L. salivarius SGL03: probiotic activities and production of antimicrobial proteins

DESCRIPTION FIELD OF THE INVENTION

The present invention relates to the use of a strain of L. salivarius SGL03 as an antimicrobial agent.

The invention further concerns a composition comprising L. salivarius SGL03 and one or more antimicrobial proteins, and the use of such a composition for the preparation of a nutraceutical or dermo-cosmetic product.

STATE OF THE ART Probiotics are living microorganisms that can bring beneficial properties to the body, if they are included in adequate quantities in the diet. For an organism to be considered "probiotic", there must be scientific studies that ensure on one hand its safe use in humans and, on the other, the presence of properties such as resistance to the aggression of gastric, pancreatic and bile juices, and the ability to adhere firmly to the intestinal mucosa by colonizing it.

Lactic Acid Bacteria (LAB), for the most part represented by lactobacilli and bifidobacteria, are the most common types of probiotic microorganisms. Such microorganisms may carry out their effect at the level of the host organism, directly or indirectly, by modulating the endogenous ecosystem or the immune response. Some probiotics, on the other hand, may act by directly strengthen the intestinal barrier, preventing permeability, and the subsequent loss of macromolecules, which are observed in intestinal infections and food intolerances, or by exerting a trophic action on the colon mucosa, or by protecting the mucus coating the intestinal wall. Further species indirectly intervene on the intestinal barrier, by stimulating the intestinal immune system, or Gut Associated Lymphoid Tissue (GALT), which constitutes an immune defense barrier for the body. Specifically, probiotics are adjuvants of the endogenous bacterial flora, ensuring the development of IgA producing cells and intestinal epithelial lymphocytes, as well as modulating the production of IgE and interleukins. Basic research also showed that probiotics can act by inhibiting the synthesis of some inflammatory mediators.

The strong antagonistic action that some strains play against pathogenic microorganisms, making them potentially effective in preventing and treating certain pathologies, is widely documented.

The antimicrobial effect is mainly linked to the pH lowering due to the production of lactic acid, while other inhibitory mechanisms comprise hydrogen peroxide production, nutrient competition, and the production of inhibitory metabolites, factors which alone or combined result in a block of pathogens growth.

In the last decades, an important object of study has been the antimicrobial action mediated by the production of "bacteriocins", biologically active peptides, synthesized at ribosomal level, capable of developing linkages to specific anchor sites located on the cell membranes.

The bacteriocin family comprises a wide range of proteins that differ in terms of size, chemical structure, target cells, mode of action, and induced immune mechanisms. It is believed that they are produced by 99% of the bacterial species present in nature.

Bacteriocins produced by Gram-negative bacteria are generally high molecular weight proteins that exhibit a characteristic domain, specific for the adhesion, translocation, or killing activity of the bacteriocin. Bacteriocins produced by Gram- positive bacteria are generally small and thermostable cationic peptides, initially synthesized as pre-peptides and which, following splitting phenomena, are transformed into biologically active molecules.

Their inhibitory spectra may be limited to certain strains belonging to the same species of the producing organism (narrow spectrum), or they can have a broad spectrum of action against various bacteria species (broad spectrum) (Gillor et al., 2005). As for the mechanism of action of these proteins, some of them act forming pores in the cytoplasmic membrane, others interfere with protein synthesis, or have nuclease activity. These substances with strong antimicrobial activity have gained a growing interest for their potential use both in the clinical field, as therapeutics, and in technological/food field as natural preservatives in foods.

Bacteriocins are, in fact, resistant to strong thermal stresses and are active in a wide range of pH. An important peculiarity is then represented by bacteria difficulties in developing resistance to them; a phenomenon linked to their rapid mechanism of action. In addition, being generally sensitive to proteases, they are easily degraded; this means they do not last long in the environment, and therefore the development of resistances by bacteria is less favorable. Finally, bacteriocins are highly specific against clinical pathogens, including multidrug-resistant strains (MDRs, Cotter PD et al., 2013).

Bacteriocins may be used as supplements, or added to probiotics for the treatment of dysbiosis and the restoration of homeostasis in various districts of the body. The probiotic effects of a microbial species are species-characteristic, but they may also vary within the same species.

Many in vitro experiments have shown that closely related strains may have significantly different adhesion, aggregation, competitive exclusion, and inhibitory activity properties against pathogens. Phenotypic and genotypic characterization is therefore a key requirement for obtaining a probiotic-based product that may adequately be used for health purposes.

The object of the present invention is therefore to provide a specific bacterial strain for the production of antimicrobial proteins with inhibitory activity against harmful microorganisms.

SUMMARY OF THE INVENTION

The aim of the present work is the identification and the characterization of some antimicrobial proteins produced by da L. salivarius SGL03, and their therapeutic uses.

The invention therefore concerns the use of L. salivarius SGL03 strain for the production of antimicrobial proteins.

In a further embodiment, the invention relates to a probiotic composition comprising L. salivarius SGL03, having or being supplemented with one or more antimicrobial proteins selected from the group consisting of 50S Ribosomal Protein L27, DNA- Binding Protein HU, 30S Ribosomal Protein S20, and 50S Ribosomal Protein L30, and optionally magnesium peroxide.

In another aspect, the invention relates to the use of the composition comprising L. salivarius SGL03 and one or more antimicrobial proteins selected from the group consisting of 50S Ribosomal Protein L27, DNA-Binding Protein HU, 30S Ribosomal Protein S20, and 50S Ribosomal Protein L30 for the preparation of a nutraceutical. In yet another aspect, the invention relates to the use of the composition comprising L. salivarius SGL03 and one or more antimicrobial proteins selected from the group consisting of 50S Ribosomal Protein L27, DNA-Binding Protein HU, 30S Ribosomal Protein S20, and 50S Ribosomal Protein L30 for the preparation of a dermo- cosmetic. DESCRIPTION OF THE FIGURES

The invention will now be described in detail, and with reference to the attached Figures wherein:

Figure 1 depicts the photograph of an agarose gel, wherein a species-specific amplification with primer is shown: B1 and B2 (blanks, DNA-free samples to verify the absence of contamination in the PCR mix), C+ and C- (positive control and negative control with respect to amplified DNA), S (amplified sample corresponding to L. salivarius SGL03 by appearance of the 41 1 pb band as a confirmation of the species), M (molecular weight marker);

Figure 2 depicts the graph of the results of resistance evaluation to high saline concentrations;

Figure 3 depicts the graph of the results of resistance evaluation to acidic environment;

Figure 4 depicts the growth curve of S. pyogenes in the presence of various concentrations (1 x10 ⁷ CFU/ml, 1 x10 ⁸ CFU/ml, 1 x10 ⁹ CFU/ml) of L. salivarius SGL03, to determine the minimum inhibitory concentration (MIC);

Figure 5 depicts the growth curve of S. uberis in the presence of L. salivarius SGL03 at the concentration of 1 x10 ⁷ CFU/ml (MIC);

