Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
LEVAN REMOVAL FROM SUGAR JUICE
Document Type and Number:
WIPO Patent Application WO/1999/031281
Kind Code:
A1
Abstract:
Methods for improving the filterability of extracted sugar juices are provided. The methods comprise treating the extracted juices with an endo-levanase devoid of sucrase (invertase) activity or a combination of an endo-levanase and dextranase prior to carbonation. Treatment with an endo-levanase even at low dosages efficiently eliminates filtration problems associated with contaminating levans.

Inventors:
Miasnikov, Andrei (Harju 1 C 16 Kantvik, FIN-02460, FI)
Application Number:
PCT/FI1998/000988
Publication Date:
June 24, 1999
Filing Date:
December 16, 1998
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
CULTOR CORPORATION (Kyllikinportti 2 Helsinki, FIN-00241, FI)
Miasnikov, Andrei (Harju 1 C 16 Kantvik, FIN-02460, FI)
International Classes:
C13B20/00; (IPC1-7): C13D3/00
Attorney, Agent or Firm:
KOLSTER OY AB (Iso Roobertinkatu 23 P.O. Box 148 Helsinki, FIN-00121, FI)
Download PDF:
Claims:
WHAT IS CLAIMED IS:
1. A method of improving the filterability of sugar extraction juice which comprises treatment of the juice with an endolevanase enzyme preparation devoid of sucrase (invertase) activity.
2. The method of Claim 1 wherein the sugar extraction juice is obtained from damaged sugar beets or damaged sugar cane.
3. The method of Claim 1 or 2 further comprising treatment with an enzyme having dextranase activity.
4. Use of an endolevanase enzyme preparation devoid of sucrase (invertase) activity for treating sugar extraction juices.
5. Use of Claim 4, wherein the endolevanase enzyme preparation is used for specific removal of levan.
6. Use of Claim 4 or 5, wherein the endolevanase enzyme preparation is used in combination with a dextranase.
Description:
LEVAN REMOVAL FROM SUGAR JUICE FIELD OF THE INVENTION The present invention relates to methods of using enzyme technology for improving the performance of sugar purification processes. In particular, it relates to a method of improving the filterability of sugar juices contaminated with microbial polysaccharides through treatment with an endo- levanase enzyme preparation either alone or in combination with a dextranase.

BACKGROUND OF THE INVENTION The difficulties associated with microbial polysaccharides produced from sucrose are well known in the sugar industry. These difficulties include: interference with sucrose measurement by polarimetry, increase in the viscosity of juices, anormal crystallization behavior of sucrose, etc. (Kitched R. A. in: Chemistry and Processing of Sugarbeet and Sugarcane (Clarke M. A. and Godshall M. A. eds.), Elsevier, 1988, pp. 208-235; McGinnis R. A., in Beet- Sugar Technology (McGinnis R. A., ed.) 2nd edition, Beet Sugar Development Foundation, Fort Collins, Colorado, 1971, p. 41). A particularly serious technical problem caused by these polysaccharides is impaire filterability of the carbonation sludge. In worst cases this problem may reduce a plant's processing capacity by more than 50% (Barfoed S., Moellgaard A., Zuckerindustrie 112: 391-395 (1987)). Two major microbial polysaccharides- dextran and levan-accumulate whenever damaged beets or cane are stored for a sufficiently long time to allow significant microbial growth. In the beet sugar industry, large-scale bacterial infection typically develops after the beets have been frost damage.

The presence of dextran in sugar juice is a well known problem both in cane and beet sugar production. Sugar mills use dextranase to combat the problem. Levan (a generic name for a large variety of mainly 2-6 linked fructose polymers differing in molecular weight and degree of branching) is formed under similar circumstances, i. e. whenever bacterial contamination of damaged sugarbeet or sugarcane occurs. Levan-associated problems in sugar processing have received much less attention than those caused by dextran even though some harmful influence of levan on sugar processing has long been suspecte. It is generally believed that contribution of levan to filtration problems is small, if not negligible, relative to that of dextran (Oldfield

J. F. T. et al. in Proc. 15th General Assembly of CITS (Commission Internationale Technique de Sucrerie), 1975, Wien, pp. 229-249).

