FIELD OF THE INVENTION

This invention relates to isolated RNA molecules with high or

strong affinity for amino acids, as well as uses thereof. Also, a part of

the invention are processes lor securing these RNA molecules.

BACKGROUND AND PRIOR ART

Interactions between amino acids and RNA play substantial

roles in a number of biological systems See, e.g., Draper, Ann. Rev.

Biochem 64: 593-620 (1995). For example, arginine inhibits the self-

splicing reaction of the grou jinrron of Tetrahymena by substituting for

two H-donor sites ot the guanosine cofactor which contact the G ^2M -C ^m

base pair in the ribozvme ^' s guanosine binding site. Yarus, Science

240:1751-1758 (1988); Michel, et al. Nature 342:391-395 (1989).

Recently, the editing reactions of aminoacyl tRNA synthetases have

been viewed as an example of RNA dependent amino acid recognition.

Schimmel, et al., Trends Biochem. Sci 20:1-2 (1995). These editing

reactions involve RNA dependent steps which eliminate errors of

amino acid activation and aminoacvlation. Jakubowski, et al.,

Microbiol. Rev 56:412-429 (1992). A third example is the interaction of

the HΓV-1 TAT protein with a stem loop structure of TAR RNA, located

at the 5' -end of HIV-1 mRNA. Critical for the recognition of TAT and

TAR is a single arginine within a basic region of TAT. Calnan, et al.,

Science 252:1167-1171 ( 1991). Short oligopeptides resembling the basic

region as well as tree arginine bind specifically to TAR, although

weaker than within the context of the whole protein Weeks, et al.,

Science 249:1281-1285 ( 1990). The TAT-TAR interaction provided the

first example to show that in protein-RNA recognition RNA structures

are involved which interact with individual amino acid side chains in

the protein. It seems likelv that other, yet undiscovered RNA-protein

interactions exist in which single amino acid side chains within a

protein or peptide torm specific contacts to structural elements

provided by RNA to largely determine specificity, functionality, and

strength of binding Draper, supra.

The isolation and characterization of RNA sequences which

specifically recognize individual amino acids might facilitate a better

understanding of biologically relevant protein-RNA or RNA-amino

acid interactions. A powerful tool to obtain amino acid binding RNAs

is in vitro selection as taught by, e.g. Famulok, et al., Agnew. Chem.

Int. Ed. Engl. 31:979-988 (1992). Klug, et al., Mol. Biol. Rep 20:97-107

(1994); Gold, et al. Ann. Rev. Biochem. 64:763-797 (1995); Joyce, Curr.

Opin. Struct. Biol 4:331-336 (1994), all of which are incorporated by

reference. RNA aptamers which specifically recognize amino acids,

such as ύrrimobilized tryptophan, arginine, cirxulline, and valine have

been extracted from pools of up to 10 ¹⁵ different RNA sequences. See

Connell, et al., Biochemistry 32:5497-5502 (1993); Famulok, J. Am.

Chem. Soc. 116:1698-1706 (1994); Majesfeld, et al., Natur. Struct. Biol.

1:287-292 (1994), all of which are incorporated by reference. The

reported affinities ranged from 60μM (Famulok) to 12mM (Majesfeld)

with a high level of discriinination against other amino acids being

obtained in each case. Among these amino acid binding RNAs, the

arginine specific aptamers might be especially relevant to protein-RNA

recognition because arginine side chains carrying a positive charge at

neutral pH seem to be particularly suited to form specific contacts with

a negatively charged nucleic acid. See Aboul-ela et al., J. Mol. Biol

253:313-332 (1995). For example, the HIV-1 Rev protein contains a

basic region in which ten of seventeen amino acids between positions

34-50 are arginines. A corresponding 17-mer peptide binds to the Rev

responsive element (RRE) RNA IIB hairpin in the same way as within

the context of the lull-length protein with four arginines being

important for specificity. See, respectively, Kjems, et al., EMBO J

11:1119-1129 (1992); Tan, et al. CeU 73:1031-1040 (1993). In the HIV-

TAR/ Tat complex an -irginine and an isoleucine residue were found to

be critical for binding and specificity. Frankel, in Nagai, et al., ed,

RNA-Protein Interactions IRL Press, New York, NY 1994) pp. 221-247.

