embodiments, one or more compounds and/or compositions as described herein are useful, for example as a method of for inhibiting the degradation of neurons derived from a subject. In some embodiments, one or more compounds and/or compositions as described herein, are useful for inhibiting the degeneration of a neuron, or portion thereof, cultured in vitro. In some embodiments, one or more compounds and/or compositions as described herein, are useful as stabilizing agents to promote in vitro neuronal survival. [0250] In some embodiments, one or more compounds and/or compositions as described herein are useful, for example in affecting biomarkers associated with neurodegeneration. In some embodiments, changes in biomarkers can be detected systemically or with a sample of cerebral spinal fluid (CSF), plasma, serum, and/or tissue from a subject. In some embodiments, one or more compounds and/or compositions can be used to affect a change in the concentration of neurofilament protein light (NF-L) and/or neurofilament protein heavy (NF-H) contained the cerebral spinal fluid of a subject. In some embodiments, one or more compounds and/or compositions as described herein can affect constitutive NAD and/or cADPR levels in neurons and/or axons. [0251] In some embodiments, one or more compounds and/or compositions as described herein can affect a detectable change in the levels of one or more neurodegeneration-associated proteins in a subject. Such proteins include, but are not limited to, albumin, amyloid-b (Ab)38, Ab40, Ab42, glial fibrillary acid protein (GFAP), heart-type fatty acid binding protein (hFABP), monocyte chemoattractin protein (MCP)-1, neurogranin, neuron specific enolayse (NSE), soluble amyloid precursor protein (sAPP)a, sAPPb, soluble triggering receptor expressed on myeloid cells (sTREM) 2, phospho-tau, and/or total-tau. In some embodiments, one or more compounds and/or compositions as described herein can affect a change in cytokines and/or chemokines, including, but not limited to, Ccl2, Ccl7, Ccl12, Csf1, and/or Il6. Diseases, Disorders, and Conditions [0252] In some embodiments, compounds and/or compositions as described herein may be administered to subjects suffering from one or more diseases, disorders, or conditions. [0253] In some embodiments, the condition is an acute condition. In some embodiments, the condition is a chronic condition. [0254] In some embodiments, the condition is characterized by axonal degeneration in the central nervous system, the peripheral nervous system, the optic nerve, the cranial nerves, or a combination thereof. [0255] In some embodiments, the condition is or comprises acute injury to the central nervous system, e.g., injury to the spinal cord and/or traumatic brain injury. In some embodiments, the condition is or comprises a chronic injury to the central nervous system, e.g., injury to the spinal cord, traumatic brain injury, and/or traumatic axonal injury. In some embodiments, the condition is or comprises chronic traumatic encephalopathy (CTE). [0256] In some embodiments, the condition is a chronic condition affecting the central nervous system, e.g., Parkinson’s disease, amyotrophic lateral sclerosis, multiple sclerosis, or Huntington disease, Alzheimer’s disease. [0257] In some embodiments, the condition is an acute peripheral neuropathy. Chemotherapy-induced peripheral neuropathy (CIPN) is an example of an acute peripheral neuropathy. CIPN can be associated with various drugs, such as, but not limited to, thalidomide, epothilones (e.g., ixabepilone), taxanes (e.g., paclitaxel and docetaxel), vinca alkaloids (e.g., vinblastine, vinorelbine, vincristine, and vindesine), proteasome inhibitors (e.g., bortezomib), platinum-based drugs (e.g., cisplatin, oxaliplatin, and carboplatin). [0258] In some embodiments, the condition is a chronic condition affecting the peripheral nervous system, e.g., diabetic neuropathy, HIV neuropathy, Charcot Marie Tooth disease, or amyotrophic lateral sclerosis. [0259] In some embodiments, the condition is an acute condition affecting the optic nerve, e.g., acute optic neuropathy (AON) or acute angle closure glaucoma. [0260] In some embodiments, the condition is a chronic condition affecting the optic nerve, e.g., Leber’s congenital amaurosis, Leber’s hereditary optic neuropathy, primary open angle glaucoma, and autosomal dominant optic atrophy. [0261] In some embodiments, one or more compounds and/or compositions as described herein are useful, for example, to treat one or more neurodegenerative diseases, disorders or conditions selected from the group consisting of neuropathies or axonopathies. In some embodiments, one or more compounds and/or compositions as described herein are useful, for example to treat a neuropathy or axonopathy associated with axonal degeneration. In some embodiments, a neuropathy associated with axonal degeneration is a hereditary or congenital neuropathy or axonopathy. In some embodiments, a neuropathy associated with axonal degeneration results from a de novo or somatic mutation. In some embodiments, a neuropathy associated with axonal degeneration is selected from a list contained herein. In some embodiments, a neuropathy or axonopathy is associated with axonal degeneration, including, but not limited to Parkinson’s disease, non-Parkinson’s disease, Alzheimer's disease, Herpes infection, diabetes, amyotrophic lateral sclerosis, a demyelinating disease, ischemia or stroke, chemical injury, thermal injury, and AIDS. [0262] In some embodiments, one or more compounds or compositions as described herein is characterized that, when administered to a population of subjects, reduces one or more symptoms or features of neurodegeneration. For example, in some embodiments, a relevant symptom or feature may be selected from the group consisting of extent, rate, and/or timing of neuronal disruption. In some embodiments, neuronal disruption may be or comprise axonal degradation, loss of synapses, loss of dendrites, loss of synaptic density, loss of dendritic arborization, loss of axonal branching, loss of neuronal density, loss of myelination, loss of neuronal cell bodies, loss of synaptic