Levanases as a class of enzymes that degrades levan are well known. The term"levanase"as it is often used in literature is somewhat misleading since distinction is not made between endo-and exo-levanases.

Usually all fructofuranosidases (also commonly known as invertases and/or inulinases) have exo-levanase activity. Most of the characterized levanases such as Bacillus subtils levanase or yeast levanases belong to this class (e. g.: Wanker E. et al. Appl. Environ. Microbiol. 61 (5): 1953-1958 (1995); Chaudhary A. et al. J. Biotechnol 46: 55-61 (1996)). Such enzymes are not suitable for levan removal from sugar juices because of their inherent saccharase activity.

There are several characterized endo-levanases as well (Murakami H., Agric.

Biol. Chem 54 (9): 2247-2255 (1990); Murakami et al. Biosci. Biotech.

Biochem. 56 (4) 608-613,1992; Yokota et al. Biosci. Biotech. Biochem. 57 (5): 745-749 (1993)).

In accordance with the present invention, it has been surprisingly found that juice from frost damaged sugarbeets contains similar amounts of dextran and levan. Thus an enzyme which selectively hydrolyzes levan would be valable in solving the levan associated, problems in the beet sugar industry. The present invention provides methods of improving the filterability of sugar extraction juices by treatment with an endo-levanase enzyme preparation devoid of sucrase (invertase) activity.

SUMMARY OF THE INVENTION The present invention provides methods of improving the filterability of sugar juices by treatment with an endo-levanase enzyme preparation. The present invention also provides methods for improving the filterability of sugar juices which comprise treatment with an endo-levanase in combination with an enzyme having dextranase activity.

The present invention further relates to the use of endo-levanase in the processing of sugar. Particularly, the present invention relates to the use of endo-levanase for removal of levan from sugar extraction juices. The use of endo-levanase can be combine with the use of dextranase.

DETAILED DESCRIPTION OF THE INVENTION In accordance with the present invention, it has been surprisingly found that treatment of sugar extraction juice with enzyme products showing

endo-levanase activity results in a significant improvement of carbonation sludge filterability. The present invention is useful for removal of levan, a polysaccharide produced by microbes revalent in damaged sugar beets or sugar cane. Thus, one aspect of the present invention is directe to methods of improving filterability of sugar juices by treatment with an endo-levanase enzyme preparation.

Also, in accordance with the present invention, it has been surprisingly found that the use of both an endo-levanase enzyme preparation and a dextranase enzyme preparation results in a synergistic effect in improving the filterability of sugar juices. Thus, another aspect of the invention is directe to methods of improving filterability of sugar juices by treatment with both an endo-levanase and a dextranase.

The present invention is further directe to the use of endo- levanase in sugar processing. Particular, the present invention is directe to the use of endo-levanase for removal of levan from sugar extraction juices. In a preferred embodiment the present invention is directe to the use of endo- levanase in combination with dextranase.

Any endo-levanase devoid of saccharase activity may be used in accordance with the present invention and in the subject methods of improving filterability of sugar extraction juices. Methods for isolation of endo-levanase producing microorganisms are known, see e. g., Murakami, H. Agric. Biol.

Chem. 54 (9): 2247-2255 (1990). The endo-levanase enzyme may be obtained from its native producer or produced through recombinant DNA techniques in a suitable host. For example, the source of and/or the host for the endo- levanase may be Bacillus subtilis,'a bacterium or other microorganism compatible with the food industry. The enzyme may be purifie or else be a crude preparation as long as there is no contaminating saccharase (invertase) or other harmful enzymatic activity. Thus for the purposes of the present invention, endo-levanase, endo-levanase enzyme and endo-levanase preparation are regarde as equal and synonymes.

