KNOCKOUT MICE DERIVED FROM SITE SPECIFIC RECOMBINASE

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001 ] This application claims the benefit under 35 USC § 1 19(e) of U.S. Provisional Patent Application Ser. No.: 61/858,270 filed July 25, 2013, the disclosure of which is herein incorporated by reference in its entirety for all purposes.

FIELD

[0002] The present disclosure relates to genetically modified cells and animals, and a method for genetically modifying a transgenic non-human mammal, in embodiments a mouse, and uses thereof.

BACKGROUND

[0003] Targeted gene modification in a mouse, referred to as knockout mouse technology, is the most effective method used for creating genetic models of human disease. U.S. Patent 4,959,317 discloses the use of Cre-lox recombinase system in yeast and cultured mammalian cells, but not in transgenic mice. U.S. Patent 5,527,695 discloses the use of site specific recombinase Flp in plants. U.S. Patent Appl. Publ. 2004/0205838 discloses the use of site specific Flp recombinase in mice.

[0004] Knockout mouse creation typically begins by introducing a targeting vector into wild type mouse embryonic stem (ES) cells. The targeting vector is a plasmid DNA with a targeted sequence and a selection marker gene or selection cassette (e.g., antibiotic, drug selection). The targeting vector is introduced into the ES cells derived from the wild type mouse strain.

Selection cassettes, such as Neomycin, hygromcyin, and puromycin, are commonly used in targeting vectors for generating mouse knockout/knockin models. A common selection cassette includes a promoter that is active in ES cells linked to the coding sequence of an enzyme that imparts resistance to a drug, such as G418, followed by a polyadenylation signal, which promotes transcription termination and 3' end formation and polyadenylation of the transcribed mR A.

(0005) The selection cassette is required in the targeting vector for two reasons. First, after the targeting vector is introduced into an ES cell line, the ceils are treated with a specific antibiotic based on the selection cassette in the targeting vector. Clones that survived the antibiotic treatment have the targeting vector with selection cassette integrated into the mouse genome either correctly or randomly. Such clones will then be selected for screening of correct integration. Second, the selection cassette provides a screening strategy to identify ES clones that have undergone correct integration into a pre-determined location in the genome. The selection cassette may include unique restriction site sequences used to design PCR primers and Southern blot screenings to identify clones that have the targeting vector integrated in the correct locus in the mouse genome. After ES cells are identified, ES cells which now have clones with the correctly integrated targeting vector are injected into blastocysts and then implanted in the uterus of a surrogate mother (e.g., a pseudopregnant mouse) that will give birth to chimeric pups that are partially or fully derived from the genetically modified ES cells. After growing to sexual maturity and breeding with wild-type mice, some of the chimeric pups will transmit the modified gene to their progeny. Further breeding of the progeny with each other (e.g. a brother to a sister) will produce progeny that homozygous for the modified allele and are commonly referred to as knockout mice.

{0006] After selection of drug-resistant clones, the selection casse tte serves no further function for the modified allele. Ideally, the cassette should be removed, leaving an allele with only the intended genetic modification, because the selection cassette might interfere with the expression of a neighboring gene such as a reporter gene, which is often incorporated adjacent to the selection cassette in many knockout alleles, or might interfere with a nearby endogenous gene (see, e.g., Olsen et al. (1996) Know Your Neighbors: Three Pheno types of the Myogenic bHLH Gene MRP 4, Celt 85: 1-4; Strathdee el al, (2006) Expression of Transgenes Targeted to the Gt(R.OSA)26Sor Locus Is Orientation Dependent, PloS ONE i(! ):e4,). Either event can. confound the interpretation of the phenotype of the modified allele.

[0ΘΘ7] Deleting the selection cassette from genetically engineered mouse models is thus important and necessary, as the selection cassette can also act as a trap and affect either the target gene or possibly other genes nearby, in some cases, two genes can overlap each other and thus the insertion of a selection cassette can destroy both genes. Moreover, the selection cassette may be detrimental in early stages of mouse development. In some cases, the insertion of the selection cassette will slow down the growth of ES cells during cul hiring stage and some could be detrimental for genes with one copy or those located on the X chromosome. Removal of the selection cassette during ES culture stage thus provides an extra advantage. Thus, the selection cassette should he removed after identification of recombinant clones.

[0008] There are two major approaches for removing the selection cassette. One of the approaches is to delete the selection cassette in ES cells by eiect.roporat.ing positively targeted ES cell clones with a plasmid containing site-specific recombinase such as FLP or Cre and then screening for cells which lack the selection cassette. The disadvantage of this approach is that performing a second electroporation will jeopardize the genomic stability of ES cells and their ability to contribute to gennline. Furthermore, this approach is costly and time consuming, as it will take additional months to perform the electroporation and screening for clones without the selection cassette. [0009] The transient expression method mentioned above is not 100% efficient and may result in ES subclones with the selection cassette intact. These subclones must be screened to determine whether the selection cassette has been excised, and they must be subjected to high levels of recombinase activity and extra manipulations in cell culturing. Such a process might affect the clone's ability to transmit the modified allele in germline and might impair its ability to produce knockout mice with a successfully deleted selection cassette. Furthermore, selection cassette excision using gene targeted ES cells may result in improper phenotype alleles and is prone to human error.

[0010] Another approach to remove the selection cassette is to breed the mice that carry the knock out allele with a site-specific recombinase deletor strain. However, such breeding is also not 100% efficient because such breeding will result in an incomplete (mosaic) excision of the selection cassette in the presence of the knockout allele in tissues and organs in the first generation of mice. Therefore, progeny mice must be screened for the presence of correct recombinants with the excised selection cassette. This involves breeding another generation of mice, which is very time-consuming due to several generations of mating and

genotyping identifying the correct mice. It is also labor intensive and costly due to the need to maintain the colony and housing for mice for several additional generations. This process might result in about six months in breeding and housing costs, and may introduce mixed strain backgrounds through breeding since the mice carrying the recombinase (deletor strain) may have a different genetic background than the knockout mice containing the selection cassette.

[0011] There is still a need to remove the selection cassette efficiently aside from using the two approaches mentioned above. For example, U.S. Patent 8,354,389, assigned to egeneron Pharmaceuticals. Inc., discloses a method for building in. a promoter and a coding sequence for a site-specific recombinase such as FLP or Cre Into a targeting vector plasmid, not in ES cells. The targeting vector is then introduced into wild-type ES cells, in the ES cells, the vector will integrate into the targeted location in the undifferentiated cells such as ES ceils, and FLP or Cre will not he substantially expressed. The ES cells were then injected into blastocysts and further developed into chimeric mice, In the differentiated cells such as germ ceils of the chimeric mouse, the promoter within the targeting vector will start to express FLP or Cre and excise the selection cassette flanked by respective recombinase recognition sites. This method is mostly dependent on the promoter and the locus of the gene, which is designed to be targeted and thus results in differential expression of the recombinase and excision of the selection cassette with varied effectiveness, which results in unpredictable results, it is also well known in the art that when the same promoter is integrated into different genomic location, it will drive the expression of the gene differently due to methylation and other complex regulation mechanisms.

Furthermore, addition of extra sequences to the targeting vector will make the construction of the vector more difficult because the vector already contains long homology arms and other components. Moreover, U.S. Patent 8,354389 discloses that promoter driven FLP or Cre do not, or do not substantially, express in the ES cells.

SUMMARY OF THE I VENTION

[0012] Compositions and methods for excising nucleic acid sequences in genetically modified cells and animals are provided, and, in particular, using embryonic stem (ES) cells with a site-specific recombinase.

f0013J According to the disclosure, to generate recombinase containing mice and ES cel ls derived from these mice, DNA construct having a desired promoter, which expresses in the ES cells and in the chimeric mice, a site-specific recombinase coding sequence and polyadenylation signal is introduced, into the mouse genomic DMA via microinjection, gene targeting, or by any other means to create a mouse in which site-specific recombinase is expressed in ES cells or chimeric mice. Such a mouse is further bred to create early stage embryos and further developed into ES ceils.