Figure 6a shows the growth curve of S. mutans in the presence of L. salivarius SGL03 at the concentration of 1 x10 ⁷ CFU/ml (MIC);

Figure 6b shows the growth curve of S. mutans, obtained by testing higher concentrations of L. salivarius SGL03 in order to evaluate if the growth inhibition was dose-dependent. The tested concentrations were: 2x10 ⁷ CFU/ml, 3x10 ⁷ CFU/ml, 10x10 ⁷ CFU/ml;

Figure 7 depicts the growth curve of L. salivarius SGL03 during the fermentation in batch ;

Figure 8 depicts the picture of Tricine SDS-PAGE gel of L. salivarius SGL03 secretome;

Figure 9 depicts the picture of Tricine SDS-PAGE gel of rpmA, rpmD, rpsT, and LSL_0885 expressed in E. coli BL21 (DE) and purified;

Figure 10 depicts the picture of a plate showing the inhibition of S. pyogenes growth due to the presence of 15 μΙ of 1 Mg/μΙ rpmA (A), 15 μΙ of 1 g/μΙ rpmD (B), simultaneous presence (synergistic activity) of 15 μΙ of 1 μ9/μΙ rpmA and rpmD (C); Figure 1 1 depicts the inhibitory effects on S. pyogenes ATCC 19615 growth, due to the presence of rpmA (1 1 a, 1 1 b) and rpmD (1 1 c,1 1 d), both tested at the concentration of 133 AU/ml. Specifically, the measurements of the optical density at 600 nm, and the viable cell counts (CFU/ml) are shown: control curve (Δ), growth in the presence of rpmA or rpmD (·).

DETAILED DESCRIPTION OF THE INVENTION

The invention therefore concerns the use of the L. salivarius SGL03 strain as an antimicrobial agent.

In the present invention, when using the definition:

- "bacteriocins" is meant to include a wide range of proteins that differ in terms of size and chemical structure. These biologically active peptides are synthesized at the ribosomal level of various microbial species, and have an antimicrobial action. Surprisingly, said bacteriocins have an inhibitory action against Gram-positive and Gram-negative bacteria.

Specifically, it was found that said bacteriocins have an inhibitory action against bacteria of the Streptococcus pyogenes, Enterococcus faecium, and Streptococcus uberis species.

In a preferred embodiment, said bacteriocins are selected from the group consisting of Peptidoglycan Binding Protein, 50S Ribosomal Protein L1 , 30S Ribosomal Protein S5, 30S Ribosomal Protein S8, 50S Ribosomal Protein L1 1 , 50S Ribosomal Protein L14, 50S Ribosomal Protein L27, DNA-Binding Protein HU, 30S Ribosomal Protein S20, and 50S Ribosomal Protein L30.

In an even more preferred embodiment, said bacteriocins are selected from the group consisting of 50S Ribosomal Protein L27, DNA-Binding Protein HU, 30S Ribosomal Protein S20, and 50S Ribosomal Protein L30.

In another aspect, the invention relates to a probiotic composition comprising L. salivarius SGL03, having or being supplemented with one or more bacteriocins selected from the group consisting of 50S Ribosomal Protein L27, DNA-Binding Protein HU, 30S Ribosomal Protein S20, and 50S Ribosomal Protein L30.

In a preferred embodiment, the probiotic composition comprises:

L. salivarius SGL03; and

one or more bacteriocins selected from the group consisting of 50S Ribosomal Protein L27, DNA-Binding Protein HU, 30S Ribosomal Protein S20, and 50S Ribosomal Protein L30,

wherein said one or more antimicrobial proteins are in an amount in a range from 10 to 20C^g, 50 to 150μg or preferably from 50 to 100μg of purified protein.

In a preferred embodiment, the probiotic composition comprises:

L. salivarius SGL03;

one or more bacteriocins selected from the group consisting of 50S Ribosomal Protein L27, DNA-Binding Protein HU, 30S Ribosomal Protein S20, and 50S Ribosomal Protein L30; and

magnesium peroxide.

The invention may be realized in the form of a food product comprising the composition according to the invention, and other ingredients suitable for food use. Such food products may include the probiotic composition and a food base. The composition or probiotic component may be in liquid or solid form, dried or lyophilized, depending on the needs, and time and temperatures of storage, conservation and transport.

Advantageously, the invention concerns a food product in the form of a dietary supplement, or a food for special medical purposes (FSMPs).

In comparison to other foods, FSMPs have the ability to fully or partially cover for particular nutritional needs imposed by a disease, disorder or pathological condition, as well as consequences of malnutrition.

Dietary or food supplements are defined as specific products aimed at promoting the intake of certain nutritional principles that are not present in the food of an incorrect diet.

Supplements are recommended in cases where the body is lacking certain alimentary principles: they do not have healing properties, but they supplement a normal diet by completing it.

The probiotic effects are closely related to the microbial species, and there may also be differences within the same species.

Many in vitro experiments have shown that closely related strains may have significantly different adhesion, aggregation, competitive exclusion, and inhibitory activity properties against pathogens. Phenotypic and molecular characterization is therefore a key requirement for obtaining a probiotic-based product that may adequately be used for health purposes.

Molecular and phenotypic characterization demonstrated that L. salivarius SGL03 possesses the essential characteristics and beneficial properties of a proper probiotic strain that promotes its use in therapeutic formulations.

The invention can be prepared in the form of a nutraceutical product comprising the composition according to the invention, and other ingredients suitable for such a use.

When used as a nutraceutical, the probiotic composition or component may be in liquid or solid form, dried or lyophilized.

In another aspect, then, the invention relates to the use of the composition comprising L. salivarius SGL03, and one or more antimicrobial proteins selected from the group consisting of 50S Ribosomal Protein L27, DNA-Binding Protein HU, 30S Ribosomal Protein S20 and 50S Ribosomal Protein L30, for the preparation of a nutraceutical.

In a further aspect said nutraceutical is in the form of capsules, tablets, sachets, or chewing gums.

In yet another aspect, the invention relates to the use of the composition comprising L. salivarius SGL03, and one or more antimicrobial proteins selected from the group consisting of 50S Ribosomal Protein L27, DNA-Binding Protein HU, 30S Ribosomal Protein S20, and 50S Ribosomal Protein L30, for the preparation of a dermo- cosmetic.

In another preferred aspect, said dermo-cosmetic is in the form of a patch, a plaster, a cream, a powder or talk, oil, or dry oil.

The following are Examples of embodiments of the present invention provided for illustrative purposes.

EXAMPLES

EXAMPLE 1 : STRAIN ISOLATION

The strain was isolated from healthy infants' feces.