The endo-levanases used in the present invention may be isolated and purifie by any of a myriad of methods known to those of skill in the art.

For example, the protein may be collecte from broken open cells (in the case of an endo-levanase produced intracellularly) or else collecte from the supernatant of cell cultures (in the case of secreted endo-levanase) and subjected to isopropanol precipitation, dialysis, fractionation by DEAE

Sephadex chromatography, gel filtration and ion exchange chromatography, ammonium sulfate precipitation, and polyacrylamide gel electrophoresis (PAGE).

Endo-levanases useful for practicing the present invention are thus those which are devoid of sucrase (invertase) activity. Preferably, the enzyme is thermostable at least up to 50°C. An example of an endo-levanase useful for practicing the methods of the present invention is the levanbiose- generating endo-levanase described in Yokota et al. supra. The endo- levanase enzyme disclosed in A. Miasnikov, FEMS Microbiol. Lett. 154,23-28 (1997), is particularly useful in the practice of the present invention.

Said endo-levanase is produced by a novel microbe, designated Bacillus L7, and is moderately thermostable up to 60°C.

The endo-levanase has an apparent molecular weight of 86 kDa, a pH optimum in the range of 5.5-6.0, and an activity of 100% after 20 minutes at 60°C, pH 6.0 in the presence of levan as substrate. The L7 endo-levanase can also be characterized as having a pH optimum of 5.5 at a temperature range of 50°-52°C, a pH optimum of 6.2 to 6.4 at a temperature range of 57°- 60°C, and an activity of 100% after 40 minutes at 50°-55°C, pH 6.4 in the presence of sugarbeet extraction juice.

The endo-levanase comprises the amino acid sequence as set forth in SEQ ID NO: 2, in whole or a functional fragment or equivalent thereof.

Preferably, the amino acid sequence is encoded by the nucleotide sequence as set forth in SEQ ID NO: 1 or a functional variant thereof.

Naturally, the amino acid sequences are nucleotide sequences disclosed herein can be modifie to result in equivalent (expression) products that maintain the function and activity of an endo-levanase. Such modifications include insertions, substitutions and deletions, and specifically substitutions which reflect the degeneracy of the genetic code.

The endo-levanase can be produced by transforming a host cell with isolated nucleic acid encoding an endo-levanase. As host cells, bacteria and yeasts of different genera, e. g. Eschericia coli, Bacillus subtils, or Saccharomyces cerevisiae, can be used.

In addition, or alternatively, the endo-levanase can be produced by cultivating an endo-levanase producing microorganism, in particular a strain of Bacillus in a nutrient medium containing carbon and nitrogen sources and inorganic salts, followed by recovery of said endo-levanase.

In accordance with the present invention, a method for improving the filterability of sugar juices comprising the step of mixing the endo-levanase enzyme preparation with extracted juice prior to carbonation, and use of an endo-levanase preparation in such a method, are provided. The amount of enzyme depends on the degree and type of spoilage and may be in the range of 100-100,000 U/m3 Of juice, preferably, 1000-10,000 U/m3. As used herein, a unit is defined as the amount of enzyme that produces 1 pm of reducing ends per minute in the levanase activity assay as described in Example 6. Similar amounts of levanase may be used when it is applied in combination with dextranase. The amount of dextranase, expressed in Amano units, may vary between 10,000 to 10,000,000 U/m3 and is preferably in the range of 100,000 to 1,000,000 U/m3.

During the enzyme treatment of sugar juices, the temperature may vary between 15° and 60°C. Preferably, the temperature during enzyme treatment is in the range of 40° to 55°C. Incubation time can be from five minutes to two hours and is preferably in the range of from 15 to 45 minutes.

Typically, it is not necessary to adjust the pH of the juice during incubation as long as the pH is within the range of about 5.0 to 6.5. Otherwise, the pH may be adjusted to a preferable range of from about 5.5 to about 6.0.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a restriction map of the L7 DNA insert of the plasmid pL7. The location of the coding region is based on sequencing data. The Cipal site marked with an asterisk is blocked by Dam-methylation in most E. coli hosts.

