Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
L-ARABINOSE ISOMERASE EXHIBITING MINIMUM DEPENDENCE ON METAL IONS FOR ITS ACTIVITY AND FOR THERMOSTABILITY, ISOLATED AND CHARACTERIZED NUCLEOTIDE SEQUENCE THEREOF
Document Type and Number:
WIPO Patent Application WO/2006/071203
Kind Code:
A2
Abstract:
The invention concerns identification of a gene encoding a novel L-arabinose isomerase of the Bacillus stearothernivphilus strain US100 (L-AI US 100), a L-arabinose isomerase expressed from said gene, recombinant vectors hosting said gene, microorganisms transformed with said gene, a protocol for preparing and purifying said recombinant protein, biochemical and kinetic characterization of said recombinant enzyme and a method for bioconversion of a D-galactose solution into a solution rich in D-tagatose using said polypeptide. This novel protein has original characteristics, in particular its independence from metal ions for its activity and its low need for such ions for its thermostability, as well as its potential for isomerizing D-galactose into D-tagatose with great efficacy of the order of 48 % after 7 hours at 70 °C.

Inventors:
Rhimi, Moez (Cité Hajaj Ibn Youssef-Djilma, 9110 Sidi Bouzid, TN)
Chouayekh, Hichem (Chez Adel Chouayekh, Sakiet-Ezzit, 3021 Sfax, TN)
Ben Ali, Mamdouh (Cité Jardin Appartement N°8, Immeuble F 12, 3025 Sfax, TN)
Naili, Belgacem (Bouattouch N° 15, El Hamma, Gabès, TN)
Jemli, Sonia (Cité Bahri 3, Rue N°2235 Maison N°46, 3064 Sfax, TN)
Bejar, Samir (Route de Sokra Km 4, Lotissement Faiza, 3058 Sfax, TN)
Application Number:
PCT/TN2005/000005
Publication Date:
July 06, 2006
Filing Date:
June 28, 2005
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
CENTRE DE BIOTECHNOLOGIE DE SFAX - CBS (BP K, 3038 Sfax, TN)
International Classes:
C12N15/61; C12N9/90; C12P19/24
Attorney, Agent or Firm:
Hachaichi, Sarah (Rue du Lac Victoria, 2045 Les Berges du Lac, Tunis, TN)
Download PDF:
Claims:
Revendications
1. Un polynucléolidc codant pour un polypcptide ayant une activité Larabinosc isomerase de la souche Bacillus slearothermophilus (souche US 100) et ayant la séquence en aa annotée dans Ia figure 3. Un polypeptide codé par le polynucléotide selon la revendication I , isolée à partir de la souche Bacillus slearothermophilus (souche USlOO), ayant la séquence nucléotidique annotée dans la figure 2 et possédant une activité Larabinose isomerase capable de bioconvertir le D galactose en Dtagatose.
2. Une Larabinose isomerase selon la revendication 2 ayant une indépendance en ions métallique pour son activité et une exigence minime en ces ions pour sa thermostabilité.
3. Des vecteurs d'expression hébergeant le polynucléotide de la revendication 1.
4. Des souches recombinantes susceptibles de produire le polypeptide selon la revendication 2.
5. Un protocole de production de la Larabinose isomerase. Cette méthode comporte la culture de la souche hébergeant le vecteur d'expression de la LAI US100 selon les revendications 4 et 5, dans un milieu de culture ainsi que la purification du polypeptide.
6. Une méthode de production du Dtagatose consistant à convertir une solution de galactose, ou riche en galactose, en une solution riche en Dtagatose moyennant la LAI US lOO produite suivant la revendication 6.
7. Une méthode conformément à la revendication 7, où la réaction de bioconversion est menée à un pH compris entre 6.5 et 8.5 et une température entre 60 et 900C préférentiellement à 75 0C.
8. Une Larabinose isomerase, LAI US100, incluant l'utilisation du polypeptide de la revendication 2 sous toutes formes possibles, y compris les cellules entières ou le polypeptide sous leurs formes libres ou immobilisées.
Description:
TITRE :

Une L-arabinose isomérase ayant une dépendance minime en ions métalliques pour son activité et pour sa thermoslabilité, codée par une séquence nucléotidique nouvellement isolée et caractérisée.