[0014] hi one aspect, a targeting vector construct is provided. The targeting vector includes a selection cassette, having a nucleic acid sequence encoding a selection marker gene and a promoter sequence, wherein the selection cassette is flanked by a first recombinase site and a second recombinase site and the first recombinase site and the second recombinase site are oriented to direct an excision of the selection cassette. The first recombinase recognition site and the second recombinase recognition site flank the selection cassette and a recombinase enzyme expressed by a recombinase transgene recognizes the first recombinase recognition site and the second recombinase recognition site,

[0015] in one embodiment, the first recombinase recognition site and the second

recombinase recognition site is selected from a group including ioxp, lox51 1 , lox2272, lox66 ₅ lox 71 , loxM2, fox517L FRT, F3, FRT 1 1. FRT71, attP, attB, rox, or vox sites. In one embodiment, the first recombinase recognitio site and the second recombinase recognition site is an FRT site. In one embodiment, the selection marker gene is a gene that confers resistance to a drug. In one embodiment, the selection cassette includes a gene that encodes neomycin phosphotransferase (neo ^r ), hygromycin B phosphotransferase (hyg'X puromycin-N- acetyltransfera.se (puro ^! ), b!astieidin S deaminase (hsfl xanthine/guanine phosphoribosyl transferase (gpt), and Herpes simplex virus thymidine kinase (HSV-tk). in one embodiment, the selection cassette includes a gene that encodes neomycin phosphotransferase (neo ^f ). According to an embodiment, the promoter sequence is selected from the group having UbC promoter, hCMV promoter, mCMV promoter, CAGGS promoter, EFl promoter, Pgkl promoter, beta-actin promoter, and ROSA26 promoter. In one embodiment, promoter sequence is a pG promoter, in one embodiment, the targeting vector construct includes a nucleotide sequence of SEQ. ID. NO. 1. In one embodiment, the targeting vector construct includes a nucleotide sequence of SEQ. ID. NO. 2. In one embodiment, the target vector construct has at least 75% sequence identity to the SEQ. ID. NO. .1 or SEQ. ID. NO. 2. In one embodiment, the target vector construct has at least 75% sequence similarity to the SEQ, ID. NO. 1 or SEQ. ID. NO. 2. In one embodiment, the target vector construct has at least. 90% sequence identity to the SEQ. ID. NO. 1 or SEQ. ID. NO. 2. In one embodiment, the target vector construct has at least 95% sequence identity to the SEQ. ID. NO. 1 or SEQ ID. NO. 2. In one embodiment, the first and second recombinase recognition sites are identical or homoiogs.

0016 ^' j According to an embodiment, the targeting vector is introduced by electroporat on, chemical transformation, or any other means to the said ES cells, in which the site-specific recombinase is already built-in. According to an embodiment, the targeting vector farther includes a sequence encoding a developmental gene, essential gene, cytokine gene,

neurotransmitter gene, neurotransmitter receptor gene, oncogene, tumor suppressor gene, selectable marker, or histochemical marker.

[0017] According to an aspect, a method for generating a mouse embryonic stem cell line with a site-specific recombinase sequence integrated into the mouse genomic sequence is provided. The method includes providing a mouse embryonic stem ceil with a DNA construct that expresses a recombinase transgene, providing the mouse embryonic stern cell with a targeting vector including a selection cassette, expressing the recorabinase transgene at a level of recombinase activity sufficient to produce site-specific excision of the selection cassette in a chimeric mouse. The site-specific recombination, according to an embodiment, occurs in germ ceils. The method further includes mating the chimeric mouse with a wild type mouse strain to produce an offspring which does not contain the selection cassette. The targeting vector includes a selection cassette flanked upstream and downstream by a first recombinase recognition site and a second recognition site recognized by the recombinase transgene, wherein the first

recombinase recognition site and the second recognition site are oriented to direct an excision of the selection cassette. According to an embodiment, the selection cassette is a drug selectable marker.

[0018] According to a embodiment, recombination between the first recognition site and the second recognition site causes deletion of the selection cassette sequence in the vector.

According to an embodiment, recognition of the first recognition site and the second recognition site by recombinase causes deletion of the selection cassette sequence from the targeting vector. According to an embodiment, the recombinase transgene is selected from the group including Flp, Cre, VCre, Dre . Vika, or P C31 ,

[0019] According to an embodiment, the DNA construct includes a nucleotide sequence having at least 80% sequence identity to the nucleotide sequence of Flp, Cre, VCre, Dre, Vika, or PhiC31 . According to an embodiment, the selection cassette includes a gene that encodes neomycin phosphotransferase (neo ¹ ), hygromycin B phosphotransferase (hyg"), puromycin-N- acetyitransferase (puro ^! ), blasticidin S deaminase (bsr ^! ), xanthine/guanine phosphoribosyl transferase (gpt), or Herpes simplex virus thymidine kinase (HSV-tk). According to an embodiment, the selection cassette includes a gene that encodes neomycin phosphotransferase (neo ^r ). According to an embodiment, the selection cassette gene is excised in cells containing sufficient FLP recombinase activity. Mice produced by the above method are also provided. According to another aspect, a mouse embryonic stem cell, includes a DNA sequence that encodes a recombinase. A targeting vector is introduced. The targeting vector includes a selection cassette flanked upstream and downstream by a first recombinase recognition site and a second recombinase recognition site recognized by the recombinase transgene, wherein the recombinase transgene and the targeting vector are integrated into the mouse genome, and the first recombinase recognition site and the second recombinase recognition site are oriented to direct an excision by the expression of recombinase in the ES cells and chimeric mice.

According to an embodiment, the recombinase transgene is selected from the group includes Flp, Cre, VCre, Dre, Vika or PhiC3I . According to an embodiment, the recombinase transgene is Fip.

[0020] The mouse embryonic stem ceil further includes a promoter sequence for the expression of the recombinase transgene. According to an embodiment, the promoter sequence is expressed in the mouse embryonic stem cell. According to an embodiment, the promoter sequence is expressed in germ cells of the chimeric mice. According to an embodiment, the promoter sequence is expressed in the mouse embryonic stem cell and in the germ cells of the chimeric mice. According to an embodiment, the promoter of the recombinase transgene is selected from the group including, but not limited to, UbC promoter, hCMV promoter, mCMV promoter, CAGGS promoter, EF1 promoter, Pgkl promoter, beta-actin promoter, Pnnl, Blimp I , Gata6, Igi Lhx5, or Pax or ROSA26 promoter. According to an embodiment, the promoter of the recombinase transgene is human beta-actin promoter.

[00211 According to an embodiment, the mouse strain is derived from C57BL 6. According to an embodiment, the mouse strain is derived from 129. According to an embodiment, the mouse strain is a mixture of C57BL/6 and 129 backgrounds. In embodiments, the mouse strain is an inbred strain. In other embodiments, the mouse strain is an outbred strain. According to an embodiment, the selection casseiie includes a gene that confers resistance to a drug.

[0022] According to yet another aspect of the invention, a transgenic mouse having a recombinase transgene and a targeting vector construct is provided. The targeting vector construct includes a selection cassette gene, wherein the recombinase transgene and the targeting vector are integrated in a genome of the transgenic mouse and the expression of the recombinase transgene directs excision of the selection cassette gene. The selection cassette gene is flanked upstream and downstream by a first, recombinase recognition site and a second recombinase recognition site recognized by the recombinase. The selection cassette is excised in cells containing sufficient recombinase activity. The targeting vector construct includes a nucleotide sequence of SEQ.ID. NO. 1 or SEQ.ID. NO, 2. The recombinase is selected from the group including Flp, Cre, VCre, Dre, Vlka or P.hiC3.1. The selection cassette includes a gene that encodes neomycin phosphotransferase (neo ¹ ), hygromycin B phosphotransferase (hyg ¹ ), purotnycin-N-acetyltransferase (puro ^r ), blasticidin S deaminase (bsr\ xanthine/guanine phosphoribosyl transferase (gpt), or Herpes simplex virus thymidine kinase (HSV-ik), The selection cassette includes a gene thai, encodes neomycin phosphotransferase ( eo'). In one embodiment, a promoter sequence for the expression of the recombinase transgene is provided. The promoter sequence is expressed in the mouse embryonic stem cell. The promoter sequence may be expressed in germ cells of the chimeric mice. In one embodiment, the promoter sequence may be expressed in the mouse embryonic stem cell and in the germ ceils of the chimeric mice. In one embodiment, the promoter of the recombinase transgene may be selected from the group including UbC promoter, hC V promoter, mCMV promoter, CAGGS promoter, EF1 promoter, Pgkl promoter, beta-actin promoter, Prml, Blimp 1, Gata6, Igfi, Lhx5, or Pax or ROSA26 promoter, in one embodiment, the promoter of the recombinase transgene is human beta-actin promoter.