Initially, a suspension of homogenized fresh stool in 50% de Man Rogosa and Sharpe (MRS) broth (Oxoid, Basingstoke, UK) complex medium, added with 0.05% L-cysteine as reducing agent, was prepared. After incubating the samples at 37°C for 30 minutes, the isolation was carried out in LAMVAB agar (LV) selective medium for vancomycin-resistant lactobacilli. To obtain 1 liter of LAMVAB medium, solution A was prepared dissolving the following components in 500 ml of distilled water:

MRS Broth 52.2 g/l

L-Cysteine 0.25 g/l

Green Bromocresol (0.25% in ethanol) 3 ml/l

Solution A was brought to pH 5 using 4 N HCI, and sterilized in autoclave at 1 10°C for 30 minutes. Subsequently, solution B was prepared by resuspending 18 g of agar in 500 ml of distilled water, sterilized at 1 10°C for 30 minutes. After being cooled down to 55°C, solutions A and B were merged. The agarized medium was added with 20 mg/l vancomycin before being poured into a plate.

RESULTS

The strain was isolated from healthy infants' feces on LAMVAB (LV) in anaerobiosis, at 37°C for 48 hours. L. salivarius SGL03 colonies resulted to be medium in size, and green in color on LV, while they were cream-white in color on MRS. From a morphological point of view, under a microscope such microorganisms appear in the form of medium length, regular rods.

EXAMPLE 2: MOLECULAR CHARACTERIZATION The isolated strain was initially identified by growth on LAMVAB selective medium, as described above, and direct observation of the morphology of colonies grown in plate and cell morphology following observation at the optical microscope.

Certain attribution of the genus and species was done by means of 1 6S ribosomal DNA analysis techniques and biochemical characterization. Analysis of 1 6S Sequence

The genome of the microorganism was extracted using a commercial kit (Macherey Nagel) following the manufacturer's instructions. For 1 6S gene amplification reaction, the DNA was used in a 50-100 ng concentration. The amplification reactions were carried out using Biometra T-professional thermocycler (Biometra, Gottingen, Germany). The amplification conditions used were those that gave the best amplification product yields. All reactions were carried out using a final volume of 25 μΙ.

The components used in all amplification reactions are:

• DyNAzyme (Finnzymes, Espoo, Finland) as thermostable DNA polymerase (1 U per reaction) and its reaction buffer 10, Optimized

DyNAzyme buffer (100 mM Tris-HCI, 500 mM KCI, 15 mM MgCI ₂ , 0.1 % Triton X-100, pH 8.8 at 25°C);

• Mixture of triphosphate nucleotides (8 mM, Euroclone, Siziano, Italy).

• set of primers (100 μΜ, Eurofins MWG Operon, Ebersberg, Germany); · genomic DNA;

• sterile water.

Below are the primers used, the thermocycle and the expected amplicon.

Primer: 1 6S-27 For 5'-AGAGTTTGATCCTGGCTCAG-3' SEQ ID NO.1

16-1552 Rev 5'-AAGGAGGTGWTCARCCGCA-3' SEQ ID NO.2 Thermocycle: 95°C 5'

72°C 5'

15°C∞

Amplicon: 1552 bp

The fragment of approximately 1550 bp was sequenced (MWG Biotech, Ebersberg, Germany), and it was aligned against Blast database (NCBI, nucleotide blast) to obtain the correct species identification.

Species-specific PCR

The same DNA was used as a template for a species-specific primer set for L. salivarius SGL03. If the amplified DNA belongs to the species in question, these primers produce a fragment of about 41 1 bp.

The primers, thermocycle, and amplicon are reported below.

Primer: L Sail 5'-AAT CGC TAA ACT CAT AAC CT-3' SEQ ID NO.3

L Sal2 5'-CAC TCT CTT TGG CTA ATC TT - 3' SEQ ID NO.4

Thermocycle: 95°C 5'

72°C 5'

15°C∞

Amplicon: 41 1 bp

The visualization of the amplification products was performed by electrophoresis on agarose gel (1 -2%). This analysis was carried out by loading on the gel a 10-15 μΙ volume of the reaction mixture in parallel with the molecular weight marker (MassRuler™ Low Range DNA Ladder, Fermentas). Strain Profile in MALDI-TOF MS

To obtain a Maldi-Tof identification profile, the sample was prepared as follows: a bacterial culture of L. salivarius SGL03 grown overnight was harvested in order to have a sufficient amount of cells to be detected (5 billions). The cell pellet was washed with physiological solution to remove fermented medium residues, and resuspended in 300 μΙ of distilled water and 900 μΙ of pure ethanol. The suspension was well homogenized. The sample was then centrifuged at 13,000 rpm for 2 minutes, and allowed to dry in the air after removing the supernatant. The sample was stored at -20°C while waiting for the analysis.

At the time of the analysis, the sample was resuspended with 50 μΙ of 70% formic acid. After the resuspension, additional 50 μΙ of acetonitrile were added and it was all vigorously stirred. The sample was then centrifuged at 13,000 rpm for 2 min. 1 μΙ of the supernatant was placed in the center of a spot in a disposable MALDI plate, and air-dried. The addition of 1 μΙ of a matrix made of organic materials (a-cyano-4- hydroxycinnamic acid) determined the start of the Maldi Tof analysis.

Maldi Tof MS was performed with a MicroFlex LT system by using the conditions set out in the user manual. The ions generated by the nitrogen laser at the wavelength of 337 nm were linearly captured in a mass range of 2 to 20 KDa. The instrument was connected to Biotyper 2.0 software (Bruker Daltonics) which is able to capture incoming data, process them into mass spectra, and compare them with reference spectra stored in an internal database (3,740 spectra of 319 genera and 1 ,946 different species). For each MALDI plate containing 24 samples, a standard test was included to calibrate and validate the analysis.

The degree of correspondence with the typical spectrum of each microorganism in the database determines the attribution of a score value expressing the degree of certainty of the proposed identification for the species under consideration. Scores over 2,000 are considered reliable in species-level identification, values ranging from 1 ,700 to 1 ,900 are, instead, attributable to a certain gender-specific identification.

The strain was analyzed in triplicate using 3 different bacterial cultures.

Gram Staining Gram staining is a type of differential staining that allows to classify bacteria in Gram-positive and Gram-negative.

This identification test, which was carried out using the Gram Color Kit (Liofilchem), is divided into 4 steps, spaced by washings with distilled water, each of which involves treatment with a particular reagent that is left to act for about 1 minute on the surface of a slide on which a microbial colony from a solid soil has been deposited, diluted with a drop of sterile water. The suspension thus obtained is then heat fixed e with a Bunsen burner.

The reagents used, in order of application, are:

· crystal violet,

• Lugol's solution,

• decolorizing solution (ethyl alcohol),

• safranin.

At the end, Gram-positive bacteria appear purple in color, while Gram-negative bacteria are red or pink.

Catalase Assay

This assay is used to verify the presence of the catalase enzyme in a bacterial culture able to detoxify hydrogen peroxide (Brock et al. 1995).

A loop of cells from a solid culture were dissolved in a drop of 3% hydrogen peroxide. The immediate appearance of effervescence is indicative of the presence of catalase.

