FIELD AND BACKGROUND OF THE INVENTION

The present invention, in some embodiments thereof, relates to isolated cells genetically modified to express a DISRAM system having an anti-phage activity and methods of using same.

The ongoing arms race between bacteria and bacteriophages (phages) has led to the rapid evolution of efficient resistance systems to protect bacteria from phage infection. Hence, a substantial fraction of bacterial and archaeal genomes is dedicated to phage defense while the defense genes are typically clustered in genomic islands termed defense islands [Makarova et al. J Bacteriol. 2011 Nov; 193(21): 6039-6056]. Some of these systems include restriction- modification (R/M) systems, abortive infection (Abi) mechanisms, the CRISPR/Cas adaptive defense system and more newly discovered defense systems such as the prokaryotic argonaute [Swarts et al. Nature (2014) 507, 258-261] and the BREX system [Goldfarb et al. EMBO J. (2015) 34, 169-83; and international Application Publication No. WO2015/059690]. It is estimated that many additional, yet uncharacterized anti-phage defense systems are encoded by bacteria and archaea genomes [Stern and Sorek, Bioessays (2011) 33, 43-51].

R/M systems are the most common form of active defense against phages used by bacteria and archaea. In such systems the modification entity modifies the self-genome on specific sequence motifs and the restriction entity recognizes and degrades foreign DNA in which such motifs are non-modified [e.g. Roberts et al. Nucleic Acids Res. (2003) 31, 1805-12]. R/M systems characterized to date are typically classified into 4 categories named in the order of their discovery: Type I, Type II, Type III and Type IV, all containing a restriction endonuclease activity and a methylase activity (not present in Type IV systems) encoded as 1-3 proteins.

Some of these phage-resistance systems have been successfully adapted for biotechnological application; for example, the R/M and the CRISPR/Cas systems have been extensively used for genetic engineering purposes in general and gene therapy in particular.

A broad array of food products, commodity chemicals, and biotechnology products are manufactured industrially by large-scale bacterial fermentation of various substrates. Enormous amounts of bacteria are being cultivated each day in large fermentation vats, thus phage contamination can rapidly bring fermentations to a halt and cause economic setbacks, and is therefore considered a serious threat in these industries. The dairy fermentation industry has openly acknowledged the problem of phage and has been working with academia and starter culture companies to develop defense strategies and systems to curtail the propagation and evolution of phages for decades.

On the counter arm, harnessing phages and their defense mechanisms as anti-bacterial agents for therapeutic uses has gained much interest over the last decade, especially in light of the substantial rise in the prevalence of bacterial antibiotic resistance, coupled with an inadequate number of new antibiotics.

SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided an isolated cell genetically modified to express a DISARM system having an anti-phage activity, the system comprising:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; and a drmD polypeptide or a drmE polypeptide, the drmD polypeptide comprising a pfam00176 domain, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell.

According to some embodiments of the invention, the isolated genetically modified cell of claim 1, being resistant to infection by at least one phage.

According to an aspect of some embodiments of the present invention there is provided an isolated cell genetically modified to express at least two DISARM system components selected from the group consisting of:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain;

a drmD polypeptide, the drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell

According to some embodiments of the invention, the cell does not express an

endogenous DISARM system.

According to some embodiments of the invention, the cell is a bacteria.

According to some embodiments of the invention, the DISARM system is on a transmissible genetic element. According to an aspect of some embodiments of the present invention there is provided a method of protecting bacteria from phage infection, the method comprising introducing into the bacteria a DISARM system having an anti-phage activity, the system comprising:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; and a drmD polypeptide or a drmE polypeptide, the drmD polypeptide comprising a pfam00176 domain, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell,

thereby protecting the bacteria from phage infection.

According to some embodiments of the invention, the bacteria does not express an endogenous DISARM system.

According to some embodiments of the invention, the bacteria is a first bacteria and the introducing into the bacteria the DISARM system comprises contacing the first bacteria with a second bacteria expressing the DISARM system on a transmissible genetic element.

According to some embodiments of the invention, the first bacteria does not express an endogenous DISARM system.

According to an aspect of some embodiments of the present invention there is provided a method of killing a bacteria, the method comprising introducing into a bacteria which expresses a DISARM system having an anti-phage activity an anti-DISARM agent capable of down regulating expression and/or activity of a drmM I polypeptide and/or a drmM II polypeptide, the drmMI polypeptide comprising a S-adenosyl-L-methionine-dependent methyltransferase (SSF5335) domain, the drmMII polypeptide comprising a pfam00145 domain, the DISARM system comprises:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; and a drmD polypeptide or a drmE polypeptide, the drmD polypeptide comprising a pfam00176 domain, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell,

thereby killing the bacteria.

According to an aspect of some embodiments of the present invention there is provided an isolated anti-DISARM agent capable of down regulating expression and/or activity of at least two DISARM system components selected from the group consisting of: a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain; a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain;

a drmD polypeptide, the drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell.

According to an aspect of some embodiments of the present invention there is provided a method of inducing phage sensitivity in a bacteria, the method comprising introducing into a bacteria which expresses a DISARM system having an anti-phage activity an anti-DISARM agent, the DISARM system comprises:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain; a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; and a drmD polypeptide or a drmE polypeptide, the drmD polypeptide comprising a pfam00176 domain, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell,

and the anti-DISARM agent is capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of the drmA polypeptide, the drmB polypeptide, the drmD polypeptide, the drmE polypeptide and a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain,

thereby inducing sensitivity of the bacteria to phage infection.

According to some embodiments of the invention, the method further comprising infecting the bacteria with a phage.

According to an aspect of some embodiments of the present invention there is provided a method of treating a bacterial infection in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an anti-DISARM agent capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of:

a drmMI polypeptide, the drmMI polypeptide comprising a S-adenosyl-L-methionine- dependent methyltransferase (SSF5335) domain;

a drmMII polypeptide, the drmMII polypeptide comprising a pfam00145 domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain;

a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain; a drmD polypeptide, the drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell, thereby treating the bacterial infection in the subject.

According to an aspect of some embodiments of the present invention there is provided a use of an anti-DISARM agent capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of:

a drmMI polypeptide, the drmMI polypeptide comprising a S-adenosyl-L-methionine- dependent methyltransferase (SSF5335) domain;

a drmMII polypeptide, the drmMII polypeptide comprising a pfam00145 domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain;

a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain;

a drmD polypeptide, the drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell, for the manufacture of a medicament identified for the treatment of bacterial infection in a subject in need thereof.

According to some embodiments of the invention, the method further comprising administering to the subject a phage therapy and/or an antibiotic.

According to some embodiments of the invention, the use further comprising a phage therapy and/or an antibiotic.

According to an aspect of some embodiments of the present invention there is provided an article of manufacture identified for treating a bacterial infection comprising:

(a) an anti-DISARM agent capable of down regulating expression and/or activity of a

DISARM system component selected from the group consisting of:

a drmMI polypeptide, the drmMI polypeptide comprising a S-adenosyl-L-methionine- dependent methyltransferase (SSF5335) domain;

a drmMII polypeptide, the drmMII polypeptide comprising a pfam00145 domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain;

a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain;

a drmD polypeptide, the drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell; and

(b) a phage and/or an antibiotic.

According to an aspect of some embodiments of the present invention there is provided a method for preparing a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product, the method comprising adding to the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product a DISARM system comprising:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain; a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; and a drmD polypeptide or a drmE polypeptide, the drmD polypeptide comprising a pfam00176 domain, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell,

thereby preparing the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product.

According to an aspect of some embodiments of the present invention there is provided a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product comprising a DISARM system comprising:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain; a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; and a drmD polypeptide or a drmE polypeptide, the drmD polypeptide comprising a pfam00176 domain, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell.

According to some embodiments of the invention, there is provided a method for preparing a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product, the method comprising adding to the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product the isolated cell of the present invention, thereby preparing the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product. According to some embodiments of the invention, there is provided a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product comprising the isolated cell of the present invention.

According to an aspect of some embodiments of the present invention there is provided a method for preparing a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product comprising adding to the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product a bacteria which expresses on a transmissible genetic element a DISRAM system comprising:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; and a drmD polypeptide or a drmE polypeptide, the drmD polypeptide comprising a pfam00176 domain, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell,

thereby preparing the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product.

According to an aspect of some embodiments of the present invention there is provided a method for preparing a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product, the method comprising adding to the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product an anti-DISARM agent capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of:

a drmMI polypeptide, the drmMI polypeptide comprising a S-adenosyl-L-methionine- dependent methyltransferase (SSF5335) domain;

a drmMII polypeptide, the drmMII polypeptide comprising a pfam00145 domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain;

a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain;

a drmD polypeptide, the drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell, thereby preparing the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product.

According to an aspect of some embodiments of the present invention there is provided a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product comprising an anti-DISARM agent capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of:

a drmMI polypeptide, the drmMI polypeptide comprising a S-adenosyl-L-methionine- dependent methyltransferase (SSF5335) domain;

a drmMII polypeptide, the drmMII polypeptide comprising a pfam00145 domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain;

a drmD polypeptide, the drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell.

According to some embodiments of the invention, the agent is selected from the group consisting of a nucleic acid suitable for silencing expression, aptamers, small molecules and inhibitory peptides.

According to some embodiments of the invention, the food or feed is a dairy product.

According to some embodiments of the invention, the bacteria is a lactic acid bacteria.

According to some embodiments of the invention, the bacteria is a species selected from the group consisting of Lactococcus species, Streptococcus species, Lactobacillus species, Leuconostoc species, Oenococcus species, Pediococcus species, Bifidobacterium, and Propionibacterium species.

According to some embodiments of the invention, the bacteria is a species selected from the group consisting of Escherichia, Shigella, Salmonella, Erwinia, Yersinia, Bacillus, Vibrio, Legionella, Pseudomonas, Neisseria, Bordetella, Helicobacter, Listeria, Agrobacterium, Staphylococcus, Streptococcus, Enterococcus, Clostridium, Corynebacterium, Mycobacterium, Treponema, Borrelia, Francisella, Brucella, Campylobacter, Klebsiella, Frankia, Bartonella, Rickettsia, Shewanella, Serratia, Enterobacter, Proteus, Providencia, Brochothrix, and Brevibacterium.

According to an aspect of some embodiments of the present invention there is provided a method of screening for identifying phage useful for infecting a bacteria, the method comprising:

(a) contacting a phage with a bacteria expressing a DISARM system comprising: a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; and a drmD polypeptide or a drmE polypeptide, the drmD polypeptide comprising a pfam00176 domain, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell;

(b) determining deleterious effects induced in the bacteria, wherein an increase in deleterious effects of the bacteria in the presence of the phage compared to deleterious effects in the absence of the phage is indicative of a phage useful for infecting the bacteria.

According to an aspect of some embodiments of the present invention there is provided a method of cutting a nucleic acid sequence, the method comprising contacting the nucleic acid sequence with a DISARM system component selected from the group consisting of:

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain;

a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain;

a drmD polypeptide, the drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell, thereby cutting the nucleic acid sequence.

According to some embodiments of the invention, the nucleic acid sequence is comprised in a cell.

According to some embodiments of the invention, the nucleic acid sequence is not comprised in a cell expressing a drmM polypeptide selected from the group consisting of a drmMI polypeptide, the drmMI polypeptide comprising a S-adenosyl-L-methionine-dependent methyltransferase (SSF5335) domain; and a drmMII polypeptide the drmMII polypeptide comprising a pfam00145 domain.

According to some embodiments of the invention, the nucleic acid sequence is not comprised in a cell expressing an endogenous DISARM system comprising:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain; and a drmD polypeptide or a drmE polypeptide, the drmD polypeptide comprising a pfam00176 domain, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell. According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising polynucleotide encoding at least two DISARM system components selected from the group consisting of:

a drmM polypeptide, the drmM polypeptide containing a methyltransferase domain;

a drmA polypeptide, the drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, the drmB polypeptide comprising a pfam09369 domain;

a drmC polypeptide, the drmC polypeptide comprising a pfaml3091 domain;

a drmD polypeptide, the drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, the drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding the drmM, the drmA and/or the drmB in a genome of a prokaryotic cell, and a regulatory element selected from the group consisting of: a cis-acting regulatory element for directing expression of the polynucleotide, a transmissible element for directing transfer of the polynucleotide from one cell to another and a recombination element for integrating the polynucleotide into a genome of cell transfected with the construct.

According to some embodiments of the invention, the polynucleotide encoding a DISARM system having an anti-phage activity, the system comprising: the drmM polypeptide; the drmA polypeptide; the drmA polypeptide; the drmB polypeptide; and the drmD polypeptide or the drmE polypeptide.

According to some embodiments of the invention, the nucleic acid construct of the present invention, being a nucleic acid construct system comprising at least two nucleic acid constructs each expressing at least one of the drmM, the drmA, the drmB, the drmC, the drmD and/or the drmE.

According to some embodiments of the invention, the construct encodes a polycistronic mRNA comprising the polynucleotide.

According to some embodiments of the invention, there is provided a transmissible genetic element comprising the construct of the present invention.

According to some embodiments of the invention, the transmissible genetic element comprises a conjugative genetic element or mobilizable genetic element.

According to some embodiments of the invention, the phage comprises a double stranded DNA genome.

According to some embodiments of the invention, the phage is a Caudavirales.

According to some embodiments of the invention, the phage is a lytic phage.

According to some embodiments of the invention, the phage is a temperate phage. According to some embodiments of the invention, the drmM polypeptide is selected from the group consisting of: a drmMI polypeptide, the drmMI polypeptide comprising a S-adenosyl- L-methionine-dependent methyltransferase (SSF5335) domain; and a drmMII polypeptide the drmMII polypeptide comprising a pfam00145 domain.

According to some embodiments of the invention, the drmM polypeptide methylates a

CCWGG (SEQ ID NO: 3321) motif.

According to some embodiments of the invention, the drmA being about 1,100-1,300 amino acids long.

According to some embodiments of the invention, the drmD further contains a pfam00271 domain.

According to some embodiments of the invention, the DISARM system is a Type 1 DISARM system comprising the drmM, the drmA, the drmB and the drmD.

According to some embodiments of the invention, the drmD, the drmM, the drmA and the drmB are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to some embodiments of the invention, the DISARM system is a Type 2

DISARM system comprising the drmM, the drmA, the drmB and the drmE.

According to some embodiments of the invention, the drmE, the drmA, the drmB and the drmM, are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to some embodiments of the invention, the DISARM system further comprising a drmC polypeptide, the drmC polypeptide comprising a pfam 13091 domain.

According to some embodiments of the invention, the drmA, the drmB and the drmC are positioned sequentially 5' to 3' on in a genome of a prokaryotic cell.

According to some embodiments of the invention, the prokaryotic cell is selected from the group consisting of the prokaryotes listed in Tables 1A-C.

According to some embodiments of the invention, the drmM polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1639-1894, 3045-3087 and 3285-3286;

the drmMI polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1639-1894;

the drmMII polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 3045-3087 and 3285-3286; the drmA polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1895-2172, 2916-2958 and 3195- 3224; the drmB polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence encoded by a nucleic acid sequence selected SEQ ID NOs: 2173-2450, 2959-3001 and 3225-3254;

the drmC polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 2451-2728, 3002-3044 and 3255- 3284;

the drmD polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1365-1638 and 3335-3339; and/or

the drmE polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 3088-3102.

According to some embodiments of the invention, the drmE polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 3088-3102.

According to some embodiments of the invention, the DISARM system is characterized by at least one of:

(a) not causing an abortive infection;

(b) not affecting phage adsorption to a bacteria expressing same;

(c) preventing phage genomic replication in a bacteria expressing same;

(d) preventing phage lysogeny in a bacteria expressing same;

(e) preventing circularization of phage genome in a bacteria expressing same;

(f) leading to degradaiotn of phage genome in a bacteria expressing same; and/or

(g) being a restriction modification system.

According to an aspect of some embodiments of the present invention there is provided an isolated polypeptide comprising an amino acid sequence of at least two DISARM system components selected from the group consisting of:

a drmM polypeptide, the drmM polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1639-1894, 3045-3087 and 3285-3286;

a drmA polypeptide, the drmA polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1895-2172, 2916-2958 and 3195-3224; a drmB polypeptide, the drmB polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 2173-2450, 2959-3001 and 3225-3254;

a drmC polypeptide, the drmC polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 2451-2728, 3002-3044 and 3255-3284;

a drmD polypeptide, the drmD polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1365-1638 and 3335-3339; and

a drmE polypeptide, the drmE polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 3088-3102.

According to some embodiments of the invention, the polypeptide comprising an amino acid sequence of a DISARM system having an anti-phage activity, the system comprising: the drmM polypeptide; the drmA polypeptide; the drmA polypeptide; the drmB polypeptide; and the drmD polypeptide or the drmE polypeptide.

Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIG. 1 demonstrates alignment of Illumina reads from whole genome sequencing of the constructed B. subtilis BEST7003 containing complete DISARM system against the DISARM systems with the indicated deletions. Shown is the DISARM locus. Each track represents a different deletion strain, as indicated on the left. X-axis represents genomic coordinate on the constructed strain. For each curve, Y-axis represents read coverage, with absence of coverage representing the deletion. Vertical blue line at the delta-drmE strain represents a L216P substitution in a non-conserved residue. Curves were prepared using IGV.

FIGs. 2A-B are schematic representations of Type 1 and Type 2 DISRAM systems identified in bacteria and archaeal. Figure 2A demonstrates the Type 1 DISARM systems comprising the core gene triplet: drmA, a gene with a helicase domain (marked in orange); drmB, a gene containing a DUF1998 domain (marked in yellow); and drmC, a gene containing a PLD domain (marked in green), preceded by drmD, an SNF2-like helicase (marked in pink) and drmMI, an adenine methylase (marked in peach). Figure 2B demonstrates the Type 2 DISARM systems comprising the core gene triplet as in Figure 2A, drmMII, a cytosine methylase (marked in blue) and drmE a gene of encoding a protein of -800 amino acids (marked in red). RefSeq genome accession Nos. are indicated.