DESCRIPTION DETAILLEE

Contexte de l'invention

Ce brevet concerne la production et l'exploitation des enzymes d'intérêts industriels dans les domaines agro-alimentaires ou autres. Plus particulièrement, l'invention concerne une L- arabinose isomérase ayant des propriétés physico-chimiques intéressantes pouvant être exploitée à l'échelle industrielle.

L'invention a pour objet le criblage, le clonage et le séquençage du gène codant une nouvelle L-AI, ainsi que l'analyse de la séquence en aa de l'enzyme correspondante. Elle concerne également Ia caractérisation et l'utilisation d'une L-arabinose isomérase ayant des caractéristiques originales.

Les L-arabinose isomérases sont également connues sous le nom de D-galactose isomérases puisque, Ui vitro, elles sont capables de bio-convertir le D-galactose en D-tagatose. C'est en fait cette caractéristique qui présente un intérêt industriel puisqu'elle est exploitée pour la production du D-tagatose.

Le D-tagatose est un ceto-hexose naturel, stéréo-isomère du D-fructose. Il possède un pouvoir sucrant similaire à celui du sucrose et un pouvoir calorifique nul. Ce cétose est utilisé en tant qu'édulcorant, ou en association avec d'autres composés ayant des pouvoirs sucrant intenses dans les produits agro-alimentaires. Grâce à son pouvoir anti-hyperglycémiant. le D- tagatose est d'un apport important essentiellement pour les sujets diabétiques. Dans le domaine pharmaceutique ce sucre est employé pour la conservation des organes en plus de son pouvoir «anti-biofilm».

Néanmoins, la production de ce sucre à l'échelle industrielle demeure contingentée par le coût élevé de sa production. Afin de surmonter cette limite, un nouveau processus a été mis au point. Ce dernier se base sur l'usage de la L-arabinose isomérase, qui est capable de transformer le D-galactose en D-tagatose. Dans ce cadre, plusieurs brevets tels que : USPA N 0 : 20030022844; USP N° : 6, 057, 135; USPA N 0 : 20040058419 et USPA N 0 : 20030175909 ont prouvé la faisabilité de ce procédé. Au cours de ce processus de bio-

conversion, il y a formation d'un mélange équilibré de D-galactose el de D-tagalose. Pour déplacer cet équilibre en faveur du D-tagatose, il faudrait opérer à haute température. Par ailleurs, les L-arabinosc isomerases sont des métallo-protéines qui exigent des concentrations assez élevées d'ions métalliques pour leurs fonctionnements optimaux. Or, ces ions ne sonl pas autorisés dans les produits finaux et doivent être éliminés ce qui nécessite une étape supplémentaire de séparation augmentant ainsi le coût de production final. Il s'en suit d'après ce qui précède qu'il est intéressant de cribler de nouvelles L-arabinose isomerases thermoactives, thermostables et ayant une faible exigence en ions métalliques.

La L-arabinose isomérase de la souche USlOO que nous décrivons dans ce document, a l'originalité d'avoir à la fois une température optimale élevée (80 0 C), une efficacité catalytique importante, une indépendance vis-à-vis des ions métallique pour sa thermoactivité et une très faible exigence en ces ions pour sa thermostabilité .

Résumé de l'invention

Sous sa forme spécifique, cette invention est caractérisée par les étapes suivantes :

a) Le criblage de l'activité L-arabinose isomérase de Bacillus stearothermophilus (souche US lOO). b) Le clonage du gène codant pour cette activité dans une souche modèle d'£ coll. c) La détermination de la séquence nucléotidique de ce gène ainsi que la déduction et l'analyse de la séquence en aa de l'enzyme correspondante. d) La sur-expression et purification de la protéine recombinante. e) La caractérisation biochimique et cinétique de l'enzyme recombinante. f) L'utilisation de cette enzyme purifiée pour la bioconversion d'une solution de D-galactose en une solution riche en D-tagatose.