Furthermore, the Rex-protein of HTLV-I might interact with its natural

RNA binding element XBE through arginine residues. Baskerville et

al., J. Virol 69:7559-7569 ( 1995).

Further work has now been carried out, resulting in the

development of techniques which permit, and have permitted, the

isolation of RNA molecules which have strong or high affinities for

particular amino acid molecules. The present invention is a

development of the work described by Famulok, J. Am. Chem. Soc.

116:1698-1706 (1994), incorporated by reference. Via modifications in

the protocols described therein, it has been possible to isolate RNA

molecules of extremely high affinity, as is shown via the examples

which follow.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is a representative elution protocol obtained in

accordance with the invention.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

EXAMPLE 1

Two pools of RNA were prepared for screening for high affinity

binding to amino acids. The first pool ("pool 1" hereafter) was

prepared according to Famulok, J. Am Chem. Soc. 116(5) :1698-1706

(1994), incorporated by reference. The Famulok paper teaches the

production of a pool of about 10 ^l3 RNA molecules which were 111

nucleotides in length. These lllmers were prepared using defined 5'

and 3' sequences, together with a randomized 74mer insert.

-D-

Famulok teaches, inter alia, a particular RNA molecule ("clone

16"), which has high L-citrulline affinity. This clone was used as the

basis for preparing a second, degenerate pool. This pool was prepared,

also following Famulok except that in preparing the 74mer insert, the

reservoirs of phospharamidite were each doped with 10% of each of the

other phospharamidites, to provide reservoirs of, e.g., 70%A, and 10%

of each of G, C and T, and so forth. (The 74mer insert is placed in

between an 18-mer and a 19-mer primer binding site.)

The entirety of pool 2 was then subjected to PCR amplification.

The PCR amplification was carrier out as described by Famulok, supra,

resin the primers described therein, i.e.,

TCTAATACGA CTC ACTA TAG GAG CTC AGC CTT CAC TGC (SEQ ID NO.:l)

and

GTGGATCCGACCGTG GTGCC

(SEQ ID NO: 2),

respectively, as the 5' and 3' primers. Six cycles of amplification were

carried out (94 °C 4min; 42 °C, 7min; 72 °C 7min), and then the

amplification product was extracted with phenol/ CHCL _y precipitated

with ethanol, dissolved in 1.3 ml of TE (lOmM Tris-HCl, pH 7.6; ImM

EDTA. pH 80), followed by gel filtration on Sephadex G-50. RNA was

transcribed from the PCR product and used in the s election

protocol s wh ich fo l l ow .

EXAMPLE 2

The RNA produced in Example 1, supra, was selected for high

affinitv amino acid binding. Prior to this, however, it was treated to

purifv it. This procedure is now set forth.

Samples ot the RNA containing solutions of example 1 (10-15 μg,

or 0.4nmoles of RNA), were diluted with water to final volumes of 80

μl. Then, the solutions were heated to 90 °C for 10 minutes, followed

by cooling to 23 °C for 5 additional minutes, after which they were

added to a preselection column. The preselection column consisted of

0.5 ml of agarose which had derivatized glycine bound thereto

(following manufacturer's instructions), and which had been

equilibrated with several column volumes of binding buffer prior to

the addition of the samples.

The RNA containing samples were added to the preselection

column, and then washed with 2-3 volumes of buffer. The effect of this

wash is to start a flow-through from the preselection column, which

was placed directly on top of the selection column (discussed infra).

Positioned direct lv below the preselection column was the

selection column, which was agarose with derivatized arginine bound

thereto, the arginine having been derivatized and attached to the

agarose, in accordance with the manufacturer's instructions. The

selection column had been rinsed, previously, with binding buffer.