FIGs. 3A-F demonstrate that the DISARM system Type 2 provides protection against phages. Figure 3A is a schematic representation of the DISARM locus of Bacillus paralicheniformis ATCC 9945a. The numbers below the X-axis represent position on the B. paralicheniformis genome. Locus tags are provided for each gene (SEQ ID NOs: 3322-3331, from left to right). Figure 3B is a growth curve demonstrating that insertion of the DISARM locus into the Bacillus subtilis BEST7003 genome does not impair bacterial growth. Curves show the mean of 2 biological repeats with 3 technical repeats each. Error bars are 95 % confidence interval of the mean. Figures 3C-E are growth curves demonstrating that DISARM system type 2 provides protection against phi3T (Figure 3C), Nf (Figure 3D) and SPOl (Figure 3E) phages. Bacteria were infected at time=0 at multiplicities of infection (MOIs) of 0.05, 0.5 and 5 as denoted in the Figures. Curves show the mean of 2 biological repeats with 3 technical repeats each. Error bars are 95% confidence interval of the mean. Figure 3F is a bar graph demonstrating reduced plaque formation on DISARM-containing strains. The Y-axis represents concentration of plaque forming units (PFU). Shown is mean of 3 replicates; error bars are SD of the mean.

FIGs. 4A-D demonstrate phage adsorption and DNA replication in DISARM-containing B. subtilis cells. Figure 4A is a bar graph demonstrating that adsorption of phi3T phage to DISARM-containing B. subtilis cells (red bars) was not impaired compared to control B. subtilis cells (grey bars). Bars represent mean of 3 experiments, error bars are SEM. Figure 4B is a graph demonstrating the ratio of phage DNA to bacterial DNA during infection. Total DNA was extracted from infected bacteria (MOI=l) at the indicated time points and sequenced using an Illumina sequencer. The Y-axis represents relative phage DNA concentrations compared to bacterial genome equivalents, normalized to the value at t=5 minutes post infection. Figure 4C demonstrates that DISARM prevents lysogeny of phages. Shown is an agarose gel of multiplex PCR with 3 primer sets, aimed to detect bacterial DNA, phage DNA and lysogeny as schematically represented on the right. Lanes denote minutes post infection; U lane denotes the uninfected control. Figure 4D demonstrated that DISARM prevents phage circularization. Shown is an agarose gel of multiplex PCR with facing primers at the edges of the phi3T genome aimed to detect phage genome circularization as schematically represented on the right. Lanes correspond to the lanes in Figure 4C.

FIG. 5 demonstrates that deletion of drmE, drmA, drmB or drmC does not effect bacterial growth. B. subtilis control bacteria (black lines), B. subtilis bacteria containing complete DISARM Type 2 system (red lines) and B. subtilis bacteria containing DISARM Type 2 system with the indicated gene deletions were grown in MMB medium for 5.5 hours and OD (Y-axis) was recorded. Curves show the mean of two biological repeats with 3 technical repeats each. Error bars represent 95 % confidence interval of the mean.

FIG. 6A-F are growth curves demonstrating the effect of deletion of DISARM Type 2 components on protection of B. subtilis from phage infection. Figures 6A-C demonstrate that deletion of drmE, drmA or drmB abolished DISARM defense against phi3T infection. Figures 6D-F demonstrate that deletion of drmC had no effect on the defense against phi3T infection (Figure 6D), but reduced protection against Nf (Figure 6E) and SPOl (Figure 6F) infection. Note that the drmC deletion strains were still protected against Nf and SPOl infection compared to the control B. subtilis bacteria. Curves show the mean of 2 biological repeats with 2 technical repeats each, error bars represent 95 % confidence interval of the mean. Infections were performed at MOI=0.5.

FIG. 7 show growth curves demonstrating that deletion of drmE, drmA or drmB abolished

DISARM defense against all tested phages: phi3T, Nf and SPOl. Curves show the mean of 2 biological repeats with 2 technical repeats each, error bars represent 95 % confidence interval of the mean. Infections were performed at MOI=0.5.

FIG. 8 is a bar graph demonstrating that transformation with a plasmid containing DISARM Type 2 with a deletion of drmMII is significantly less efficient than transformation with the complete DISARM Type 2 system. The Y-axis represent the number of colonies per plate following transfomration and overnight incubation. Bars show the mean of 2 biological repeats with 3 technical repeats each, error bars represent 95 % confidence intervals of the mean. FIGs. 9A-B demonstrate that the DISARM provides protection against phages. Figure 9A shows growth curves demonstrating that DISARM system type 2 provides protection against phil05, SPP1, SPR and phi29 phages. Bacteria were infected at time=0 at multiplicities of infection (MOIs) of 0.05, 0.5 and 5 as denoted in the Figure (except for SPR where MOI was 0.003, 0.03 and 0.3, respectively, due to low phage titer). Curves show the mean of 3 technical repeats of each independent biological experiment. Figure 9B is a bar graph demonstrating reduced plaque formation of the indicated phages on DISARM-containing B. subtilis strains. The Y-axis represents concentration of plaque forming units (PFU). Shown is mean of 3 replicates; error bars are SD of the mean.

FIG. 10 demonstrates that Nf and SPOl escape from DISARM system Type 2 is not due to genetic or epigenetic traits, as determined by escape phage plating. For each of the phages Nf and SPOl, eight isolates (escapees) from plaques formed on DISARM-containing B. subtilis bacteria were re -plated on DISARM-containing and DISARM-lacking B. subtilis cells at equal concentrations. The EOP of the escape phages propagated on DISARM-containing cells was similar to that of the ancestral phage propagated on DISARM-lacking cells. Shown are representative images of 2 independent repeats.

FIG. 11 is a bar graph demonstrating DISARM system Type 2 does not affect plasmid transformation efficiency. DISARM-containing and DISARM-lacking B. subtilis cells were transformed through natural competence with 100 fmol of the episomal plasmid pHCMC05. Following the transformation, the cultures were plated on both antibiotic-selective plates and LB plates, and transformation efficiency was calculated as the ratio between the number of transformants and the number of cells in the culture as measured on the LB plates. Bars represent mean of 2 independent repeats, error bars represent standard deviation.

FIGs. 12A-B demonstrate that DISARM does not block phage DNA injection into the infected cell, but causes intracellular phage DNA decay. Figure 12A shows representative fluorescence microscopy images of phage DNA in co-cultures of DISARM-lacking (expressing RFP, i.e. red cells) and DISARM-containing (light blue cells) B. subtilis cells in a microfluidic device that allows visualization of a single bacterial layer. Both strains constitutively express LacI-CFP. SPP1 phages containing a LacO array (105 p.f.u. μΓ ¹ ) were flowed into the device from t = 15 min to t = 45 min and an image was taken every 5 min. Upon injection of phage DNA, a fluorescent focus of LacI-CFP was formed on the LacO array in the phage DNA. White arrows show foci in DISARM-lacking cells, which did not disappear, and grew in size through the time course. Foci on DISARM-containing cells appeared (filled yellow arrows) but later disappeared (open yellow arrows). Scale bars represent 5 μιη. Figure 12B is a quantification of phage foci over time in the microscopy field, of which a subsection is shown in Figure 12A. The shaded area represents the time where phages were continuously flowed in.

FIG. 13A-E demonstrate the effect of deletion of DISARM Type 2 drmC on protection of B. subtilis from phage infection. Figures 12A-D demonstrate that deletion of drmC had no effect on the defense against phil05 infection (Figure 13A), phi29 infection (Figure 13B) or SPR infection (Figure 13C), but reduced protection against SPP1 infection (Figure 13D) infection. Note that the drmC deletion strains were still protected against SPP1 infection compared to the control DISARM-lacking B. subtilis bacteria. Curves show the mean of 3 technical repates for each biological repeat. Infections were performed at MOI=0.5. Figure 13E is a bar graph showing EOP of Nf phage on DISARM- (grey bar), DISARM+ (red bar) and drmC deletion (blue bar) B. subtilis strains. Bars represent mean of 2 biological repeats, error bars represent standard deviation.

FIGs. 14A-B demonstrate that methylated phages do not escape DISARM defense. Figure 14A shows methylation ratio of CCWGG (SEQ ID NO: 3321) positions in the phi3T genome, as inferred from bisulfite sequencing. X-axis represents the 78 CCWGG motifs in phi3T, arranged serially according to their position on the phi3T genome. Y-axis represents the fraction of bisulfite-treated sequences that maintained a cytosine (indicating methylation) for each position. In blue: phi3T that was propagated on BEST7003 cells is not methylated in CCWGG motifs. In red, phi3T that was propagated on cells constitutively expressing the DrmMII methylase is methylated at CCWGG sites, except for the 3 sites that overlap GGCC sites, which are methylated by the phi3T native methylase. Figure 14B shows that CCWGG- methylated phi3T phages do not overcome DISARM protection.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

The present invention, in some embodiments thereof, relates to isolated cells genetically modified to express a DISRAM system having an anti-phage activity and methods of using same.

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

The evolutionary pressure imposed by phage predation on bacteria has resulted in the development of both anti-phage bacterial resistance systems and counter-resistance mechanisms developed by phages. Harnessing the anti-phage bacterial mechanisms to improve industrial processes by e.g. curtailing the propagation and evolution of phages in fermentation vats in the manufacturing of food products, commodity chemicals, and biotechnology products is a standing goal in biological research. On the counter arm, properly formulated and applied phages or their defense mechanisms have sufficient potential to cure bacterial infections.

Whilst reducing the present invention to practice, the present inventors have now uncovered a novel multi-gene phage resistance system broadly distributed in bacteria and archaea, which the present inventors denoted DISARM (Defense Island System Associated with Restriction-Modification). Specifically, the present inventors have uncovered that DISARM system confers resistance against phages spanning a wide phylogeny of phage types, including lytic and temperate (also referred lysogenic) phages. Alternatively, mutations (e.g.; deletion of drmA, drmB or drmE) affecting the functionality of the DISARM system abrogate phage resistance.

Taken together, the present teachings suggest that DISARM system and functional portions thereof can be used for conferring phage resistance. Such naturally and engineered bacteria can be utilized for example in the dairy industry, where phages cause serious annual losses, as well as in other industries that rely on large-scale bacterial fermentation for biotechnological production. Alternatively, anti-DISARM system agents can be used as antibiotics.

As is illustrated hereinunder and in the Examples section which follows, the present inventors have uncovered that DISARM system exists in >350 sequenced genomes of bacteria and archaea and can be roughly divided into two subtypes containing 5 genes each; including genes with helicase-related domains, a DNA methyltransferase, and a phospholipase D domain- containing gene, three of which are core genes present in both subtypes: a pfam00271 -containing gene (denoted herein as drmA), a DUF1998-containing gene (denoted herein as drmB) and a pfaml3091-containing gene (denoted herein as drmC) (Tables 1A-C hereinbelow, Example 1, Figures 2A-B). The inventors have further demonstrated that engineering the Bacillus paralicheniformis 9945A DISARM system (type 2 DISARM) into Bacillus subtilis lacking an endogenous DISARM system has rendered the engineered bacterium protected against phages from all 3 major families of tailed double- stranded DNA phages (Example 2, Figures 3A-E and 9A-B). Using a series of deletion strains the inventors show that four of the five genes are essential for DISARM-mediated defense, with the fifth (drmC) being redundant for defense against some of the phages tested (Example 4, Figures 1, 5, 6A-F, 7 and 13A-E). The present inventors have gained insight into DISARM mechanism of action (Example 3, Figures 3C-E, 4A-D, 10, 11, 12A-B and 14A-B), accordingly it is demonstrated that integration of the type 2 DISARM into Bacillus subtilis strain allows phage adsorption and DNA injection but prevents phage lysogeny and phage DNA replication and probably also causes phage DNA degradation. The data also indicates that DISARM does not cause abortive infection (Abi). In addition, the system methylates the host chromosomal DNA at a specific motif (CCWGG, SEQ ID NO: 3321) thus serving as a marker of self/foreign DNA akin to restriction-modification systems. Consistently, inventors' attempts to clone a methyltransferase-deleted type 2 DISARM system into B. subtilis yielded very low transformation efficiency (Example 4, Figure 8), while some of the resulting transformed colonies showed massive deletions or frameshift mutations in the DISARM locus in addition to the intended deletion. This suggests that in the absence of the methyltransferase (drmM) the DISARM system is toxic to the cells and only cells with a defective DISARM locus can survive.

Hence, in some aspects DISARM can be viewed as a new type of multi-gene restriction- modification module. Furthermore, in the absence of methylation in the bacterial chromosome on e.g. CCWGG motif (SEQ ID NO: 3321), the restriction components in the DISARM system attack the chromosome leading to the observed toxicity.

Consequently, the present invention provides isolated cells, methods and compositions for use in the food, feed, medical and veterinary industries to confer phage resistance. Embodiments further relate to methods and compositions suitable for use in the food, feed, medical and veterinary industries to generate phage with broader host range that can be used for more effective bio-control of bacteria. Further embodiments exploit the restriction-modification characteristics of the DISARM system for cloning and for cutting a desired nucleic acid sequence.

Thus, according to a first aspect of the present invention, there is provided a nucleic acid construct comprising a polynucleotide encoding at least two DISARM system components selected from the group consisting of:

a drmM polypeptide, said drmM polypeptide containing a methyltransferase domain; a drmA polypeptide, said drmA polypeptide comprising a pfam00271 domain;

a drmB polypeptide, said drmB polypeptide comprising a pfam09369 domain;

a drmC polypeptide, said drmC polypeptide comprising a pfaml3091 domain;

a drmD polypeptide, said drmD polypeptide comprising a pfam00176 domain; and a drmE polypeptide, said drmE polypeptide being encoded by a gene positioned within 5 genes of a gene encoding said drmM, said drmA and/or said drmB in a genome of a prokaryotic cell, and a regulatory element selected from the group consisting of: a cis-acting regulatory element for directing expression of said polynucleotide, a transmissible element for directing transfer of said polynucleotide from one cell to another and a recombination element for integrating said polynucleotide into a genome of cell transfected with said construct.

According to specific embodiments, the nucleic acid construct comprises a polynucleotide encoding 2, 3, 4 or 5 of the DISARM system components described herein.

According to specific embodiments, the nucleic acid construct comprises a polynucleotide encoding 2, 3 or 4 of the DISARM system components described herein.

According to specific embodiments, the nucleic acid construct comprises a polynucleotide encoding 2 or 3 of the DISARM system components described herein.

According to specific embodiments, the nucleic acid construct comprises a polynucleotide encoding 3 or 4 of the DISARM system components described herein.

According to specific embodiments, the nucleic acid construct comprises a polynucleotide encoding 4, 5 of the DISARM system components described herein.

According specific embodiments, the nucleic acid construct comprises a polynucleotide encoding a DISARM system having an anti-phage activity, the system comprising: said drmM polypeptide; said drmA polypeptide; said drmA polypeptide; said drmB polypeptide; and said drmD polypeptide or said drmE polypeptide.

According to specific embodiments, the DISARM system further comprises a drmC polypeptide, said drmC polypeptide comprising a pfaml3091 domain.

According to specific embodiments, the nucleic acid construct comprises a polynucleotide encoding 1, component of the DISARM system components described herein. For instance drmM, drmA, drmB, drmC, drmD or drmE, whereby a plurality of constructs can be used to assemble a functional DISARM system, as described below.

As used herein "DISARM system" or a "functional DISARM system", refers to a multi- gene system which comprises at least the minimal number of drm genes, as defined below, which expression is sufficient to elicit an anti-phage activity.

The expression can be transient or consistent, episomal or integrated into the chromosome of the cell. According to specific embodiments, the expression is on a transmissible genetic element.

As used herein, the terms "anti-phage activity" or "resistant to infection by at least one phage" refers to an increase in resistance of a bacteria expressing a functional DISARM system to infection by at least one phage in comparison to a bacteria of the same species under the same developmental stage (e.g. culture state) which does not express a functional DISARM system, as may be determined by e.g. bacterial viability, phage lysogeny, phage genomic replication and phage genomic degradation. The phage can be a lytic phage or a temperate (lysogenic) phage as further described hereinbelow. According to specific embodiments the increase is at least 1.5 fold, at least 2 fold, at least 3 fold, at least 5 fold, at least 10 fold, or at least 20 fold as compared to same in the absence of the functional DISARM system.

According to other specific embodiments the increase is by at least 5 %, by at least a 10 %, at least 20 %, at least 30 %, at least 40 %, at least 50 %, at least 60 %, at least 70 %, at least 80 %, at least 90 % or more than 100 % as compared to same in the absence of the functional DISARM system.

Assays for testing phage resistance are well known in the art and described hereinbelow. According to specific embodiments, the functional DISARM system is characterized by at least one of:

(a) not causing an abortive infection;

(b) not affecting phage adsorption to a bacteria expressing same;

(c) preventing phage genomic replication in a bacteria expressing same;

(d) preventing phage lysogeny in a bacteria expressing same;

(e) preventing circularization of phage genome in a bacteria expressing same;

(f) leading to degradation of phage genome in a bacteria expressing same;

(g) being a restriction modification system; and/or

(h) not affecting phage DNA injection to a bacteria expressing same;

each possibility represents a separate embodiment of the present invention.

The functional DISARM system may be characterized by one, two, three, four, five, six, seven or all of (a) - (h).

According to specific embodiments, the functional DISARM system is characterized by at least (a) + (b), (a) + (c), (a) + (d), (a) + (e), (a) + (f), (a) + (g), (b) + (c), (b) + (d), (b) + (e), (b) + (f), (b) + (g), (c) + (d), (c) + (e), (c) + (f), (c) + (g), (d) + (e), (d) + (f), (d) + (g), (e) + (f). (e) + (g) and/or (e) + (f).

According to specific embodiments, the functional DISARM system is characterized by at least (a) + (h), (b) + (h), (c) + (h), (d) + (h), (e) + (h), (f) + (h) and/or (g) + (h).

According to a specific embodiment, the functional DISARM system is characterized by (a) + (b) + (c) + (d) + (e) + (f) + (g).

According to a specific embodiment, the functional DISARM system is characterized by

(a) + (b) + (c) + (d) + (e) + (f) + (g) + (h).