Figure 2 depicts the nucleotide sequence of the L7 levanase gene (SEQ ID NO: 1). The location of 6-base restriction sites and the deduced amino acid sequence of the levanase are shown. The sequence of oligonucleotides used for creating a deletion derivative of the levanase gene (without a signal peptide sequence) is shown in bold.

Figure 3 depicts the construction scheme of a Bacilllus subtils levanase expression vector, pBSL700. pBSL700 expresses the levanase L7 gene from its own promoter.

Figure 4 depicts the construction scheme of pTAC, a precursor plasmid for a L7 levanase expression vector.

Figure 5 depicts the construction of pTAC (IL7) and pTACL. pTAC (IL7) expresses a modifie levanase gene (signal sequence coding fragment removed) intracellularly in E. coli under control of the tac promoter.

The invention is further illustrated by the following specific examples which are not intended in any way to limit the scope of the invention.

EXAMPLE 1 ISOLATION OF LEVANASE-PRODUCING MICROORGANISMS The screening of soil samples for levanase producing bacteria was done essentially according to Murakami et al., 1990"Purification and properties of a Levanase from Streptomyces sp No. 7-3"Agric. Biol. Chem 54 (9): 2247-2255. Briefly, soil samples, collecte from a grass lawn in southern Finland were suspende in water and the suspension was spread on plates containing minimal medium with levan as the sole carbon source. After incubation for 2 days at 30°C, individual colonies were purifie by cloning and grown in liquid culture. The supernatants were used as enzyme preparations to degrade levan. The rection products were analyzed by TLC on silica plates (Merk 5719) using acetonitrile-water (8: 2) as solvent and fructose, sucrose, and raffinose as standards. Bacterial clone L7 was identifie as a source of enzyme hydrolyzing levan to a mixture of oligosaccharides rather than fructose. The strain was designated Bacillus sp. L7.

EXAMPLE 2 CLONING AND SEQUENCING OF THE LEVANASE L7 GENE Conventional recombinant DNA techniques were used (Maniatis, T. et al., 1982 Molecular Cloning. Cold Spring Harbor Laboratory. Briefly, a gene library was constructed in pUC19 after digesting L7 DNA with Sau3A. The E. coli clone containing the levanase gene was identifie by a clear zone formed around it on a levan-containing plate. The plasmid from this clone (pL7) was isolated, re-transformed into E. coli and the presence of levanase activity in all assayed transformants was confirme. To enable the transposon-facilitated DNA sequencing, the originally cloned 3.7 kb DNA insert was transferred as a Xba-EcoRl fragment into a small size E. coli vector pMOB (Strathmann, M. et al., 1991 Proc. Natl. Acad. Sci. USA 88: 1247-1250) resulting in plasmid pMOB (RIX). The sequence of the 3.7 kb DNA insert containing the levanase gene was obtained through a commercial service of the Biotechnology

Institute of University of Helsinki. The sequence (deposited with EMBL Data Library under accession number y 12619 BSL7EL) contains an open reading frame coding for a 750 amino acid residue long polypeptide with a typical signal sequence at the N-terminus.

EXAMPLE 3 EXPRESSION OF THE L7 LEVANASE IN RECOMBINANT MICROORGANISMS Escherichia coli and Bacillus subtils were evaluated as hosts for the expression for the recombinant L7 levanase. B. subtils seemed to be the most obvious choice because of its regulatory acceptability and its ability to secrete significant amounts of proteins, especially such proteins that are derived form closely related microbes and are naturally secreted in their native host (e. g. L7 levanase). E. coli was employed because of the ease of manipulation and availability of good tools: strong promoters, stable multicopy plasmids etc.