Brève description des figures

Les caractéristiques de la présente invention vont ressortir à partir des descriptions suivantes fournies en conjonction avec les figures et les tableaux ci-joints et qui sont données à titre indicatif et non limitatif.

- La figure 1 montre les cartes de restriction des vecteurs d'expression pMRl (A) et pMR6 (B) contenant le gène arci US l OO de la L-AI US100, objet de cette invention. Amp : gène codant pour la résistance à l'ampicillinc, T7 : promoteur T7, SP6 : promoteur SP6.

- La figure 2 montre la séquence nucléotidique du gène aruA de la souche liacillus Slearothermophilυs US 100 codant la L-arabinose isomérase de l'invention. Les codants ATG (initiation de la traduction) et TAA (stop) sont représentés en gras.

- La figure 3 montre la séquence en acides aminés de la L-AI US 100 s objet de cette invention codée par le gène araA US 100.

- La figure 4 montre les effets de la température (A) et du pH (B) sur l'activité de la L- arabinose isomérase purifiée de l'invention en utilisant le L-arabinose comme substrat en présence de 0.2 raM Co 2+ et 1 mM Mn 2+ . L'activité définie à 100 % est celle mesurée dans les conditions optimales de fonctionnement de l'enzyme et elle correspond à une activité spécifique de 185 U/mg.

- Le tableau 1 montre l'effet des ions métalliques sur l'activité L-AI US100. (A) L'activité définie à 100 % est celle mesurée dans les conditions optimales de fonctionnement de l'enzyme et elle correspond à une activité spécifique de 185 U/mg. (B) les ions Co 2+ et Mn sont ajoutés à raison de 0.1 mM.

- La figure 5 illustre l'effet de la concentration des ions métalliques Mn 2+ et Co 2+ sur la thermostabilité de la L-AI USlOO. (A) effet du Co 2+ : 0 mM (Φ), 0.1 mM (©), 0.2 mM(π), 0.4 mM (Δ) et (B) effet du Mn 2+ : 0 mM (*), 0.8 mM (•), 1 mM (a), 1.2 mM (À).. L'activité définie à 100 % est celle mesurée dans les conditions optimales de fonctionnement de l'enzyme et elle correspond à une activité spécifique de 185 U/mg.

- Le tableau 2 montre les caractéristiques catalytiques de la L-arabinose isomérase de l'invention purifiée en comparaison avec d'autres L-arabinose isomérases bactériennes cataloguées, nd : non déterminé.

- La figure 6 montre les représentations de Lineweaver et Burck de la L-arabinose isomérase de l'invention purifiée en utilisant le L-arabinose et le D-galactose comme substrats.

- La figure 7 montre les rendements de conversion du D-galactose en D-tagatose obtenus avec la L-arabinose isomérase purifiée de l'invention et en présence de 0.2 mM Co 2+ et 1 mM Mn 2+ à différentes températures : 65 °C (Δ), 7O 0 C (a) et 75 0 C (•).

Description détaillée de l'invention

L'étape (a) a consiste au criblage de plusieurs souches thcπnophilcs pour leurs capacités de pousser sur milieu minimum de sélection contenant le L-arabinose en tant que source unique de carbone. Les études préliminaires des activités L-AI de ces différentes souches nous ont incité à retenir la souche de Bacillus stearolhermophihis (souche US lOO) qui a été déjà identifiée dans un travail antérieur, comme souche productrice d'alpha-amylase originale (Brevet d'invention N 0 17236 INNORPI TUNISIE 5 2001 ; Mamdouh Ben Ali, Monia Mezghani and Samir Bejar. Enz. Microb. Technol. 24: 584-589, 1999).

L'étape (b) a consisté à amplifier le gène codant pour cette activité moyennant l'ADN génomique de la souche US lOO en tant que matrice. Le fragment d'intérêt a été clone dans un vecteur approprié, le produit de la ligation a servi pour transformer des cellules compétentes d'£ coll. La sélection des clones recombinants a été faite sur milieu MacConkey -L-arabinose additionné d'Ampicilline. Les tests d'activité réalisés sur les souches recombinantes ont montré que ces dernières possèdent une activité L-arabinose isomérase prouvant le clonage et l'expression du gène ara A US 100.