As used herein "abortive infection (Abi)" refers to a controlled cell death of an infected bacterial cell which takes place prior to the production of phage progeny, thus protecting the culture from phage propagation. Methods of analyzing Abi include, but are not limited to cell survival assays using high multiplicity of infection, one step growth assays and determination of phage DNA replication by e.g. DNA sequencing and southern blot analysis as further described hereinbelow.

As used herein, the phrase "not affecting phage adsorption" refers to a non-statistically significant difference in phage adsorption to bacteria expressing a functional DISARM system in comparison to a bacteria of the same species under the same developmental stage (e.g. culture state) which does not express a functional DISARM system.

As used herein "adsorption" refers to the attachment to the host (e.g. bacteria) cell surface via plasma membrane proteins and glycoproteins. Methods of analyzing phage adsorption include, but are not limited to enumerating free phages in bacterial cultures infected with the phages immediately after phage addition and at early time points (e.g. 30 minutes) following phage addition as further described hereinbelow.

As used herein, the term "prevent" or "preventing" refers to a decrease in activity (e.g. phage genomic replication, phage lysogeny, circularization of phage genome) in a bacteria expressing a functional DISARM system in comparison to a bacteria of the same species under the same developmental stage (e.g. culture state) which does not express a functional DISARM system. According to specific embodiments the decrease is at least 1.5 fold, at least 2 fold, at least 3 fold, at least 5 fold, at least 10 fold, or at least 20 fold as compared to same in the absence of the functional DISARM system.

According to other specific embodiments the decrease is by at least 5 %, by at least a 10

%, at least 20 %, at least 30 %, at least 40 %, at least 50 %, at least 60 %, at least 70 %, at least 80 %, at least 90 %, at least 95 % or 99 % or 100 % as compared to same in the absence of the functional DISARM system.

As used herein "phage genomic replication" refers to production of new copies of the phage genome which can be dsDNA or ssDNA. Methods of analyzing phage genomic replication are well known in the art and described e.g. in Goldfarb et al. ¹⁰ , and in the Examples section which follows.

As used herein, the term "lysogeny" refers to the incorporation of the phage genetic material inside the genome of the host (e.g. bacteria). Methods of analyzing phage lysogeny are well known in the art and include, but not limited to, DNA sequencing and PCR analysis. Typically, when a temperate phage infects a bacterium, its genetic material becomes circular before it incorporates into the bacterial genome. Circularization of phage genome can be analyzed by methods well known in the art including, but not limited to, PCR analysis as described e.g. in the Examples section which follows. When referring to "degradation of phage genome" the meaning is the cleavage of the foreign phage genome by the host bacteria. Method of analyzing genomic degradation are well known in the art including, but not limited to, DNA sequencing and PCR analysis.

As used herein "restriction modification system" typically comprises, a restriction entity having an activity of cleaving a genomic molecule (e.g. DNA) / DNA and a modification entity capable of protecting (e.g., by methylation) the host DNA from the cleavage by the restriction enzyme e.g. by methylating the host DNA. Analyzing restriction modification mode of action include, but is not limited to, evaluation of host specific methylation, presence of degraded foreign DNA and host cell death in the absence of the modification enzyme by methods described infra.

As used herein, the phrase "not affecting phage DNA injection" refers to a non- statistically significant difference in phage DNA injection into a bacteria expressing a functional DISARM system in comparison to a bacteria of the same species under the same culture stage which does not express a functional DISARM system.

A non-limiting example of a method of analyzing phage DNA injection is disclosed in

Jakutyte, L. et al. J. Bacteriol. 193, 4893-4903 (2011); and Jakutyte, L. et al. Virology 422, 425- 434 (2012) and is further described in the Examples section hereinbelow.

As described herein, the DISARM system uncovered by the present inventors is a multi- gene phage resistance system broadly distributed in bacteria and archaea. According to specific embodiments, the DISARM system components are located in gene cluster in a prokaryotic cell. According to specific embodiments the prokaryotic cell expresses an endogenous DISARM system. According to specific embodiments, the prokaryotic cell expresses an endogenous functional DISARM system. According to specific embodiments, the prokaryotic cell is selected from the group consisting of the prokaryotes listed in Tables 1A-C.

The term "endogenous" as used herein, refers to the expression of the native gene in its natural location and expression level in the genome of an organism.

Altogether, the DISARM system components comprise drmM, drmA, drmB, drmC, drmD and drmE and functional portions thereof. Non-limiting exemplary DISARM systems and the respective location of their components are shown in Figures 2A-B and Table 1A-C hereinbelow.

As used herein the term "pfam" refers to a large collection of protein domains and protein families maintained by the pfam consortium and available at several sponsored world wide web sites, including for example: pfam.sanger.ac.uk/ (Welcome Trust, Sanger Institute); pfam.sbc.su.se/ (Stockholm Bioinformatics Center); pfam.janelia.org/ (Janelia Farm, Howard Hughes Medical Institute); pfam.jouy.inra.fr/ (Institut national de la Recherche Agronomique); and pfam.ccbb.re.kr/. Pfam domains and families are identified using multiple sequence alignments and hidden Markov models (HMMs) (see e.g. R.D. Finnet et al. Nucleic Acids Research Database (2010) Issue 38: D211-222). By accessing the pfam database, for example, using any of the above-reference websites, protein sequences can be queried against the hidden Markov models (HMMs) using HMMER homology search software (e.g., HMMER3, hmmer.janelia.org/).

As used herein, the term "drmM" refers to the polynucleotide and expression product e.g., polypeptide of the drmM gene. According to specific embodiments, the term "drmM" refers to a drmM polypeptide. The product of the drmM gene contains a methyltransferase domain. According to specific embodiments, the drmM gene is positioned such that it is the closest methyltransferase containing gene to a drmB gene on a genome of a prokaryotic cell. According to specific embodiments, drmM methylates the host (e.g. bacteria) genome. According to a specific embodiment, the drmM drives motif-specific (e.g. according to specific embodiments, the drmM methylates a cysteine residue in CCWGG (SEQ ID NO: 3321) motif) methylation on the genomic DNA of a host cell (e.g. bacteria) expressing same. According to specific embodiments the methylation is non-palindromic. According to specific embodiments the drmM does not methylate a phage genome. Methods of analyzing methylation are well known in the art and include, but not limited to, bisulfite sequencing; array or bead hybridization; methyl- sensitive cut counting: endonuclease digestion followed by sequencing; methylation- specific PCR; and PacBio sequencing platform.

According to specific embodiments the methylation serves as part of the self/non-self recognition machinery of DISARM.

drmM with at least drmA, drmB, and drmD or drmE; and optionally drmC, comprise the DISARM system. drmM is a critical gene as the present inventors have shown that cloning of a methyltransferase-deleted type 2 DISARM system into B. subtilis yielded very low transformation efficiency, while some of the resulting transformed colonies showed massive deletions or frameshift mutations in the DISARM locus in addition to the intended deletion. This suggests that a DISARM system not comprising drmM is toxic to a cell expressing it.

According to specific embodiments, drmM polypeptide is encoded by a gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmM polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmM gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmM polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmA, drmB, drmC, drmD and/or drmE in a genome of a prokaryotic cell; each possibility represents a separate embodiment of the present invention.

According to specific embodiments, drmM polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmM gene positioned within 5 genes of a gene encoding drmA, drmB, drmC, drmD and/or drmE in a genome of a prokaryotic cell.

According to specific embodiments, drmM polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmA, a gene encoding drmB and a gene encoding drmC in a genome of a prokaryotic cell.

According to specific embodiments, drmM polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmM gene positioned within 5 genes of a gene encoding drmA, a gene encoding drrnfi and a gene encoding rm in a genome of a prokaryotic cell.

According to specific embodiments, drmM, drmA, drmB and drmC are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmM and drmA are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmD and drmM are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmA, drmB, drmC and drmM are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmC and drmM are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmM polypeptide is about 500-1600 amino acids long.

According to specific embodiments, the drmM polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1639-1894, 3045-3087 and 3285-3286. According to specific embodiments, the drmM polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1639-1894, 3045-3087 and 3285-3286.

According to specific embodiments, the drmM polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1639-1894, 3045-3087 and 3285- 3286.

According to specific embodiments, the drmM polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 275-530, 2858-2900 and 3193-3194.

According to specific embodiments, the drmM polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence selected from the group consisting of SEQ ID NO: 275-530, 2858-2900 and 3193-3194.

According to specific embodiments, the drmM polypeptide is selected from the group consisting of: a drmMI polypeptide, said drmMI polypeptide comprising a S-adenosyl-L- methionine-dependent methyltransferases (SSF5335) domain; and a drmMII polypeptide, said drmMII polypeptide comprising a pfam00145 domain.

According to specific embodiments, drmM is drmMI.

As used herein, the term "drmMI" refers to the polynucleotide and expression product e.g., polypeptide of the drmMI gene. According to specific embodiments, the term "drmM/" refers to a drmMI polypeptide. The product of the drmMI gene contains the DNA adenine N6 methyltransferase domain S-adenosyl-L-methionine-dependent methyltransferase (SSF5335) domain. According to specific embodiments, the product of the drmMI gene contains a pfaml3659 domain. drmMI with at least drmA, drmB, and drmD or drmE; and optionally drmC, comprise a DISARM system. According to specific embodiments drmMI with at least drmA, drmB, and drmD; and optionally drmC, comprise a DISARM system.

According to specific embodiments, drmMI polypeptide is encoded by a gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmMI polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmMI gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell. According to specific embodiments, drmMI polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmA, drmB, drmC and/or drmD in a genome of a prokaryotic cell; each possibility represents a separate embodiment of the present invention.

According to specific embodiments, drmMI polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmMI gene positioned within 5 genes of a gene encoding drmA, drmB, drmC and/or drmD in a genome of a prokaryotic cell.

According to specific embodiments, drmMI polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmA, a gene encoding drmB and a gene encoding drmC in a genome of a prokaryotic cell.

According to specific embodiments, drmMI polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmMI gene positioned within 5 genes of a gene encoding drmA, a gene encoding drmB and a gene encoding drmC in a genome of a prokaryotic cell.

According to specific embodiments, drmMI, drmA, drmB and drmC are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmMI and drmA are positioned contiguously 5' to

3' in a genome of a prokaryotic cell.

According to specific embodiments, drmD and drmMI are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmMI polypeptide is about 500-1600 amino acids long.

According to specific embodiments, drmMI polypeptide is about 1300 amino acids long.

According to specific embodiments, drmMI polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1639-1894.

According to specific embodiments, the drmMI polypeptide comprises an amino acid sequence having at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1639-1894.

According to specific embodiments, the drmMI polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1639-1894. According to specific embodiments, the drmMI polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 275-530.

According to specific embodiments, the drmMI polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 275-530.

According to specific embodiments, drmM is drmMII.

As used herein, the term "drmMII" refers to the polynucleotide and expression product e.g., polypeptide of the drmMII gene. According to specific embodiments, the term "drmM refers to a drmMII polypeptide. The product of the drmMII gene contains the DNA 5-cytosine methyltransferase pfam00145 domain. According to specific embodiments, the drmMII polypeptide methylates a cysteine residue in CCWGG (SEQ ID NO: 3321) motif. drmMII with at least drmA, drmB, and drmD or drmE; and optionally drmC, comprise a DISARM system. According to specific embodiments drmMII with at least drmA, drmB, and drmE; and optionally drmC, comprise a DISARM system.

According to specific embodiments, drmMII polypeptide is encoded by a gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmMII polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmMII gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmMII polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmA, drmB, drmC and/or drmE in a genome of a prokaryotic cell; each possibility represents a separate embodiment of the present invention.

According to specific embodiments, drmMII polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmMII gene positioned within 5 genes of a gene encoding drmA, drmB, drmC and/or drmE in a genome of a prokaryotic cell.

According to specific embodiments, drmMII polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmA, a gene encoding drmB and a gene encoding drmC in a genome of a prokaryotic cell. According to specific embodiments, drmMII polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmMII gene positioned within 5 genes of a gene encoding drmA, a gene encoding drrnfi and a gene encoding rm in a genome of a prokaryotic cell.

According to specific embodiments, drmA, drmB, drmC and drmMII are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmC and drmMII are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, the drmMII polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 3045-3087 and 3285-3286.

According to specific embodiments, the drmMII polypeptide comprises an amino acid sequence having at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 3045-3087 and 3285-3286.

According to specific embodiments, the drmMII polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3045-3087 and 3285-3286.

According to specific embodiments, the drmMII polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 2858- 2900 and 3193-3194.

According to specific embodiments, the drmMII polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2858-2900 and 3193-3194.

As used herein, the term "drmA " refers to the polynucleotide and expression product e.g., polypeptide of the drmA gene. According to specific embodiments, the term "drmA" refers to a drmA polypeptide. The product of the drmA gene contains the helicase pfam00271 domain. According to specific embodiments, the drmA is the closest pfam00271 containing gene to a drmB gene on a genome of a prokaryotic cell. drmA with at least drmM, drmB, and drmD or drmE; and optionally drmC, comprise a DISARM system.

According to specific embodiments, drmA polypeptide is encoded by a gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell. According to specific embodiments, drmA polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmA gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmA polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmM, drmB, drmC, drmD and/or drmE in a genome of a prokaryotic cell; each possibility represents a separate embodiment of the present invention.

According to specific embodiments, drmA polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmA gene positioned within 5 genes of a gene encoding drmM, drmB, drmC, drmD and/or drmE in a genome of a prokaryotic cell.

According to specific embodiments, drmA polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmB and a gene encoding drmC in a genome of a prokaryotic cell.

According to specific embodiments, drmA polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmA gene positioned within 5 genes of a gene encoding drmB and a gene encoding drmC in a genome of a prokaryotic cell.

According to specific embodiments, drmA, drmB and drmC are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmA, drmB and drmC are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmA and drmB are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmA and drmB are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmE and drmA are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmE and drmA are positioned contiguously 5' to 3' in a genome of a prokaryotic cell. According to specific embodiments, the drmA polypeptide is about 1,100-1,300 amino acids long.

According to specific embodiments, the drmA polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1895-2172, 2916-2958 and 3195-3224.

According to specific embodiments, the drmA polypeptide comprises an amino acid sequence having at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1895-2172, 2916-2958 and 3195-3224.

According to specific embodiments, the drmA polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1895-2172, 2916-2958 and 3195- 3224.

According to specific embodiments, the drmA polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 531-808, 2729-2771 and 3103-3132.

According to specific embodiments, the drmA polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 531-808, 2729-2771 and 3103-3132.

As used herein, the term "drmB" refers to the polynucleotide and expression product e.g., polypeptide of the drmB gene. According to specific embodiments, the term "drmB" refers to a drmB polypeptide. The product of the drmB gene contains a pfam09369 (DUF1998) domain. drmB with at least drmM, drmA, and drmD or drmE; and optionally drmC, comprise a DISARM system.

According to specific embodiments, drmB contains only the pfam09369 domain with no other known domain of the domains known upon filing of the instant application (i.e. according to the Integrated Microbial Genomes (IMG) database from June 2016).

According to specific embodiments, drmB polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmM, drmA, drmC, drmD and/or drmE in a genome of a prokaryotic cell; each possibility represents a separate embodiment of the present invention.

According to specific embodiments, drmB polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmB gene positioned within 5 genes of a gene encoding drmM, drmA, drmC, drmD and/or drmE in a genome of a prokaryotic cell. According to specific embodiments, drmB polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmA and a gene encoding drmC in a genome of a prokaryotic cell.

According to specific embodiments, drmB polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drrnfi gene positioned within 5 genes of a gene encoding drmA and a gene encoding drmC in a genome of a prokaryotic cell.

According to specific embodiments, drmB and drmC are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmB and drmC are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, the drmB polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 2173-2450, 2959-3001 and 3225-3254.

According to specific embodiments, the drmB polypeptide comprises an amino acid sequence having at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 2173-2450, 2959-3001 and 3225-3254.

According to specific embodiments, the drmB polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2173-2450, 2959-3001 and 3225- 3254.

According to specific embodiments, the drmB polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 809- 1086, 2772-2814 and 3133-3162.

According to specific embodiments, the drmB polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 809-1086, 2772-2814 and 3133-3162.

As used herein, the term "drmC" refers to the polynucleotide and expression product e.g., polypeptide of the drmC gene. According to specific embodiments, the term "drmC refers to a drmC polypeptide. The product of the drmC gene contains a phospholipase D (PLD) pfaml3091 domain. According to specific embodiments, the drmC is the closest pfaml3091 containing gene to a drmB gene on a genome of a prokaryotic cell. DrmC has been shown to be redundant for defense against some of the phages tested, thus an optional DISARM system comprises drmC with at least drmM, drmA, drmB, and drmD or drmE.

According to specific embodiments, drmC polypeptide is encoded by a gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmC polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least

93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100

% identity to a polypeptide encoded by a drmC gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmC polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmM, drmA, drmB, drmD and/or drmE in a genome of a prokaryotic cell; each possibility represents a separate embodiment of the present invention.

According to specific embodiments, drmC polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100

% identity to a polypeptide encoded by a rm gene positioned within 5 genes of a gene encoding drmM, drmA, drmB, drmD and/or drmE in a genome of a prokaryotic cell.

According to specific embodiments, drmC polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmA and a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmC polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmC gene positioned within 5 genes of a gene encoding drmA and a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, the drmC polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 2451-2728, 3002-3044 and 3255-3284.

According to specific embodiments, the drmC polypeptide comprises an amino acid sequence having at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 2451-2728, 3002-3044 and 3255-3284.

According to specific embodiments, the drmC polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2451-2728, 3002-3044 and 3255- 3284. According to specific embodiments, the drmC polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1087- 1364, 2815-2857 and 3163-3192.

According to specific embodiments, the drmC polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1087-1364, 2815-2857 and 3163-3192.

As used herein, the term "drmD" refers to the polynucleotide and expression product e.g., polypeptide of the drmD gene. According to specific embodiments, the term "drmD" refers to a drmD polypeptide. The product of the drmD gene contains the SNF2 family helicase pfam00176 domain. According to specific embodiments, the drmD is the closest pfam00176 containing gene to a drmB gene on a genome of a prokaryotic cell. According to specific embodiments, the drmD further contains a pfam00271 domain. drmD with at least drmM, drmA, drmB; and optionally drmC, comprise a DISARM system. According to specific embodiments drmD with at least drmMI, drmA and drmB; and optionally drmC, comprise a DISARM system.