[0023] According to an embodiment, the system further includes means for producing a knockout mouse having a genome which contains a site-specific recombinase-recognition sequence and a targeting vector, wherein expression of the recombinase transgene directs excision of a selection cassette in the targeting vector. The excision of the selection cassettes occurs in the ES cells during expansion and chimera, stage. A mouse produced by die above system is also provided.

[0024] The subject technology is illustrated, for example, according to various aspects described below. Various examples of aspects of the subject technology are described as numbered clauses (1 , 2, 3, etc.) for convenience. These are provided as examples and do not limit the subject technology. It is noted that any of the dependent clauses may be combined in any combination, and placed into a respective independent clause, e.g., clause 1 , clause 16, etc. The other clauses can be presented in a similar manner.

Clause 1. A targeting vector comprising a selection cassette having a nucleic acid sequence encoding a selection marker gene and a promoter sequence, wherein the selection cassette is flanked by a first recombinase site and a second recombinase site and the first recombinase site and the second recombinase site are oriented to direct an excision of the selection cassette.

Clause 2. The targeting vector of Clause 1, wherein the first recombinase recognition site and the second recombinase recognition site flank the selection cassette. Clause 3. The targeting vector of Clause 1 , wherein a recombinase expressed by a recombinase transgene recognizes the first recombinase recognition site and the second recombinase recognition site.

Clause 4. The targeting vector of Clause 1 , wherein each of the first recombinase recognition site and the second recombinase recognition site is selected .from a group comprising ioxp, lox511 , Iox2272, lox66, [ox 71, !ox 2, lox517L FRT, FRT l 1 , FRT71 , attpattP, attB, FRT, rox, or Dre vox sites.

Clause 5, The targeting vector of Clause 1, wherein the first recombinase recognition site and the second recombinase recognition site is an FRT she.

Clause 6. The targeting vector of Clause 1, wherein the selection marker gene is a gene that confers resistance to a drug.

Clause 7. The targeting vector of Clause 1 , wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (neo ^! ), hygromycin B phosphotransferase (hyg ), puromycin- -acetyl transferase (puro'), blasticidin S deaminase (bsr), xanthine/guanine phosphoribosyl transferase (gpt), or Herpes simplex virus thymidine kinase (HSV-tk).

Clause 8. ^' The targeting vector of Clause 1, wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (neo ^r ).

Clause 9. The targeting vector of Clause 1, wherein the promoter sequence is selected from the group comprising UbC promoter, hCMV promoter, mCMV promoter, CAGGS promoter, EF1 promoter, Pgkl promoter, beta-actin promoter, and ROSA26 promoter. Clause 10. The targeting vector of Clause 1 , wherein the promoter sequence is a UbC pGK promoter.

Clause 1 1. The targeting vector construct of Clause 1 comprising a nucleotide sequence of SEQ ΪΪ). NO. i or SEQ ID. NO. 2.

Clause 12. The targeting vector construct of Clause 1 having at least 75% sequence identity to the SEQ. ID. NO. 1 or SEQ ID. NO. 2.

Clause 13. The targeting vector construct of Clause 1 having at least 75% sequence similarity to the SEQ. ID. NO. 1 or SEQ ID. NO. 2.

Clause 14. The targeting vector construct of Clause 1 having at least 90% sequence identity to the SEQ. ID, NO. 1 or SEQ ID. NO. 2.

Clause 1 5. The targeting vector construct of Clause I having at least. 95% sequence identity to the SEQ. ID. NO. 1 or SEQ ID. NO. 2.

Clause 16. A mouse embryonic stern cell, comprising a DNA construct that encodes a. recombinase transgene and a targeting vector, wherein the targeting vector comprises a selection cassette fl.an.ked upstream and downstream by a first recombinase recognition site and a second recombinase recognition site recognized by a recombinase expressed by the recombinase iransgene, wherein the recombinase transgene and the targeting vector are integrated into the mouse genome, and the first recombinase recognition site and the second recombinase recognition site are oriented to direct an excision by the expression of recombinase transgene in a. chimeric mice.

1.3 Clause 1 7. The mouse embryonic stem cell of Clause 16, wherein the recombinase transgene is selected from the group comprising Fip, Cre, VCre, Dre, Vika or PhiC31.

Clause 18. The mouse embryonic stem cell of Clause 16, wherein the recombinase transgene is Fip.

Clause 19. The mouse embryonic stem cells according to Clause 16 comprising a nucleotide sequence that encode Fip.

Clause 20. The mouse embryonic stem cells according to Clause 16 comprising a nucleotide sequence that possess at least 75% sequence identity to a nucleotide sequence selected from a group comprising Cre, VCre, Dre, Vika, or PhiC31 ,

Clause 21. The mouse embryonic stem cell of Clause 16, further comprising a promoter sequence for the expression of the recombinase transgene.

Clause 22. The mouse embryonic stern cell of Clause 16, wherein the promoter sequence is expressed in the mouse embryonic stem cell.

Clause 23. The mouse embryonic stem cell of Clause 16, wherein the promoter sequence is expressed in germ cells of the chimeric mice.

Clause 24. The mouse embryonic stem cell of Clause 1.6, wherein the promoter sequence is expressed in the mouse embryonic stem cell and in the germ cells of the chimeric mice.

Clause 25. The mouse embryonic stem cell of Clause 16, wherein the promoter of the recombinase transgene is selected from the group comprising UbC promoter, hCMV promoter, mCMV promoter, CAGGS promoter, EFl promoter, Pgkl promoter, beta-actin promoter, PrmI, B!impl, Gata6, lgf2, Lhx5, or Pax or ROSA26 promoter. Clause 26. The mouse embryonic stem cell of Clause 16, wherein the promoter of the recombinase iransgene is human beta-actin promoter.

Clause 27, The mouse embryonic stem cell of Clause 16. wherein the mouse embryonic stem cell is derived from C57BIJ6.

Clause 28. The mouse embryonic stern ceil of Clause 16, wherein the mouse embryonic stem ceil is derived from 129.

Clause 29. The mouse embryonic stem ceil of Clause 1.6, wherein the mouse embryonic stem cell is a mixture of C57BL/6 and 129.

Clause 30. The mouse embryonic stem cell of Clause 1 , wherein the selection cassette comprises a gene that confers resistance to a drug.

Clause 31. The mouse embryonic stem cell of Clause 16, wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (neo ^r ), hygromycin B

phosphotransferase (hyg ^s ) _s purom ein-N~acet I tran sferase (puny), blasticidin S deaminase (bsf ), xanthine/guanine phosphoribosyl transferase (gpt), or Herpes simplex virus thymidine kinase

(HSV~tk).

Clause 32, The mouse embryonic stem cel l of Clause 16, wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (neo').

Clause 33. A transgenic mouse comprising a recombinase transgene and a targeting vector construct, wherein the targeting vector construct comprises a selection cassette gene, wherein the recombinase transgene and the targeting vector are integrated in a genome of the transgenic mouse and the expression of the recombinase transgene directs excision of the selection cassette gene.

Clause 34. The transgenic mouse of Clause 33, wherein the selection cassette gene is flanked upstream and downstream by a first recombinase recognition site and a second recombinase recognition site recognized by a recombinase expressed by the recombinase transgene.

Clause 35. The transgenic mouse of Clause 33, wherein the selection cassette is excised in cells containing sufficient recombinase activity.

Clause 36. The transgenic mouse of Clause 33, wherein the target, vector construct comprises a nucleotide sequence of SEQ.1D. NO. .1 or SEQ.ID. NO, 2.

Clause 37. The transgenic mouse of Clause 33, wherein the recombinase transgene is selected from the group comprising Flp, Cre, VCre, Dre, Vika or PhiCB I .