potentiation, loss of action-potential potentiation, loss of cytoskeletal stability, loss of axonal transport, loss of ion channel synthesis and turnover, loss of neurotransmitter synthesis, loss of neurotransmitter release and reuptake capabilities, loss of axon- potential propagation, neuronal hyperexitability, and/or neuronal hypoexcitability. In some embodiments, neuronal disruption is characterized by an inability to maintain an appropriate resting neuronal membrane potential. In some embodiments, neuronal disruption is characterized by the appearance of inclusion bodies, plaques, and/or neurofibrillary tangles. In some embodiments, neuronal disruption is characterized by the appearance of stress granules. In some embodiments, neuronal disruption is characterized by the intracellular activation of one or more members of the cysteine-aspartic protease (Caspase) family. In some embodiments, neuronal disruption is characterized by a neuron undergoing programed cell death (e.g. apoptosis, pyroptosis, ferroapoptosis, and/or necrosis) and/or inflammation. [0263] In some embodiments, the neurodegenerative or neurological disease or disorder is associated with axonal degeneration, axonal damage, axonopathy, a demyelinating disease, a central pontine myelinolysis, a nerve injury disease or disorder, a metabolic disease, a mitochondrial disease, metabolic axonal degeneration, axonal damage resulting from a leukoencephalopathy or a leukodystrophy. In some embodiments, the neurodegenerative or neurological disease or disorder is selected from the group consisting of spinal cord injury, stroke, multiple sclerosis, progressive multifocal leukoencephalopathy, congenital hypomyelination, encephalomyelitis, acute disseminated encephalomyelitis, central pontine myelolysis, osmotic hyponatremia, hypoxic demyelination, ischemic demyelination, adrenoleukodystrophy, Alexander's disease, Niemann-Pick disease, Pelizaeus Merzbacher disease, periventricular leukomalacia, globoid cell leukodystrophy (Krabbe's disease), Wallerian degeneration, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease), Huntington's disease, Alzheimer's disease, Parkinson's disease, Tay-Sacks disease, Gaucher's disease, Hurler Syndrome, traumatic brain injury, post radiation injury, neurologic complications of chemotherapy (chemotherapy induced neuropathy; CIPN), neuropathy, acute ischemic optic neuropathy, vitamin B12 deficiency, isolated vitamin E deficiency syndrome, Bassen-Kornzweig syndrome, Glaucoma, Leber's hereditary optic atrophy (neuropathy), Leber congenital amaurosis, neuromyelitis optica, metachromatic leukodystrophy, acute hemorrhagic leukoencephalitis, trigeminal neuralgia, Bell's palsy, cerebral ischemia, multiple system atrophy, traumatic glaucoma, tropical spastic paraparesis human T-lymphotropic virus 1 (HTLV-1) associated myelopathy, west Nile virus encephalopathy, La Crosse virus encephalitis, Bunyavirus encephalitis, pediatric viral encephalitis, essential tremor, Charcot-Marie-Tooth disease, motor neuron disease, spinal muscular atrophy (SMA), hereditary sensory and autonomic neuropathy (HSAN), adrenomyeloneuropathy, progressive supra nuclear palsy (PSP), Friedrich’s ataxia, hereditary ataxias, noise induced hearing loss, congenital hearing loss, Lewy Body Dementia, frontotemporal dementia, amyloidosis, diabetic neuropathy, HIV neuropathy, enteric neuropathies and axonopathies, Guillain-Barre syndrome, severe acute motor axonal neuropathy (AMAN), Creutzfeldt-Jakob disease, transmissible spongiform encephalopathy, spinocerebellar ataxias, pre- eclampsia, hereditary spastic paraplegias, spastic paraparesis, familial spastic paraplegia, French settlement disease, Strumpell-Lorrain disease, and non-alcoholic steatohepatitis (NASH). [0264] In some embodiments, the present disclosure provides inhibitors of SARM1 activity for treatment of neurodegenerative or neurological diseases or disorders that involve axon degeneration or axonopathy. The present disclosure also provides methods of using inhibitors of SARM1 activity to treat, prevent or ameliorate axonal degeneration, axonopathies and neurodegenerative or neurological diseases or disorders that involve axonal degeneration. [0265] In some embodiments, the present disclosure provides methods of treating neurodegenerative or neurological diseases or disorders related to axonal degeneration, axonal damage, axonopathies, demyelinating diseases, central pontine myelinolysis, nerve injury diseases or disorders, metabolic diseases, mitochondrial diseases, metabolic axonal degeneration, axonal damage resulting from a leukoencephalopathy or a leukodystrophy. [0266] In some embodiments, neuropathies and axonopathies include any disease or condition involving neurons and/or supporting cells, such as for example, glia, muscle cells or fibroblasts, and, in particular, those diseases or conditions involving axonal damage. Axonal damage can be caused by traumatic injury or by non-mechanical injury due to diseases, conditions, or exposure to toxic molecules or drugs. The result of such damage can be degeneration or dysfunction of the axon and loss of functional neuronal activity. Disease and conditions producing or associated with such axonal damage are among a large number of neuropathic diseases and conditions. Such neuropathies can include peripheral neuropathies, central neuropathies, and combinations thereof. Furthermore, peripheral neuropathic manifestations can be produced by diseases focused primarily in the central nervous systems and central nervous system manifestations can be produced by essentially peripheral or systemic diseases. [0267] In some embodiments, a peripheral neuropathy can involve damage to the peripheral nerves, and/or can be caused by diseases of the nerves or as the result of systemic illnesses. Some such diseases can include diabetes, uremia, infectious diseases such as AIDs or leprosy, nutritional deficiencies, vascular or collagen disorders such as atherosclerosis, and autoimmune diseases such as systemic lupus erythematosus, scleroderma, sarcoidosis, rheumatoid arthritis, and polyarteritis nodosa. In some embodiments, peripheral nerve degeneration