The construction schemes leading to the levanase expression plasmids pTACL, pTAC (IL7) and pBSL700 are illustrated in Figs. 3-5. The plasmid PBSL700 expresses the pL7 levanase gene from its own promoter. <BR> <BR> <BR> <P>The plasmid pL7 is a clone from the Bacillus sp. pL7 gene library containing the levanase gene. The plasmid pGDVI was obtained from the Bacillus Genetic Stock Center (Ohio State Univ., Dept. of Biochemistry, Columbus, Ohio). Plasmid pMOB was obtained from L. Paulin, Inst. of Biotechnology.

Univ. of Helsinki.

Plasmid pTAC was used as the precursor for levanase expression plasmid construction. The plasmid pKK223-3 was purchased from Pharmacia.

The construction scheme for the plasmid pTAC (a high copy number version of the plasmid pKK223-3) was identical to that used by Hibino et al., J.

Biotechnol. 32,139-148 (1994) forthe construction of the plasmid pMK2.

Plasmid pTAC (IL7) expresses a modifie levanase gene (signal sequence coding fragment removed) intracellularly in E. coli under control of the tac promoter. pTACL has similar structure but the signal peptide region of the levanase gene is retained. E. coli transformed with this plasmid secrets a significant fraction of the expressed levanase.

The main features of the constructed expression vectors are summarized in Table 1.

TABLE 1 MAIN FEATURES OF THE LEVANASE EXPRESSION PLASMIDS HOST OR-PLASMID PRO-PARENT SIGNAL LEVANASE SECRETED GANISM MOTER VECTOR SEQUENCE PRODUCTION % mg/l CULTURE(*) E. coli pTACL Tac pUC19 Present 25-50 25-70 E. coli pTAC (IL7) Tac pUC19 Removed 30-60 0 B. subtils pBSL700 own pGDVI Present 20-40 100

(*) The expression levels are approximate figures for the standard density batch cultures grown in standard laboratory media (LB for bacterial and YEPD for yeast). The expression levels were calculated from the measured levanase activities and specific activity of the purifie levanase.

EXAMPLE 4 Large scale purification of a levanase for use in improving the filterability of sugar juice was performed by the following procedure. A strain producing levanase intracellularly (E. coli XL 1-Blue MRF 1 (stratagene transformed with plasmid pTACL) was grown at a large (approx. 60 liter) scale.

The cells were collecte by centrifugation, treated with lysozyme, sonicated and the enzyme was partly purifie by one cycle of batch adsorption- desorption on the DEAE Sephadex A-50 followed by concentration with ammonium sulfate and dialysis against 50% glycerol. About 100 mi of the enzyme preparation with activity towards levan of approx. 3000 U/ml (1U= l['TlOI2 (reducing ends) /min at 50°C and pH 5.5) was obtained. This activity corresponds to about 20 mg/ml levanase concentration. This very concentrated levanase preparation was used to confirm the earlier findings on the absence of invertase side activity in the L7 levanase. No hydrolysis of sucrose could be detected at about 1000-fold higher enzyme concentration than that used in the levanase assay described.

EXAMPLE 5 PREPARATION OF SUGAR JUICES UNDER EXPERIMENTAL CON- DITIONS Healthy beets were freeze-damaged by placing them in open cardboard boxes (about 10 kg per box) and keeping them in a freezer at-20°C for 16-20 houris. The frozen beets were then transferred to a cool storage

(+4°C) and stored there for 1-2 weeks during which significant microbial activity was initiated.

About 5 kg of beets were washed, cut into pieces and sliced mechanically into 3-4 mm thick slices. Water was added (1 liter per kg of beets) and the pH was adjusted to 7.5 with 1 M NaOH. The mixture was heated to 70°-75°C with stirring and allowed to stand at this temperature for 10 min. The juice was filtered through a coarse sieve and heated to the boiling point. The pasteurized juice was immediately either used for filtration experiments or frozen and stored at-20°C.