Clause 38. The transgenic mouse of Clause 33, wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (neo'), hygromycin B phosphotransferase (hyg ¹ ), puromycin-N-acet ltransferase (puro ^r ) ₅ blasticidin S deaminase (bsr , xanthine/guanine phosphoribosyl transferase (gpt. or Herpes simplex virus thymidine kinase (HSV-ik).

Clause 39. The transgenic mouse of Clause 33, wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (net/),

Clause 40. The transgenic mouse of Clause 33, further comprising a promoter sequence for the expression of the recombinase transgene. Clause 41. The transgenic mouse of Clause 33, wherein the promoter sequence is expressed in the mouse embryonic ste n cell

Clause 42. The transgenic mouse of Clause 33. wherein the promoter sequence is expressed in germ cells of the chimeric mice.

Clause 43. The transgenic mouse of Clause 33, wherein the promoter sequence is expressed in the mouse embryonic stem cell and in the germ cells of the chimeric mice.

Clause 44. The transgenic mouse of Clause 33, wherei the promoter of the recombinase transgene is selected from the group comprising UbC promoter, hCMV promoter, mCMV promoter, CAGGS promoter, EFl promoter, Pgkl promoter, beta-actin promoter, Prml, Blimp 1, Gata6, lgf2, Lhx5, or Pax or ROSA26 promoter.

Clause 45. The transgenic mouse of Clause 33, wherein the promoter of the recombinase transgene is human beta-actin promoter.

Clause 46. A method for generating a mouse embryonic stem cell line with a site- specific recombinase sequence integrated into the mouse genomic sequence comprising: providing a mouse embryonic stem cell with a DNA construct that encodes a

recombinase transgene ;

providing the mouse embryonic stem cell wit a targeting vector comprising a selection cassette;

expressing the recombinase transgene at a level of recombinase activity sufficient to produce site-specific excision of the selection cassette in a chimeric mouse.

Clause 47. The method according to Clause 46, wherein site-specific recombination occurs in germ cells.

1 Clause 48. The method according to Clause 46, further comprising mating the chimeric mouse with a wild type mouse strain to produce an offspring which does not contain the selection cassette.

Clause 49. The method according to Clause 46. wherein the targeting vector comprises a selection cassette flanked upstream and downstream by a first recombinase recognition site and a second recognition site recognized by the recombinase transgene, wherein the first recombinase recognition site and the second recognition site are oriented to direct an excision of the selection cassette.

Clause 50. The method according to Clause 46, wherein the selection cassette is a drug selectable marker.

Clause 51. The method according to Clause 49, wherein recombination between the first recognition site and the second recognition site causes insertion of the selection cassette sequence into the vector.

Clause 52. The method according to Clause 49, wherein recognition of the first recognition site and the second recognition site causes deletion of the selection cassette sequence from the targeting vector.

Clause 53. The method of Clause 46, wherein the recombinase transgene is selected from the group comprising Flp, Cre, VCre, Dre, Vika, or PhiC31 .

Clause 54. The method of Clause 46. DNA construct comprises a nucleotide sequence having at least 80% sequence identity to a nucleotide sequence of Flp, Cre, VCre, Dre, Vika, or

PMC3 L Clause 55. The method of Clause 46, wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (neo ^f ), hygromycin B phosphotransferase (hyg'), puromycm-N-acetyltransferase (puro ¹ ), blasticidin S deaminase (bs ), xanthine/guanine phosphoribosyl transferase (gpt), or Herpes simplex virus thymidine kinase (HSV-tk),

Clause 56. The method of Clause 46, wherein the selection cassette comprises a gene that, encodes neomycin phosphotransferase (neo ^! ).

Clause 57. A mouse produced by the method of Clause 46.

Clause 58. A method for generating a mouse embryonic stem (ES) cell line with a promoter sequence linked to a site-specific recombinase sequence integrated into the mouse genome comprising: breeding a male mouse and a female mouse in which at least one mouse contains a copy of the transgene sequence for a site-specific recombinase; and

isolating resulting embryos from the breeding and further developing into ES ceils in culture.

Clause 59. The ES cell line of Clause 58, wherein the site-specific recombinase includes FLP, C:re VCre, Dre, Vika, or P C3 I ,

Clause 60. The ES cell line of Clause 58, wherein the site-specific recombinase includes protein variations with enzyme activity for FLP, Cre, VCre, Dre, Vika, or PhiC31 ,

Clause 61. The ES cell line of Clause 58, wherein a recognition site for the site-specific recombinase is selected from a group comprising loxP, loxS l 1 , lox2272, lox66. 1οχ71 , loxM2, lox5171, FRT, F3, FRTi l , FRT71 , attP, attB, rox, or vox sites. Clause 62, The ES cell line of Clause 58, wherein the promoter sequence comprises a promoter expressed in ES cells.

Clause 63. The ES cell Line of Clause 58, wherein the promoter sequence can be a promoter not expressed in ES cells, but expressed in germ cells of chimeric mice.

Clause 64, The ES cell line of Clause 58, wherein the promoter sequence can be a promoter expressed in ES cells and germ cells of chimeric mice.

Clause 65, The ES cell line of Clause 58, wherein the promoter sequence can be a promoter expressed in ES cells but not in germ cells.

Clause 66. The ES ceil line of Clause 58, wherein the promoter sequence is selected from the group comprising UbC promoter, hCMV promoter, mCMV promoter, CAGGS promoter, EFI promoter, Pgkl promoter, beta-actin promoter, or ROSA26 promoter, Prml, Blimpl , Gata6, lgf2, Lhx5, or Pax,

Clause 67. The ES cell line of Clause 58, wherein the promoter sequence is a human beta-actin promoter.

Clause 68. The ES cell line of Clause 58, wherein the embryos comprise an inbred strain. Clause 69. The ES cell line of Clause 58, wherein the embryos comprise an outbred strain.

Clause 70. The ES cell line of Clause 58, wherein the embryos comprise a mouse strain derived from C57BL/6.

Clause 71. The ES cell line of Clause 58, wherein the embryos comprise a mouse strain derived from 129.

Clause 72. The ES cell line of Clause 58, wherein the embryos comprise a mouse strain comprising a mixture of C57BL/6 and 129. [0025] Additional features and advantages of the subject technology will be set forth in the description below, and in part will be apparent from the description, or may be learned by practice of the subject technology. The advantages of the subject technology will be realized and attained by the information provided in the written description and embodiments hereof as well as the Figures accompanying this application.

[0026] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are intended to provide further explanation of the subject technology.

BRIEF DESCRIPTION OF THE FIGURES

[0027] Various embodiments of the present disclosure are described herein below with reference to the Figures:

[0028] FIG. 1 illustrates conventional methods for generating knockout mice with the deletion of the selection cassette by introducing a targeting vector into an ES cell line derived from a wild-type strain.

[0029] FIG. 2 illustrates methods for generating knockout mice with the deletion of the selection cassette by introducing a targeting vector into an embryonic stem cell line derived from a site-specific recombinase strain, according to the present disclosure.

[0030] FIG. 3 illustrates a targeting vector according to an embodiment of the present disclosure that includes site-specific recombinase recognition sites Hanking both sides of a selection cassette. [0031] FIG. 4 illustrates the selection cassette of the targeting vector and targeted allele after excision by the site-specific recombinase.

[0032] FIG. 5 illustrates a Southern Blot strategy to detect Neo deletion after expansion of recombinant ES cell clones.

[0033] FIG. 6 illustrates a PGR strategy to identify ES cell clones with correct integration and with Neo-intact and Neo-deieted.

[0034] FIG. 7 A illustrates results of PGR analysis of recombinant clones before and after ES cell expansion.

[0035] FIG. 7B illustrates results of PGR analysis of recombinant clones wit presence of FLP iransgene,

[0036] FIG. 8 illustrates results of Southern Blot analysis of recombinant ES cell clones.

[0037] FIGs. 9 A and 9B illustrate a PGR strategy for detecting Neo deletion and the results of genotyping Fl progeny after mating chimeric mice to wild-type mice.