results from traumatic (mechanical) damage to nerves as well as chemical or thermal damage to nerves. Such conditions that injure peripheral nerves include compression or entrapment injuries such as glaucoma, carpal tunnel syndrome, direct trauma, penetrating injuries, contusions, fracture or dislocated bones; pressure involving superficial nerves (ulna, radial, or peroneal) which can result from prolonged use of crutches or staying in one position for too long, or from a tumor; intraneural hemorrhage; ischemia; exposure to cold or radiation or certain medicines or toxic substances such as herbicides or pesticides. In particular, the nerve damage can result from chemical injury due to a cytotoxic anticancer agent such as, for example, taxol, cisplatinin, a proteasome inhibitor, or a vinca alkaloid such as vincristine. Typical symptoms of such peripheral neuropathies include weakness, numbness, paresthesia (abnormal sensations such as burning, tickling, pricking or tingling) and pain in the arms, hands, legs and/or feet. In some embodiments, a neuropathy is associated with mitochondrial dysfunction. Such neuropathies can exhibit decreased energy levels, i.e., decreased levels of NAD and ATP. [0268] In some embodiments, peripheral neuropathy is a metabolic and endocrine neuropathy which includes a wide spectrum of peripheral nerve disorders associated with systemic diseases of metabolic origin. These diseases include, for example, diabetes mellitus, hypoglycemia, uremia, hypothyroidism, hepatic failure, polycythemia, amyloidosis, acromegaly, porphyria, disorders of lipid/glycolipid metabolism, nutritional/vitamin deficiencies, and mitochondrial disorders, among others. The common hallmark of these diseases is involvement of peripheral nerves by alteration of the structure or function of myelin and axons due to metabolic pathway dysregulation. [0269] In some embodiments, neuropathies include optic neuropathies such as glaucoma; retinal ganglion degeneration such as those associated with retinitis pigmentosa and outer retinal neuropathies; optic nerve neuritis and/or degeneration including that associated with multiple sclerosis; traumatic injury to the optic nerve which can include, for example, injury during tumor removal; hereditary optic neuropathies such as Kjer’s disease and Leber’s hereditary optic neuropathy; ischemic optic neuropathies, such as those secondary to giant cell arteritis; metabolic optic neuropathies such as neurodegenerative diseases including Leber’s neuropathy mentioned earlier, nutritional deficiencies such as deficiencies in vitamins B12 or folic acid, and toxicities such as due to ethambutol or cyanide; neuropathies caused by adverse drug reactions and neuropathies caused by vitamin deficiency. Ischemic optic neuropathies also include non-arteritic anterior ischemic optic neuropathy. [0270] In some embodiments neurodegenerative diseases that are associated with neuropathy or axonopathy in the central nervous system include a variety of diseases. Such diseases include those involving progressive dementia such as, for example, Alzheimer’s disease, senile dementia, Pick’s disease, and Huntington’s disease; central nervous system diseases affecting muscle function such as, for example, Parkinson’s disease, motor neuron diseases and progressive ataxias such as amyotrophic lateral sclerosis; demyelinating diseases such as, for example multiple sclerosis; viral encephalitides such as, for example, those caused by enteroviruses, arboviruses, and herpes simplex virus; and prion diseases. Mechanical injuries such as glaucoma or traumatic injuries to the head and spine can also cause nerve injury and degeneration in the brain and spinal cord. In addition, ischemia and stroke as well as conditions such as nutritional deficiency and chemical toxicity such as with chemotherapeutic agents can cause central nervous system neuropathies. [0271] In some embodiments, the present disclosure provides a method of treating a neuropathy or axonopathy associated with axonal degeneration. In some such embodiments, a neuropathy or axonopathy associated with axonal degeneration can be any of a number of neuropathies or axonopathies such as, for example, those that are hereditary or congenital or associated with Parkinson’s disease, Alzheimer's disease, Herpes infection, diabetes, amyotrophic lateral sclerosis, a demyelinating disease, ischemia or stroke, chemical injury, thermal injury, and AIDS. In addition, neurodegenerative diseases not mentioned above as well as a subset of the above mentioned diseases can also be treated with the methods of the present disclosure. Such subsets of diseases can include Parkinson’s disease or non-Parkinson’s diseases, or Alzheimer’s disease. Subjects [0272] In some embodiments, compounds and/or compositions as described herein are administered to subjects suffering from or susceptible to a disease, disorder or condition as described herein; in some embodiments, such a disease, disorder or condition is characterized by axonal degeneration, such as one of the conditions mentioned herein. [0273] In some embodiments, a subject to whom a compound or composition is administered as described herein exhibits one or more signs or symptoms associated with axonal degeneration; in some embodiments, the subject does not exhibit any signs or symptoms of neurodegeneration. [0274] In some embodiments, provided methods comprise administering a compound of Formula I or Formula II to a patient in need thereof. In some such embodiments, the patient is at risk of developing a condition characterized by axonal degeneration. In some embodiments, the patient has a condition characterized by axonal degeneration. In some embodiments, the patient has been diagnosed with a condition characterized by axonal degeneration. [0275] In some embodiments, provided methods comprise administering a composition as described herein to a patient population of in need thereof. In some embodiments, the population is drawn from individuals who engage in activities where the potential for traumatic neuronal injury is high. In some embodiments, the population is drawn from athletes who engage in contact