Effervescence is due to the oxygen that develops in the reaction:

Oxidase Assay

The oxidase assay is an enzymatic test used to detect the presence of cytochrome oxidase enzyme in bacteria. It is positive for aerobic and facultative anaerobic bacteria. Oxidase Test Discs (Liofilchem), i.e. paper discs of 3 mm diameter impregnated with tetramethyl-p-phenylenediamine hydrochloride (Kovacs reagent), were used. The disc was moistened with 2 drops of distilled water, and rubbed with a loop of a pure colony. The development of a blue color within 30 seconds demonstrates the oxidation of the substrate contained in the disk. In this case, the microorganism is oxidase- positive, conversely, if no color development occurs, the microorganism will be oxidase-negative. Sugar Fermentation Profile (API)

For the biochemical characterization of L. salivarius SGL03, the API 50 CH gallery system was used with API 50 CHL (BioMerieux, Milano, Italy) inoculum medium. The gallery consists of 50 microtubes containing dehydrated substrates for the detection of the enzymatic activity and the fermentation of sugars. The bacterial suspension, with a turbidity of 2 McFarland, was distributed in the microtubes, and anaerobiosis was obtained by covering it with sterile paraffin oil. The metabolism of the substrate by the bacterium during the incubation period at 37°C is highlighted by a color change of the medium, following acidification of the medium. Reaction reading was performed on the basis of a reading table where the results were recorded, and the identification was performed using a computer software (www.apiweb.biomerieux.com).

RESULTS

Molecular Characterization Lactobacilli strains selected by isolation with LV medium were taxonomically classified by the study of the entire 1 6S gene. A 1500 bp long region was amplified using generic primers for eubacteria, sequenced and then aligned using BLAST with public databases. The results enabled a certain classification. The Maldi Tof results shown below provided additional support to the strain identification.

The L. salivarius SGL03 strain was deposited on 21 /1 1 /201 1 at the European International Collection DSMZ, which possess IDA (International Depositary Authority) status, with a "patent deposit" having the following registration number: L. salivarius SGL03 DSM.25381 . In addition, the microorganism was amplified with species-specific primers, verifying the positivity by the appearance of the amplicon having the expected 41 1 pb size. This additional data allows us to assign unambiguously the species, and to have an instrument for controlling and monitoring the culture under examination during the fermentation and lyophilization phases. Figure 1 shows the result of L. salivarius SGL 03 amplification using species-specific primers.

Biochemical Characterization

The L. salivarius SGL03 strain was also analyzed in terms of biochemical profile by Gram staining, catalase test, oxidase test, and API 50CH system.

The results obtained confirmed that the strain is Gram-positive, catalase and oxidase negative, and ferments the sugars as shown in Table 1 .

Table 1 : Biochemical characterization of L. salivarius SGL03 by API 50CH system. EXAMPLE 3: CHARACTERIZATION OF THE PROBIOTIC CHARACTERISTICS OF L. SALIVARIUS SGL03

Tolerance to the qastro-intestinal environment

In order to evaluate the tolerance to gastro-intestinal juices, vitality over time was determined by plate count of the isolated strain, after it had been contacted with:

• synthetic pepsin;

• synthetic pancreatin; · various concentrations of bile salts;

• various concentrations of NaCI;

• growth medium acid pH.

- Pepsin Resistance Test

A pepsin solution consisting of 3 g/l of pepsin, derived from pig gastric mucosa (Sigma-Aldrich, St. Louis, MO), was obtained by solubilizing powdered pepsin in sterile 0.5% NaCI (w/v) saline solution, and the pH was adjusted to 3. Starting from cultures grown overnight in 10 ml of MRS broth medium supplemented with 0.05% of L-cysteine at 37°C for about 18 hours, in the presence of O2, about 10 ⁹ cells/ml were harvested by centrifugation at 4,000 rpm for 10 minutes. Subsequently, the pelletized cells were washed with a 0.09% NaCI (w/v) sterile saline solution, and subjected to the same centrifugation cycle. Washing was repeated a second time under the same conditions.

To simulate the passage through the gastric tract, cells were resuspended in 10 ml of pepsin solution at pH 3. The suspension thus prepared was incubated in anaerobiosis, at 37°C, for 2 hours, by measuring the number of CFU/ml at 0, 90 and 120 minutes by plate count.

To monitor growth even in the absence of pepsin, the strain was inoculated into two 0.5% (w/v) sterile saline solutions, at pH 3, one containing pepsin and one without it (control sample). The samples were incubated under the same conditions described above. The resistance of the treated strain was expressed as a percentage of survival over the control.

-Pancreatin Resistance Test

A pancreatin solution, consisting of 1 g/l pancreatin from pig pancreas (Sigma- Aldrich), was obtained by solubilizing the powder in 0.5% NaCI (w/v) sterile saline solution, and the pH was adjusted to 8. Starting from cultures grown overnight at 37°C for about 18h, in the presence of O2, in 10 ml of MRS broth medium supplemented with 0.05% of L-cysteine, about 10 ⁹ cells/ml were harvested by centrifugation at 4,000 rpm for 10 minutes. Using the same centrifugation cycle, the cells were washed with a 0.09% NaCI (p/v) sterile saline solution.

Subsequently the cells were washed with a sterile neutralization buffer (PBS - 8 g/l NaCI, 0.2 g/l KCI, 1 .44 g/l Na ₂ HP04, 0.24 g/l KH2PO4) at pH 7 and, to simulate passage through the intestine, they were resuspended in 10 ml of pancreatin solution at pH 8. The suspension was incubated in anaerobiosis, at 37°C for 4 hours, and the number of CFU/ml at 0, 60 and 240 minutes was estimated by plate count. To monitor growth in the absence of pancreatin, the strain under evaluation was inoculated into two 0.5% (w/v) sterile saline solutions, pH 8, one containing pancreatin and the other without it (control sample). The samples were incubated under the same conditions described above.

The resistance of treated strains was expressed as a percentage of survival over control.

- Resistant Test to Bile Salts, pH and NaCI

The analysis was carried out on bacterial cultures grown overnight. Approximately 10 ⁹ cells/ml were harvested by centrifugation at 4,000 rpm for 10 minutes. The cells were then washed with 2 ml of sterile physiological solution (NaCI 9 g/l) and, following centrifugation at 4,000 rpm for 10 minutes, they were resuspended in MRS broth containing:

• 0%, 0.5%, 1 %, 2%, 3% bile salts (p/v, Sigma-Aldrich);

• 0%, 2%, 6%, 10% NaCI (p/v, Oxoid); · pH 6.3, 3.5, 2, 1 .5, adjusted with 4 N HCI. The solutions were incubated in anaerobiosis, at 37°C for 24h, for each inoculum the optical density at 600 nm was recorded at Oh, 2h and 24h, while the estimate of the CFU/ml number was performed at Oh and 24h, by plate count.