[0038] FIG. 10A illustrates a schematic diagram, of the targeting strategy using FLP hybrid ES cell line. FIG. 10B illustrates a Southern Blot strategy to detect Neo deletion after expansion of recombinant ES clones. FIG. 10C illustrates results of Southern Blot analysis of recombinant ES cell elones.

[0Θ39] FIG. 1 1 illustrates the nucleotide sequence represented in the sequence listings. FIG. 1 1 A shows backbone vector sequence. FIG. 1 I B shows targeting vector sequence. FIG. 1 1C shows Neo cassette flanked by FRT (underlined) and LoxP (italicized) sites. FIG. 1 ID shows sequence of Neo selection marker gene. FIG. 1 IE shows sequence after deletion of Neo gene

(FRT site underlined; LoxP site italicized).

79 SEl ^EDJ CRJPTiON

[0040] The present disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary, The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be Limiting, since die scope of the present disclosure will be limited only by the claims. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this disclosure belongs, Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, particular methods and materials are now described. All publications mentioned herein are incorporated herein by reference in their entirety for all purposes.

[0041] Methods and compositions are provided for genetically modifying non-human ceils or animals using a selection cassette in a. site-specific recombinase dependent manner.

[0042] The present disclosure relates to generating an embryonic stem (ES) ceil line derived from one of the site-specific recombinase mouse strains. An overview of the conventional process is set forth in FIG. 1.

[0043] Briefly, as noted above, traditional methods used for cell culture and preparation for DNA insertion are well-known in the art. for example, as set forth in any of the following references: Joyner, A L, Gene Targeting: A Practical Approach, 2 ^nd Edition. Oxford University Press. Oxford, UK (2000), Hogan, B. et ah. Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1 997). The entire disclosures of each of the above references are incorporated by reference herein. [0044] The use of FLP recombinase in mice, to produce site-specific recombination of DNA at chromosomal regions containing FLP recognition sites (such as DNA sequences containing FRT sites) has also been, described. See, e.g., U.S. Patent Nos. 7,736,897, 7,223,601 and 6,774,279; U.S. Patent Application Publication Nos. 2004/0205838 and 2008/0300202, and Dymecki, "Flp Recombinase Promotes Site-Specific DNA Recombination in Embryonic Stem Cells and Transgenic Mice;' Proc. Nail. Acad. Set. USA, Vol. 93, pp. 6191 -6196 (1996), the entire disclosures of each of which are incorporated by reference herein.

[0045] in accordance with the present disclosure, ES cell lines are provided that are derived from a FLP recombinase mouse. An overview of the general process of the present disclosure is set forth in FIG. 2. Rather than starting with a wild-type mouse, as conventionally utilized, the methods of the present, disclosure start with a FLP recombinase mouse, such as those commercially available from, for example, The Jackson Laboratory, Bar Harbor, Maine. ES cells may be obtained therefrom, and a targeting vector including a selection cassette introduced therein. As described herein, according to an aspect of the present disclosure, embryonic stem (ES) cells, i.e., an ES ceil line derived from FLP mouse strain is employed, in accordance with an aspect of the present disclosure, FLP .ES cells include a FLP transgene. According to an aspect of the present disclosure, the FLP transgene is expressed in ES cells and chimeric mice, thereby excising or deleting the selection cassette in the targeting vector of the recombinant clones. U pon generating the mice, the progeny is confirmed for the absence of the selection cassette,

[00461 The advantages of the methods of the present disclosure include excision of a selection cassette in germ cells and deletion of the selection cassette without extra manipulations of ES cells and additional mating, which results in shorter time to obtain selection cassette-free mice, eliminating 3-6 months applicable for the traditional method. Also, since wild-type mice are used for breeding with chimeras, purchase or maintenance of FLP recombinase mice is eliminated, which reduce the number of mice for breeding, housing cost and space. In addition, other advantages include reduced genotyping cost for tail DNA extraction and PGR analysis, [ess labor in maintaining colony and genotyping. minimal human errors while breeding and genotyping. and avoiding mixed genetic background with other strains and sub-strains through mating to deietor strain. These advantages enable researchers to begin their studies faster with confidence and cost efficiency.

j ^' 0047] ES cells are generally selected due to their abi lity to integrate into and become part of the germ line of a developing embryo so as to create germ line transmission of the knockout construct. ES cell line can be generated from transgenic or knockout/in mice which express, without limiting. FLP, Cre, VCre, Die, Vika, PhiC31 and other recombinases. ES cell lines can also be generated by introducing such recombinase in the ES cells without deriving ES cells from transgenic mice. Any such ES ceil line is also suitable for use herein. Thus, any ES cell line generated from transgenic or knockout/in mice which express, without limiting, FLP, Cre, VCre, Dre, Vika, PhiC31 , and other recombinases, may be used.

[Θ048] In one embodiment, the ES cell line expresses the recombinase transgene with recombinase activity. In one embodiment, ES cells are derived from a mouse strain, which includes the FLP transgene. In one embodiment, the recombinase transgene expressed in the ES cells have a nucleotide sequence that is about 60%, about 70%, about 80%, about 90%), about. 95%, about 96%, about 97%, about 98%, about 99%, sequence identity to FLP transgene. in one embodiment, the recombinase transgene expressed in the ES cells have an amino acid sequence thai is about 60%, about 70%, about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, sequence identity to Cre, VCre, Dre, Vika. PhiC31 , and/or other recombinases. (0049) To generate ES cells containing the site-specific reco.mbina.se, blastocysts were harvested from recombinase transgenic mice with a promoter sequence, in one embodiment, blastocysts were harvested from C57BL/6. homozygous or heterozygous FLP transgenic mice with human beta-actin promoter, mating to C57BL/6N or 129/SvEv males. Mice were commercially available at, for example, Taconic Farms. In one embodiment, the promoter of the recombinase may be a promoter that is expressed in ES ceils. In another embodiment, the promoter of the recombinase may be a promoter that is not expressed in ES cells but expressed in germ cells of chimeric mice, in another embodiment, the promoter of the recombinase may be a promoter that is expressed in ES cells and in germ cells of chimeric mice. In another

embodiment, the promoter of the recombinase may be a promoter that is expressed in ES ceils but not expressed in germ cells of chimeric mice.

[0Θ50] ES ceils, thus derived from site-specific recombinase mouse strain are often grown on an appropriate fibroblast ^■ · feeder layer in the presence of appropriate growth factors, such as leukemia inhibiting factor (LIF), When ES cells have been expanded, a confluent ES cell line was obtained and they were used to produce genetically modified animals. All ES cell lines were confirmed by PGR for the recombinase gene using appropriately designed PGR primers and the cell lines were karotyped using standard protocol. (See, Hogan, B, et al. Manipulating the Mouse Embryo: A Laboratory -Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1997), disclosure of which is incorporated herein by reference for all purposes).

[0051] The sex of ES cell lines was determined by Y-chromosome PGR reactions of genomic DNA from ES cell colonies isolated from feeder cell. (See, M.W. Bradbury, L.M. Isola, J,W. Gordon. Enzymatic amplification of a Y chromosome repeat in a single blastomere allows identification of the sex of preimplantation mouse embryos. Proc. Mail, Acad, ScL 87 (1990); 4053-4057, disclosure of which is incorporated herein by reference for all purposes).