According to specific embodiments, drmD polypeptide is encoded by a gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmD polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmD gene positioned within 5-60 genes of a gene encoding drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmD polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmM, drmA, drmB and/or drmC in a genome of a prokaryotic cell; each possibility represents a separate embodiment according to the present invention.

According to specific embodiments, drmD polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmD gene positioned within 5 genes of a gene encoding drmM, drmA, drmB and/or drmC in a genome of a prokaryotic cell.

According to specific embodiments, drmD polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmMI, drmA, drmB and/or drmC in a genome of a prokaryotic cell, each possibility represents a separate embodiment of the present invention. According to specific embodiments, drmD polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmD gene positioned within 5 genes of a gene encoding drmMI, drmA, drmB and/or drmC in a genome of a prokaryotic cell.

According to specific embodiments, the drmD polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1365-1638 and 3335-3339.

According to specific embodiments, the drmD polypeptide comprises an amino acid sequence having at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1365-1638 and 3335-3339.

According to specific embodiments, the drmD polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1365-1638 and 3335-3339.

According to specific embodiments, the drmD polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 1-274 and 3332-3334.

According to specific embodiments, the drmD polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-274 and 3332-3334.

As used herein, the term "drmE" refers to the polynucleotide and expression product e.g., polypeptide of the drmE gene. According to specific embodiments, the term "drmE" refers to a drmE polypeptide. drmE with at least drmM, drmA, drmB; and optionally drmC, comprise a DISARM system. According to specific embodiments drmE with at least drmMII, drmA, drmB and drmD; and optionally drmC, comprise a DISARM system.

The drmE polypeptide is encoded by a gene positioned within 5 - 60 genes of a gene encoding drmM, drmA and/or drmB in a genome of a prokaryotic cell; each possibility represents a separate embodiment of the present invention.

According to specific embodiments, drmE polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmE gene positioned within 5 - 60 genes of a gene encoding drmM, drmA and/or drmB in a genome of a prokaryotic cell. According to specific embodiments, the drmE polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmM, drmA and/or drmB in a genome of a prokaryotic cell; each possibility represents a separate embodiment of the present invention.

According to specific embodiments, drmE polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmE gene positioned within 5 genes of a gene encoding drmM, drmA and/or drmB in a genome of a prokaryotic cell.

According to specific embodiments, drmE polypeptide is encoded by a gene positioned within 5 genes of a gene encoding drmM, drmA, drmB and/or drmC in a genome of a prokaryotic cell; each possibility represents a separate embodiment of the present invention.

According to specific embodiments, drmE polypeptide comprises an amino acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to a polypeptide encoded by a drmE gene positioned within 5 genes of a gene encoding drmM, drmA, drmB and/or drmC in a genome of a prokaryotic cell.

According to specific embodiments, the drmE is not drmM, drmA, drmB, drmC and drmD.

According to specific embodiments, drmE and drmA are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, drmE and drmA are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, the drmE polypeptide is about 800 amino acids long. According to specific embodiments, the drmE polypeptide comprises an amino acid sequence having at least 80 % identity to a sequence selected from the group consisting of SEQ ID NOs: 3088-3102.

According to specific embodiments, the drmE polypeptide comprises an amino acid sequence having at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 3088-3102.

According to specific embodiments, the drmE polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3088-3102.

According to specific embodiments, the drmE polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence having at least 80 %, at least 85 %, at least 90 %, at least 95 % identity to a sequence selected from the group consisting of SEQ ID NOs: 2901- 2915.

According to specific embodiments, the drmE polypeptide comprises an amino acid sequence encoded from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2901-2915.

According to specific embodiments, the terms "drmM", "drmMT" , "drmMi , "drmA", "drmB", "drmC", "drmD" and "drmE" refer to a full length drmM, drmMI, drmMII, drmA, drmB, drmC, drmD and drmE, respectively. According to other specific embodiments, the terms "drmM", "drmMT "drmMII", "drmA", "drmB", "drmC, "drmD" and "drmE" refer to a fragment of drmM, drmMI, drmMII, drmA, drmB, drmC, drmD and drmE, respectively, which maintains the activity as described herein.

The terms "drmM "drmMT "drmMIT "drmA", "drmB", "drmC", "drmD" and "drmE" also refers to functional drmM, drmMI, drmMII, drmA, drmB, drmC, drmD and drmE homologues which exhibit the desired activity {i.e., conferring phage resistance). Such homologues can be, for example, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide SEQ ID NOs: 1639-1894, 3045-3087 and 3285-3286; 1639-1894; 3045-3087 and 3285-3286; 1895-2172, 2916-2958 and 3195-3224; 2173-2450, 2959-3001 and 3225-3254; 2451-2728, 3002-3044 and 3255-3284; 1365-1638 and 3335-3339; and 3088-3102, respectively, or 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical to the polynucleotide SEQ ID NOs: 275-530, 2858-2900 and 3193-3194; 275-530; 2858-2900 and 3193-3194; 531-808, 2729-2771 and 3103-3132; 809-1086, 2772-2814 and 3133-3162; 1087- 1364, 2815-2857 and 3163-3192; 1-274 and 3332-3334; and 2901-2915, respectively.

The homolog may also refer to an ortholog, a deletion, insertion, or substitution variant, including an amino acid substitution.

Sequence identity or homology can be determined using any protein or nucleic acid sequence alignment algorithm such as Blast, ClustalW, MUSCLE, and HHpred.

Alternatively or additionally, homology can be based on shared motifs [e.g., the methyltransferase domain in drmM, the SSF5335 domain in drmMI, the pfam00145 domain in drmMII, the pfam00271 domain in drmA, the pfam09369 domain in drmB, the pfaml3091 domain in drmC, and the pfam00176 domain in drmD] combined with the conserved size of the gene or the expression product in the different subtypes and the location of the gene in the gene cluster as further described herein above and below.

According to specific embodiments, a functional DISARM system is a type 1 DISARM system comprising drmM, drmA, drmB and drmD.

According to specific embodiments, a functional DISARM system is a Type 2 DISARM system comprising drmM, drmA, drmB and drmE (see Figures 2A-B).

According to specific embodiments, the DISARM system is a Type 1 DISARM system comprising drmM, drmA, drmB and drmD.

According to specific embodiments, the drmM in Type 1 DISARM is drmMI.

According to specific embodiments, the drmD, the drmM, the drmA and the drmB are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, the drmD, the drmM, the drmA and the drmB are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, the Type 1 DISARM further comprises drmC.

According to specific embodiments, the drmD, the drmM, the drmA, the drmB and the drmC are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, the drmD, the drmM, the drmA, the drmB and the drmC are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to a specific embodiment, the type 1 DISARM system composition and order is as shown in Figure 2A.

According to specific embodiments, the DISARM system is a Type 2 DISARM system comprising drmM, drmA, drmB and drmE.

According to specific embodiments, the drmM in Type 2 DISARM is drmMII.

According to specific embodiments, the drmE, the drmA, the drmB and the drmM, are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, the drmE, the drmA and the drmB are positioned contiguously 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, the Type 2 DISARM further comprises drmC.

According to specific embodiments, the drmE, the drmA, the drmB, the drmC and the drmM, are positioned sequentially 5' to 3' in a genome of a prokaryotic cell.

According to specific embodiments, the drmE, the drmA, the drmB, the drmC and the drmM, are positioned contiguously 5' to 3' in a genome of a prokaryotic cell. According to a specific embodiment, the type 2 DISARM system composition and order is as shown in Figure 2B.

As used herein the term "polynucleotide" refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).

According to specific embodiments, the nucleic acid construct of the present invention encodes no more than 20, no more than 15, no more the 10 genes expression products.

According to specific embodiments, in order to express, the polynucleotides described herein are part of a nucleic acid construct system (also referred to herein as an "expression vector" or a "vector") where the DISARM components are expressed from a single or a plurality of constructs (i.e. construct system).

According to specific embodiments, the present invention further provides for a nucleic acid construct system comprising at least two nucleic acid constructs each expressing at least one of said drmM, said drmA, said drmB, said drmC, said drmD and/or said drmE.

According to specific embodiments, the nucleic acid construct system comprises a plurality of constructs each expressing a single DISARM system component.

According to other specific embodiments a single construct comprises a number of DISARM components.

Thus, according to specific embodiments, the construct encodes a polycistronic mRNA comprising the polynucleotides of the present invention.

Various construct schemes can be utilized to express few genes from a single nucleic acid construct. According to specific embodiments, the construct encodes a polycistronic mRNA comprising the polynucleotides of the present invention; that is the polynucleotides can be co- transcribed as a polycistronic message from a single promoter sequence of the nucleic acid construct. To enable co-translation of all the genes from a single polycistronic message, the different polynucleotide segments can be transcriptionally fused via a linker sequence including an internal ribosome entry site (IRES) sequence which enables the translation of the polynucleotide segment downstream of the IRES sequence. In this case, a transcribed polycistronic RNA molecule including the coding sequences of different combinations of the polynucleotides of the present invention will be translated from both the capped 5' end and the internal IRES sequence of the polycistronic RNA molecule.

Alternatively, each two polynucleotide segments can be translationally fused via a protease recognition site cleavable by a protease expressed by the cell to be transformed with the nucleic acid construct. In this case, a chimeric polypeptide translated will be cleaved by the cell expressed protease.

Still alternatively, the nucleic acid construct of some embodiments of the invention can include at least two Cis acting regulatory elements each being for separately expressing a distinct polynucleotide. These at least two Cis acting regulatory elements can be identical or distinct.

Cis-acting regulatory elements include those that direct constitutive expression of a nucleotide sequence as well as those that direct inducible expression of the nucleotide sequence only under certain conditions.

According to specific embodiments, the cis-acting regulatory element is heterologous to drmM, drmA, drmB, drmC, drmD and/or drmE.

According to specific embodiments, the nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.

Constitutive promoters suitable for use with some embodiments of the invention are promoter sequences which are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV). Inducible promoters suitable for use with some embodiments of the invention include for example the tetracycline- inducible promoter (Zabala M, et al., Cancer Res. 2004, 64(8): 2799-804) or pathogen-inducible promoters. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen.

According to specific embodiments the promoter is a bacterial nucleic acid (e.g., expression) construct.

A bacterial promoter is any DNA sequence capable of binding bacterial RNA polymerase and initiating the downstream (3') transcription of a coding sequence into mRNA. A promoter can have a transcription initiation region, which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region typically includes an RNA polymerase binding site and a transcription initiation site. A bacterial promoter can also have a second domain called an operator, which can overlap an adjacent RNA polymerase binding site at which RNA synthesis begins. The operator permits negative regulated (inducible) transcription, as a gene repressor protein can bind the operator and thereby inhibit transcription of a specific gene. Constitutive expression can occur in the absence of negative regulatory elements, such as the operator. In addition, positive regulation can be achieved by a gene activator protein binding sequence, which, if present is usually proximal (5') to the RNA polymerase binding sequence. An example of a gene activator protein is the catabolite activator protein (CAP), which helps initiate transcription of the lac operon in Escherichia coli (Raibaud et al. (1984) Annu. Rev. Genet. 18: 173). Regulated expression can therefore be either positive or negative, thereby either enhancing or reducing transcription. Other examples of positive and negative regulatory elements are well known in the art. Various promoters that can be included in the protein expression system include, but are not limited to, a T7/LacO hybrid promoter, a trp promoter, a T7 promoter, a lac promoter, and a bacteriophage lambda promoter. Any suitable promoter can be used to carry out the present invention, including the native promoter or a heterologous promoter. Heterologous promoters can be constitutively active or inducible. A non-limiting example of a heterologous promoter is given in U.S. Pat. No. 6,242,194 to Kullen and Klaenhammer.

Sequences encoding metabolic pathway enzymes provide particularly useful promoter sequences. Examples include promoter sequences derived from sugar metabolizing enzymes, such as galactose, lactose (lac) (Chang et al. (1987) Nature 198: 1056), and maltose. Additional examples include promoter sequences derived from biosynthetic enzymes such as tryptophan (trp) (Goeddel et al. (1980) Nucleic Acids Res. 8:4057; Yelverton et al. (1981) Nucleic Acids Res. 9:731; U.S. Pat. No. 4,738,921; EPO Publication Nos. 36,776 and 121,775). The beta- lactamase (bla) promoter system (Weissmann, (1981) "The Cloning of Interferon and Other Mistakes," in Interferon 3 (ed. I. Gresser); bacteriophage lambda PL (Shimatake et al. (1981) Nature 292: 128); the arabinose-inducible araB promoter (U.S. Pat. No. 5,028,530); and T5 (U.S. Pat. No. 4,689,406) promoter systems also provide useful promoter sequences. See also Balbas (2001) Mol. Biotech. 19:251-267, where E. coli expression systems are discussed.

In addition, synthetic promoters that do not occur in nature also function as bacterial promoters. For example, transcription activation sequences of one bacterial or phage promoter can be joined with the operon sequences of another bacterial or phage promoter, creating a synthetic hybrid promoter (U.S. Pat. No. 4,551,433). For example, the tac (Amann et al. (1983) Gene 25: 167; de Boer et al. (1983) Proc. Natl. Acad. Sci. 80:21) and trc (Brosius et al. (1985) J. Biol. Chem. 260:3539-3541) promoters are hybrid trp-lac promoters comprised of both trp promoter and lac operon sequences that are regulated by the lac repressor. The tac promoter has the additional feature of being an inducible regulatory sequence. Thus, for example, expression of a coding sequence operably linked to the tac promoter can be induced in a cell culture by adding isopropyl-l-thio-.beta.-D-galactoside (IPTG). Furthermore, a bacterial promoter can include naturally occurring promoters of non-bacterial origin that have the ability to bind bacterial RNA polymerase and initiate transcription. A naturally occurring promoter of non- bacterial origin can also be coupled with a compatible RNA polymerase to produce high levels of expression of some genes in prokaryotes. The phage T7 RNA polymerase/promoter system is an example of a coupled promoter system (Studier et al. (1986) J. Mol. Biol. 189: 113; Tabor et al. (1985) Proc. Natl. Acad. Sci. 82: 1074). In addition, a hybrid promoter can also be comprised of a phage promoter and an E. coli operator region (EPO Publication No. 267,851).

The nucleic acid construct can additionally contain a nucleotide sequence encoding the repressor (or inducer) for that promoter. For example, an inducible construct of the present invention can regulate transcription from the Lac operator (LacO) by expressing the nucleotide sequence encoding the Lacl repressor protein. Other examples include the use of the lexA gene to regulate expression of pRecA, and the use of trpO to regulate ptrp. Alleles of such genes that increase the extent of repression (e.g., laclq) or that modify the manner of induction (e.g., lambda CI857, rendering lambda pL thermo-inducible, or lambda CI+, rendering lambda pL chemo-inducible) can be employed.

In the construction of the construct, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

The nucleic acid construct of some embodiments of the invention includes additional sequences which render this construct suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).

The present invention also contemplates a transmissible genetic element comprising the construct of the invention.

Thus, according to specific embodiments, the DISARM system or the DISARM system component(s) is on a transmissible genetic element.

As used herein the term "transmissible element" or "transmissible genetic element", which are interchangeably used, refers to a nucleic acid sequence that allows the transfer of the polynucleotide from one cell to another, e.g. from one bacteria to another.

According to specific embodiments, the transmissible genetic element comprises a conjugative genetic element or mobilizable genetic element. As used herein, a "conjugative plasmid" refers to a plasmid that is transferred from one cell (e.g. bacteria) to another during conjugation.

As used herein, the term "mobilizable element" refers to a transposon, which is a DNA sequence that can change its position within the genome. According to specific embodiments, the construct comprises a recombination element for integrating the polynucleotide into a genome of cell transfected with the construct.

As used herein the term "recombination element" refers to a nucleic acid sequence that allows the integration of the polynucleotide in the genome of a cell (e.g. bacteria) transfected with the construct.

In addition, typical construct may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.

According to a specific embodiment, the nucleic acid construct comprises a plurality of cloning sites for ligating a nucleic acid sequence of the invention such that it is under transcriptional regulation of the regulatory elements.

Selectable marker genes that ensure maintenance of the construct in the cell can also be included in the construct. Preferred selectable markers include those which confer resistance to drugs such as ampicillin, chloramphenicol, erythromycin, kanamycin (neomycin), and tetracycline (Davies et al. (1978) Annu. Rev. Microbiol. 32:469). Selectable markers can also allow a cell to grow on minimal medium, or in the presence of toxic metabolite and can include biosynthetic genes, such as those in the histidine, tryptophan, and leucine biosynthetic pathways.

Other than containing the necessary elements for the transcription and translation of the inserted coding sequence, the expression construct of some embodiments of the invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed polypeptide.

Where appropriate, the polynucleotides may be optimized for increased expression in the transformed organism. For example, the polynucleotides can be synthesized using preferred codons for improved expression.

Various methods known within the art can be used to introduce the construct of some embodiments of the invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, natural or induced transformation, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.

Exemplary methods of introducing construct into bacterial cells include for example conventional transformation or transfection techniques, or by phage-mediated infection. As used herein, the terms "transformation", "transduction", "conjugation", and "protoplast fusion" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a cell, such as calcium chloride co-precipitation.

Introduction of nucleic acids by phage infection offers several advantages over other methods such as transformation, since higher transfection efficiency can be obtained due to the infectious nature of phages. These methods are especially useful for rendering bacteria more sensitive to phage attack for antibiotics purposes as further described hereinbelow.

It will be appreciated that the DISARM polypeptides can be introduced directly into the cell (e.g., bacterial cell) and not via recombinant expression to confer resistance. Thus, according to specific embodiments, the present invention also contemplates isolated polypeptides of the DISARM system components and functional fragments thereof as described herein.

Thus, according to an aspect of the present invention, there is provided an isolated polypeptide comprising an amino acid sequence of at least two DISARM system components selected from the group consisting of a drmM polypeptide; a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide.