L'étape (c) a consisté à déterminer la séquence nucléotidique du gène ara A US100 via les techniques de séquençage couramment utilisées. Cette séquence, est constituée de 1491 pb codant pour un polypeptide composé de 496 aa présentant une homologie significative avec les autres séquences des L-AIs déjà cataloguées dans les banques de données.

L'étape (d) a consisté à sur-exprimer et purifier la L-AI US100. La souche recombinante a été utilisée pour la purification de l'enzyme. Le processus de purification mis au point consiste en un traitement à la chaleur des extraits bruts, une précipitation fractionnée au sulfate d'ammonium suivie d'une chromatographie échangeuse d'ions (technique FPLC). La pureté de la protéine a été vérifiée par migration sur gel dénaturant montrant une bande unique homogène de taille 56 kDa. Sur gel natif la protéine migre sous forme d'une seule bande de 225 kDa.

L'étape (e) a consisté à étudier les caractéristiques biochimiques de l'enzyme recombinante notamment ses profils de pH, de température et de thermostabilité ainsi que ses besoins en

ions métalliques. Cette étude a révélé entre autre une caractéristique très originale de l'enzyme, à savoir son indépendance vis-à-vis des ions métalliques, y compris le Mn 2+ et le Co 21 , pour son activité et sa faible exigence en ces ions pour sa thermostabilité. En effet cette enzyme requiert uniquement 0.2 mM de Co 2 ^ et 1 mM de Mn 24 pour une stabilité maximale ce qui se contraste avec la plus part des L-AI déjà décrites. L'étude cinétique menée sur la L-Al US lOO nous a permis de déterminer ses paramètres cinétiques à savoir : K 1n , V max , K caι et K n /K Ca i et ce pour les deux substrats ; le L-arabinose et le D-galactose.

L'étape (f) a consisté à étudier la bioconversion d'une solution aqueuse de D-galactose en une solution riche en D-tagatose en utilisant la L-Al USlOO purifiée. Cette étude a été menée à différentes températures.

EXEMPLES

Les personnifications de la présente invention seront illustrées dans les exemples suivants, qui ne doivent pas être pris comme limite des capacités de l'invention

Exemple 1 : Identification d'une séquence nucléotidique codant la L- arabinose isomérase dε Baciîhis stearothennophilus (souche USlOO) et son expression hétérologue chez E. coli.

Dans cet exemple, sont données à titre indicatif et non limitatif l'identification d'une séquence nucléotidique de la L-arabinose isomérase de Bacillus stearothennophilus (souche USlOO) et son expression hétérologue chez E. coli.

La souche thermophile Bacillus stearothennophilus (souche US l OO) a été cultivée sur milieu approprié pendant une nuit à 55°C. Cette culture a servi pour la préparation de l' ADN génomique. En se référant à la séquence de l'opéron arabinose de Bacillus stearothennophilus T6 (numéro d'accession : AAD45718') déjà existante dans la banque de données Genbank, nous avons conçu deux oligonucléotides, à savoir ; Ol 5 GTGAACGGGGAGGAGCAATG 11 et 02 5' GAAATCTTACCGCCCCCGCC 3' de façon à amplifier la totalité du gène ara.A USlOO codant pour la L-arabinose isomérase de Bacillus stearothennophilus (souche USlOO). Moyennant ces oligonucléotides, et en utilisant l'ADN génomique de la souche US100 en tant que matrice, nous avons amplifié un fragment d'ADN ayant une taille de 1.5 kb environ. Ce

fragment d'intérêt a été purifié et clone dans un vecteur de clonage en l'occurrence le pGEMT-Easy Vcctor (Promega). Le produit de la ligation a servi pour transformer des cellules compétentes de la souche HBl Ol d'E coli. La sélection des clones recombinants a été réalisée sur milieu Mac-conkey-L-arabinose additionné d'Ampicillinc. Plusieurs colonies rouges ont été obtenues, celles ci devraient contenir le gène araA USl OO fonctionnel complémentant la mutation ara-] de HBl Ol , preuve de l'utilisation du L-arabinose. L'une de ces colonies hébergeant le plasmide baptisé pMRl et portant le gène araA US100 sous le contrôle du promoteur T 7 a été retenue pour la suite du travail (figure IA).