EXAMPLE 6 LEVANASE ACTIVITY ASSAY The rection mixture contained 1% levan (Sigma L8647) in 0. 1 M Na-maleate buffer, pH 6.0 and suitably diluted enzyme. The rection was allowed to proceed for 10 min at a temperature of from about 45°-50°C and stopped by addition of two volumes of the DNS-reagent (30% K-Na tartrate, 1.6% sodium hydroxide, 1.0% 3,5-dinitrosalicylic acid). The mixture was incubated in the boiling water bath for 10 min and the absorbance at 540 nm was recorde. A control without enzyme was always subjected to the same treatments. The amount of reducing ends was calculated from a glucose standard curve. 1 U of levanase activity is defined as the amount of enzyme that produces 1 pmole of reducing ends per min in the assay.

EXAMPLE 7 EFFECT OF LEVANASE AND DEXTRANASE TREATMENTS ON CARBONATION JUICE FILTRATION Commercially available dextranase (Amano, Dextranase L, 30,000 U/ml) or laboratory-scale preparation of L7 levanase (approx. 250 U/ml) were used. A batch of sugar juice was adjusted to 6.0 and four 0.5 liter portions were taken. These four portions (designated: K, L, D, and M) were treated for 1 h at 50°C with the following amounts of enzymes: K-no enzyme; L-5 pi levanase D-1 pI dextranase M-5 pl levanase + 1 pl dextranase.

Healthy beets were freeze-damaged and extraction juices were prepared according to Example 2 (the juices were coded FD1-FD7). Several extraction juice samples were also prepared from spoiled beets collecte from the Salo sugar mill (Finland) at the beginning of December, 1996 (these juices were coded N1-N9). Because of the mild weather conditions during the autumn of 1996, these beets were probably damaged by factors other then freezing-thawing. Therefore, they are not very representative. The extraction juices were treated with commercial dextranase, L7 endo-levanase or their combination and subjected to the Ca (OH) 2/CO2 treatment modeling the initial steps of the sugar purification process. The filtration rates of the carbonation sludge formed in the enzyme-treated juices was compare to the filtration rate of carbonation sludge from untreated juice. This assay was performed as follows.

25 ml of the Ca (OH) 2 suspension (22% CaO w/v) was added to 0.5 1 of the extraction juice. The mixture was incubated at 80°C for 1 h with occasional stirring. C02 was subsequently passed through the suspension (0.41/min) with vigorous stirring until the pH dropped to 9.0. The carbonate juice was incubated for 30 min at 80°C followed by readjusting the pH to 9.0 with tec02 and a second incubation for 1 h at 80°C. The filtration assays were done using scintered glass filters (N4, 36mm). The same set of three filters was used in each series of measurements. The filters were washed with chromic acid after each assay to ensure complete removal of calcium carbonate and organic material. Every series of experiments comprise measurements of filtration times of the four carbonation juices (K, L, D and M) prepared from the same batch of extraction juice after different enzyme treatments. For each sample, filtration times through the three different filters were averaged. The volume of the carbonation juice used in the filtration assay was constant through each series of measurements (typically 25 ml).

The filtration was performed at 80°C.

Results of these experiments are presented in Table 2 (smaller numbers correspond to faster filtration rates).

TABLE 2 The effect of enzyme treatments on carbonation juice filtration time. Enzyme Relative Filtration Time (Untreated juice = 100) treatment FD 1 FD2a FD3 FD4 (*) FD6 FD7 N1 (*) N2 (*) N3 (*) N9 No Enzyme 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 Dextranase 388. 18. 6 17.7 34. 4 60.5 78.6 14.7 6.9 4. 9 16.7 Levanase 610.88.628.481.318.890.261.599.848.746. Both enzymes 42. 5 1. 5 1. 5 471. 8 16.913.35. 0 5.8. 4 14.7

(*) Incomplete set of data was used for calculations: less then three parallel filtration time measurements were done or filtration time of some samples was too long to be measured accurately.

As Table 2 indicates, treatment with endo-levanase has a significant positive effect on carbonation sludge filtration of most sugar juice amples. In many cases levanase is more efficient than dextranase. Further, in most cases, synergy between the two enzymes is observe.

SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: Cultor Ltd.