According to specific embodiments, the isolated polypeptide comprising an amino acid sequence of a DISARM system having an anti-phage activity.

As used herein the term "isolated" refers to at least partially separated from the natural environment, physiological environment e.g., a microorganism e.g., bacteria.

The term "polypeptide" as used herein encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N terminus modification, C terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein.

The polypeptides of the present invention may be synthesized by any techniques known to those skilled in the art of peptide synthesis, for example but not limited to recombinant DNA techniques or solid phase peptide synthesis.

Thus, regardless of the method of introduction, the present teachings provide for an isolated cell (e.g., bacterial cell) which comprises a heterologous functional DISARM system, as described herein.

According to specific embodiments, the isolated cell is transformed or transfected with the above-mentioned nucleic acid construct or nucleic acid construct system.

According to an aspect of the present invention, there is provided an isolated cell genetically modified to express at least two DISARM system components selected from the group consisting of: a drmM polypeptide; a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide.

According to specific embodiments, the isolated cell is genetically modified to express at least 3, at least 4 or at least 5 of the DISARM system components.

According to another aspect of the present invention, there is provided an isolated cell genetically modified to express a DISARM system having an anti-phage activity.

According to specific embodiment the isolated cell (e.g., bacterial cell) does not express an endogenous DISARM system.

According to specific embodiment the isolated cell (e.g., bacterial cell) does not express an endogenous functional DISARM system.

According to specific embodiments, the isolated cell is resistant to infection by at least one phage.

According to specific embodiments the isolated cell is resistant to at least one lytic phage.

According to specific embodiments the isolated cell is resistant to at least one temperate (also referred as lysogenic) phage.

According to a specific embodiment the isolated cell is resistant to phage lysogeny.

According to another specific embodiment the isolated cell is resistant to phage DNA replication.

According to specific embodiments the isolated cell is a microbial cell such as a bacteria, e.g., Gram-positive or Gram-negative bacteria.

Representative Gram-positive bacteria include, but are not limited to, Actinomyces spp.,

Bacillus anthracis, Bifidobacterium spp., Clostridium botulinum, Clostridium perfringens, Clostridium spp., Clostridium tetani, Corynebacterium diphtheriae, Corynebacterium jeikeium, Enterococcus faecalis, Enterococcus faecium, Erysipelothrix rhusiopathiae, Eubacterium spp., Gardnerella vaginalis, Gemella morbillorum, Leuconostoc spp., Mycobacterium abcessus, Mycobacterium avium complex, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium haemophilium, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium scrofulaceum, Mycobacterium smegmatis, Mycobacterium terrae, Mycobacterium tuberculosis, Mycobacterium ulcerans, Nocardia spp., Peptococcus niger, Peptostreptococcus spp., Proprionibacterium spp., Staphylococcus aureus, Staphylococcus auricularis, Staphylococcus capitis, Staphylococcus cohnii, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus lugdanensis, Staphylococcus saccharolyticus, Staphylococcus saprophyticus, Staphylococcus schleiferi, Staphylococcus similans, Staphylococcus warned, Staphylococcus xylosus, Streptococcus agalactiae (group B streptococcus), Streptococcus anginosus, Streptococcus bovis, Streptococcus canis, Streptococcus equi, Streptococcus milleri, Streptococcus mitior, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes (group A streptococcus), Streptococcus salivarius, Streptococcus sanguis.

Representative Gram-negative bacteria include Acinetobacter calcoaceticus, Actinobacillus actinomycetemcomitans, Aeromonas hydrophila, Alcaligenes xylosoxidans, Bacteroides, Bacteroides fragilis, Bartonella bacilliformis, Bordetella spp., Borrelia burgdorferi, Branhamella catarrhalis, Brucella spp., Campylobacter spp., Chalmydia pneumoniae, Chlamydia psittaci, Chlamydia trachomatis, Chromobacterium violaceum, Citrobacter spp., Eikenella corrodens, Enterobacter aerogenes, Escherichia coli, Flavobacterium meningosepticum, Fusobacterium spp., Haemophilus influenzae, Haemophilus spp., Helicobacter pylori, Klebsiella spp., Legionella spp., Leptospira spp., Moraxella catarrhalis, Morganella morganii, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Plesiomonas shigelloides, Prevotella spp., Proteus spp., Providencia rettgeri, Pseudomonas aeruginosa, Pseudomonas spp., Rickettsia prowazekii, Rickettsia rickettsii, Rochalimaea spp., Salmonella spp., Salmonella typhi, Serratia marcescens, Shigella spp., Treponema carateum, Treponema pallidum, Treponema pallidum endemicum, Treponema pertenue, Veillonella spp., Vibrio cholerae, Vibrio vulnificus, Yersinia enterocolitica, Yersinia pestis.

According to specific embodiments the bacteria is a species selected from the group consisting of Escherichia, Shigella, Salmonella, Erwinia, Yersinia, Bacillus, Vibrio, Legionella, Pseudomonas, Neisseria, Bordetella, Helicobacter, Listeria, Agrobacterium, Staphylococcus, Streptococcus, Enterococcus, Clostridium, Corynebacterium, Mycobacterium, Treponema, Borrelia, Francisella, Brucella, Campylobacter, Klebsiella, Frankia, Bartonella, Rickettsia, Shewanella, Serratia, Enterobacter, Proteus, Providencia, Brochothrix, and Brevibacterium. Additionally, or alternatively the bacteria may be useful in the manufacture of dairy and fermentation processing such as, but not limited to, milk-derived products, such as cheeses, yogurt, fermented milk products, sour milks, and buttermilk.

According to specific embodiments the bacteria is a lactic acid bacteria.

As used herein the term "lactic acid bacteria" refers to Gram positive, microaerophillic or anaerobic bacteria which ferment sugar with the production of acids including lactic acid as the predominantly produced acid, acetic acid, formic acid and propionic acid.

According to specific embodiments the bacteria is a species selected from the group of the industrially most useful lactic acid bacteria consisting of Lactococcus species, Streptococcus species, Lactobacillus species, Leuconostoc species, Oenococcus species, Pediococcus species, Bifidobacterium, and Propionibacterium species.

As used herein, the term "phage" or "bacteriophage" refers to a virus that selectively infects one or more bacterial species. Many phages are specific to a particular genus or species or strain of bacteria. According to specific embodiments, the phage genome can be ssDNA or dsDNA.

According to specific embodiments, the phage comprises a double stranded DNA genome.

According to specific embodiments, the phage is virulent to the bacteria.

According to some embodiments, the phage is a lytic phage.

According to other embodiments, the phage is temperate (also referred to as lysogenic).

According to specific embodiments the phage is from the order Caudavirales.

Exemplary phages which fall under the scope of the invention include, but are not limited to, phages that belong to any of the following virus families: Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, or Tectiviridae .

According to specific embodiments, the phage is a lytic phage selected from the group consisting of Nf, SP82G and SPOl.

According to specific embodiments, the phage is a lytic phage selected from the group consisting of SPOl, SPP1, phi29 and Nf.

According to specific embodiments, the phage is Nf.

According to specific embodiments, the phage is SPOl.

According to specific embodiments, the phage is SPP1.

According to specific embodiments, the phage is phi29.

According to other specific embodiments, the phage is a temperate phage selected from the group consisting of phi3T and phil05. According to other specific embodiments, the phage is a temperate phage selected from the group consisting of phi3T, SPR and phil05.

According to specific embodiments, the phage is phi3T.

According to specific embodiments, the phage is SPR.

According to specific embodiments, the phage is phi 105.

According to specific embodiments, phage that infect bacteria that are pathogenic to plants and/or animals (including humans) find particular use.

According to specific embodiments, the resistance of a cell against a phage is improved as compared to a cell of the same species which was not treated according to the present teachings (i.e., with a functional DISARM system).

The lysogenic activity of a phage can be assessed in multiple ways, including but not limited to PCR and DNA sequencing, as further described herein above and below.

The DNA replication activity of a phage can be assessed in multiple ways, including but not limited to DNA sequencing and southern blot analysis, as further described hereinabove and below.

The lytic activity of a phage can be assessed in multiple ways, including but not limited to optical density, plaque assay, and living dye indicators.

The lytic activity of a phage can be measured indirectly by following the decrease in optical density of the bacterial cultures owing to lysis. This method involves introduction of phage into a fluid bacterial culture medium. After a period of incubation, the phage lyses the bacteria in the broth culture resulting in a clearing of the fluid medium resulting in decrease in optical density.

Another method, known as the plaque assay, introduces phage into a few milliliters of soft agar along with some bacterial host cells. This soft agar mixture is laid over a hard agar base (seeded-agar overlay). The phage adsorbs onto the host bacterial cells, infect and lyse the cells, and then begin the process anew with other bacterial cells in the vicinity. After 6 - 24 hours, zones of clearing on the plate, known as plaques, are observable within the lawn of bacterial growth on the plate. Each plaque represents a single phage particle in the original sample.

Yet another method is the one-step phage growth curve which allows determining the production of progeny virions by cells as a function of time after infection. The assay is based on the fact that cells in the culture are infected simultaneously with a low number of phages so that no cell can be infected with more than one phage. At various time intervals, samples are removed for a plaque assay allowing quantitative determination of the number of phages present in the medium.

Other methods use for example redox chemistry, employing cell respiration as a universal reporter. During active growth of bacteria, cellular respiration reduces a dye (e.g., tetrazolium dye) and produces a color change that can be measured in an automated fashion. On the other hand, successful phage infection and subsequent growth of the phage in its host bacterium results in reduced bacterial growth and respiration and a concomitant reduction in color.

Thus, polynucleotides encoding DISARM system components and functional fragments thereof and the polypeptides and nucleic acid constructs of the present invention can be used in conferring phage resistance thereby protecting bacteria from phage infection. Following are embodiments that take advantage of the DISARM system as described herein.

According to specific embodiments, "conferring phage resistance" refers to the level of phage infection and/or multiplication in the e.g. bacteria containing a functional DISARM system does not cause a deleterious effect to the bacteria e.g., growth arrest or death.

In some embodiments, the bacteria has about 100-100,000 times lower efficiency of plaquing ([EOP] = 10-2), about 1000 times lower EOP (EOP = 10 ^"3 ), 10,000 times lower EOP (EOP = 10-4), or 100,000 times lower EOP (EOP=10-5). In some embodiments, the level of phage multiplication in a culture is measured after about 6-14 hours incubation of the culture, e.g., after about 12 hours, after about 9 hours, after about 8 hours after about 7 hours, or after about 6 hours.

Thus, according to an aspect of the present invention there is provided a method of protecting bacteria from phage infection, the method comprising introducing into the bacteria a DISARM system having an anti-phage activity, thereby protecting the bacteria from phage infection.

According to specific embodiments, the bacteria does not express an endogenous DISARM system.

According to specific embodiments, the bacteria does not express an endogenous functional DISARM system.

Various modalities may be used to introduce or express the DISARM system or its components in the bacteria.

Thus, according to specific embodiments, the method is effected by expressing in the bacteria, an isolated polynucleotide(s), nucleic acid construct or construct system or alternatively introducing the DISARM polypeptides as described herein to confer protection. Alternatively or additionally, the DISARM system is introduced into the bacteria via a transmissible genetic element in a process of bacterial conjugation.

Thus, according to specific embodiments, there is provided a method of protecting bacteria from phage infection, the method comprising introducing into the bacteria a DISARM system having an anti-phage activity, wherein said bacteria is a first bacteria and said introducing into said bacteria said DISARM system comprises contacting said first bacteria with a second bacteria expressing said DISARM system on a transmissible genetic element.

As used herein, the phrase "bacterial conjugation" refers to a direct transfer of genetic material between bacterial cells by cell-to-cell contact or by bridge-like connection between the cells. During conjugation the donor bacterium provides a transmissible genetic element, typically a plasmid or a transposon. The transfer of the transmissible genetic element takes advantage of the complementary nature of double stranded DNA. Thus, one strand of the transmissible genetic element is transferred and the other remains in the original bacteria. Both strands have the complementary stranded added so that each bacterium ends up with a complete transmissible element.

According to some embodiments, contacting first bacteria with second bacteria comprises the step of incubating the bacterial cell (e.g., first bacteria) with a substance or cell (e.g., second bacteria) such that the substance or a substance contained in the cell affects the bacterial cell resistance to phage infection.

According to specific embodiments, the first bacteria and the second bacteria are non identical.

According to specific embodiments, the first bacteria does not express an endogenous DISARM system.

According to specific embodiments, the first bacteria does not express an endogenous functional DISARM system.

According to a specific embodiment, the first bacteria is a commercially valuable bacteria such as those used for fermentation as described above.

Thus, following the above teachings, according to specific embodiments there is provided an isolated bacteria comprising a nucleic acid sequence encoding a DISARM system having an anti-phage activity and a transmissible genetic element expressing the DISARM system, wherein the isolated bacteria does not express an endogenous functional DISARM system.

According to specific embodiments, DISARM system confers resistance to a plasmid. The plasmid may undergo integration into the bacterial genome or may be episomal.

According to a specific embodiment, the plasmid is episomal. As used herein, "plasmid resistance" refers to an increase of at least 5 % in bacterial resistance towards a plasmid in comparison to bacteria of the same species under the same developmental stage (culture state) which does not express a DISARM system, as may be manifested in e.g. viability. According to a specific embodiment, the increase is in at least 10 %, 20 %, 30 %, 40 % or even higher say, 50 %, 60 %, 70 %, 80 %, 90 % or more than 100 %.

Assays for testing plasmid resistance are well known in the art and include, but not limited to, a transformation assay such as described in Itaya and Tsuge [Methods Enzymol (2011) 498:427-47] .

Cultures, and starter cultures, in particular are used extensively in the food industry in the manufacture of fermented products including milk products (e.g., yogurt, buttermilk, and cheese), meat products, bakery products, wine, and vegetable products. The preparation of cultures is labor intensive, occupying much space and equipment, and there is a considerable risk of contamination with spoilage bacteria and/or phages during the propagation steps. The failure of bacterial cultures due to phage infection and multiplication is a major problem with the industrial use of bacterial cultures. There are many different types of phages and new strains continue to emerge. Indeed, despite advances in culture development, there is a continuing need to improve cultures for use in industry.

Thus, according to an aspect of the present invention, there is provided a method for preparing a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product, the method comprising adding to the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product a DISARM system, thereby preparing the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product.

Thus, following the above teachings there is provided a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product comprising a DISARM system.

According to another aspect of the present invention, there is provided a method for preparing a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product, the method comprising adding to the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product the isolated cell of the present invention, thereby preparing the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product. Thus, following the above teachings there is provided a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product comprising the isolated cell of the present invention.

Yet, according to another aspect of the present invention, there is provided a method for preparing a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product comprising adding to the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product a bacteria which expresses on a transmissible genetic element a DISRAM system, thereby preparing the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product. Thus, following the above teachings there is provided a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product comprising a bacteria which expresses on a transmissible genetic element a DISRAM system.

According to specific embodiments food or feed is a dairy product.

The preparation of starter cultures of such bacteria, and methods of fermenting substrates, particularly food substrates such as milk, can be carried out in accordance with known techniques, including but not limited to those described in Mayra-Makinen and Bigret (1993) Lactic Acid Bacteria; Salminen and vonWright eds. Marcel Dekker, Inc. New York. 65-96; Sandine (1996) Dairy Starter Cultures Cogan and Accolas eds. VCH Publishers, New York. 191- 206; Gilliland (1985) Bacterial Starter Cultures for Food. CRC Press, Boca Raton, Fla.

The term "fermenting" refers to the energy-yielding, metabolic breakdown of organic compounds by microorganisms that generally proceeds under anaerobic conditions and with the evolution of gas.

Products produced by fermentation which have been known to experience phage infection, and the corresponding infected fermentation bacteria, include cheddar and cottage cheese (Lactococcus lactis subsp. lactis, Lactococcus lactis subsp. cremoris), yogurt {Lactobacillus delbrueckii subsp. bulgaricus, Streptococcus thermophilus), Swiss cheese (S. thermophilus, Lactobacillus lactis, Lactobacillus helveticus), blue cheese (Leuconostoc cremoris), Italian cheese (L. bulgaricus, S. thermophilus), viili (Lactococcus lactis subsp. cremoris, Lactococcus lactis subsp. lactis biovar diacetylactis, Leuconostoc cremoris), yakult {Lactobacillus casei), casein (Lactococcus lactis subsp. cremoris), natto (Bacillus subtilis var. natto), wine (Leuconostoc oenos), sake (Leuconostoc me s enter oides), polymyxin (Bacillus polymyxa), colistin (Bacillus colistrium), bacitracin (Bacillus licheniformis), L-glutamic acid (Brevibacterium lactofermentum, Microbacterium ammoniaphilum), and acetone and butanol {Clostridium acetobutylicum, Clostridium saccharoperbutylacetonicum).

The present inventors have further uncovered that transformation of a Bacillus subtilis strain with a non-complete type 2 DISARM (i.e. not expressing either drmE, drmA or drmB) does not confer phage resistance. In addition it was also discovered that cloning of a drmMII- deleted type 2 DISARM system into B. subtilis yielded very low transformation efficiency, while some of the resulting transformed colonies showed massive deletions or frameshift mutations in the DISARM locus in addition to the intended deletion, suggesting that a DISARM system not comprising drmM is toxic to a cell expressing it. Taken together, these results suggest the use of anti-DISARM agents as a method to directly kill a bacteria or to induce phage sensitivity.

As used herein, "inducing phage sensitivity" refers to an increase of at least 5 % in bacterial susceptibility towards a phage, as compared to same in the absence of the anti- DISARM agent, as may be manifested e.g. in prevention of lysogeny, growth arrest or death. According to a specific embodiment, the increase is in at least 10%, 20 %, 30 %, 40 % or even higher say, 50 %, 60 %, 70 %, 80 %, 90 % or more than 100 %.

Thus, according to further aspect of the present invention, there is provided a method of killing a bacteria, the method comprising introducing into a bacteria which expresses a DISARM system having an anti-phage activity an anti-DISARM agent capable of down regulating expression and/or activity of a drmM I polypeptide and/or a drmM II polypeptide, thereby killing the bacteria.

According to another aspect of the present invention, there is provided an isolated anti- DISARM agent capable of down regulating expression and/or activity of at least two DISARM system components selected from the group consisting of: a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide.