[0052] A targeting construct is introduced into the ES cells. The targeting construct includes nucleic acid sequences of selectable marker, a selection cassette, and recognition sites that are recognized by a site-specific recombinase. A selection marker is included as pan of a selection cassette, to permit identification of colonies possessing the desired construct. For example, PGK-Neo is a gene including the phosphogiycerate kinase I promoter driving the neomycin phosphotransferase gene, resulting in neomycin resistance. This is a widely used cassette employed as a selectable marker for homologous recombination in ES cells. Other selectable markers and selection cassettes known to the skilled person in the art may also be used.

|00531 The selection cassette is flanked on both sides by recombinase recognition sites that are recognized by the respective site-specific recombinase, for example, without limiting, FLP, Cre, VCre, Dre, Vika, PhiC31. In one embodiment, the recognition site is FRT site. Any site specific recombinase known to the skilled person in the art may be used. FRT ^' sites flank both sides of the selection cassette. The selection cassette flanked on each side by the recombinase recognition sites is excised by the action of the recombinase. In one embodiment, the Neo cassette is flanked by FRT sites. In one embodiment, the long homology arm extends 5' to the Neo cassette and the short homology arm extends 3' to the Neo cassette. In embodiments, the FLP transgene, when expressed, recognizes FRT sites present on the targeting vector and excises the sequence between the FRT recognition sites, FIG. 3 illustrates a targeting vector that includes site-specific recombinase recognition sites .flanking both sides of the selection cassette. In FIG. 3, the recognition sites flanking the selection cassette are FRT and loxP sites. [0054] According to an embodiment, the targeting vector is introduced by electroporation, chemical transformation, or any other means to the said ES cells, in which the site- specific recombmase is already built-in. According to an embodiment, the targeting vector further includes a sequence encoding a developmental gene, essential gene, cytokine gene,

neurotransmitter gene, neurotransmitter receptor gene, oncogene, tumor suppressor gene, selectable marker, or histochemical marker.

[0055] According to an aspect, a method of genetic engineering of mouse embryonic stem cells is provided. The method includes mouse embryonic stem cells with a pre-built in recombmase transgene. Upon introducing the targeting vector including a selection cassette, the recombmase transgene is expressed at a level of recombmase activity sufficient to allow clone growth during drug selection. According to an embodiment, the excision of the selection cassette occurs in ES cells. According to an embodiment, the ES cells are further expanded into larger quantity to fulfill other tasks, such as PGR or Southern analyses and microinjection of blastocysts. During the ES cell expansion, the ES cells with a pre-built in recombmase gene will further express the recombmase and excise the selection cassette. The method further includes, in embodiments, mating the chimeric mouse with a wild type mouse strain to produce an offspring which does not contain the selection cassette.

[Θ056] In one embodiment, the targeting vector includes a selection cassette, wherein the selection cassette is present between a first recombmase recognition site and a second

recognition site, both sites flanking the selection cassette and the reeombinase recognizes the first, recognition site and the second recognition site. According to an embodiment the targeting vector has a nucleotide sequence of SEQ.1D. NO. 1 or SEQ. ID. NO. 2. [0057] SEQ. ID. NO 3 illustrates an alignment of nucleic acid sequences, which include FRT and ioxP recognition sites flanking Neomycin cassette on both sides of the selection cassette. FRT recognition sites are shown using underlining,

[0058] In one embodiment, the first and second recognition sites are similar, in another embodiment, the first recognition site and the second recognition site are identical.

[0059] In one embodiment the first and second recognition sites are loxp, lox51 i. lox2272, lox66, iox 7L ioxM2, lox5171 , FRT, F3, FRT! L FRT71 , aitP, attB, rox, or vox sites. In one embodiment, the first recognition site and the second recognition site are oriented such that sequences present between the recognition site are deleted and the selection cassette is excised by the recombinase, following recognition of the sites by the reeombinase.

[0060] In one embodiment, the selection cassette includes a gene that confers resistance to a drug. In embodiments, the selection cassette includes a coding sequence of neomycin phosphotransferase. In one embodiment the selection cassette includes a selectable marker such as: neomycin phosphotransferase (neo ¹ ), hygromycin B phosphotransferase (hyg ^r ), puromycin-N- acetyitransferase (puro ^'! ), b!asticidin S deaminase (bsr ⁽ ), xanthine/guanine phosphoribosyi transferase (gpt), and Herpes simplex virus thymidine kinase (HSV -tk). In one embodiment, the promoter sequence is a promoter such as a UbC promoter, an hCMV promoter, an mCMV promoter, a CAGGS promoter, an EFl. promoter, a Pgkl promoter, a beta-acdn promoter, and a ROSA26 promoter. In a preferred embodiment, the selectio cassette includes a neo' gene driven by a pGK promoter.

[0061] The expression of the site-specific recombinase will cause the ES cells to lose the selection cassette under drug selection process. However, since slowing the cell growth and eventually killing the cells by antibiotic will take a matter of days, many ES cells without the selection cassette can survive the drug selection after the selection cassette has been deleted. For example, the entire drug selection process takes about 15 days. In some embodiments, the drug selection process takes about 10 days, about 7 days or about 5 days. Typically; after 7 days, the antibiotic will be removed. In one embodiment, it may take 4 days to kill the wild-type ES cells or the ES cells without the selection cassette. The selection cassette is deleted on or after about 7 days, in embodiments after about 4 days, by the recombinase transgene. These ES cells will survive the antibiotic selection and, typically, will generate sufficient number of colonies and amount of ES cells to use for the next step of the experiment.

[0062] in one embodiment, an enzyme such as aminoglycoside 3'-phosphotransferase, which confers from the Neo selection gene, may still survive after the selection cassette has been deleted by the recombinase transgene. The ES clones having such enzyme are able to grow and survive through drug selection.

[0063] The targeting vector is shown in FIG. 1 I B. Long homology arm (6189 bp) are shown in bold and italic text (e.g., A TCG). Distal LoxP (68 bp) is shown in light gray text, and highlighted in yellow. Target region ( 1347 bp) is shown in green text. Neo cassette ( 1708 bp) is shown in red text. Short homology arm (1500 bp is in underlined text (e.g.. ATCG). LoxP is in red text, and highlighted in yellow. FRT is shown in red and underlined text, and highlighted in gray. Exons are highlighted in pink and probe 3/4 is highlighted in sandy brown.

[0064 In one embodiment, the site specific recognition sequence includes a sequence that is identical to the sequence underlined in FIG. 1 1C.

[0065] In one embodiment, the site specific recognition sequence is about 70%, about 85%, about 90%, 92%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the sequence underlined in FIG, ! IC, {0066} SEQ. ID. NO. 4 shows a nucleotide alignment of Neo selection marker gene, in one embodiment, in one embodiment, the selection cassette is about 70%, about 85%, about 90%, 92%, 95%, 96%, 97%, 98%, 99%, 99,5%, or 99,9% identical to the sequence il lustrated in SEQ.ID. NO. 4.

[0067] in one embodiment, in one embodiment, the selection cassette is about 70%, about 85%, about 90%, 92%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% similar to the sequence illustrated in SEQ.ID. NO. 4.

[0068] In one embodiment, the site specific recognition sequence is about 70%, about 85%, about 90%, 92%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% similar to the sequence underlined in FIG, 1 I C.

[0069] FIG. 4 illustrates the targeting vector nucleic acid sequence alter deletion of

Neomycin selection cassette. Remaining sequence of the Neomycin cassette is shown in FIG 1 IE. I.o p is shown in italics and the remaining FRT site after deletion is shown using underlining in FIG. 1 IE.

[0070] According to the present disclosure, the selection cassette is incorporated in the targeting vector. The selection cassette and the targeting vector are confirmed by restriction analysis after each modification step and by sequencing using primers designed to read the selection cassette into the 3' targeting region and the 5' end of the short homology arm, the site specific recognition sequence, and sub-clone. Each knockout construct DNA to be introduced into the ES cell must first be linearized. Linearization is accomplished by digesting the nucleic acid sequence with a suitable restriction endonuclease selected to cut only within the vector sequence and not within the knockout construct sequence. Insertion of the knockout construct into ES cells is accomplished using a variety of well-known methods including, for example, eiectroporation, transfection, and calcium phosphate treatment. in embodiments, the method of insertion is eiectroporation. See, Robertson, E J, In: Teratocarcinomas and Embryonic Stem

Cells: A Practical Approach, E J Robertson, ed. IRL Press, Washington, D.C. (1987); Bradley εί al.. Current Topics in Devel. Biol. 20:357-371 ( 1986); Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

( 1 997): and Talis, J F et al, Meih. Mol. Biol. 129: 153-187 (1999). The entire disclosures of each of the above references are incorporated by reference herein.

[0071] In order for the cells to be e!ectroporated, the ES cells, and knockout construct DMA, are exposed to an electrical pulse using an eiectroporation machine following the manufacturer's guidelines for use. After eiectroporation, the cells are allowed to recover under suitable incubation conditions. The cells are then screened for the presence of the knockout construct. After screening, the cells with targeting construct are identified and expanded for further analysis and injection.