sports or other high-risk activities. [0276] In some embodiments, the subject is at risk of developing a condition characterized by axonal degeneration. In some embodiments, the subject is identified as being at risk of axonal degeneration, e.g., based on the subject’s genotype, a diagnosis of a condition associated with axonal degeneration, and/or exposure to an agent and/or a condition that induces axonal degeneration. [0277] In some embodiments, the patient is at risk of developing a neurodegenerative disorder. In some embodiments, the patient is elderly. In some embodiments, the patient is known to have a genetic risk factor for neurodegeneration. In some embodiments, the patient has a family history of neurodegenerative disease. In some embodiments, the patient expresses one or more copies of a known genetic risk factor for neurodegeneration. In some embodiments, the patient is drawn from a population with a high incidence of neurodegeneration. In some embodiments, the patient has a hexanucleotide repeat expansion in chromosome 9 open reading frame 72. In some embodiments, the patient has one or more copies of the ApoE4 allele. [0278] In some embodiments, subjects to which a compound or composition as described herein is administered may be or comprise subjects suffering from or susceptible to a neurodegenerative disease, disorder or condition. In some embodiments, a neurodegenerative disease, disorder or condition may be or comprise a traumatic neuronal injury. In some embodiments, a traumatic neuronal injury is blunt force trauma, a closed-head injury, an open head injury, exposure to a concussive and/or explosive force, a penetrating injury in to the brain cavity or innervated region of the body. In some embodiments, a traumatic neuronal injury is a force which causes the axons to deform, stretch, crush or sheer. [0279] In some embodiments, the subject engages in an activity identified as a risk factor for neuronal degradation, e.g., a subject that engages in contact sports or occupations with a high chance for traumatic neuronal injury. [0280] For example, the subject may be a patient who is receiving, or is prescribed, a chemotherapy associated with peripheral neuropathy. Examples of chemotherapeutic agents include, but not limited to, thalidomide, epothilones (e.g., ixabepilone), taxanes (e.g., paclitaxel and docetaxel), vinca alkaloids (e.g., vinblastine, vinorelbine, vincristine, and vindesine), proteasome inhibitors (e.g., bortezomib), platinum-based drugs (e.g., cisplatin, oxaliplatin, and carboplatin). [0281] In some embodiments, provided methods comprise administering a composition as described herein to a patient or patient population based on the presence or absence of one or more biomarkers. In some embodiments, provided methods further comprise monitoring the level of a biomarker in a patient or patient population and adjusting the dosing regimen accordingly. Dosing [0282] Those of skill in the art will appreciate that, in some embodiments, the exact amount of a particular compound included in and/or delivered by administration of a pharmaceutical composition or regimen as described herein may be selected by a medical practitioner and may be different for different subjects, for example, upon consideration of one or more of species, age, and general condition of the subject, and/or identity of the particular compound or composition, its mode of administration, and the like. Alternatively, in some embodiments, the amount of a particular compound included in and/or delivered by administration of a pharmaceutical composition or regimen as described herein may be standardized across a relevant patient population (e.g., all patients, all patients of a particular age or stage of disease or expressing a particular biomarker, etc.). [0283] A provided compound or composition of the present disclosure is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. The expression "dosage unit form" as used herein refers to a physically discrete unit of agent appropriate for the patient to be treated. It will be understood, however, that the total daily usage of a provided compound or composition of the present disclosure will be decided by the attending physician within the scope of sound medical judgment. The specific effective dose level for any particular patient or organism will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the clinical condition of the individual patient; the cause of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, delivery site of the agent, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed, and like factors well known in the medical arts. The effective amount of the compound to be administered will be governed by such considerations, and is the minimum amount necessary to inhibit SARM1 activity as required to prevent or treat the undesired disease or disorder, such as for example, neurodegeneration or traumatic neural injury. [0284] A pharmaceutically acceptable composition of this disclosure can be administered to humans and other animals orally, rectally, intravenously, parenterally, intracisternally, intravaginally, intraperitoneally, topically (as by powders, ointments, or drops), bucally, as an oral or nasal spray, or the like, depending on the severity of the disease, disorder or infection being treated. The daily dose is, in certain embodiments, given as a single daily dose or in divided doses two to six times a day, or in sustained release form. This dosage regimen may be adjusted to provide the optimal therapeutic response. The compounds may be administered on a regimen of 1 to 4 times per day, preferably once or twice per day. [0285] In some embodiments, compositions of the present disclosure may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. The term "parenteral" as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intradermal, intraocular, intralesional and intracranial injection or infusion techniques. Preferably, the compositions are administered orally, intraperitoneally or intravenously. [0286] In some embodiments, pharmaceutically acceptable compositions of this disclosure may also be administered topically, especially