L'activité L-AI a été testée sur des extraits protéiques préparés à partir des cultures liquides des souches HBlOl/pMRl et HBlOl/pGEMT-easy Vector. Cette dernière est déterminée en présence de 50 μl d'extrait enzymatique, 100 mM MOPS (pH 7.5) et 5 mM de L-arabinose ou D-galactose pendant 1 et 10 min à 80°C respectivement. Le L-ribulose ou D- tagatose formé est détecté par la méthode à la cystéine carbazole (Dische, Z., and. Borenfreund, E., J. Biol. Chem., 192:583-587, 1951). Cette étude montre bien la présence d'une activité L-Al dans l'extrait issu de la souche HBlOl/pMRl contrairement à la souche HBlOl/pGEMT-easy Vector qui est dépourvue de cette activité. Ce faisant confirme le clonage et l'expression de la L-AI US 100 chez E. coli.

Exemple 2 : Séquençage du gène araA US100 et analyse de Ia séquence en aa correspondante

Dans cet exemple, sont donnés à titre indicatif et non limitatif le séquençage du gène araA US lOO et l'analyse de la séquence en aa correspondante.

Moyennant le plasmide pMRl nous avons déterminé la séquence nucléotidique du gène araA US 100 grâce aux techniques de séquençage couramment utilisées. L'étude de cette séquence révèle la présence d'une unique phase de lecture ouverte (Open Reading Frame : ORF) de 1491 pb débutant par un ATG initiateur et se teπninant par un codon stop TAA (Figure 2). La séquence en aa déduite à partir de la séquence nucléotidique montre que la L- AI US 100 est constituée de 496 aa (Figure 3). L'analyse de cette dernière a montré qu'elle présente une forte identité avec celles d'autres L-AIs allant jusqu'à 98 % (Tableau 1). En effet, la L-AI US100 présente uniquement 8 et 11 aa différents avec les L-AIs de Thermus sp (numéro d'accession : AAO72082) et de B. stearothermophilus T6 (numéro d'accession : AAD45718) respectivement. Néanmoins, ces dernières présentent des propriétés physico-

chimiques assez différentes tant du point de vue température optimale et thermostat)] * ] ité que " du point de vue exigence en ions métalliques.

Exemple 3 : Sur-production et purification de la L-Al USlOO

Dans cet exemple, sont données à titre indicatif et non limitatif, la sur-expression et la purification de la L-Al US100.

Afin d'augmenter la production de la L-AI USl OO, le gène ara A US100 a été clone sous le contrôle d'un promoteur fort à savoir le Vtac porté par le vecteur pTrc99a générant le plasmide pMR6 (Figure IB). La comparaison des activités des souches de E. coîi abritant les plasmides pMRl ou pMR6 a montré que la meilleure activité a été obtenue avec la construction Ϋtac-araA US100 avec une activité spécifique de l'ordre de 51 U/mg contre 38.6 U/mg pour la construction VT7-araA US100. '

Dans le but de purifier la L-AI US100, la souche HB101/pMR6 a été cultivée durant une nuit à 37 0 C dans le milieu LB additionné d'ampicilline. Le culot cellulaire a été récupéré par centrifugation et l'extrait enzymatique brut a été préparé suite aux opérations de traitement au lysozyme et de sonication. Les extraits bruts ont été traités à 7O 0 C durant 30 min en présence de 0.2 raM de Co 2+ et 1 mM de Mn 2+ puis centrifugés à 25000 rpm pendant 30 min afin d'enlever la majorité des protéines thermolabiles de la souche hôte. Après précipitation fractionnée au sulfate d'ammonium, le culot contenant l'activité L-AI a été resuspendu dans le tampon MOPS 100 mM puis dessalé. Enfin, la purification de l'enzyme a été achevée par la technique de cliromatographie échangeuse d'ions (FPLC) moyennant une colonne UNOQ-12. La fraction contenant l'activité L-AI a été concentrée puis conservée à - 20 0 C en présence de glycérol à 15%. Cette préparation est d'une homogénéité importante puisqu'elle a montré une seule bande de 56 kDa sur gel dénaturant SDS-PAGE (sodium dodecyl sulfate polyacrylamid gel electrophoresis) ; alors que dans les conditions natives, la L-AI US100 paraît sous forme d'une bande unique ayant une taille de l'ordre de 225 kDa ce qui prouve qu'il s'agit d'une holoenzyme constituée de 4 monomères identiques.