Once the RNA had flowed onto the selection column, a selection

scheme was employed to find onlv tightly binding aptamers. First, the

column was washed with five volumes of binding buffer. Then,

counter selection was carrier out, by washing the column with six

column volumes of bmding buffer which contained 20mM of citruJLline.

Next, in order to increase stringency of competition between free

citrulline and bound arginine. the agarose, and hence the RNA bound

to it, was heated to 90°C tor 10 minutes then cooled to 23°C for 15

minutes in the presence of the 20mM citrulline containing solution.

The column was then eluted with another 5 column volumes of

binding buffer containing 20mM citrulline so as to remove any non-

bound RNA.

The column was then washed with 15 column volumes of

binding buffer plus 20mM arginine, and was then heat denatured, in

the presence of this solution, using the parameters set forth supra. This

was done because it was assumed that molecules which have a slow

dissociation rate and hence elute slowly are tight binders when heat

denatured, these tight binding RNA molecules should separate from

the column and renarure in the presence of excess ligand in solution,

thereby avoiding undesired enrichment of those molecules which

require functional groups in the matrix plus the ligand for binding.

The column was then eluted with 5 column volumes of binding

buffer plus 20mM arginine. Eluted RNA was collected by (a) removing

amino acids with phenol (b) precipitating the RNA, and then (c)

amplifying the RNA. This cycle was repeated, twenty times, and was

carried out on both pool 1 and pool 2, as described in Example 1. A

representative elution profile from cycle 20, is shown in Figure 1.

EXAMPLE 3

The RNA aptamers which eluted after cycle 10 and cycle 20 were

subjected to PCR amplification in accordance with Famulok. supra.

and then sequenced. Of 36 clones sequenced following cycle 10, 35%

showed the arginine binding motif taught by Famulok, supra and 65%

did not. When materials obtained after twenty cycles were sequenced,

however, none of those in cycle 10 were found, indicating that the prior

art sequences do not have the same level of affinity for their partner

amino acid as do those left after 20 cycles. The sequences found after

20 cycles are presented in SEQ ID NOS: X through Y. Of the 31 clones

found, one sequence appeared 8 times, four sequences each appeared

twice, and eleven sequences, once only.

When the sequences found in pool 1 and pool 2 were compared,

only one, Le., Ag. 06 (SEQ ID NO: 3 ) was found in both pools. This

molecule was also the most prevalent one.

EXAMPLE 4

Experiments were then carried out to determine the strength of

binding of the isolated aptamers. This is determined by calculating the

dissociation constant, using the well known methods of e.g., Lorsch, et

al. Biochemistry 33:973-982 (1994); Fersht, Enzyme Structure and

Mechanism, 2 ^nd Ed. (W.H. Freeman and Co., New York, 1985), p 186;

Connors, Binding Constants (Wiley, New York 1987), p. 314,

incorporated by reference. This is an equilibrium dialysis method

using dialvsis chambers of 500 ul volume. The membrane used had a

molecular weight cutoff of 5000 daltons. A sample of RNA, typically

at a concentration of l.O^M was used. Measurements were generally

taken at three different concentrations of L-[2, 3, 4, 5- ³ H] - arginine -

HQ (Le., 250, 25 and 2.5 lvl). Sample volumes of 200 μl were used on

each side of the membrane. The samples were equilibrated at 23 °C

overnight, after which the volume on both sides of the membrane was

determined and adjusted to ensure the amounts were the same.

Aliquots were withdrawn, and subjected to scintillation counting.

Three RNA molecules were used, i.e., Ag. 06 (SEQ ID NO: ), as well

as two other molecules representing point mutations , SEQ ID NOS

4 + 5.