SHU^ i C H) ! bCO\1B : AV| ( l .O LS

[0072] Cells including die construct, may be detected by employing a selective medium, for example, medium with neomycin antibiotic (or G41 8). After sufficient time for colonies to grow, colonies are picked and analyzed for the occurrence of homologous

recombiiiation/integration of the knockout construct. Those colonies that, are positive may then be used for embryo manipulation and blastocyst injection.

[0073] Tabic I shows a comparison of clones picked for screening after G418 drug selection for wild-type versus FLP ES cell lines. The results indicated that the eiectroporation of targeting vectors into FLP ES cell lines still generate sufficient number of ES colonies for further steps. Some of the projects identified in Table 1 have less than half of the surviving colonies than from the wild-type ES cells, but in most cases, positive targeted ES cells can be identified among them,

TABLE 1

Hybrid (C57 x 129) ES cell ine

Project

Name WT FLP

P#1293 200 200

R#1594 32 24

R#1604 200 148

[0074] Screening for the presence of the knockout construct can be done using a variety of methods. Where the selection marker gene is an antibiotic resistance gene, such as neomycin (Neo), the cells are cultured in the presence of an otherwise lethal concentration of the antibiotic. Those cells that survive have presumably integrated the knockout construct correctly or randomly. To properly identify and confirm those cells with proper integration of the knockout construct, the DNA can be extracted from the cells using standard methods such as those described in Sambrook, J. et ai.. Molecular Cloning: A Laboratory Manual, 3d Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 2001. Brent, . et al, Current Protocols in Molecular Biology, John Wiley & Sons. Inc., 2003; Ausubel, F. . et al., Short Protocols in Molecular Biology, 5 ^th edition, Current Protocols, 2002), The entire disclosures of each of the above references are incorporated by reference herein.

[0075] The DNA may then be probed on a Southern blot with a probe or probes designed to hybridize in a specific pattern to genomic DNA from, for example, the ES ceils digested with (a) particular restriction enzyme(s). Alternatively, or additionally, the genomic DNA can be amplified by PGR with primers specifically designed to amplify DNA fragments of a particular size and sequence, where only those cells containing die knockout construct in the proper orientation and location will generate DNA fragments of the proper size. Even with the deletion of the selection cassette mediated by FLP or Ore reeornbinase, the remaining sequence will be different than the endogenous wild-type sequence, which can be used for Southern blot strategy and other analyses.

[0076] For example. Southern blot analysis may be performed on ES cell clones. A Southern blot strategy to detect Neo deletion is shown in FIG. 5. In Figure 5, size of WT is 5.8kb, whereas the size of the targeted clone with Neo cassette is 4.1 kb and the size of the targeted clone with Neo deletion is 6 kb.

[0077] According to an embodiment of the present disclosure, a targeting vector including a selection cassette flanked by recognition sites was introduced therein. In one embodiment, the targeting vector includes a. Neo selection cassette .flanked by FRT sites. Alter the targeting vector is introduced into the FLP ES cell line, the recombinant clones carried the selection cassette and the FLP reeornbinase. During the ES cell cuituring stage, FLP reeornbinase expression must be present in sufficient amount so as to delete or excise the selection cassette, which is flanked by the recombinase recognition sites. In one embodiment, the FLP recombinase expression is present in sufficient quantity to excise the Neo selection cassette at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 8 days, after electroporation during the cell cuituring stage, in one embodiment, the FLP recombinase is present in sufficient quantity to excise the neo cassette at least after 10 days of incubation-electroporation in the cell cuituring stage. In a specific embodiment, an increase in expression of FLP recombinase is at least 60%, at least 70%, at least 80%, at least 90%, at least 90%, at least 99%, or at least 100%. Excision of the Neo cassette during expansion in the recombinant clones is shown in FIG. 7A for PGR analysis and FIG. 8 for Southern blot. The FLP transgene is present in the recombinant ES clones as shown in FIG. 7B.

[0078] Recombinant ES cell clones confirmed for Neo deletion and correct integration using PGR. and Southern blot analyses were then injected into blastocysts from mice. In some embodiments, the ES cell clone is injected into blastocysts of Balb/c mice. .Injection of the recombinant clones generated mice (chimeras) that carried the FLP recombinase and the Neo- deleted ES cells. The chimeras were then bred with wild-type mice and the resulting progeny harbored gerrnline transmission for the knockout construct with Neo deletion in germ cells.

[0079] According to an embodiment, the system further includes means for producing a knockout mouse having a genome which contains a site-specific recombinase-recognition sequence and a targeting vector, wherein expression of the recombinase transgene directs excision of a selection cassette in the targeting vector. The excision of the selection cassette occurs in the ES cells during expansion and chimera stage, A mouse produced by the above system is also provided. [0080] The following Examples are provided to illustrate, but not limit, the features of the present disclosure so that those skilled in the art may be better able to practice the features of the disclosure described herein.

EXAMPLES

E mM^ l Gener^tU of ES .cgjHja^ w^

[0081] Nine C57BL/6 FLP ES cell lines and eight hybrid (C57BL/6 x 129/SvEv) FLP ES cell lines were established. E3.5 blastocysts were harvested from female mice of C57BL/6, homozygous or heterozygous FLP transgenic mice with the human beta-actin promoter, mating with. C57BL/6N or 129/SvEv males from ^" l aconic Farms. The embryos were washed in ES cell medium twice and plated on 96- well plates coated with mouse primary embryonic fibroblasts (MEF) feeder ceils in ES cell culture condition containing 15% fetal bovine serum (Hyclone) and 1000 U/ml leukemia inhibitory factor (LIT). After several days, the inner cell mass-derived clumps of cells were disaggregated by 0.05% Trypsin -EDTA (GIBCO) and transferred to another plate with fresh feeder layers. This process will be repeated several times until the ES colonies become confluent. Every confluent ES cell line was transferred into a well with a new feeder layer. This is considered as the first passage. Every putative ES eel! line will be stocked at passage 6.

[0082] All ES ceil lines were confirmed by PCR for the FLP transgene using FLP primers

(FLP1 ; 5'- CACTGATATTGTAAGTAGTTTGC -3 ' (SEQ.ID. NO 9); FLP2: 5 ^s - CTAGTGCGAAGTAGTGATCAGG ~3', (SEQ.ID. NO 10) and karyotyped according to standard protocols (Fiogan et ai., 1997). The sex of various ES cell lines with modal

chromosome counts of 40 was detennined by Y-chromosome-specific PCR reactions (Bradbury et al., 1990) of genomic DNA from ES cell colonies isolated free of feeder cells. Only male and FLP positive ES ceil lines were expanded and prepared for further testing for germline transmission.

Exampie-2 CoRS true tu n of Targeting Vector

[0083] An approximate 9.03 kb regio used to construct the targeting vector was first sub- cloned from a positively identified C57BL/6 BAG clone (RPCI23: 149F13) using a homologous recombination-based technique. The region was designed such that the long homology arm (LA) extended 6.19kb 5' to the single loxP site. The short homology arm (SA) extended 1.50kb 3' to the Neo cassette. The Neo cassette was flanked by loxP/FRT sites. The loxP sites flanking the Neo cassette were to be used for the Cre/loxP recombination to conditionally excise the target region when mating the resulting mice to transgenic C e mice. The single loxP site was inserted 305bp upstream of exon 6, and the loxP/F T-tlanked Neo cassette was inserted 202bp downstream, of exon 6. The target region was 1 ,35kb, including exon 6. FIG. 3 illustrates the Neo cassette flanked by loxP/FRT sites.

[0084] The targeting vector was confirmed by restriction analysis after each modification step, and by sequencing using primers designed to read from the selection cassette into the 3' end of the target region and the 5' end of the SA, the single loxP site, and the 5' and 3' ends of the BAC sub clone.