According to another aspect of the present invention, there is provided a method of inducing phage sensitivity in a bacteria, the method comprising introducing into a bacteria which expresses a DISARM system having an anti-phage activity an anti-DISARM agent, wherein said anti-DISARM agent is capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of a drmA polypeptide, a drmB polypeptide, a drmD polypeptide, a drmE polypeptide and a drmC polypeptide, thereby inducing sensitivity of the bacteria to phage infection.

According to specific embodiments, the method further comprises infecting said bacteria with a phage. As used herein the phrase "anti-DISARM agent" is an agent capable of specifically inhibiting the expression of a target DISARM gene (at the DNA or RNA level) or alternatively specifically impairing the functionality of the target DISARM protein. According to specific embodiments, the anti-DISARM agent is directed against one of the DISAM components. According to other embodiments, the anti-DISARM agent is directed against at least 2, at least 3 or at least 4 of the DISAM components.

According to specific embodiments the anti-DISARM agent is directed against drmMI and/or drmMII. For example, the anti-DISARM agent may interfere with drmMI and/or drmMII expression (as described hereinbelow) or in its DNA methyltransferase function by the use of common inhibitors of such an enzyme e.g., 5-Azacytidine, Decitabine Zebularine, RG108, Hydralazine hydrochloride, and Psammaplin A.

According to other specific embodiments the anti-DISARM agent is directed against drmA, drmB, drmD, drmE and/or drmC.

Down regulation of DISARM system can be effected on the genomic and/or the transcript level using a variety of molecules which interfere with transcription and/or translation (e.g., RNA silencing agents), or on the protein level using e.g., aptamers, small molecules and inhibitory peptides, antagonists, enzymes that cleave the polypeptide and the like.

According to specific embodiments the anti-DISARM agent is selected from the group consisting of a nucleic acid suitable for silencing expression, aptamers, small molecules and inhibitory peptides.

As used herein the phrase "nucleic acid suitable for silencing expression" refers to regulatory mechanisms mediated by nucleic acid molecules which result in the inhibition or "silencing" of the expression of a corresponding protein-coding gene.

Methods for qualifying efficacy and detecting inhibition or "silencing" of the expression of a corresponding protein-coding gene are well known in the art and include, but not limited to, DNA sequencing, electrophoresis, an enzyme-based mismatch detection assay and hybridization assay such as PCR, RT-PCR, RNase protection, in-situ hybridization, primer extension, Southern blot, Northern Blot and dot blot analysis. Inhibition or "silencing" of the expression of a specific protein-coding gene can also be determined at the protein level using e.g. chromatography, electrophoretic methods, immunodetection assays such as ELISA and western blot analysis and immunohistochemistry. In addition, one ordinarily skilled in the art can readily design a knock- in/knock-out construct including positive and/or negative selection markers for efficiently selecting transformed cells that e.g. underwent a homologous recombination event with the construct. Thus, downregulation can be achieved by DNA silencing.

Methods of introducing nucleic acid alterations to a gene of interest are well known in the art [see for example Menke D. Genesis (2013) 51: - 618; Capecchi, Science (1989) 244: 1288-1292; Santiago et al. Proc Natl Acad Sci USA (2008) 105:5809-5814; International Patent Application Nos. WO 2014085593, WO 2009071334 and WO 2011146121; US Patent Nos. 8771945, 8586526, 6774279 and UP Patent Application Publication Nos. 20030232410, 20050026157, US20060014264; the contents of which are incorporated by reference in their entireties] and include targeted homologous recombination, site specific recombinases, PB transposases and genome editing by engineered nucleases.

Non-limiting examples of DNA silencing agents that can be used according to specific embodiments of the present invention include: the "Hit and run" or "in-out" strategy; the "double-replacement" or "tag and exchange" strategy; site-specific recombinases such as, but not limited to, ere recombinase and Flp recombinase; genome editing using engineered endonucleases such as, but not limited to, meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system; transposases; and genome editing using recombinant adeno-associated virus (rAAV) platform.

It will be appreciated that the agent can be a mutagen that causes random mutations and the cells exhibiting downregulation of the expression level and/or activity of e.g., drmM, drmA, drmB, drmC, drmD and/or drmE may be selected. The mutagens may be, but are not limited to, genetic, chemical or radiation agents.

Downregulation can also be achieved by RNA silencing.

In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g., the full translation and/or expression) of an mRNA molecule through a post- transcriptional silencing mechanism. RNA silencing agents include non-coding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing agents include dsRNAs such as siRNAs, miRNAs and shRNAs.

According to specific embodiments, the RNA silencing agent is capable of inducing RNA interference.

According to specific embodiments, the RNA silencing agent is capable of mediating translational repression.

According to specific embodiments, the RNA silencing agent is specific to the target RNA (e.g., drmM, drmA, drmB, drmC, drmD, drmE) and does not cross inhibit or silence other targets or a splice variant which exhibits 99 % or less global homology to the target gene, e.g., less than 98 %, 97 %, 96 %, 95 %, 94 %, 93 %, 92 %, 91 %, 90 %, 89 %, 88 %, 87 %, 86 %, 85 %, 84 %, 83 %, 82 %, 81 % global homology to the target gene; as determined by PCR, Western blot, Immunohistochemistry and/or flow cytometry.

Non-limiting examples of RNA silencing agents that can be used according to specific embodiments of the present invention include: antisense, DsRNA, siRNA, shRNA, miRNA and miRNA mimics.

Numerous methods are known in the art for gene silencing particularly in prokaryotes; examples include but are not limited to U.S. Patent Application 20040053289 which teaches the use of si hybrids to down-regulate prokaryotic genes, and U.S. Patent Application PCT/US09/69258 which teaches the use of CRISPR to downregulate prokaryotic genes.

Alternatively the inhibition can be carried out at the protein level which interferes with protein activity, such as by the use of aptamers. Various methods are known in the art which can be used to design protein specific aptamers. The skilled artisan can employ SELEX (Systematic Evolution of Ligands by Exponential Enrichment) for efficient selection as described in Stoltenburg R, Reinemann C, and Strehlitz B (Biomolecular engineering (2007) 24(4):381-403).

Alternatively or additionally, small molecule, peptides or antibodies can be used which interfere with the DISARM component protein function (e.g., catalytic or interaction).

Another anti-DISARM agent would be any molecule which binds to and/or cleaves drmM, drmA, drmB, drmC, drmD and/or drmE. Such molecules can be, for example, a small molecule, antagonists, or inhibitory peptide.

It will be appreciated that a non-functional analogue of at least a catalytic or binding portion of drmM, drmA, drmB, drmC, drmD and/or drmE can be also used as an anti-DISARM agent.

Specifically, introducing with an anti-DISARM agent is effected such that the positioning of the anti-DISARM agent is in direct or indirect contact with the bacterial cell. Thus, the present invention contemplates both applying the anti-DISARM system agents of the present invention to a desirable surface and/or directly to the bacterial cells.

According to another embodiment the surface is comprised in a biological tissue, such as for example, mammalian tissues e.g. the skin.

It will be appreciated that the bacteria may be comprised inside a particular organism,

(e.g. intracellularly or extracellularly) for example inside a mammalian body or inside a plant. In this case, the introducing may be effected by administering the anti-DISARM per se or by transfecting the cells of the organism with the anti-DISARM agents of the present invention. Thus, according to a specific embodiment, introducing with an anti-DISARM agent is effected in-vivo.

According to another specific embodiment introducing with an anti-DISARM agent is effected ex-vivo.

According to another specific embodiment, introducing with an anti-DISARM agent is effected in-vitro.

According to specific embodiments, there is provided an isolated bacteria generated by introducing into a bacteria an anti-DISARM agent as described above.

According to specific embodiments, there is provided an isolated bacteria generated by introducing into the bacteria an anti-DISARM agent in-vitro or ex-vivo.

According to some embodiments, a DISARM system or an anti- DISARM agent is provided in a formulation suitable for cell penetration that enhances intracellular delivery of the system or the agent.

Any suitable penetrating agent for enhancing penetration of DISARM system or its components or anti- DISARM agent to cell (e.g., bacteria) may be used, as known by those of skill in the art. Examples include but are not limited to:

Phages - Phages offer several advantages including lateral infection, higher efficiency of transformation, and targeting to, and propagation in, specific bacteria.

Cell-Penetrating Peptides (CPPs) - CPPs, for example TAT (transcription activator from HIV-1) are short peptides (<40 amino acids), with the ability to gain access to the interior of almost any cell. They are highly cationic and usually rich in arginine and lysine amino acids. They have the exceptional property of carrying into the cells a wide variety of covalently and noncovalently conjugated cargoes such as proteins, oligonucleotides, and even 200 nm liposomes. Protocols for producing CPPs-cargos conjugates and for infecting cells with such conjugates can be found, for example L. Theodore et al. [The Journal of Neuroscience, (1995) 15(11): 7158-7167], Fawell S, et al. [Proc Natl Acad Sci USA, (1994) 91:664-668], and Jing Bian et al. [Circulation Research. (2007) 100: 1626-1633].

The expression level and/or activity level of the DISARM system components expressed in the cells of some embodiments of the invention can be determined using methods known in the arts, e.g. but not limited to selectable marker gene, Northern blot analysis, PCR analysis, DNA sequencing, RNA sequencing, Western blot analysis, and Immunohistochemistry.

According to another aspect of the present invention, there is provided a method of treating a bacterial infection in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an anti-DISARM agent capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of: a drmMI polypeptide; a drmMII polypeptide; a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide, thereby treating the bacterial infection in the subject.

According to another aspect of the present invention, there is provided use of an anti-

DISARM agent capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of: a drmMI polypeptide; a drmMII polypeptide; a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide, for the manufacture of a medicament identified for the treatment of bacterial infection in a subject in need thereof.

As used herein, the term "treating" refers to curing, reversing, attenuating, alleviating, minimizing, suppressing or halting the deleterious effects of a pathogen infection. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of the pathology, and similarly, various methodologies and assays may be used to assess the reversal, attenuation, alleviation or suppression of the pathology.

As used herein, the phrase "subject in need thereof includes mammals, preferably human beings of any gender and at any age which suffer from pathogen infection.

The anti-DISARM agent may be used alone or together with additional antimicrobial agents (e.g. phage therapy, antibiotic and/or additional anti-microbial peptides).

According to specific embodiments, the methods of the present invention further comprise administering to the subject a phage therapy and/or an antibiotic.

According to specific embodiments, the uses of the present invention further comprise a phage therapy and/or an antibiotic.

Exemplary antibiotics include, but are not limited to aminoglycoside antibiotics, cephalosporins, quinolone antibiotics, macrolide antibiotics, penicillins, sulfonamides, tetracyclines and carbapenems. It will be appreciated that since the polypeptides of embodiments of this invention enhance the anti-bacterial effect of the antibiotic, doses of the antibiotic may be lower (e.g. 20 % lower, 30 % lower, 40 % lower, 50 % lower, 60 % lower, 70 % lower, 80 % lower or even 90 % lower) than those currently in use.

In the context of manufacturing of food products and especially fermented products in the food industry, an anti-DISARM agent can be used to eliminate spoilage bacteria or the end product from traces of used bacteria.

Thus, according to another aspect of the present invention, there is provided a method for preparing a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product, the method comprising adding to the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product an anti-DISARM agent capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of: a drmMI polypeptide; a drmMII polypeptide; a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide, thereby preparing the food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product.

Following the above teachings there is provided a food, food additive, feed, nutritional supplement, probiotic supplement, personal care product, health care product, and veterinary product comprising an anti-DISARM agent capable of down regulating expression and/or activity of a DISARM system component selected from the group consisting of: a drmMI polypeptide; a drmMII polypeptide; a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide.

The polynucleotides, constructs, transmissible elements, polypeptides and cells comprising the DISARM system components or the anti-DISARM agent of some embodiments of the invention can be administered to a starter culture, a fermentation vat or an organism per se, or in a composition where it is mixed with suitable carriers or excipients.

The phrase "pharmaceutical composition" as used herein refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

Herein, the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.

As used herein the term "active ingredient" refers to any one of DISARM system component polypeptide or polynucleotide, anti-DISARM agent capable of down regulating a DISARM gene or cells generated according to the present teachings, accountable for the biological effect. Techniques for formulation and administration of drugs may be found in the latest edition of "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, which is herein fully incorporated by reference and are further described herein below.

It will be appreciated that the polypeptides, polynucleotides, nucleic acid construct(s) or other agents of the present invention can be provided to the individual with additional active agents to achieve an improved therapeutic effect as compared to treatment with each agent by itself.

Exemplary additional agents include phage therapy, and antibiotics (e.g. rifampicin, chloramphenicol and spectinomycin).

According to specific embodiment the composition further comprises a phage.

Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.

Conventional approaches for drug delivery to the central nervous system (CNS) include: neurosurgical strategies (e.g., intracerebral injection or intracerebroventricular infusion); molecular manipulation of the agent (e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB) in an attempt to exploit one of the endogenous transport pathways of the BBB; pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers); and the transitory disruption of the integrity of the BBB by hyperosmotic disruption (resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide). However, each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.

Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient. Pharmaceutical compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee- making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredients of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical compositions, which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by nasal inhalation, the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The preparations described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.

The preparation of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides. The preparation of the present invention may also be formulated as a topical composition, such as a spray, a cream, a mouthwash, a wipe, a foam, a soap, an oil, a solution, a lotion, an ointment, a paste, a gel and a patch.

Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients effective to prevent, alleviate or ameliorate symptoms of disease (e.g., bacterial infection) or prolong the survival of the subject being treated.

Determination of a therapeutically effective amount is well within the capability of those skilled in the art.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro assays. For example, a dose can be formulated in animal models and such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. [See e.g., Fingl, et al., (1975) "The Pharmacological Basis of Therapeutics", Ch. 1 p. l].

Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

The amount of a composition to be administered will, of course, be dependent on e.g. the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.

According to another aspect there is provided an article of manufacture or a kit identified for treating a bacterial infection comprising:

(a) an anti-DISARM agent capable of down regulating expression and/or activity of a

DISARM system component selected from the group consisting of: a drmMI polypeptide; a drmMII polypeptide; a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide; and

(b) a phage and/or an antibiotic.

According to specific embodiments the anti-DISARM agent and the phage and/or the antibiotic are packaged in separate containers.

According to yet other specific embodiments the anti-DISARM agent and the phage and/or the antibiotic are in c-formulation.

According to further aspect of the present invention there is provided a method of screening for identifying phage useful for infecting a bacteria, the method comprising:

(a) contacting a phage with a bacteria expressing a DISARM system;

(b) determining deleterious effects induced in the bacteria, wherein an increase in deleterious effects of the bacteria in the presence of the phage compared to deleterious effects in the absence of the phage is indicative of a phage useful for infecting the bacteria.

According to specific embodiments, the method comprising further isolating the phage, characterizing it in terms of sequencing and compatibility with phages species and the ability to infect different bacterial species.

The present inventors have shown that DISARM (i.e. drmMII) methylates the host chromosomal DNA while sparing the phage DNA and that the system probably causes phage DNA degradation. Consistently, it is suggested that DISARM as a new type of multi-gene restriction-modification module, can be used in various applications taking advantage of the restriction-modification characteristics. Thus, for example, the restriction entity can be used for cutting a desired nucleic acid sequence. As another non-limiting example, the system can be used for cloning: the DISARM system can be cloned into plasmids and selected because of the resistance provided by the methylation enzyme. Once the plasmid begins to replicate, the methylation enzyme is produced and methylates the plasmid DNA, protecting it from the restriction entity.

Thus, according to another aspect of the present invention, there is provided a method of cutting a nucleic acid sequence, the method comprising contacting the nucleic acid sequence with a DISARM system component selected from the group consisting of: a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide, thereby cutting the nucleic acid sequence.

Contacting the nucleic acid sequence with the DISARM system component can be performed by any in vitro conditions including for example, adding a DISARM polypeptide to a naked nucleic acid sequence, adding a DISARM polypeptide to a cell expressing the nucleic acid sequence or introducing a DISARM polynucleotide into a cell expressing the nucleic acid sequence such that the DISARM system component is in direct contact with the nucleic acid sequence.

The contacting may be effected with at least 1, at least 2, at least 3, or at least 4 of the

DISARM system components.

According to specific embodiments, the contacting is effected with a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; and a drmD polypeptide.

According to specific embodiments, the contacting is effected with a drmA polypeptide; a drmB polypeptide; and a drmD polypeptide.

According to other specific embodiments, the contacting is effected with a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; and a drmE polypeptide.

According to specific embodiments, the contacting is effected with a drmA polypeptide; a drmB polypeptide; and a drmE polypeptide.

According to specific embodiments, the nucleic acid sequence is comprised in a cell.

According to specific embodiments, the nucleic acid sequence is not comprised in a cell expressing an endogenous DISARM system.

According to specific embodiments, the nucleic acid sequence is not comprised in a cell expressing an endogenous functional DISARM system.

According to specific embodiments, the nucleic acid sequence is not comprised in a cell expressing a drmMI polypeptide; and/or a drmMII polypeptide.

According to specific embodiments, the nucleic acid sequence is not comprised in a cell expressing a drmMI polypeptide. According to specific embodiments, the nucleic acid sequence is not comprised in a cell expressing a drmMII polypeptide.

According to specific embodiments, wherein the nucleic acid is comprised in a cells expressing a drmMI polypeptide; and/or a drmMII polypeptide, the method further comprising introducing into the cell an agent capable of downregulating expression and/or activity of the expressed drmM.

According to a further aspect of the present invention there is provided a method of cloning an expression product of interest, the method comprising:

(a) introducing into a nucleic acid construct a polynucleotide encoding the expression product of interest and a drmM; and

(b) introducing into said nucleic acid construct a DISARM system component selected from the group consisting of: a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; a drmD polypeptide; and a drmE polypeptide, thereby cloning the expression product of interest.

According to specific embodiments, step (b) comprises introducing into said nucleic acid construct a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; and a drmD polypeptide.

According to specific embodiments, step (b) comprises introducing into said nucleic acid construct a drmA polypeptide; a drmB polypeptide; and a drmD polypeptide.