Using the specific activity of arginine, concentrations of bound

ligand [ESJeg, free amino acid [S]eq, and free RNA [E]eg at equiUbrium

were calculated. Kd is defined by the equation:

Kd = ([E]eq X[S]eq) x [ESJeq ¹

The value for Ag. 06 was about 330nM, i.e., nearly 200 times greater

than the tightest binders ot Famulok supra. Note that a strong affinity

is represented by a low numerical value, and a weaker affinity by a

higher numerical value. The specific values ranged from 4mM to

330nM, and are on a par with affinity values for other, non-amino acid

substances, such as theophylline (320nM) cyanco balamine (88nM), and

the aminoglycoside antibiotics tobramycin, kanamycin, lividomycin,

and neomycin (20nM - 220nM). See Jenison et al., Science 263:1425-

1429 (1996) Lorch , et al., Biochemistry 33:973-982 (1994); Wang et al.,

Chem & Biol 2:281-290 (1995); Lato, et al., Chem & Biol 2;291-303

(1995); Walks, et al., Chem & Biol 2:543-552 (1995).

EXAMPLE 5

Experiments were carried out to determine if the RNA molecules

could distinguish between L-arginine and D-arginine. Using the

analvtical affinity chroma tography method of Arnold, et al. J.

Chromatog 355:1-2 ( 1986), and when applied to a 4.0mM D-arginine

agarose column, the RNA eluted in the void volume. This leads to the

conclusion that the Kd is 4mM, i.e., the affinity was very weak.

Thus, the mole ules such as Ag. 06 (SEQ ID NO: 3), show great

discrirnination. In this particular case, it is on the order of 12,000 fold

better.

The foregoing examples set forth particular embodiments of the

invention which includes, inter alia, isolated ribonucleic acid (RNA)

molecules which have high affinity for a particular amino acid.

Especially preferred are isolated ribonucleic acid molecules having

affinities of around 300nM, more preferably greater than about 60μM.

These RNA molecules can have the strong affinity for any L- or D-

amino acid. Of particular interest are RNA molecules with high

affinity for L-arginine. and which may permit discrimination between

L- and D-arginine, and /or L-citrulline and L-arginine. Exemplary of

such RNA molecules are those set forth in SEQ ID NOS: 3 through 20 ,

inclusive.

These RNA molecules have various uses, which will be clear to

the skilled artisan. For example, the RNA molecules may be used to

remove particular amino acids from a solution, or determine the

presence or amount ol a particular amino acid, by exploiting this high

affinitv to form complexes of RNA and amino acid which can be

removed from a solution, followed by identification and/ or

quantization of the amino acid via elution, or other standard analytical

techniques. Enantiomers of amino acids may be identified and/ or

separated, such as L and D arginine; different, structurally related

amino acids, such as L-arginine and L-άtrulline may be separated, and

so forth.

Of particular interest as a feature of the invention is a process for

isolating an RNA molecule with high affinity for an amino acid. The

essential steps of this process involve the denaturing of an RNA

molecule or sample, followed by binding the denatured RNA to a solid

phase, using art recognized techniques which need not be repeated

here. Next, the bound RNA is contacted with a solution of an amino

acid which is not the amino acid for which a high affinity binder is

sought. Then, any RNA which remains bound to a solid phase is

heated, followed by contact, a second time, with the amino acid

solution referred to supra. These three steps can be repeated for any

number of cycles, using the same, or different amino acids. For

example, were one looking tor high affinity L-arginine binders, one

might contact the solid phase bound RNA with D-arginine, heat it, and

contact it a second time with D-arginine, followed by a repeat of these

steps using L-citrulline. Preferably, one carries out the cycling for

anywhere from 5 to 20 cycles, most preferably, 10-20 cycles.

Following these steps, any remaining RNA is heated and then

contacted with a solution ot the amino acid for which a strong or high

affinity binder is sought. This serves to elute the desired RNA from

the solid phase.

In these processes, it is preferred that the RNA be bound to the

solid phase by amino acid molecules for which strong affinity binders

are sought.

A strong or high affinity binder, as was noted, supra, is an RNA

molecule which has a low Kd value. For the invention as described

herein, strong affinitv (or high affinity) binders are those with a Kd

value of 60μm or less. More preferably, these molecules have a Kd

value that is an order of magnitude lower, i.e., about 6.0μm or less.

More preferably, this value is about 500 nM or less, and most

preferably, about 300 nM or less.