Adhesion to Intestinal Cells Monolayer

To assess the adhesion activity of the L. salivarius SGL03 strain to the HT29 human enteric line, 1 x 10 ⁸ bacterial cells were added to an epithelial monolayer of HT29 cells (1 .23 x 10 ⁶ cells) and incubated for 1 .5 h. At the end of the incubation, the cell monolayer was washed 4 times with PBS, and the adherent bacterial cells were quantified by Real Time PCR using the genera-specific primer (Candela M, Seibold G, Vitali B, Lachenmaier S, Eikmanns BJ, Brigidi P. Real-time PCR quantification of bacterial adhesion to Caco-2 cells: competition between bifidobacteria and enteropathogens. Res. Microbiol. (2005) 156:887-895).

The adherent enteropathogens Salmonella Typhimurium and E.coli ETEC H10407 were used as positive controls, while the non-adherent E. coli B44 strain was used as negative control.

Inhibitory Activity against the Growth of Pathogenic Streptococci Residing in the Oral Cavity The inhibitory activity of the L. salivarius SGL03 strain against certain streptococci residing in the oral cavity, some associated with pathological process of the oral cavity, was assessed. Specifically, the object of the study was S. pyogenes, the most common etiologic agent of pharyngitis and tonsillitis, and S. mutans, the primary species responsible for dental caries.

In addition, the antagonistic activity against another streptococcus commensal of the oral mucosa, S. uberis, not known as oral pathogen but occasionally associated with genitourinary urinary tract infections, was evaluated.

In order to determine the minimum concentration of L. salivarius SGL03 able to inhibit each pathogen growth, a preliminary study on S. pyogenes was performed, by testing three different concentrations of L. salivarius (1 x10 ⁷ CFU/ml, 1 x10 ⁸ CFU/ml, 1 x10 ⁹ CFU/ml). For the inhibition test, the starting point was a tube containing 10 ml of M17 medium (Liofilchem), inoculated with S. pyogenes. The culture was incubated in aerobiosis at 37°C overnight, under static conditions.

After 24 hours, 4 flasks containing 100 ml of M17 medium were inoculated with 1 ml of S. pyogenes culture grown overnight. 1 flask was used as S. pyogenes growth control, the other 3 flasks were added with different concentrations of L. salivarius SGL03 (1 x10 ⁷ CFU/ml, 1 x10 ⁸ CFU/ml, 1 x10 ⁹ CFU/ml). All the flasks were incubated in aerobiosis at 37°C, under static conditions. The microbial growth was assessed at different times by measuring the optical density of the cultures, and calculating the CFU/ml plate count on agarized M17 medium. To differentiate the pathogenic colonies from the L. salivarius SGL03 ones, counts were also performed on plates of lactobacilli-specific MRS agar medium. The plates used during the counts were incubated in aerobiosis .at 37°C. for 24-48 hours.

The minimum concentration of L. salivarius SGL03 able to inhibit S. pyogenes growth was then tested on S. mutans and S. uberis, in order to verify whether the determined dose was equally effective.

The inhibition test on S. mutans and S. uberis was performed following the same experimental plot of the preliminary test performed on S. pyogenes.

Antibiotic Resistance Profile

The sensitivity to antimicrobial agents of the L. salivarius SGL03 strain was tested using MIC Test Strip (Liofilchem), a quantitative method for the determination of the minimum inhibitory concentration (MIC) of a single antimicrobial agent against microorganisms. The kit consists of paper strips impregnated with a predetermined gradient of antibiotic concentrations, consisting of 15 dilutions in the range of dilutions used in conventional methods for MIC determination.

The cultures in stationary phase were diluted in MRD buffer (Liofilchem) in order to have a turbidity equal to McFarland 3 standard. 100 μΙ of this solution were spatulated on the surface of MRS agar medium supplemented with 0.05% of L- cysteine in plate, in order to produce an homogeneous growth. After allowing the agar surface to dry completely, the strip was placed in the center of the plate with the MIC values facing upward. The plates thus prepared were incubated, with the lid facing upward, in aerobiosis, at 37°C for 48 hours.

When the kit strip is applied to the inoculated surface of plated agarized medium, the pre-defined gradient is released by the strip to the medium, therefore, after the incubation, an elliptical, symmetrical, and centered along the strip inhibition area can be observed. The MIC value, expressed in μ9/ιτιΙ, was read at the intersection point between the edge of the inhibition ellipse and the paper strip.

RESULTS

Tolerance to the Gastro-intestinal Environment

The microorganism was tested to ensure its gastro-intestinal transit and survival, and ensure it reaches in full vitality the intestinal section where it must exert its physiological activity.

This strain was then tested under the following environmental conditions:

1 . pepsin resistance in acidic environment

2. pancreatin resistance in basic environment

3. resistance to high concentrations of bile salts

4. resistance to acidic environment

5. resistance to high saline concentrations

L. salivarius SGL03 showed a good tolerance to the gastro-intestinal environment. Specifically, the results showed a good survival rate after 1 h, and even after 4h incubation in the presence of pancreatin at pH 8. Similar results were obtained after 1 hour and 30 minutes, and after 2 hours and 30 minutes incubation in the presence of pepsin at pH 3. The results obtained are shown in Table 2 below. LOG10 CFU/ml L. salivarius SGL03

to 6.38+0.27

t90' 5.85+0.28

Test tl20' 6.18+0.25

% Survival 90' 91.61+5

PEPSINA % Survival 120' 96.80+6

pH 3 to 6.04+0.26

t90' 5.30+0.28

Control tl20' 5.00+0.27

% Survival 90' 87.75+7

% Survival 120' 82.76+5

to 8.23+0.02

t60' 8.07+0.04

Test t240' 8.03+0.01

% Survival 60' 98.13+6

PANCREATIN % Survival 240' 97.60+5

pH 8 to 8.33+0.02

t60' 8.15+0.01

Control t240' 7.98+0.03

% Survival 60' 97.89+7

% Survival 240' 95.78+5

Table 2: L. salivarius SGL03 resistance to pepsin and pancreatin

The microorganism is slightly affected by the presence of bile salts at concentrations higher than 2% (about 10 times higher than the physiological ones), still showing good survival even in the presence of 3%. Results are shown in Table 3. This makes it suitable for use as a probiotic.

Table 3: L. salivarius SGL03 resistance to bile salts Resistance in Saline Environment

As shown in Figure 2, L. salivarius SGL03 is affected by the presence of NaCI in the culture medium. Its survival is ensured up to 2% NaCI; at higher concentrations growth of the microorganism stops. Resistance in Acidic Environment

As shown in Figure 3, L. salivarius SGL03 shows a low tolerance to acidic pH; at pH below 3 its survival is compromised.

Adhesion to the Intestinal Cells Monolayer

The adhesion activity of the L. salivarius SGL03 strain to the HT29 human enteric line was evaluated by counting the number of microorganisms adherent to HT29 cells by using Real-Time PCR. The results obtained was of 9.57 bacteria per 100 HT29 cells, therefore L. salivarius SGL03 may not be considered an adhesive strain (adhesion reference value, 6.77E+5 Salmonella/100 HT29 cells and 157 E. coli B44/100 HT29). Inhibitory Activity on the Growth of Pathogens Residing in the Oral Cavity

The results of the preliminary study performed on S. pyogenes show that L. salivarius SGL03 is able to inhibit S. pyogenes growth at all concentrations tested (1 x10 ⁷ CFU/ml, 1 x10 ⁸ CFU/ml, 1 x10 ⁹ CFU/ml), with a maximum inhibition in the first 6-7 hours of co-culture, after which the microorganism, while being inhibited, begins to slowly grow, as shown in Figure 4.