when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, or the lower intestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs. [0287] Most preferably, pharmaceutically acceptable compositions of this disclosure are formulated for oral administration. Such formulations may be administered with or without food. In some embodiments, pharmaceutically acceptable compositions of this disclosure are administered without food. In other embodiments, pharmaceutically acceptable compositions of this disclosure are administered with food. [0288] Those additional agents may be administered separately from a provided compound or composition thereof, as part of a multiple dosage regimen. Alternatively, those agents may be part of a single dosage form, mixed together with a provided compound in a single composition. If administered as part of a multiple dosage regime, the two active agents may be submitted simultaneously, sequentially or within a period of time from one another, normally within five hours from one another. [0289] It should also be understood that a specific dosage and treatment regimen for any particular patient may depend upon a variety of factors, including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, rate of excretion, drug combination, and the judgment of the treating physician and the severity of the particular disease being treated. In some embodiments, the amount of a compound of the present disclosure in the composition will also depend upon the particular compound in the composition. [0290] In some embodiments, SARM1 inhibition as described herein may be utilized in combination with one or more other therapies to treat a relevant disease, disorder, or condition. In some embodiments, dosing of a SARM1 inhibitor is altered when utilized in combination therapy as compared with when administered as monotherapy; alternatively or additionally, in some embodiments, a therapy that is administered in combination with SARM1 inhibition as described herein is administered according to a regimen or protocol that differs from its regimen or protocol when administered alone or in combination with one or more therapies other than SARM1 inhibition. In some embodiments, compositions which comprise an additional therapeutic agent, that additional therapeutic agent and a provided compound may act synergistically. In some embodiments, one or both therapies utilized in a combination regimen is administered at a lower level or less frequently than when it is utilized as monotherapy. [0291] In some embodiments, compounds and/or compositions described herein are administered with a chemotherapeutic agent including, but not limited to, alkylating agents, anthracyclines, taxanes, epothilones, histone deacetylase inhibitors, topoisomerase inhibitors, kinase inhibitors, nucleotide analogs, peptide antibiotics, platinum-based agents, retinoids, vinca alkaloids and derivatives. In some embodiments, compounds and/or compositions described herein are administered in combination with PARP inhibitors. Exemplification [0292] The present teachings including descriptions provided in the Examples that are not intended to limit the scope of any claim. Unless specifically presented in the past tense, inclusion in the Examples is not intended to imply that the experiments were actually performed.. The following non-limiting examples are provided to further illustrate the present teachings. Those of skill in the art, in light of the present disclosure, will appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the present teachings. [0293] Example 1. Preparation of the compounds according to the invention [0294] General Synthetic Methods [0295] The compounds according to the present invention and their intermediates may be obtained using methods of synthesis which are known to the one skilled in the art and described in the literature of organic synthesis. Preferably, the compounds are obtained in analogous fashion to the methods of preparation explained more fully hereinafter, in particular as described in the experimental section. In some cases, the order in carrying out the reaction steps may be varied. Variants of the reaction methods that are known to the one skilled in the art but not described in detail here may also be used. [0296] The general processes for preparing the compounds according to the invention will become apparent to the one skilled in the art studying the following schemes. Starting materials may be prepared by methods that are described in the literature, herein, or may be prepared in an analogous or similar manner. Any functional groups in the starting materials or intermediates may be protected using conventional protecting groups. These protecting groups may be cleaved again at a suitable stage within the reaction sequence using methods familiar to the one skilled in the art. [0297] Optimum reaction conditions and reaction times may vary depending on the particular reactants used. Unless otherwise specified, solvents, temperatures, pressures and other reaction conditions may be readily selected by one of ordinary skill in the art. Specific procedures are provided in the Synthetic Examples section. Intermediates and products may be purified by chromatography on silica gel, recrystallization and/or reverse phase HPLC (RHPLC). Discrete enantiomers may be obtained by resolution of racemic products using chiral HPLC. RHPLC purification methods used anywhere from 0-100% acetonitrile in water containing 0.1%formic acid, 0.1-0.01% TFA, 10mM aqueous ammonium bicarbonate or 0.2% aqueous ammonium hydroxide and used one of the following columns: a) Waters Xbridge C1810 ^m 30x100 mm column b) Waters Sunfire C1810 ^m 30x100 mm column c) Waters Xbridge C183.5 ^m 50x4.6 mm column d) HALO C182.7 ^m 30x4.6 mm column e) Waters Sunfire C183.5 ^m 50x4.6 mm column [0298] LCMS methods Analytical LC/MS Analysis Method A: ESI +/- ion mode 100-1000Da Column: XBridge SB-C18, 3.5 ^m 4.6 x 50mm column Temperature: 40 o C Gradient: 10 mM a ueous Analytical LC/MS Analysis Method B: ESI +/- ion mode 100-1000Da Column: Sunfire C18, 3.5 ^m 4.6 x 50mm column Temperature: 50 o C Gradient: Analytical LC/MS Analysis