Other features ot the invention will be clear to the skilled artisan,

and need not be elaborated upon herein.

The terms and expressions which have been employed are used

as terms of description and not of limitation, and there is no intention

in the use of such terms and expressions of excluding any equivalents

of the features shown and described or portions thereof, it being

recognized that various modifications are possible within the scope of

the invention.

UAAACCGAUGCUGGGCGAUUCUCCUGAAGUAGGGGAAGAGUUGUCAUGUAUGGG ag 04 r- AUGAUAAACCGAUGCUGGGCGAUUCUCCUGAAGCAGGGGAAGAGUUGUCAUGUAUGGG ag.16 > AUGAUAAACCGAUGCUGGGCGAUUCCCCUGAAGUAGGGGAAGAGUUGUCAUGUAUGGG ag.02* ₀ CCAGCCUAUGGACGUGCCUUUACGGCUGUCCGGAAAAGGUGGUGCCGUCCGGCAUGGC

— ag 10*

/ CCAGCCUAUGGACGUGCCUUUACGGCUGUCCGGAAAAGGUAGUGCCGUCCGGCAUGGC a Ol*

23 ^" GCGGCGGGUGUACUUCGCAAGAGGCCCGUGCGGUGGGAGUGGUAGCCUUGGAAACCAUAG A agll* GGCGGGUGUACUUCGCAAGAGGCCCGUGCGGUGGGAGUGGUAGCCUUGGAAACCAUAGA . ag 13 AGAUCAGGCACGCCGGGUACGAAAUAGCACCAAUGUCAACAUGACUUUUAAAGAGC

M ae 17 AGAUCAGGCACGCCGGGUACGAAAUAGCACCAGUGUCAACAUGACUUUUAAAGAGC

ag 03*

1 2 ACAGCCAACGGUUCGGUCACGGGACUGCUCUUCAUCGUAGGGAGUGGUGGCCUUGGUACG U

GCGGA ag.12

1 3 AAUCUCGAACUCUGCGGUAGUCAAUACCGGCUUUCAGAGAACGGUCGAGGUCGCUUGUCG G

UCUGC ag.05 CGCUGAGAGAGAGUCCUCUGUUUAGGAAGUGUAGCUUAACUUGCGACAGGCAGGCUUCA ag.07

I S ^" ACAGCAACGCGUGUAAGUCGAUAAACUUCUCUUUAGCAGAAGUGGUAAGCUGUGUGACGU

AAGGC

I <p ag 08 AGCUGCGGUGUGGCGGAAGGAGUGUAGCAUAAGUUAGAGUGAGCCUUCUGCCUGUG

_ ag.09

' / ACGGACUACCAGGUAGGUCGCUGGACGAAUCGGAAGGAGGGUAACCUUGCGGUAGGACUG U G

I $f ag.14 GGAUCAGGGACGGCGGGUAGAAAUAGCACCAAUGUUCAAUCAGUGGGCCCAAAGAGC

I ύ ag.15

¹ A ^' CAGCAACGCGUGUAAGUCGAUAAACUUCUCUCUAGCAGAAGUGGUAGCUGUGCG ACGUGA

2^0 AG 18* AAUGCUAACCGCAUUGGCCGCGGGACUUCUCGUCUGACCAGUUAGCAUGGCGUGGU

ag.19

AUAGCGCAAAACGGUUCGGCUACGGGCUGCCCGGCGAAGGGUGGUAGCCUUGCUGAU GUUU GGAC

2.2- ag.20 ACGCGUGGUCCUCCUCUCCAUGACUCUCUGGACGGCGUGUAGUCUUGAAACGUCUGAU ag-21 2.? ACACCGAUGCGGGCGAUGGACAUCUCUUCCCUAAUGACUGGAAGGGAUGGUAAGGUGGCU G

UGUGGC

7 <■ ag.24

AACAGGUAGGUCGCUGCACUGUCCUUUGGGACUGUCCGGAAGGAGCGUUGUCAGGUA UCGC