According to specific embodiments, step (b) comprises introducing into said nucleic acid construct a drmA polypeptide; a drmB polypeptide; a drmC polypeptide; and a drmE polypeptide.

According to specific embodiments, step (b) comprises introducing into said nucleic acid construct a drmA polypeptide; a drmB polypeptide; and a drmE polypeptide.

According to specific embodiments the nucleic acid construct does not express an endogenous DISARM system.

According to specific embodiments, the nucleic acid sequence is not comprised in a cell expressing an endogenous functional DISARM system.

Tables 1A-C below demonstrate the types of DISARM system in a diverse array of bacteria and archaea genomes. Table 1A: Type I DISARM systems detected in microbial genomes.

Table IB: Type II DISARM systems detected in microbial genomes.

Table 1C: DISARM systems of undefined Type detected in microbial genomes.

As used herein the term "about" refers to ± 10 %

The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".

The term "consisting of means "including and limited to".

The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1- 317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference. MATERIALS AND METHODS

Genomic identification and analysis of DISARM systems - The IMG database(Markowitz et al., 2012) was searched on June 2016 for genes containing only the pfam09369 (DUF1998) domain. Following, the pfam annotations of the neighboring genes of these DUF1998 standalone genes were retrieved from IMG, and examined in order to identify the most common neighboring genes. Genomes encoding a gene containing a DUF1998 domain identified with an upstream gene containing a pfam00271 domain and a downstream gene containing a pfaml3091 domain were selected and further analyzed. Genomes encoding a gene containing a DUF1998 domain identified with an upstream gene containing a pfam00271 domain but no downstream gene containing a pfaml3091 domain were manually screened to identify possible miss-annotation of a downstream gene containing the pfaml3091 domain. The pfam00271, DUF1998 and pfaml3091 containing genes were denoted herein as drmA, drmB and drmC, respectively, and were defined as the core genes of the defense system denoted herein as Defense Island System Associated with Restriction Modification (DISARM) system.

To study the genomic neighborhood of the identified core DISARM genes, the pfam and COG annotations of 30 genes upstream and 30 genes downstream (i.e. a total of 60 genes) of the DUF1998 containing gene were retrieved from IMG and manually inspected. This led to the discovery of the additional related DISARM genes:

1. Type 1 DISARM systems were defined according to the presence of a pfam00176 containing gene and a pfaml3659 containing gene up to 30 genes upstream or downstream to the DUF1998 containing gene. In Type 1 systems, the closest gene containing a pfaml3659 domain relative to the DUF1998 gene was denoted herein as drmMI, and the closest gene with a pfam00176 domain relative to the DUF1998 gene was denoted herein as drmD. As pfaml3659 was recently cancelled and deleted from the Pfam database, some of the drmMI genes remained with no pfam annotation, but could be identified by their Superfamily SSF5335 (S-adenosyl-L-methionine- dependent methyltransferases) annotation and their size (i.e. 500-1600 amino acids long in proximity to drmA, drmB, drmC and drmD genes, and so were manually curated as drmMI. In addition, systems that contained a pfam00176 containing gene and Type III R/M genes (methylase with pfam01555 domain and restriction nuclease with a pfam04851 domain) were also defined as Type 1, based on the assumption that the R/M system methylase replaces drmMI.

2. Type 2 systems were defined according to the lack of genes containing a pfaml3659 domain and/or a pfam00176 domain and the presence of a gene containing a pfam00145 domain. In Type 2 systems, the closest gene with a pfam00145 domain was denoted herein as drmMII. An additional gene found within the 60 searched genes in Type 2 systems was manually curated according to size and location and denoted herein as drmE.

Cloning of DISARM into B. subtilis BEST7003 - A cloning vector for large fragments was constructed by assembling the pi 5a origin of replication (ori) from pACYCDuet-1 and the amyE integration cassette from plasmid pDRHO (see www(dot)ncbi(dot)nlm(dot)nih(dot)gov/pmc/articles/PMC3814332 /#pgen(dot)1003892(dot)s00 5). The pl5a ori(Sathiamoorthy and Shin, 2012) was amplified using the primers OG0174 + OG0175 (Table 2 below depicts all primers used). The amyE integration cassette was amplified using the primers OG0176 + OG0185 (Table 2 below). The two fragments were assembled and transformed into E. coli cells using Gibson assembly cloning kit (NEB E5510S), and assembled plasmids were verified by restriction pattern and full sequencing. The DISARM locus of B. paralicheniformis 9945a [Bacillus licheniformis (Weigmann) Chester (ATCC 9945a). The species designation for this strain was recently changed to Bacillus paralicheniformis Dunlap et al., 2015) with NCBI taxonomy ID 766760] in coordinates 815,730-826,377 (RefSeq NC_021362.1, SEQ ID NO: 3286) was amplified using the primers Hezi_l_F + Hezi_2_R (Table 2 below). The vector backbone was amplified using the primers OGO207 + OGO208 (Table 2 below) and the two fragments were assembled using Gibson assembly. Assembled plasmids were transformed into B. subtilis BEST7003 cells as described by Itaya(Itaya, 2003). Scarless deletion strains were constructed by amplification of the DISARM system in two fragments, omitting the desired deletion region, and Gibson assembly with the vector backbone. The vector backbone was generated by the primers OGO207 + OGO208 (Table 2 below). PCR fragments used to generate deletion systems were: AdrmE - OSM13 + SM3, SM4 + OG0175; AdrmA - OSM13 + SM5, SM6 + OG0175; AdrmB - OSM13 + SM2, SM7 + OG0175; AdrmC - OSM13 + SM9, SM10 + OG0175; AdrmMll - OSM13 + SM11, SMI + OG0175 (Table 2 below). The constructed plasmids were then used for integration of the deletion-containing system into B. subtilis BEST7003. Deletion of each gene included the ORF only without damaging intergenic regions. Deleted regions were as follows (coordinates on RefSeq NC_021362.1, SEQ ID NO: 3287): AdrmE - 816,274-818,674; AdrmA - 818,671- 821971; AdrmB - 822,039-823,752; AdrmC - 823,776-824,487; AdrmMll - 824,499-825,847. The entire genome of each constructed strain was verified by Illumina whole genome sequencing (Figure 1). Sequence analysis for strain verification was performed using breseq(Deatherage and Barrick, 2014). A control strain containing an empty integration cassette was constructed in parallel, sequenced, and used as a control in the following experiments.

For construction of the strain expressing drmMll, the ORF of drmMll was amplified from the genomic DNA of DISARM-containing B. subtilis using primers OG0425 + OG0426 (Table 2 below). The backbone of pJMP4 was amplified using primers OG0423 + OG0424 (Table 2 below) and the two fragments were assembled using Gibson assembly so that the drmMll gene is under the control of the plasmid' s Pveg constitutive promoter. To evaluate transformation efficiency, equal amounts of plasmid containing the transformed DISARM systems were used to transform B. subtilis BEST7003 cells. The entire transformation reaction was plated on selection plates and colonies were counted following overnight incubation.

Phage cultivation - phi3T (1L1), Nf (1P19), SPOl (1P4), SPR (1L56), phil05 (1L11) and SPP1 (1P7) phages were obtained from the Bacillus Genetic Stock Center (BGSC). Phage phi29 was received from DSMZ (DSM 5545). Phages were propagated on B. subtilis BEST7003 using the plate lysate method as described by Fortier & Moineau(Fortier and Moineau, 2009). Lysate titer was determined using the small drop plaque assay method as described by Mazzocco et al.(Mazzocco et al., 2009).

Phage infection growth curves - Overnight cultures of bacteria were diluted 1: 100 into MMB medium [Lysogeny broth (LB, Lenonox Cat No. 1231.00, Pronadisa, Laboratorios Conda S.A.) + 0.1 mM MgCl ₂ + 5 mM MgCl ₂ ]. Following, 200 μΐ of the diluted culture were dispensed into wells of 96 wells plates and grown at 37 °C with shaking for 1 hour until early log phase. The number of bacterial cells in the culture was calculated according to an OD ₆ oo of a CFU calibration curve. In the next step, 20 μΐ of phage lysate in the desired multiplicity of infection (MOI) were added and the growth was followed in a TECAN Infinite 200 plate reader with OD ₆ oo measurement every 15 minutes at 37 °C with shaking.

Adsorption assay - 15 ml of mid-log bacterial cultures in MMB medium at OD ₆ oo of 0.3 were infected with phage at an MOI of 1. During the infection the culture was incubated with shaking at 37 °C. At time points 1, 5, 10, 15, 20, 30 and 40 minutes post infection, 0.5 ml samples were taken and mixed with 100 μΐ of ice-cold chloroform. Samples were vortexed, incubated at 37 °C for 5 minutes, vortexed, incubated on ice for 5 minutes, vortexed again and incubated at room temperature for 40 minutes. Following, the samples were briefly centrifuged and the phage concentration in the upper aqueous phase was determined by double layer plaque assay as described by (Kropinski et al., 2009) using B. subtilis BEST7003 as an indicator strain. As a control the same amount of phage lysate was mixed with 15 ml MMB medium without bacteria and a sample was processed through the same stages and measured by double layer plaque assay to determine the reference phage concentration.

Escape phages isolation and testing - Overnight cultures of DISARM-containing B. subtilis and DISARM-lacking B. subtilis cells were diluted 1: 100 and grown to an OD of 0.3. A 100 μΐ of the culture was mixed with 100 μΐ of phage lysate and incubated at room temperature for 5 minutes. Molten top agar (MMB + 0.5 % agar, 4 ml) was added, vortexed, and poured over an MMB Petri dish and the plates were incubated overnight at room temperature. Isolated plaques from the DISARM-containing plates were picked into 100 μΐ phage buffer (50 mM Tris pH 7.4, 100 mM MgC12, 10 mM NaCl). Serial dilutions in MMB were performed and the phages were plated using the small drop plaque assay on DISARM-containing and DISARM- lacking cells.

DNA extraction and sequencing, lysogeny and phage circularization detection - DNA was extracted as follows: 50 ml of mid-log bacterial culture in MMB medium was infected with phi3T at MOI of 1 and incubated with shaking at 37 °C. 5 ml samples were taken immediately post infection (t=0) and at 5, 10, 15, 20, 30, 40 minutes post infection. An uninfected control sample was taken prior to addition of the phage. Samples were immediately transferred to ice. Following, the samples were centrifuged and the pellet was washed 3 times in ice-cold Tris pH 7.4 buffer to remove unabsorbed phages. The washed pellets were frozen in liquid nitrogen. Total DNA was extracted using Qiagen DNeasy Blood & Tissue kit (Qiagen 69504). Detection of phage lysogeny was performed using multiplex PCR as previously described by Goldfarb et al. (Goldfarb et al., 2015). Phage genome was detected using the primers PTG83 + PTG84; bacterial genome was detected using the primers PTG18 + PTG29; the lysogeny junction was detected using the primers PTG125 + PTG126; and phage circularization was detected using the primers PTG115 + PTG116 (Table 2 below). To determine the relative abundance of bacterial and phage DNA, Illumina libraries were prepared and sequenced as described in Goldfarb et al. (Goldfarb et al., 2015). Reads were aligned to the bacterial reference genome and the phi3T genome (GenBank accession: KY030782) as previously described by Goldfarb et al. (Goldfarb et al., 2015). To calculate the number of phage genome equivalents per bacterial genome the number of reads aligned to the phage and host genomes at each time point were normalized to the genome sizes. T=5 minutes, which represents a time point until which phage adsorption continued but no phage replication initiated, was used as a reference point for comparison of phage DNA levels.

Bisulfite sequencing - Genomic DNA of B. subtilis BEST7003 containing DISARM; control B. subtilis BEST7003; the constitutive drmMII strain; and B. paralicheniformis 9945a, as well as genomic DNA of phage phi3T were used to construct PBAT libraries, using a modified version of the published protocol(Miura et al., 2012). Briefly, 50 ng of genomic DNA were converted and purified according to the manufacturer's instructions (EZ DNA methylation lightning MagPrep, Zymo Research), using half of the recommended amount of each reagent. Bisulfite-converted products were subjected to second strand synthesis by Klenow fragment 3' to 5' exo- (10 units, M0212L, NEB) and the indexed random nonamer primer (0.8 μΜ): 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCT-INDEX-GGNNNNNNNNN3' (SEQ ID NO: 3288). This primer includes the truncated Illumina P5 adaptor followed by 8 bp internal index. The excess of primer was removed at the end of the reaction by exonuclease I (M0293L, NEB) and the products were purified with 0.8 x beads (Agencount Ampure XP beads, Beckman Coulter). DNA was denatured for 6 minutes at 95 °C and the second strand was synthesized by Klenow polymerase using the indexed random nonamer primer (0.8 μΜ) containing the P7 Illumina adaptor: 5'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-INDEX- CCNNNNNNNNN3 ' (SEQ ID NO: 3289). The products were purified with 0.8 x beads and the library was generated by 12 cycles or PCR amplification using 2.5 units of GoTaq Hot Start polymerase (M5005, Promega) together with 0.4 μΜ Illumina Forward PEl.O primer (5'-AATG ATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3 ', SEQ ID NO: 3290) and 0.4 μΜ pre-indexed Illumina Reverse primer (5'- CAAGCAGAAGACG GCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3', wherein XXXXXX represents barcode for multiplexing, SEQ ID NO: 3291). Amplified libraries were purified with 0.7 x Agencourt Ampure XP beads and were assessed by Qubit dsDNA HS Assay kit (Thermo Fisher Scientific) and Bioanalyzer (Agilent). The final quality-ensured libraries were pooled and sequenced on the NextSeq500 Illumina for 150 bp paired-end sequencing, and generated 4-6 M reads per each library. Before analysis, adaptor trimming and quality trimming were performed using Cutadapt [Martin, M. EMBnet.journal 17, 10 (2011)]. Analysis of bisulfite-modified sequence reads was done using Bismark [Krueger, F. & Andrews, S. R. Bismark: Bioinformatics 27, 1571-1572 (2011)]. A whole-genome cytosine methylation report was generated and methylated positions were defined as positions with total coverage greater than 5 and methylation ratio greater than 2. The neighborhood of the methylated positions was extracted from the reference genome and analysed for a recurrent motif. The positions of all CCWGG (SEQ ID NO: 3321) motifs in the genomes were extracted from the reference genomes and the methylation ratio of these positions was extracted from the cytosine methylation report.

Fluorescence microscopy visualization of injected phage DNA - Strains: The thrC:LacI-CFP cassette of strain ET3 [Tzipilevich et al. Cell 168, 186-199 (2017)] was amplified from the genomic DNA using primers OGO380 + OG0381 (Table 2 below) and transformed into the BEST7003 and DISARM-containing strains. The control cells were then transformed with a constitutive RFP construct (amyE:Pveg-RFP) using plasmid pJMP4. Phage SPP1 containing an array of 64 repeats of LacO [Jakutyte, L. et al. J. Bacteriol. 193, 4893-4903 (2011); Jakutyte, L. et al. Virology 422, 425-434 (2012); Robinson, J. T. et al. Nat. Biotechnol. 29, 24-26 (2011)] was used.

Fluorescence microscopy in a microfluidic device: Overnight cultures of LacI-CFP DISARM- containing and RFP expressing control cells were diluted 1 : 100 and grown until an OD of 0.3. Following, the culture was diluted 1 : 10, and equal amounts of both strains were mixed together. The mixed culture was loaded into the chamber of a CellASIC ONIX plate for bacterial cells (Mercury, B04A-03-5PK) according to the manufacturer instructions; and mounted on a Zeiss Axio Observer Zl inverted microscope. The cells were grown under a constant flow of MMB medium and monitored periodically in bright-field and RFP channels to monitor cell division for ~1 hour. Imaging then started and was performed in three channels: bright-field, CFP (filter set 47 HE) and RFP (filter set 64 HE). Images were captured every 5 minutes. Following 15 minutes, SPPl-LacO phages in MMB (10 ⁵ plaque forming units (p.f.u.) μΠ ¹ ) were flowed into the chamber for a period of 30 minutes. The infection was followed until the DISARM-lacking cells began to lyse.

Image analysis: Analysis was effected using Imaris software (Bitplane). The background was subtracted from CFP and RFP channels. Fluorescent foci were segmented and tracked from the CFP channel using the Imaris spots object. Foci were allocated to DISARM-lacking cells according to RFP level at the same location. Segmentation and tracking were manually corrected. The number of foci within each strain was counted for each frame separately.

EXAMPLE 1

THE IDENTIFICATION OF A NOVEL PHAGE DEFENSE SYSTEM DEFINED

HEREIN AS DISARM

Identification of DUF1998-containing gene cassettes in microbial defense islands

The Integrated Microbial Genomes (IMG) database(Markowitz et al., 2012) was searched for genes whose only annotated domain is the protein domain DUF1998 (pfam09369), which has no known function. Within the 35,893 genomes scanned, 1,369 genes containing only the DUF1998 domain were found, encoded in 1,273 different genomes - 3.5 % of the scanned genomes (data no shown). As defense systems are frequently encoded by multiple genes working in concert that are co-localized in the genome (i.e. defense islands), the genetic context of the DUF1998-containing genes was analyzed:

• In the vast majority of cases (1,095 / 1,369) the DUF1998-containing gene was preceded by a large gene (encoding -1, 100- 1,300 amino acids) containing a pfam00271 domain, a domain that is a part of the catalytic core of DExx-box helicases(Caruthers et al., 2006). Further structural modeling of this protein using Pyhre2(Kelley et al., 2015) confirmed structural homology to DExx-box helicases including the two essential catalytic domains(Caruthers and McKay, 2002).

• The only abundant annotated gene downstream to the DUF1998-containing gene was a gene with a phospholipase D (PLD) domain (pfaml3091), appearing in 370 of the 1,369 cases. The PLD domain is associated with enzymes that manipulate phosphoester bonds, such as kinases, phospholipases and endonucleases(Selvy et al., 2011), and was shown to be the catalytic domain of some restriction endonucleases(Grazulis et al., 2005; Zaremba et al., 2014).

As the combination of these three genes was found to be the most abundant conserved genetic context of DUF1998, these three consecutive genes were defined as the core genes of the hypothesized defense system: : pfam00271 -containing gene (denoted herein as drmA), DUF1998-containing gene (denoted herein as drmB) and pfaml3091-containing gene (denoted herein as drmC). In total, 351 such triplets were identified in the analyzed genomes (Tables 1A- C above).