The minimum inhibitory concentration of L. salivarius SGL03, determined in the test performed on S. pyogenes, is 1 x10 ⁷ CFU/ml, and the same concentration was therefore tested on the other oral streptococci under study, S. uberis and S. mutans. The inhibition test was performed following the same experimental plot used for S. pyogenes, and the microbial growth was also evaluated after 24 hours incubation. The results showed that, similarly to S. pyogenes, S. uberis is inhibited when 1 x10 ⁷ CFU/ml of L. salivarius SGL03 are present in the growth medium. In addition, the growth inhibition is maintained throughout the 24-hour period, as it is deduced from the graph in Figure 5.

S. mutans, on the other hand, is not affected by the presence of L. salivarius SGL03 in the culture medium at a concentration of 1 x10 ⁷ CFU/ml; in fact, as it can be seen from the graph in Figure 6a, S. mutans growth curve shows roughly the same pattern both in the sample and the control. Therefore, a further test at higher concentrations of L. salivarius SGL03 (Figura 6b) was performed, in order to evaluate whether the growth inhibition for S. mutans was dose-dependent. The tested concentrations were 2x10 ⁷ CFU/ml, 3x10 ⁷ CFU/ml, 10x10 ⁷ CFU/ml.

Th test results are shown after those for the test performed with 1 x10 ⁷ CFU/ml SGL03. The minimum concentration of L. salivarius SGL03 needed to inhibit the pathogen growth resulted to be 3x10 ⁷ CFU/ml, while at 2x10 ⁷ CFU/ml concentrations the pathogen seems to be little affected by the presence of L. salivarius SGL03, especially during the first 8-9 hours of incubation.

Antibiotic Resistance Profile

Table 4, reported below, shows the resistance profile to antibiotics tested against the L. salivarius SGL03 strain, by using the MIC Test Strip.

Table 4: L. salivarius SGL03 antibiotic resistance profile EXAMPLE 4: DESCRIPTION OF THE FERMENTATION AND LYOPHILIZATION PROCESS

Fermentation

The fermentation was carried out in a laboratory bioreactor for small batch studies, equipped with two 1 .5 liter vessels.

Initially, a screening with various culture media was carried out, in order to identify the most suitable medium for the growth of L. salivarius SGL03 in terms of biomass. The identified culture medium has the following composition:

Meat peptone 18 g/l

Yeast extract 4 g/l

Dextrose 60 g/l

Potassium dihydrogen phosphate 2 g/l

Ammonium citrate tribasic 2 g/l

Magnesium sulfate heptahydrate 0.2 g/l

Manganese sulfate monohydrate 0.05 g/l

Cysteine-HCI 0.5 g/l

Tween 80 10 g/l

Once filled with 1 .5 liters of the selected culture medium, the vessels were sterilized in autoclave at 105°C for 90 minutes, and connected to the control panel. The set parameters for batch fermentation were as follows:

- temperature 37°C;

- pH 6.0, controlled with 5N NaOH;

- oxygen;

- stirring at 100 rpm.

The inoculum with 3% of pre-culture in exponential phase was obtained by performing a short scale up: from 10 ml of MRS to 50 ml, ending with the 1 .5 liter vessel.

Lvophilization

The fermentation process was stopped after about 7 hours from the inoculum, specifically when the optical density of the bacterial culture, measured at 600 nm, reached 10. The broth culture was then centrifuged at 9,000 rpm for 20 minutes at 10°C, the supernatant was discharged, and the pellet resuspended in a 1 :1 ratio with a cryoprotector having the following composition:

Trealose 150 g/l

Polyvinylpyrrolidone K90 25 g l

Potato starch 25g/l The pellet mixed with the cryoprotector was then placed inside a metal container having a support surface perfectly adherent to the surface of the freeze-dryer shelf. The freeze-dryer used was a Lyobeta 3PS (Telstar, Spain). Table 5 below summarizes the lyophilization recipe used, with the relevant control parameters used during the lyophilization process.

Table 5: L. salivarius SGL03 lyophilization parameters temperature goes from -5°C to -55°C in 1 h, and then is maintained at -55°C for 3h and 30 minutes.

After the lyophilization, also L. salivarius SGL 03 percentage of vitality was evaluated, by revitalizing the freeze-dried obtained in MRS medium for about 30 minutes at 37°C, and performing a plate count.

RESULTS Fermentation and Lyophilization L. salivarius SGL03 growth was monitored, in terms of optical density at 600 nm and CFU/ml, during the first 6-7 hours from fermenter inoculum, until reaching an optical density of 10. The growth curve obtained during fermentation is shown in Figure 7. At the harvesting of the broth culture, the yield in terms of CFU was of about 2.5x10 ⁹ CFU/Iiter of medium. The microbial biomass obtained after lyophilization was of about 10 g per liter of medium. After revitalization of the strain, the count result was of 200x10 ⁹ CFU/g, therefore vitality percentage after lyophilization was 54%. EXAMPLE 5: PRODUCTION AD CHARACTERIZATION OF L. SALIVARIUS SGL03 SECRETOME

Analysis of L. salivarius SGL03 Secretome L. salivarius SGL03 was harvested from cultures grown in MRS medium by centrifugation (5,000 rpm, 10 minutes, 4°C) after 12 hours of fermentation at 37°C. The supernatant was then filtered through 0.22 μηι filters (Millipore). This sample, referred to the raw cell-free supernatant, was concentrated by ultrafiltration using 3 kDa nominal molecular weight limit (cut-off) filtering units (Ultracel YM-3, Millipore), and the fraction with a cut-off lower than 10 kDa was collected and concentrated using Vivaspin 6 tubes (Sartorius Stedim Biotech GmbH, Goettingen, Germania). The protein concentration was determined using the Bradford method (Sigma- Aldrich, St. Louis, Missouri) according to the manufacturer's instructions.

The secreted protein sample (cut-off <10 kDa) was then loaded onto SDS-PAGE gel, together with the molecular mass standards (Bio-Rad Laboratories, Hercules, California). The gel was prepared with a 5% acrylamide/bis-acrylamide packing gel, and a 5% separation gel for tricine-SDS-PAGE. The separation was performed at 25 mA for 3 hours on a vertical slab gel apparatus, Mini PROTEAN 3 (Bio-Rad). The gel was stained with Coomassie Brilliant Blue G-250.