Exemple 4 : Etudes biochimique et cinétique de Ia L-arabinose isomérase de la souche USlOO

Dans cet exemple sont données à titre indicatif cl non limitatif, les caractéristiques biochimiques et cinétiques de l'enzyme dans les conditions opératoires utilisées.

A- Effet de la température et du pH sur l'activité L-AI USlOO

L'enzyme recombinante a été purifiée selon l'exemple 2 ; la détermination et la mesure de l'activité sont faite selon l'exemple 1. La suivie de l'activité en fonction de la température est montrée sur la figure 4A. Cette étude a prouvé que la L-AI US100 possède une large gamme d'activité de 60 à 90°C avec un optimum de l'ordre de 80°C. De même, l'étude de l'activité à différents pH a révélé que le pH de fonctionnement se situe entre 7 et 8.5 avec un optimum à 7.5 (Figure 4B)

B- Effet des ions métalliques sur l'activité

L'élude de l'effet des ions métalliques sur l'activité de la L-AI US lOO a été menée sur r enzyme purifiée selon l'exemple 3 sans ajout d'ions métalliques lors la culture et de la purification. En plus, l'extrait enzymatique pure a été dialyse contre le tampon MOPS (100 m M) contenant de l'EDTA à raison de 10 mM et ce pendant 48 heures. La détermination de l ' effet de divers ions métalliques a été testée suite à l'addition de ces derniers à raison de 0.1 mM dans le milieu réactionnel. Le résultat figurant dans le tableau 1 prouve qu'a 65°C ces ions ne possèdent aucun effet sur l'activité de l'enzyme, alors qu'a 8O 0 C seules les ions Mn 2" et Co 2+ augmente apparemment l'activité de la L-AI US100 jusqu'à atteindre 140% (tableau 1). Ce faisant suggère le rôle stabilisateur du Mn 2+ et Co 2+ .

C- Thermostabilité en absence et en présence des ions Mn 2+ et Co 2+

L'étude de l'effet de la concentration des ions Mn 2+ et Co 2+ sur la thermostabilité de la L-AI US lOO a prouvé que les concentrations optimales sont de l'ordre de 1 mM et 0.2 mM respectivement (figure 5).

La stabilité thermique de la L-AI US l OO a été étudiée après incubation de l'enzyme pendant 30, 60, 90 et 120 min à 65, 70, 75 et 8O 0 C et ce en présence et en absence d'ions métalliques. En absence totale d'ions, la L-Al US100 conserve totalement son activité à 65 °C, alors qu'elle possède un temps de demi-vie de 10, 60 et 120 min à 80, 75 et 7O 0 C respectivement. Hn présence de 1 mM Mn 2H et 0.2 mM Co 2 ^, la L-Al US 100 retient plus que 90 % de son activité initiale à 7O 0 C après 120 min d'incubation. De plus, le temps de demi- vie atteint 20 et 1 15 min à 80 et 75°C respectivement. L'étude de l'effet de chacun ces ions sur la stabilité donne des résultats pratiquement similaires.

Ainsi il parait clairement, d'après l'étude de l'activité et de la thermostabilté, que la L-Al US100 possède, uniquement, une dépendance minime pour les ions métalliques pour sa thermostabilité. En effet, la L-AI US100 n'a besoin que de 1 mM Mn 2+ et 0.2 mM Co 2+ pour son fonctionnement optimal (tableau 2). Alors que les autres L-AIs déjà rapportées exigent des concentrations 5 fois plus élevée en ces ions (1 mM de Co 2+ et de 5 mM de Mn 2+ ) (Kim et al, Biotechnol Lett. 2003 Jun;25(12) : 963-7; Lee et al, Appl Environ Microbiol. 2004 Mar ; 70(3) : 1397-404 et Kim et al, FEMS Microbiol Lett. 2002 J un 18 ; 212 (1) : 121-6),