Method C: ESI +/- ion mode 100-1000Da Column: XBridge SB-C18, 3.5 ^m 4.6 x 50mm column Temperature: 40 o C Gradient: Analytical LC/MS Analysis Method D: ESI +/- ion mode 100-1000Da Column: XBridge SB-C18, 3.5 ^m 4.6 x 50mm column Temperature: 40 o C Gradient: Time (min) 0.01% TFA in water Acetonitrile Flow (mL/min) Analytical LC/MS Analysis Method E: ESI +/- ion mode 100-1000Da Column: XBridge C18, 3.5 ^m 4.6 x 50mm column Temperature: 40 o C Gradient: Analytical LC/MS Analysis Method F: ESI +/- ion mode 100-1000Da Column: XBridge C18, 3.5 ^m 4.6 x 50mm column Temperature: 50 o C Gradient: Analytical LC/MS Analysis Method G: ESI +/- ion mode 100-1000Da Column: XBridge C18, 3.5 ^m 4.6 x 50mm column Temperature: 45 o C Gradient: Time (min) 0.1% TFA in water Acetonitrile Flow (mL/min) Analytical LC/MS Analysis Method H: ESI +/- ion mode 100-1000Da Column: XBridge C18, 3.5 ^m 4.6 x 50mm column Temperature: 50 o C Gradient:
Analytical LC/MS Analysis Method I: ESI +/- ion mode 100-1000Da Column: XBridge C18, 3.5 ^m 4.6 x 50mm column Temperature: 45 o C Gradient: Analytical LC/MS Analysis Method J: ESI +/- ion mode 100-1000Da Column: Phenomenex Kinetix-XB C18, 1.7 ^m 2.1 x 100mm column Temperature: 40 o C Gradient: W ater (0.1%formic Acetonitrile (0.1% [0299] Synthetic Examples [0300] Synthetic Example A: Synthesis of Example 76 [0301] To a solution of R-1 (80 mg, 0.36 mmol) in DMF (3 mL) is added R-2 (53 mg, 0.43 mmol) and K 2 CO 3 (149 mg, 1.1 mmol). The mixture is stirred at 80 °C for 2 h then cooled, treated with H2O (10 mL) and extracted with EtOAc (10 mL x 3). The organic layer is washed with brine (30 mL x 2), dried over Na 2 SO 4 , and concentrated under reduced pressure. The crude residue is purified by Prep-HPLC to afford Example 76 (72 mg). [0302] The following examples are prepared in similar fashion from the appropriate reagents: Examples 1-6, 8-14, 16-19, 26-27, 35, 47-64, 67-69, 75-77, and 82-83. [0303] Synthetic Example B: Synthesis of Example 20 [0304] Step 1 [0305] A mixture of R-3 (6.0 g, 26.55 mmol) and R-4 (8.2 g, 79.65 mmol) in acetic acid (25 mL) is stirred at 130 o C for 16h. The reaction mixture is cooled and concentrated under reduced pressure to remove acetic acid. The residue is diluted with water (200 mL), neutralized with saturated aqueous NaHCO 3 to pH=7-8 and filtered. The filtrate is acidified with conc. aqueous HCl to pH=1-2, filtered and the solid is dried to afford I-1 (5.4 g, 76%). [0306] Step 2 [0307] A mixture of I-1 (2.7 g, 10.0 mmol) and PCl 5 (5.2 g, 25.0 mmol) in POCl 3 (20 mL) is stirred at 110 o C for 1.5h. The reaction mixture is cooled and concentrated under reduced pressure to afford a residue that is dissolved in THF (30 mL). The mixture is added to a solution of ammonium hydroxide (20 g, 30% aqueous, 171.3 mmol) in THF (10 mL) at 0 o C. After stirring at 0 o C for 0.5h, the reaction is concentrated under reduced pressure, filtered, and the resulting solid is washed with water (10 mL) and dried to give a solid. [0308] The solid is dissolved in CH 2 Cl 2 (40 mL), cooled to 0 o C then treated with TEA (2.14 mL, 15.4 mmol). After 5 min, TFAA (1.3 mL, 9.24 mmol) is added slowly and the mixture is stirred at 0 o C for 1 h. The mixture is neutralized with NaHCO3 to pH = 7, extracted with CH 2 Cl 2 (3 x 60 mL), dried over Na2SO4, filtered and concentrated under reduced pressure. The residue is washed with EtOAc (10 mL) and the solid filtered and dried to give I-2 (1.78 g, 68%). [0309] Step 3 [0310] A mixture of I-2 (0.4 g, 1.5 mmol), R-5 (0.36 g, 1.8 mmol) and K2CO3 (1.0 g, 7.5 mmol) in DMF (8 mL) is stirred at 80 °C for 1h. The reaction is cooled to room temperature and diluted with EtOAc (150 mL), washed with water (20 mL), brine (4 x 20 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to afford the Boc amine intermediate that is dissolved in CH 2 Cl 2 (20 mL). The mixture is treated with TFA (5 mL) and stirred for 1 h at room temperature then concentrated under reduced pressure. The residue is neutralized with 10% aqueous K2CO3, extracted with EtOAc (3 x 20 mL), dried over Na2SO4, filtered and concentrated in vacuo. The crude residue is purified by Prep-HPLC to afford Example 20 (0.16 g, 33%). [0311] The following examples are prepared in similar fashion from the appropriate reagents: Examples 21-25, 65-66, 72-74, 84-85, 93, 94, 97, 99-130, 132-139, 141-143, 145, 146, and 150-153. [0312] Synthetic Example C: Synthesis of Example 70 [0313] The mixture of R-1 (200 mg, 0.9 mmol) in DMF (3 mL) is added R-6 (333 mg, 1.8 mmol). The resulting mixture is stirred at 100 o C for 2 h. The reaction mixture is concentrated under vacuum to get a crude product (300 mg), which is dissolved in THF (5 mL) and treated with hydrazine monohydrate (0.3 mL). The resulting mixture is stirred at 80 o C for 2 h. The solvent is removed, and the residue is purified by prep-HPLC to afford Example 70 (46 mg, 25 %). [0314] Synthetic Example D: Synthesis of Example 71 [0315] To a solution of Example 10 (30 mg, 0.12 mmol) in THF (3 mL) is added the solution of LHMDS (1M in THF, 0.06 ml, 0.06 mmol) at -50 o C dropwise, then the mixture is stirred at -50 o C for 1h. To this solution is added R-7 (57 mg, 0.18 mmol) and after addition, the mixture is stirred at 0 o C for 1 hour then adjusted to pH = 6 by dilute aqueous HCl. The mixture is partitioned between water and EtOAc. The organic phase is separated, and the aqueous phase is extracted with EtOAc (12 mL x 3). The combined organic layer is washed with saturated aqueous NaCl, dried over Na 2 SO 4 , filtered, and concentrated. The residue is purified by Prep-HPLC to afford Example 71 (0.3 mg, 2%). [0316] The following example was prepared in similar fashion from the appropriate reagents: Example 89. [0317] Synthetic Example E: Synthesis of Example 78 [031 p [0319] To a solution of R-1 (220 mg, 1.0 mmol) in DMF (4 mL) is added R-8 (210 mg, 1.2 mmol) and K 2 CO 3 (691 mg, 5.0 mmol), then stirred at 80 o C for 2 h. The mixture is treated with H2O (50 mL) and extracted with EtOAc (50 mL x 3). The combined organic layers are washed with brine (30 mL), dried over Na 2 SO 4 , filtered, and concentrated. The residue is purified by flash