An abundant 5-gene cassette represents a putative new defense system

The genomic neighborhood of the 3 core genes was analyzed and in most of the cases (324/351) the genes were associated with a gene with a DNA methyltransferase domain, marking it as a possible new type of restriction/modification system. Hence this system was denoted as Defense Island System Associated with Restriction Modification (DISARM).

Type 1 DISARM: In most cases, the core gene triplet was adjacent to a DNA adenine N6 methyltransferase gene (a gene containing a pfaml3659 domain, denoted herein as drmMI) usually annotated in the restriction enzymes database REBASE(Roberts et al., 2015) as a putative Type IIG R/M gene. In these cases, which were defined as Type 1 DISARM, the systems comprised the core triplet, the methyltransferase, and a fifth gene annotated as COG0553 SNF2 family helicase, containing SNF2-like ATPase (pfam00176) and helicase C- terminal (pfam00271) domains(Diirr et al., 2006) (denoted herein as drmD). Gene cassettes containing the Type 1 DISARM system were found in 11 bacterial and 3 archaeal phyla (Figures 2A; Table 1A above).

Type 2 DISARM: A second subset of systems, defined as Type 2 DISARM, did not contain the SNF2 helicase and the Type IIG R/M enzyme pair mentioned above, but instead contained a DNA 5-cytosine methyltransferase (pfam00145 domain, denoted herein as drmMII). These systems were mostly found in extremophilic bacteria and archaea and in Firmicutes, especially Bacilli. Unlike the larger Type 1 systems, the Type 2 systems were more compact. In most Bacilli and halophilic archaea, the systems comprised another gene encoding a protein sized -800 amino acids (Figure 2B).

DISARM systems of unclear Type: In cases where no drmMI or drmMII were identified next to the core drmABC genes a type was not assigned to the system. In many cases, this was due to the presence of the drmABC genes on a short contig or at the end of a contig.

EXAMPLE 2

TYPE 2 DISARM CONFERS RESISTANCE TO PHAGE INFECTION IN BACILLUS

SUBTILIS

Type 2 DISARM system was selected for experimental validation. To test whether the hypothesized DISARM system provides protection against phage infection, the DISARM locus of Bacillus paralicheniformis 9945A, including the upstream and downstream intergenic regions, was cloned into the Bacillus subtilis BEST7003 genome (Figure 3A). Prior cloning it was verified that the Bacillus subtilis BEST7003 (hereinafter B. subtilis) does not contain a DISARM system of its own by searching for homologs of each of the DISARM genes in its genome. The correct insertion of the system into the B. subtilis genome was verified by whole genome sequencing (Figure 1). Importantly, no change in growth dynamics was observed in the DISARM-containing B. subtilis bacteria compared to the control strain transformed with an empty plasmid (Figure 3B).

Challenging the DISARM-containing B. subtilis strain with phages from all 3 morphological families of the Caudavirales: the Siphophages phi3T, SPR, SPP1 and phil05, the Myophage SPOl and the Podophages Nf and phi29. SPOl, SPP1, phi29 and Nf are obligatory lytic phages, while phi3T, SPR and phil05 are temperate phages. Infections were performed at 3 orders of magnitude of Multiplicity of Infection (MOI) - 0.05, 0.5 and 5 phages per bacterium. The results show that Type 2 DISARM provided protection against all phages, manifested by delay or no culture collapse following infection with the phages (Figures 3C-E and 9A). To quantify the protection, phage efficiency of plating (EOP) was measured on DISARM- containing bacteria vs. control bacteria (Figures 3F and 9B). As shown, Phi3T did not form plaques on DISARM-containing B. subtilis bacteria at any of the concentrations tested, indicating the DISAM system provided >7 orders of magnitude of protection. Further, DISARM provided strong protection against Nf, phi29, SPR, phil05, with up to seven orders of magnitude of protection. For two of the phages intermediate levels of DISARM defense was observed, with two orders of magnitude against SPOl and one order of magnitude against SPP1.

EXAMPLE 3

THE MECHANISM OF ACTION OF TYPE 2 DISARM

To test whether the partial protection observed for some of the phages is due to a heritable trait such as resistance mutations or epigenetic modification in a subpopulation of the infecting phages, Nf and SPOl phages were isolated from single plaques that appeared on DISARM+ cells. These isolated phages did not show increased resistance (measured via plaque assays) against DISARM+ cells as compared to their ancestor phages (Figure 10), suggesting that for these phages escape from DISARM is not due to genetic or epigenetic traits. Instead, a small proportion of these phages seem naturally to be able to propagate inside at least a fraction of the DISARM+ cell population.

One of the known phage defense paradigms is abortive infection, in which bacteria commit suicide upon infection, thus preventing the completion of the phage replication cycle(Dy et al., 2014), thereby preventing the release of phage progeny and the spread of infection to neighboring cells. In this scenario, infection with an MOI > 1 is expected to cause the suicide of a large fraction of cells in the culture and an immediate reduction of OD upon infection. As DISARM-containing B. subtilis cultures infected with MOI = 5 did not collapse upon infection (Figures 3C-E), the DISARM probably does not provide protection through an abortive infection mechanism.

In addition, transformation efficiency experiments using an episomal Bacillus plasmid were also performed. No reduced transformation efficiency in DISARM+ cells was detected, suggesting that DISARM does not interfere with DNA import of this plasmid through the natural competence system of B. subtilis (Figure 11).

To test if DISARM protects the bacteria by preventing phage attachment, the rate of phage adsorption to DISARM-containing B. subtilis vs. DISARM-lacking B. subtilis bacteria was compared. No significant difference was observed in the adsorption rates, indicating that DISARM provides protection without hampering phage adsorption (Figure 4A). In the next step, replication of the phage genome in DISARM-containing B. subtilis bacteria was evaluated. To this extent, Illumina sequencing was used to quantify the amount of phage DNA in comparison to bacterial DNA during infection with phi3T at MOI = 1. As the bacterial genome is not degraded during phi3T infection(Goldfarb et al., 2015), the ratio between phage reads and bacterial reads can be used to quantify the number of phage genome equivalents per infected cell. The results show that while in control B. subtilis bacteria the phage DNA replicated over 100 fold 30 minutes post infection, in DISARM-containing B. subtilis bacteria the phage DNA did not replicate but was rather depleted over time in comparison to the bacterial genome (Figure 4B). In addition, phi3T was not able to circularize its genome or form detectible lysogens in DISARM-containing B. subtilis cells (Figures 4C-D). This indicates that DISARM prevents phage DNA replication and lysogeny, and probably also cause phage DNA degradation. Moreover, as DNA circularization occurs soon after injection and is essential for both lytic and lysogenic cycles(Weigel and Seitz, 2006), the results indicate that DISARM stops the infection at a very early stage.

To further examine the dynamics of phage DNA decay in DISARM-containing B. subtilis bacteria, a previously established system that allows imaging of phage SPPl infection [Jakutyte, L. et al. J. Bacterid. 193, 4893-4903 (2011); and Jakutyte, L. et al. Virology 422, 425-434 (2012)] was used. In this system, the SPPl genome is modified to include a lacO array and the infected cells express a LacI-CFP fusion protein. Upon phage DNA injection to infected cells, LacI-CFP proteins bind to the phage lacO array, resulting in a clear focus. Foci were clearly observed on wild-type (WT), DISARM-lacking B. subtilis cells and, once established, the foci grew in size during phage DNA replication (Figures 12A-B). Foci were also observed in infected DISARM-containing B. subtilis cells, but these foci did not expand and rapidly disappeared during the time course of infection (Figures 12A-B). These results further substantiate that DISARM does not block phage DNA injection into the infected cell, but causes intracellular phage DNA decay.

Taken together, DISARM Type 2 is not an abortive infection system and it allows phage adsorption and DNA injection while prevents phage replication.

EXAMPLE 4

ESSENTIAL COMPNONENTS OF TYPE 2 DISARM ACTIVITY

To map the essential components of the DISARM system, a series of B. subtilis BEST7003 strains were engineered (hereinafter deletion strains), each containing a DISARM Type 2 system with a scarless deletion of one of the DISARM Type 2 genes (Figures 5, 6A-F and 7). These deletions were verified by whole genome sequencing (Figure 1). As shown in Figure 5, no growth impairment was observed in B. subtilis strains containing DISARM system with deletion of drmE, drmA, drmB or drmC as compared to control B. subtilis cells or B. subtilis cells containing the full DISARM system. It was not possible to obtain a single-gene deletion for drmMII (further discussed below).

The contribution of each components of the DISARM Type 2 system was then evaluated in the B. subtilis deletion strains by infecting each of them with phi3T, SPOl or Nf phages. As shown in Figures 6A-F and 7, deletions of drmA (helicase domain), drmB (DUF1998 domain) or drmE abolished DISARM protection against all phages tested, indicating that each of these 3 genes is essential for DISARM activity. In contrast, deletion of drmC (PLD domain) had no effect on DISARM protection against phi3T; however, a reduction in protection efficiency against SPOl and Nf phages was observed, such that AdrmC cells were less resistant than cells containing the full DISARM system, but still more resistant than DISARM-lacking cells. Quantification via plaque assays further showed that the AdrmC reduced DISARM defense against Nf by two to three orders of magnitude (Figure 13E). Variable protection in AdrmC cells was also observed in other phages (Figures 13A-D). Hence, drmC appears to be redundant for defense against some phages, while required for defense against others.

As DISARM system Type 2 contains a predicted 5-cytosine DNA methyltransferase (drmMII), a whole genome bisulfite sequencing was performed to find its cognate methylation sequence motif. While in control B. subtilis no significant motif for 5-methylcytosine (5mC) was identified, in DISARM-containing B. subtilis cells the motif CCWGG (W=A or T, SEQ ID NO: 3321) was methylated in the underlined cytosine. Bisulfite sequencing further validated that the same motif was methylated in B. paralicheniformis ATCC 9445A, in which the DISARM locus resides endogenously. These results suggest that drmMII methylates the DNA at CCWGG (SEQ ID NO: 3321) motifs. Without being bound by theory, presumably other components of the DISARM system use non-methylated CCWGG motifs as a marker of foreign DNA akin to other known R/M systems. Consistent with this hypothesis, the attempts to clone a rm H-deleted DISARM system into B. subtilis yielded very low transformation efficiency (Figure 8). Whole genome sequencing of three of the resulting transformed colonies showed massive deletions or frameshift mutations in the DISARM locus in addition to the intended deletion of drmMII. This suggests that in the absence of drmMII the DISARM system is toxic to the cells and only cells with a defective DISARM locus can survive. Without being bound be theory, it is likely that in the absence of CCWGG methylation in the bacterial chromosome, the restriction components in the DISARM system attack the chromosome leading to the observed toxicity. To further examine whether drmMII alone is sufficient for DNA methylation, this gene was cloned under a Pveg constitutive promoter in a WT B. subtilis. Bisulfite sequencing validated that the drmMII expressing strain was methylated on 97.7 % of the reads mapping to CCWGG (SEQ ID NO: 3321) motifs, validating drmMII as the system's methylase. To test whether CCWGG methylation is sufficient to protect phages against DISARM interference, phi3T was propagated on the rm H-expressing strain, yielding methylated phages. Bisulfite sequencing verified that 75 of the 78 CCWGG sites in phi3T became methylated following propagation in the methylase-expressing cells (Figure 14A). The three sites that were not modified overlapped with GGCC sites that are known to be methylated by the native methylase M.Phi3TI encoded by phi3T (the same methylase also methylates GCNGC sites [Noyer- Weidner, et al. Gene 35, 143-150 (1985)], while an additional methylase, M.Phi3TII, modifies TCGA motifs [Noyer-Weidner, M. et al. Nucleic Acids Res. 22, 5517-5523 (1994)]. The DISARM+ strain still protected against the modified phages despite their high level of methylation (Figures 14B). Moreover, DISARM also provided a high level of protection against phage Nf (Figure 3D), although the genome of this phage (GenBank accession no. EU622808) is devoid of any CCWGG site, which was also verified by whole genome sequencing of the Nf phage used. These results suggest that DISARM probably uses an additional, yet unknown mechanism to identify invading phage DNA in addition to the CCWGG (SEQ ID NO: 3321) methylation signature.

Taken together the data establish DISARM as a new defense system, providing protection against diverse phages. The DISARM system is widespread in defense islands across the microbial world, and contains drmA, drmB and drmC accompanied by a methyltransferase (drmMI or drmMII) and an additional gene (drmD or drmE). Four of the five genes comprising DISARM are absolutely essential for its activity in phage resistance; while the fifth gene, drmC, is partially required for defense against SPOl and Nf, but is redundant against phi3T. Without being bound by theory, the existence of an R/M-related active methyltransferase, the toxicity caused by its deletion, and the depletion of phage DNA during infection suggests that DISARM represents a new composition of an R/M system that differs from other known such systems: while the modification module of DISARM is composed of a methyltransferase as in classic R/M systems, the restriction module seems to be unique and requires multiple components. In this regard, the drmC gene has a PLD domain, which is a catalytic nuclease domain. However, due it its redundancy in defense against phi3T, drmC is unlikely to function as the core restriction endonuclease of the system, and is more likely to take an auxiliary role. Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

REFERENCES

(other references are cited throughout the application)

Caruthers, J.M., and McKay, D.B. (2002). Helicase structure and mechanism. Curr. Opin. Struct. Biol. 12, 123-133.

Caruthers, J.M., Hu, Y., McKay, D.B., A., B., E., B., R., D., R., E.S., L., H.K., L., S.E., U., B., et al. (2006). Structure of the second domain of the Bacillus subtilis DEAD-box RNA helicase YxiN. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 62, 1191-1195.

Deatherage, D.E., and Barrick, J.E. (2014). Identification of mutations in laboratory-evolved microbes from next-generation sequencing data using breseq. Methods Mol. Biol. 1151, 165— 188.

Dunlap, C.A., Kwon, S.-W., Rooney, A.P., and Kim, S.-J. (2015). Bacillus paralicheniformis sp. nov., isolated from fermented soybean paste. Int. J. Syst. Evol. Microbiol. 65, 3487-3492.

Diirr, H., Flaus, A., Owen-Hughes, T., and Hopfner, K.-P. (2006). Snf2 family ATPases and DExx box helicases: differences and unifying concepts from high-resolution crystal structures. Nucleic Acids Res. 34, 4160-4167.

Dy, R.L., Przybilski, R., Semeijn, K., Salmond, G.P.C., and Fineran, P.C. (2014). A widespread bacteriophage abortive infection system functions through a Type IV toxin-antitoxin mechanism. Nucleic Acids Res. 42, 4590-4605.

Fortier, L.-C, and Moineau, S. (2009). Phage production and maintenance of stocks, including expected stock lifetimes. Methods Mol. Biol. 501, 203-219.

Goldfarb, T., Sberro, H., Weinstock, E., Cohen, O., Doron, S., Charpak-Amikam, Y., Afik, S., Ofir, G., and Sorek, R. (2015). BREX is a novel phage resistance system widespread in microbial genomes. EMBO J. 34, 169-183.

Grazulis, S., Manakova, E., Roessle, M., Bochtler, M., Tamulaitiene, G., Huber, R., and Siksnys, V. (2005). Structure of the metal-independent restriction enzyme Bfil reveals fusion of a specific DNA-binding domain with a nonspecific nuclease. Proc. Natl. Acad. Sci. U. S. A. 102, 15797-15802.

Itaya, M. (2003). Stable Positional Cloning of Long Continuous DNA in the Bacillus subtilis Genome Vector. J. Biochem. 134, 513-519.

Kelley, L.A., Mezulis, S., Yates, CM., Wass, M.N., and Sternberg, M.J.E. (2015). The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 10, 845-858.

Kropinski, A.M., Mazzocco, A., Waddell, T.E., Lingohr, E., and Johnson, R.P. (2009). Enumeration of Bacteriophages by Double Agar Overlay Plaque Assay. In Methods in Molecular Biology (Clifton, N.J.), pp. 69-76.

Markowitz, V.M., Chen, I.-M.A., Palaniappan, K., Chu, K., Szeto, E., Grechkin, Y., Ratner, A., Jacob, B., Huang, J., Williams, P., et al. (2012). JJVIG: the Integrated Microbial Genomes database and comparative analysis system. Nucleic Acids Res. 40, Dl 15-22.

Mazzocco, A., Waddell, T.E., Lingohr, E., and Johnson, R.P. (2009). Enumeration of bacteriophages using the small drop plaque assay system. Methods Mol. Biol. 501, 81-85.

Miura, F., Enomoto, Y., Dairiki, R., and Ito, T. (2012). Amplification-free whole-genome bisulfite sequencing by post-bisulfite adaptor tagging. Nucleic Acids Res. 40, el36.

Roberts, R.J., Vincze, T., Posfai, J., and Macelis, D. (2015). REBASE-a database for DNA restriction and modification: enzymes, genes and genomes. Nucleic Acids Res. 43, D298-9.

Robinson, J.T., Thorvaldsdottir, H., Winckler, W., Guttman, M., Lander, E.S., Getz, G., and Mesirov, J.P. (2011). Integrative genomics viewer. Nat. Biotechnol. 29, 24-26.

Sathiamoorthy, S., and Shin, J. A. (2012). Boundaries of the origin of replication: creation of a pET-28a-derived vector with pl5A copy control allowing compatible coexistence with pET vectors. PLoS One 7, e47259.

Selvy, P.E., Lavieri, R.R., Lindsley, C.W., and Brown, H.A. (2011). Phospholipase D: enzymology, functionality, and chemical modulation. Chem. Rev. Ill, 6064-6119. Weigel, C, and Seitz, H. (2006). Bacteriophage replication modules. FEMS Microbiol. Rev. 30, 321-381.

Zaremba, M., Toliusis, P., Grigaitis, R., Manakova, E., Silanskas, A., Tamulaitiene, G., Szczelkun, M.D., and Siksnys, V. (2014). DNA cleavage by Cgll and NgoAVII requires interaction between N- and R-proteins and extensive nucleotide hydrolysis. Nucleic Acids Res. 42, 13887-13896.