Antimicrobial Activity of L. salivarius SGL03 Secretome The antimicrobial activity of the total secretome was analyzed by the diffusion in agar method. To detect the antimicrobial activity of L. salivarius SGL03 secretome, the culture supernatant was centrifuged at 5,000 rpm for 10 minutes at 20°C, brought to pH 7 with 2N NaOH, and treated with 1000 U/ml of catalase (Sigma- Aldrich, St.Louis, Missouri) to exclude effects due to organic acids and hydrogen peroxide. The supernatant was then sterilized through a 0.22 μηι filter (Millipore), and dilutions of the supernatant in sterile M17 medium were performed.

Subsequently, 25 μΙ aliquots of the diluted supernatant samples were poured into 4 mm holes made on the surface of M17 agar plates (1 .2% agar), previously spatulated with 1 x10 ⁸ CFU/ml of the marker strain in exponential growth phase. A 0.9% NaCI solution was also tested as a control test. The plates were incubated at 37°C for 24 hours.

The antimicrobial activity was highlighted by the presence of a growth inhibition halo, whose diameter in millimeter (mm) for the secretome was measured. For heterologous proteins, instead, the antimicrobial activity was expressed in the form of arbitrary units (AU/ml), defined as the reciprocal of the highest dilution able to produce an inhibition halo.

RESULTS

Analysis of L. salivarius SGL03 Secretome

In the present study, the extracellular protein profile of L. salivarius SGL03 was analyzed by mono-dimensional electrophoresis on tricine gel. The protein concentration in the supernatant, estimated using the Bradford method, in the L, salivarius SGL03 secretome was 8 mg/l. In order to focus on bacteriocin-like compounds, the total secretome was concentrated 15 times, and the protein fraction with a cut-off lower than 10 kDa was loaded on to SDS-PAGE gel (Figure 8). The separated bands were then extracted from the gel, and treated with trypsin before the analysis by mass spectrometry.

Antimicrobial Activity of L. salivarius SGL03 Secretome The secretome obtained from L. salivarius SGL03 was tested for its antibacterial activity against various Gram-positive and Gram-negative bacteria (Table 6). The antibacterial activities were determined by measuring the diameter of the inhibition halo. L. salivarius SGL03 showed inhibitory activity against Streptococcus pyogenes, Enterococcus faecium, Streptococcus uberis. The degree of inhibition against S. pyogenes was high, with a 15 mm inhibition halo diameter; and moderate against E. faecium and S. uberis, with a 6 mm inhibition halo diameter.

Inibition zone: + inhibition activity, - no inhibition activity.

Table 6: Antibacterial activity of L. salivarius SGL03 secretome

EXAMPLE 6: IDENTIFICATION OF SECRETED PROTEINS WITH ANTIMICROBIAL ACTIVITY BY MASS SPECTROMETRY (MS)

The bands were carefully cut from Coomassie gel and submitted to in-gel digestion with trypsin according to Shevchenko et al., with minor modifications. Briefly, the gel fragments were allowed to hydrate in a digestion buffer containing 50 mM NH4HCO3 and 12,5 ng/μΙ of pig trypsin (Promega, Madison, Wl, USA), and the digestion was allowed to proceed at 37°C overnight. Prior to mass spectroscopy, the peptide mixtures were redissolved in 5 μΙ of 2% acetonitrile and 0.1 % formic acid.

The peptides obtained from 5 μΙ of each sample were then separated by reverse phase nano-HPLC-Chip system (Agilent Technologies, Palo Alto, CA, USA) online coupled to a 3D ion trap mass spectrometer (Esquire 6000 model, Bruker Daltonics, Bremen, Germany). Sequential peptide elution was performed within the chip using a flow rate of 300 n l/minute and a linear gradient from a Solution A (2% acetonitrile; 0.1 % formic acid), 50% v/v, to a Solution B (98% v/v acetonitrile; 0.1 % v/v formic acid) in 20 minutes on a Zorbax 300SB-C18 enrichment column (40 nl, 5μηι) and on a Zorbax 300SB-C18 (43 mm x 75μηπ, 5μηι) analytical column. The complete system was fully controlled by ChemStation (Agilent Technologies) and EsquireControl (Bruker Daltonics) softwares.

The scan range used to acquire the spectra was 300-1800 m/z (mass/charge ratio). For MS tandem experiments, the system was operated with an automatic switch between MS and MS/MS modes.

The three most abundant peptides for each m/z value were selected to be further isolated and fragmented. The MS/MS scan was performed in normal resolution mode, at a scan speed of 13,000 m/z per second. An average of five scans were performed to obtain a MS/MS spectrum. For the peptides identification, some searches were carried out using the search software Mascot in the National Center for Biotechnology Information (NCBInr) database containing non-redundant protein sequences (NCBInr 20.130.918 database, 3261 1 672 sequences, 1 1345269536 residues).

The following parameters were used for the search: specific digestion with trypsin, up to one missed cleavage; fixed and variable modifications: cysteine carbamidomethylation and methionine oxidation; mass tolerance for peptide and fragment ± 0.9 Da and ± 0.9 Da, respectively; peptide charges: +1 , +2 and +3. Proteins were identified with a significant result (P <0.05) based on the individual score for the peptide ion. These scores were automatically calculated by the Mascot program, wherein P is the probability that the match observed is a random event.

RESULTS

A total of 10 different proteins were found in the tested media. The identified secreted proteins are summarized in Table 7 below.

Table 7: Proteins secreted by L. sal i van us SGL03 and identified by MS.

EXAMPLE 7: HETEROLOGOUS EXPRESSION OF L. SALIVARIUS SGL03 SECRETOME PROTEINS AND EVALUATION OF THE ANTIMICROBIAL ACTIVITY

Design of Primers and Amplification Conditions by PCR

Due to the fact that many ribosomal proteins are characterized by extra ribosomal features, in particular for antimicrobial functions, we have decided to concentrate initially on rpmA (50S Ribosomal Protein L27), rpmD (50S Ribosomal Protein L30), rpsT (30S Ribosomal Protein S20), and LSL_0885 (DNA-Binding Protein HU) proteins.

The primers were designed to amplify the entire encoding sequence of rpmA (Gene Bank, accession number: Q1 WTI2), rpmD (Gene Bank, accession number: Y_536304), rpsT (Gene Bank, accession number: Q1 WU88), and LSL_0885 (Gene Bank, accession number: Q1WTQ5) genes.

The sequence of mature polypeptides (rpmA 282 pb, rpmD 183 pb, rpsT 255 pb, LS_0885 276 pb) was amplified by PCR using the following primers:

For rpmA CTCAGCACATATGTTAATGAATTTACAATTCTTCGCT SEQ ID NO. 5 Rev rpmA CCCTCGACATATGGATAAATTAAAAGTTACTTTAATTCG SEQ ID NO. 6

For rpmD G CTG G ATCCTTATTATTCAG CAACAG G GTAAACA SEQ ID NO. 7 Rev rpmD GATGGATCCCTACTATTTAGCCAATTCAACGTCC SEQ ID NO. 8 For rpsT CCACCTCATATGCCAATTATCAAATCTGCTATTAAA SEQ I D NO. 9 Rev rpsT S20 TCTGGATCCTTATTATTTAGCTAAACGAGCAGC SEQ ID NO. 10 For LSL_0885 TTG G ACG CATATGG CAAACAAAG CAG CATTG ATTG SEQ ID NO. 1 1

Rev LSL_0885 GGCGGATCCTTATTATTTAACAGCGTCTTTCAAAGA SEQ ID NO. 12

Recognition sites for Ndel and BamHI restriction endonuclease, needed for sub- cloning, were embedded at the 5' and 3' ends of the mature gene, respectively. Gene amplification was performed using a total volume containing 20 ng of DNA template, 0.5 μΜ of each primer, 2 mM Mg ²⁺ , 200 mM of each deoxynucleotide triphosphate, PCR buffer 1 X and 2.5 units of Taq polymerase.