chromatography (EtOAc:Petroleum ether = 1:1) to afford I-3 (310 mg, 95%) [Analytical Method I, ret time = 2.16 min, m/z = 330.1]. [0320] Step 2 [0321] To a solution of I-3 (310 mg, 0.94 mmol) in THF (8 ml) and H 2 O (2 ml) is added LiOH . H2O (158 mg, 3.76 mmol). The mixture is stirred at room temperature for 2 h. The solvent is removed under reduce pressure. The residue is dissolved in CH 2 Cl2/MeOH=10:1 (100 mL) and filtered. The filtrate is dried over Na 2 SO 4 and filtered. The filtrate is concentrated under reduce pressure to afford I-4 (280 mg, 96%) [Analytical Method E, ret time = 1.87 min, m/z = 316.1]. [0322] Step 3 [0323] To a solution of I-4 (280 mg, 0.88 mmol) in CH 2 Cl 2 (45 mL) is added SOCl 2 (2.09 g, 17.6 mmol). The mixture is stirred at room temperature for 2 h and then concentrated under reduced pressure. The residue is dissolved in THF (6 mL) then treated with a solution of ammonium hydroxide (6 mL, 30 % aqueous, 42.8 mmol) at 0 o C and stirred an additional 0.5 h at 0 o C. The reaction mixture is concentrated under reduced pressure. The residue is treated with water (10 mL) and extracted with EtOAc (20 mL x 3). The combined organic layers are washed with brine (30 mL x 3), dried over Na 2 SO 4 , and filtered. The filtrate is concentrated under reduce pressure then purified by prep-HPLC to afford Example 78 (130 mg, yield = 48%). [0324] The following examples are prepared in similar fashion from the appropriate reagents: Examples 79-80, 88, 90-92, 95, 96, 98, 131, 140, 144, and 147-149. [0325] Synthetic Example F: Synthesis of Example 81 [0326] The mixture of R-1 (300 mg, 1.35 mmol), R-9 (608 mg, 5.38 mmol), and 2,2,6,6- tetramethylpiperidine (474 mg, 3.36 mmol) is stirred at 230 o C for 7 h. The reaction mixture is cooled to room temperature, and then filtered. The filtrate is directly purified by prep-HPLC to give Example 78 (12.3 mg, 3%). [0327] Synthetic Example G: Synthesis of Example 87 [0328] To a mixture of R-1 (100 mg, 0.45 mmol) and R-2 (102 mg, 0.5 mmol) in 1,4- dioxane (5 mL) and H2O (0.5 mL) is added PdCl2(dppf) (33 mg, 0.045 mmol) and K2CO3 (186.3 mg,1.35 mmol). The mixture is stirred at 110 °C for 2 h under N 2 the cooled, treated with H 2 O (10 mL) and extracted with EtOAc (20 mL x 3). The combined organic layer is washed brine (30mL x 2) and dried over Na2SO4. The organic layer is concentrated under reduced pressure then purified by Prep-HPLC to afford Example 87 (25 mg, 21%). [0329] The following example is prepared in similar fashion from the appropriate reagents: Example 86. [0330] Results are presented in Table 1:
[0331] Table 1.
Example 2: ARM-SAM-TIR SARM1 IC50 Assay [0332] This Example describes an assay of ARM-SAM-TIR NADase activity and use of this assay to measure the efficacy of compounds of Formula I or Formula II to block SARM1 mediated NAD+ cleavage. This assay is optimized in such a way as to characterize the efficacy of the compounds in Formula I or Formula II to inhibit SARM1 activity and to calculate an IC50 value for each compound. This assay makes use of full length SARM1, which encompasses the ARM, SAM and TIR domains. As demonstrated herein, expression of this fragment without the autoinhibitory N- terminal domain generates a constitutively active enzyme that cleaves NAD+. [0333] Preparation of ARM-SAM-TIR lysate (STL) [0334] NRK1-HEK293T cells were seeded onto 150 cm 2 plates at 20 x 106 cells per plate. The next day, the cells were transfected with 15 mg ARM-SAM-TIR expression plasmid, SEQ ID NO: 1. GCGATCGCGGCTCCCGACATCTTGGACCATTAGCTCCACAGGTATCTTCTTCCCTCTAGT GGTCATAACAGCAGCTTCAG CTACCTCTCAATTCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTA TCAATCGTTGCGTTACACAC ACAAAAAACCAACACACATCCATCTTCGATGGATAGCGATTTTATTATCTAACTGCTGAT CGAGTGTAGCCAGATCTAGT AATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTA CGGTAAATGGCCCGCCTGGC TGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACG CCAATAGGGACTTTCCATTG ACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCA TATGCCAAGTACGCCCCCTA TTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGG ACTTTCCTACTTGGCAGTAC ATCTACGTATTAGTCATCGCTATTACCATGCTGATGCGGTTTTGGCAGTACATCAATGGG CGTGGATAGCGGTTTGACTC ACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAA TCAACGGGACTTTCCAAAAT GTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCT ATATAAGCAGAGCTGGTTTA GTGAACCGTCAGATCAGATCTTTGTCGATCCTACCATCCACTCGACACACCCGCCAGCGG CCGCTGCCAAGCTTCCGAGC TCTCGAATTCAAAGGAGGTACCCACcatgGCCATGCATCACCACCACCATCATAGCTCCG GCGTCGACCTCGGCACCGAG AATTTATATTTCCAAAGCGGCCTCAATGATATCTTCGAGGCCCAGAAGATCGAGTGGCAC GAGGGCAGCTCCGACCTCGC CGTGCCCGGTCCCGATGGAGGCGGAGGCACTGGTCCTTGGTGGGCTGCTGGCGGCAGAGG CCCTAGAGAAGTGAGCCCCG GTGCTGGCACCGAGGTGCAAGACGCTCTGGAGAGGGCTCTGCCCGAACTGCAGCAAGCTC TGTCCGCTTTAAAGCAAGCT GGAGGAGCTAGAGCCGTCGGCGCCGGACTGGCCGAAGTGTTCCAGCTCGTGGAGGAAGCT TGGTTATTACCCGCTGTGGG AAGAGAGGTCGCCCAAGGTCTGTGTGACGCCATTCGTCTGGACGGAGGTTTAGACTTATT ACTGAGGCTGCTGCAAGCTC CCGAACTGGAGACAAGGGTCCAAGCTGCTCGTCTGCTGGAGCAGATCCTCGTGGCCGAGA ATCGTGACAGAGTGGCTAGA ATCGGTTTAGGCGTCATCCTCAATTTAGCCAAAGAGAGGGAGCCCGTTGAGCTGGCCAGA AGCGTCGCTGGCATCCTCGA GCACATGTTCAAGCATTCCGAGGAGACTTGTCAGAGACTGGTCGCCGCCGGAGGACTCGA TGCTGTTTTATACTGGTGCA GAAGGACAGACCCCGCTTTACTGAGGCATTGTGCTCTGGCCCTCGGCAATTGCGCTTTAC ATGGAGGCCAAGCCGTCCAG AGAAGGATGGTGGAGAAAAGAGCCGCCGAGTGGCTGTTCCCTTTAGCCTTCTCCAAAGAA GACGAACTGTTACGTCTGCA TGCTTGTCTCGCTGTCGCTGTTTTAGCCACCAACAAGGAGGTGGAAAGGGAAGTGGAAAG AAGCGGAACACTGGCTTTAG TCGAACCTCTGGTGGCTTCTTTAGATCCCGGAAGGTTTGCCAGATGTCTGGTCGACGCCA GCGATACCTCCCAAGGAAGA GGCCCCGACGATCTCCAGAGACTGGTGCCTCTGCTGGACAGCAATCGTCTGGAGGCCCAA TGTATTGGCGCCTTCTATCT CTGCGCCGAAGCCGCCATCAAGTCTTTACAAGGTAAGACCAAGGTGTTCTCCGACATTGG AGCCATCCAATCTTTAAAGA GGCTGGTGAGCTATTCCACCAACGGCACAAAAAGCGCTTTAGCCAAAAGAGCTTTAAGAC TGCTGGGCGAAGAGGTGCCT AGGCCCATTTTACCTTCCGTGCCTAGCTGGAAGGAGGCCGAGGTGCAGACTTGGCTGCAG CAGATCGGCTTTAGCAAATA TTGCGAATCCTTTAGGGAGCAGCAAGTTGACGGCGATTTATTATTAAGGCTGACCGAGGA AGAGCTCCAGACAGATTTAG GCATGAAAAGCGGCATCACTCGTAAGAGGTTCTTTCGTGAGCTCACCGAACTGAAGACCT TCGCCAACTACTCCACTTGT GATCGTAGCAATTTAGCTGATTGGCTCGGATCCCTCGATCCCAGATTTCGTCAGTACACC TATGGACTCGTCTCTTGTGG ACTGGACAGATCTTTACTGCATCGTGTGAGCGAGCAACAGCTGCTGGAAGATTGCGGCAT CCATTTAGGAGTGCACAGAG CCAGAATTCTGACCGCCGCTAGAGAGATGCTGCATTCCCCTCTCCCTTGTACCGGAGGCA