D- Détermination des paramètres cinétiques :

Pour déterminer les paramètres cinétiques de la L-AI US100 pour le L-arabinose et le D- galactose, les représentations de Lineweaver-Burck ont été réalisées (Figure 6). D'après ces représentations, nous déduisons que la L-AI US 100 possède une K 1n évaluée à 28.57 mM pour le L-arabinose et 52.63 mM pour le D-galactose. De plus, les valeurs de Vmox sont de 40 U/mg et 8.7 U/mg pour le L-arabinose et le D-galactose respectivement. Il s'en suit que l'efficacité catalytique (K ca /K ιn ) de cette enzyme pour le L-arabinose est de 71.4 rmVr'.min " 1 et 8.46 mM^.min "1 pour le D-galactose.

Exemple 4 : Taux de conversion du D-galactose en D-tagatose à différentes températures.

Dans cet exemple, est donnée à titre indicatif et non limitatif l'étude du taux de conversion du D-galactose en D-tagatose en utilisant la L-AI US100.

Moyennant la L-Al USl OO, objet de la présente invention, le taux de conversion du D- galactosc en D-tagatosc a été déterminé à différentes températures et à des intervalles de temps réguliers. Lc mélange réactionnel est composé de 5 mM de D-galactose, 100 mM MOPS (pl i 7.5) et de l'enzyme pure à raison de 3 m g/ml. Le D-tagatosc apparu est dosé par la méthode à la Cysteine-carbazole (tel qu'il a été rapporté dans l'exemple 1). En présence de 1 mM Mn 2+ et 0.2 mM Co 2"1 le rendement maximal de bioconversion du D-galactose en D- tagatose atteint 48 % après 7h d'incubation à 70°C (figure 7). Ainsi, l'efficacité catalytique de l'enzyme et son indépendance vis-à-vis des ions métalliques pour son activité, rend la L- AlUSlOO très probante pour une application industrielle en vue de la production du D- tagatose.

Références citées :

1- Kim JW, Kim YW, Roh MJ, Kim HY, Cha JH, Park KH, Park CS. Production of lagatosc by a recombinant Ihcrmoslablc L-arabinosc isomerase from Thermu.s sp.IM6501.Biolechnol Lett. 2003 Jun; 25(12): 963-7.

2- Lee DW, Jang HJ, Choe EA, Kim BC, Lee SJ, Kim SB, Hong YH, Pyun YR. Characterization of a thermostable L-arabinose (D-galactose) isomerase from the hyperthermophilic eubacterium Thermotoga marilima. Appl Environ Microbiol. 2004 Mar; 70(3): 1397-404.

3- Kim BC, Lee YH, Lee HS, Lee DW, Choe EA 1 Pyun YR. Cloning, expression and characterization of L-arabinose isomerase from Thermotoga neapolitana : bioconversion of D-galactose to D-tagatose using the enzyme. FEMS Microbiol Lett. 2002 Jun 18; 212(1): 121-6.

4- Dische, Z., and Borenfreund, E. A New Spectrophotometric Method for the Détection and Détermination of Keto Sugars and Trioses. J. Biol. Chem., 192:583-587, 1951 .

5- Mamdouh Ben Ali, Monia Mezghani, and Samir Bejar. A thermostable α-amylasε producing maltohexaose from a new isolated bacillus sp. US100: study of activity and molecular cloning of the corresponding gène. Enz. Microb. Technol. 24: 584-589, 1999.

6- Mamdouh Ben Ali, Monia Mezghani, lotfi Mallouli, Sonda Mhiri, Radhouane Ellouze et Samir Bejar. Une nouvelle activité amylase thermostable et productrice de maltohexaose : caractérisation de l'activité, de la protéine et du gène correspondant. Brevet d'invention N 0 : 17236, INNORPI TUNISIE, 2001.




 
Previous Patent: CARD EJECTION MECHANISM

Next Patent: SEAMLESS FABRIC DYE ROLL