The following program was used for the amplification:

Hot start at 94°C for 5 minutes, 34 denaturation cycles for 40 seconds, annealing of primers at 60°C for 30 seconds, extension at 72°C for 30 seconds, followed by a final extension at 72°C for 5 minutes.

The PCR products were analyzed in 0.8% agarose gel in TBE buffer 1 X, and purified from the gel using GenElute™ Gel Extraction kit (Sigma-Aldrich, St. Louis, Missouri), following the manufacturer's instructions.

Isolation of DNA Clones from PCR Products and Sequencing

PCR products were ligated to the pGEM Teasy-vector, to generate recombinant plasmids using T4 DNA ligase. Competent cells of E. coli JM109 were transformed using the pGEM Teasy plasmid vector. Transformed bacteria were selected by blue- white colony screening on medium containing Ampicillin (100 pg/ml), X-Gal (80 Mg/ml) and IPTG (0.5 mM).

The plasmid DNA templates were purified using Wizard® Plus SV Minipreps DNA Purification System (Promega) purification system.

RpmA, rpmD, rpsT and LSL_0885 gene sequencing was performed using the Sanger method (BMR-genomics, Padova, Italia).

Heterologous Expression of Recombinant Proteins E. coli BL21 (DE3) cells were used as transformation hosts for the expression of recombinant proteins. Such cells, containing RNA polymerase T7 gene under the control of the lacl promoter gene, were transformed using the pET-15b plasmid. A single colony of transformed E. coli BL2 (DE3) cells was incubated at 37°C, under 200 rpm stirring, in 2 ml of Luria-Bertani (LB) medium, containing Ampicillin (100 Mg/ml).

500 μΙ of culture broth were taken and inoculated in 1 liter of LB medium.

The cells were grown at 37°C, under vigorous stirring at 200 rpm, until reaching an optical density of 0.8 at 600 nm.

lsopropyl- -D-1 - thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM to induce the expression of mature peptides in E. coli.

The incubation was then extended for 4 hours at 37°C, while keeping stirring at 200 rpm.

Aliquots were taken from the bacterial suspension at 4, 6, 12 hours.

The expressed proteins were purified by Ni-sepharose columns, following manufacturer's instructions (GE Healthcare), and then concentrated with PBS buffer at 4°C.

The degree of purity of each purified recombinant protein was evaluated by 15% SDS-PAGE, and confirmed by nano-HPCL coupled to mass spectrometry.

Antimicrobial Activity Evaluation

In order to test the bacteriostatic and bactericidal activity of rpmA, rpmD, rpsT, and LSL_0885 against the S. pyogenes ATCC19615 strain, the latter was grown in 100 ml of M17 medium until the exponential phase (10 ⁸ CFU/ml) was reached. Four 100 ml flasks with S. pyogenes were produced, one for each protein to be tested.

Subsequently, the proteins were filtered through 0.45 m filters (Millipore) and singly added to the grown cultures of S. pyogenes, at the concentration of 133 AU/ml. A culture of S. pyogenes, grown in M17 medium without any addition of the purified proteins, was used as control. After protein addition, the cultures were incubated at 37°C for another 6 hours. Changes in culture turbidity were monitored over time by recording the optical density at 600 nm, and performing CFU/ml counts on M17 agar plates.

RESULTS

Antimicrobial Activity Evaluation

Heterologous expression was performed to obtain purified proteins. A positive E. coli BL21 (DE3) clone allowed to accumulate the recombinant protein (i.e. rpmA, rpmD rpsT, and LSLJ3885) in a cytoplasm soluble form , and produced at a constant level with IPTG.

The purified proteins from heterologous expression were detected as a band of about 10, 7, 9 and 10 kDa by SDS-PAGE (Figure 9), which were identified as rpmA, rpmD, rpsT and LSLJ3885, and having a Mr of 9941 , 6557, 9126, and 9802Da by MS/MS analysis, respectively.

The total quantity of purified proteins was 1 .5 mg/l, 0.3 mg/l, 6 mg/l, and 1 1 mg/l for rpmA, rpmD, rpsT, and LSL_0885, respectively.

The purified rpmA, rpmD, rpsT, and LSL_0885 proteins were tested for their antimicrobial activity against the strains reported in Table 6.

The results showed that rpmA and rpmD proteins exhibit a specific antimicrobial activity against S. pyogenes, E. faecium and S. uberis strains.

Various concentrations of the purified proteins were tested: 0.25 μ9/μΙ, 0.5 μ9/μΙ, 1 .0 μ9/μΙ, 1 .5 μ9/μΙ, and 2.0 μ9/μΙ (Table 8).

Table 8: Results of the antimicrobial activity of proteins produced by L. salivarius SGL03 against S. pyrogenes ATCC19615. Inhibition halo: + inhibitory activity, - no inhibitory activity. The arbitrary unit calculated for rpmA and rpmD proteins was 133 AU/ml, using Streptococcus pyogenes as marker strain.

RpmA and rpmD were tested together to verify the presence of any synergistic activity. To this end, 15 μΙ_ of each protein, at a concentration of 1 pg/μΙ, were tested in combination, and a 0.5 mm increase of the inhibition halo diameter was obtained using the agar diffusion method (Figure 10).

The addition of purified rpmA and rpmD proteins, at a concentration of 133 AU/mL, to the S. pyogenes ATCC 19615 culture, in the logarithmic growth phase, resulted in a rapid decrease of S. pyogenes viable cells from 10 ⁸ CFU/ml to 10 ⁶ CFU/ml and from 10 ⁸ CFU/ml to 10 ⁵ CFU/ml, over a period of 9 hours, in cultures treated with rpmA and rpmD, respectively.

In the control sample (no addition of purified proteins), S. pyogenes ATCC 19615 viable cells reached 10 ¹⁰ CFU/ml after 9 hours growth.

The optical density of the marker microorganism remained constant after the addition of purified rpmA and rpmD proteins (Figure 1 1 a, 1 1 b, 1 1 c and 1 1 d). These results showed that both proteins exhibit bactericidal activity against S. pyogenes. From the detailed description and Examples above, the advantages obtained with the probiotic strain of the present invention are apparent. Specifically, such probiotic strain showed to be surprisingly and advantageously suitable for the production of proteins having inhibitory activity against certain Gram-positive bacteria.