AGCCTAGCGGAGACACCCCC GACGTGTTCATCAGCTATCGTAGAAACAGCGGAAGCCAGCTGGCCTCTTTACTGAAGGTC CATTTACAGCTGCACGGATT TAGCGTCTTCATCGACGTGGAGAAACTGGAGGCTGGCAAGTTCGAGGACAAGCTGATCCA GTCCGTGATGGGCGCTAGGA ATTTCGTTTTAGTGCTCAGCCCCGGCGCTCTGGATAAATGCATGCAAGATCATGACTGTA AGGACTGGGTCCACAAGGAA ATCGTGACCGCTCTGTCTTGTGGCAAGAACATCGTCCCCATCATCGACGGCTTCGAATGG CCCGAGCCTCAAGTTCTCCC CGAAGATATGCAAGCTGTTTTAACCTTCAATGGAATCAAGTGGAGCCACGAGTACCAAGA AGCCACAATCGAGAAGATCA TTCGTTTTCTGCAAGGTAGATCCTCCAGAGATTCCTCCGCTGGCAGCGACACATCTTTAG AGGGCGCCGCCCCTATGGGT CCTACCTAATAATctagAAGTTGTCTCCTCCTGCACTGACTGACTGATACAATCGATTTC TGGATCCGCAGGCCTCTGCT AGCTTGACTGACTGAGATACAGCGTACCTTCAGCTCACAGACATGATAAGATACATTGAT GAGTTTGGACAAACCACAAC TAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGT AACCATTATAAGCTGCAATA AACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGG AGGTTTTTTAAAGCAAGTAA AACCTCTACAAATGTGGTATTGGCCCATCTCTATCGGTATCGTAGCATAACCCCTTGGGG CCTCTAAACGGGTCTTGAGG GGTTTTTTGTGCCCCTCGGGCCGGATTGCTATCTACCGGCATTGGCGCAGAAAAAAATGC CTGATGCGACGCTGCGCGTC TTATACTCCCACATATGCCAGATTCAGCAACGGATACGGCTTCCCCAACTTGCCCACTTC CATACGTGTCCTCCTTACCA GAAATTTATCCTTAAGGTCGTCAGCTATCCTGCAGGCGATCTCTCGATTTCGATCAAGAC ATTCCTTTAATGGTCTTTTC TGGACACCACTAGGGGTCAGAAGTAGTTCATCAAACTTTCTTCCCTCCCTAATCTCATTG GTTACCTTGGGCTATCGAAA CTTAATTAACCAGTCAAGTCAGCTACTTGGCGAGATCGACTTGTCTGGGTTTCGACTACG CTCAGAATTGCGTCAGTCAA GTTCGATCTGGTCCTTGCTATTGCACCCGTTCTCCGATTACGAGTTTCATTTAAATCATG TGAGCAAAAGGCCAGCAAAA GGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGA CGAGCATCACAAAAATCGAC GCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTG GAAGCTCCCTCGTGCGCTCT CCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTG GCGCTTTCTCATAGCTCACG CTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACC CCCCGTTCAGCCCGACCGCT GCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCAC TGGCAGCAGCCACTGGTAAC AGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAAC TACGGCTACACTAGAAGAAC AGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTC TTGATCCGGCAAACAAACCA CCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGAT CTCAAGAAGATCCTTTGATC TTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATG AGATTATCAAAAAGGATCTT CACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTA AACTTGGTCTGACAGTTACC AATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTG CATTTAAATTTCCGAACTCT CCAAGGCCCTCGTCGGAAAATCTTCAAACCTTTCGTCCGATCCATCTTGCAGGCTACCTC TCGAACGAACTATCGCAAGT CTCTTGGCCGGCCTTGCGCCTTGGCTATTGCTTGGCAGCGCCTATCGCCAGGTATTACTC CAATCCCGAATATCCGAGAT CGGGATCACCCGAGAGAAGTTCAACCTACATCCTCAATCCCGATCTATCCGAGATCCGAG GAATATCGAAATCGGGGCGC GCCTGGTGTACCGAGAACGATCCTCTCAGTGCGAGTCTCGACGATCCATATCGTTGCTTG GCAGTCAGCCAGTCGGAATC CAGCTTGGGACCCAGGAAGTCCAATCGTCAGATATTGTACTCAAGCCTGGTCACGGCAGC GTACCGATCTGTTTAAACCT AGATATTGATAGTCTGATCGGTCAACGTATAATCGAGTCCTAGCTTTTGCAAACATCTAT CAAGAGACAGGATCAGCAGG AGGCTTTCGCATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATT TTGCCTTCCTGTTTTTGCTC ACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCGCGAGTGGGTT ACATCGAACTGGATCTCAAC AGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGCTTTCCAATGATGAGCACTTTT AAAGTTCTGCTATGTGGCGC GGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCA GAATGACTTGGTTGAGTATT CACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTG CCATAACCATGAGTGATAAC ACTGCGGCCAACTTACTTCTGACAACGATTGGAGGACCGAAGGAGCTAACCGCTTTTTTG CACAACATGGGGGATCATGT AACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGA CACCACGATGCCTGTAGCAA TGGCAACAACCTTGCGTAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAAC AGTTGATAGACTGGATGGAG GCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCT GATAAATCTGGAGCCGGTGA GCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGT AGTTATCTACACGACGGGGA GTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTA AGCATTGGTAACCGATTCTA GGTGCATTGGCGCAGAAAAAAATGCCTGATGCGACGCTGCGCGTCTTATACTCCCACATA TGCCAGATTCAGCAACGGAT ACGGCTTCCCCAACTTGCCCACTTCCATACGTGTCCTCCTTACCAGAAATTTATCCTTAA GATCCCGAATCGTTTAAACT CGACTCTGGCTCTATCGAATCTCCGTCGTTTCGAGCTTACGCGAACAGCCGTGGCGCTCA TTTGCTCGTCGGGCATCGAA TCTCGTCAGCTATCGTCAGCTTACCTTTTTGGCA (SEQ ID NO: 1). [0335] The cultures were supplemented with 1 mM NR at time of transfection to minimize toxicity from ARM-SAM-TIR overexpression. Forty-eight hours after transfection, cells were harvested, pelleted by centrifugation at 1,000 rpm (Sorvall ST 16R centrifuge, Thermo Fisher), and washed once with cold PBS (0.01 M phosphate buffered saline NaCl 0.138 M; KCl 0.0027 M; pH 7.4). The cells were resuspended in PBS with protease inhibitors (cOmplete™ protease inhibitor cocktail, Roche product # 11873580001) and cell lysates were prepared by sonication (Branson Sonifer 450, output = 3, 20 episodes of stroke). The lysates were centrifuged (12,000×g for 10 min at 4°C) to remove cell debris and the supernatants (containing ARM-SAM-TIR protein) were stored at -80°C for later use in the in vitro ARM-SAM-TIR NADase assay (see below). Protein concentration was determined by the Bicinchoninic (BCA) method and used to normalize lysate concentrations. ARM-SAM-TIR IC50 assay of Formula I or Formula II compounds. [0336] The enzymatic assay was performed in a 384-well polypropylene plate in Dulbecco’s PBS buffer in a final assay volume of 20 µL. ARM-SAM-TIR lysate with a final concentration of 5 µg/mL was pre-incubated with the respective compound at 1% DMSO final assay concentration over 2h at room temperature. The reaction was initiated by addition of 5 µM final assay concentration of NAD+ as substrate. After a 2hr room temperature incubation, the reaction was terminated with 40 µL of stop solution of 7.5% trichloroactetic acid in acetonitrile. The NAD+ and ADPR concentrations were analyzed by a RapidFire High Throughput Mass Spectrometry System (Agilent Technologies, Santa Clara, CA) using an API4000 triple quadrupole mass spectrometer (AB Sciex Framingham, MA). [0337] Results are presented below in Table 2. Compounds having an activity designated as “A” provided an IC 50 < 5µM; compounds having an activity designated as “B” provided an IC 50 5-15 µM; compounds having an activity designated as “C” provided an IC 50 15.01-30 µM; compounds having an activity designated as “D” provided an IC50 >30 µM; nd: not determined.
[0338] Table 2.
Next Patent: POINT OF SALE INTERMEDIATION SYSTEM