[0085] The BAC was sub cloned into an approximate 2.4kb backbone vector (pSP72, Promega) containing an ampicihin selection cassette for retransformation of the construct prior to electroporation. The total size of the targeting construct (including vector backbone and Neo cassette) was 13.23 kb. [0086] The targeting vector was linearized by Not Ϊ and electroporated into FLP C57BL/6 embryonic stem (ES) cells via high voltage electrical pulse. The FLP ES cells were plated and grown on irradiated mouse embryonic fibroblasts (MEF) with Neo resistance. After 24 hours from the ekctroporation, G41 8 antibiotic selection was treated on the cells for 7 days. The ES cell medium was changed out every 2 days. A total of 32 surviving cells carrying the Neo resistance were picked and each colony was placed in a well from a 96- well plate. Replica plates were made to generate a set of cells for freezing and a set for DNA extraction for PCR. analysis of recombinant ES clones.

[0087] A PCR primer RcvNeo3B (SEQ.ID. NO. 8) is located on the Neo cassette and another primer Al (SEQ.ID, NO.9) located outside of the short homology arm was designed to identify recombinant clones that have undergone correct integration and Neo deletion. Expected size for the PCR product with Neo intact is 3,4kb and the Neo deletion is 1 ,9kb. FIG. 6 shows Neo intact (Targeted) and Neo deleted. FIG. 7 shows the results of PCR. DNA samples from individual clones before and after expansion. An "x" after the number denotes expanded clones. Wild Type DNA was used as a negative control and denoted by a WT. Clones that have undergone expansion had the Neo selection cassette deleted and thus the PCR product size is 1.6 kb smaller.

[0088] PCR was also performed on the ES clones to confirm the presence of the FLP recombinase. FLP primers (SEQ.ID.NO. i0 and SEQ.ID.NO.i l ) was used to amplify the FLP transgene with a PCR product of 725bp. Example- Southern Blo Analysis and xpansion of Clones, | ^' I)0S9] A total of 6 positive targeted ES cell clones were then expanded for more ceils for Southern blot analysis and for injection. The cells were thawed out from the frozen replica 96- well plate referenced in Example 2. Medium was changed daily and the ceils were passaged and transferred to a larger plate of 24- well plate and then to 6-weif plate. Cells were trypsinized and frozen down for injection and aliquot of cells were grown further for DNA extraction for Southern blot analysis,

[0090] Southern blot analysis was performed on expanded ES cell clones, DNA was digested with EcoRV to confirm the integration of the 3' homology arm and the deletion of the Neo cassette. The digested DNA was eiectrophoretically separated on a 0.8% agarose gel. After transfer to a nylon membrane, the digested DNA was hybridized with probe PB3/4 targeting against the 3' region. The Souther strategy to detect the Neo deletion is indicated on the schematic diagram included in Figure 6. The expected sizes were as follows: WT ^:::: 5.8kb; targeted clone with Neo cassette ^:::: 4, 1 kb; targeted clone with Neo deletion ^::: 6kb.

[0091] Figure 8 shows the results of Southern Blot Analysis. Probe PB3/4 was used for hybridization and the DNA samples were digested by restriction enzyme EcoRV. Expected sizes were as follows: WT - 5.8kb; Targeted (Neo intact) = 4. Ikb: Targeted (Neo deleted) - 6,0kb. The DNA ladder indicated sizes in kilobases (kb). DNA trorn FLP C57BL/6 ES cell was used as wild type control. The results indicated that ail the clones had Neo deletion due to the absence of the 4. Ikb band during the process of G418 Neo selection and ES cell expansion. [0092] Recombinant ES cell clone confirmed by Southern blot were injected into 3.5 d.p.c. (days post coitum) blastocysts from Baib/c mice. The injected embryos were then implanted into a pseudo-pregnant female mouse via uterine transfer method. The table 2 below shows the injection results for clones. Chimerism was determined by the percentage of the black coat color distributed on the mouse body. Keys for % of chimerism: H ^:::: 80-99%; M ^::: 50-79%. The high % of chimerism indicated the piuripotency of ES cells and chance of achieving germ!ine transmission.

TABLE 2

[0093] The chimeras were set up for mating to wild-type C57BL/6 mice to generate gemiline transmitted mice. Pups with black coat, color indicated germ!ine transmission and were tail tipped for genotyping.

[0094] PGR analysis was performed on tail DNA. Primer set NDEL1 (SEQ.ID. O, 6); and NDEL2 (SEQ.ID. NO. 7) designed flanking the Neo cassette was used to screen for the deletion of the Neo cassette in the F1 offspring. The location of the primers is shown in Figure 9A. Tail samples were analyzed by primer set NDEL1 and NDEL2. The PCR product for the wild-type is 279bp. After Neo deletion, one set of LoxP-FRT sites remained (178bp). A second band with a size of 456bp indicated Neo deletion. The presence of the Neo cassette was not amplified by this PCR screening due to the given conditions. FIGs. 9A and 9B show the PGR genotyping and results of PCR genotyping.

[0O9S] The PCR results indicated that the recombinant clones with the Neo cassette deletion from FLP ES cell line achieved germline transmission in the Fi offspring. The FLP ES cell line that were created were able to delete the Neo cassette during ES cell culturing and expansion and thus improved the mating scheme md shortened the timeline by an average of 4-6 months in obtaining germline eo-deleted mice.

Example 7: Testing iaJFLP _^ ^ Lma

[0096] An approximate 10,61 kb region used to construct the targeting vector was first sub cloned from a positively identified C57BL/6 BAG clone (RPCI23: 362P13) using a homologous recombination- based technique. The region was designed such that the short homology arm (SA) extends about 1.69kb 5' to the Neo cassette. The Neo cassette is flanked by F T-loxP sites. The long homology arm (LA) ends 3' to single loxP site and is 6,21kb long. The IoxP/FRT flanked Neo cassette is inserted 913bp upstream of exon 3. The single loxP site is inserted 178bp downstream of exon 6, The target region is 2.7kb including exons 3-6. FIG. 10A illustrates a schematic diagram of the targeting strategy of this Example 7.

[Θ097] The targeting vector was confirmed by restriction analysis after each modification step, and by sequencing using primers designed to read from the selection cassette into the 3 ⁵ end of the SA and 3' end of the target region, the single loxP site, and the 5 ^" and 3' ends of the BAC sub clone, The BAC was sub cloned into an approximate 2.4kb backbone vector (pSP72, Promega) containing an ampieillin selection cassette for retransiormaiion of the construct prior to electroporation. The total size of the targeting construct (including vector backbone and Neo cassette) is 16.36kb.

[0098] The targeting vector was linearized by Not Ϊ and electroporated into FLP Hybrid (129/SvEv x C57BL/6) embryonic stem (ES) cells via high voltage electrical pulse. The FLP ES cells were plated and grown on irradiated mouse embryonic fibroblasts (MEF) with Neo resistance. After 24 hours of electroporation, G418 antibiotic selection was treated on the cells for 7 days. The ES ceil medium was changed out every 2 days. A total of 200 surviving cells carrying the Neo resistance were picked and each colony was placed in a well from a 96- well plate. Replica plates were made to generate a set of cells for freezing and a set for DNA extraction for PGR analysis of recombinant ES clones.

[0099] The positive targeted ES cell clones were then expanded for more cells for Southern blot analysis and for injection. The cells were thawed out from the frozen replica 96-weli plate. Medium was changed daily and the cells were passaged and transferred to a larger plate of 24- weil plate and then to 6-well plate. Cells were trypsinized and frozen down for injection and aiiquots of cells were grown further for DNA extraction for Southern blot analysis. Figure 10B shows the Southern blot strategy to detect the Neo deletio after expansion of recombinant ES clones. Figure IOC shows the results of Southern blot analysis. Probe PB3/4 was used for hybridization and the DNA samples were digested by restriction enzyme Sspl, Expected sizes were as follows: WT = 10.7kb; Targeted (Neo intact) = 6.3kb; Targeted (Neo deleted) = 4.7kb. The DNA ladder indicated sizes in kilobases. DNA from FLP Hybrid (129 x C57) ES cell was used as wild type control. The results indicated that all the clones had Neo deletion due to the absence of the 6,3kb band during the process of G418 Neo selection and ES cell expansion. [00100] While the above description contains many specifies, these specifics should not be construed as limitations on the scope of the present disclosure, bat merely as exemplifications of preferred embodiments thereof Those skilled in the art will envision many other possible variations that are within the scope and spirit of the present disclosure.