(ii) TITLE OF INVENTION: Levan removal from sugar juice (iii) NUMBER OF SEQUENCES: 2 (iv) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.30 (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS: (A) LENGTH: 3724 base vairs (B) TYPE: nucleic acin (C) STRANDEDNESS: single (D) TOPOLOGY: linear (il) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 961.. 3213 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 : CCGACAGAGCATCCGGATGTTACGCTGTCCCGCGTCATTT60TGGAGGATGTCGTCCATT TT GTGGATGCGATCGGCATCGGCTCATTCGGCCCGATCGATT120CCTACTTCAGCGAAAAA AAT TGAAGCCCAG CAGCACTACA TACGGGTTCG TGACAACGAC GCCGAAGCAG GGCTGGGGAC 180 ATTGCGACGT GCTCGGGAAA CTGAkC-AAAC ATTATGATGT GCCATACGGT TGGC-ATACGG 240 GCGAAACGGTGTGGGGAGCGGCAAAAGGCCTGGGCAGCTG300ACGTGAACGCGGCACGT ACG CGTTTATATAGGTCGGCGTATATGCCGAAGGCAGGCTCGT360CCGGCGTAGG CCATGGACTG GTTCATCCGG AGACGCCATCCTGACGATCA420TGTCCTGATA ATATGCAGGG GCTTGTCCTT ATCACGGAGA TTGCTTCC-AG GGCATGGCTG CCGGCCCGGC 480 C-ATCGAkGCG CGCTGGGGCG TGAP. AGGCGA TCAGCTGCCG GCAGhCCACC CGGCCTGGCC 5a0 TATGGAAGCC TACTATATCG CCCAGGCCGT TGCAGGGATC ATTTTGACGC ATTCCCCGGA 600 GAAGATCATT CTGGGCGGCG GCGTCATGCA GCAGGCCCAT CTGTTTCCGC TGGTCCGTTC 660 CGAAGTTCAA CGGATATTAA ACGGCTATGT GCAGGCGGAT GAAATTATGA ACCGGATCGA 720 GGAATATATC ATTCCACCCG GTTTGGGCTC TCAAGCCGGA CTTTACGGTG CGCTGGCACT 780 GGGATTAA. AG GCGATTCAAG ACCGCCGTTC CGCCGTTTAG CAGCGATTTC TTATGCGATG 840 AGCTTTCGTCATAGGGACGGGGAAGATTACGAAAAAGGAG900GCTGCTCTGCCAGGCAG GGC TGCAAGATCA TCAGCTGCC-A ATAGGGAAGT TTTAAATACA AGGTTGGATT TGGAGGGAGT 960 ATG ATG AAA TGG TTC GCA AAA TTA ATC CTG TCT CTA AGC TTG GCT GTC 1008 Met Met Lys Trp Phe Ala Lys Leu Ile Leu Ser Leu Ser Leu Ala Val 1 5 10 15 GTG ATG GCT GCT TCG AGC GCT GCA ATA TCG TTC GGC GCT TCC AAT TCG 1056 Val Met Ala Ala Ser Ser Ala Ala Ile Ser Phe Gly Ala Ser Asn Ser 20 25 30 AGC TTG GAT ACC CAT GCC AGT TTG GTT ACC CAG CTG GAC AGC GCA GCT 1104 Ser Leu Asp Thr His Ala Ser Leu Val Thr Gln Leu Asp Ser Ala Ala 35 40 45 TCG C-PA GCT GCA G. 1A GGG PlA AGC GCG ATG ATT AAT GAA AGC GCA ATC 1152 Ser Glu Ala Ala Glu Gly Lys Ser Ala Met Ile Asn Glu Ser Ala Ile 50 55 60 SAC TCG A-AT GTA ACG GGA TGG A-AG CTG CAT GGC P. A GGG CGG ATG GAG 1200 Asn Ser Asn Val Thr Gly T=-Lys Leu His Gly Lys Gly Arg Met Glu 65 70 75 80 GTA ACA GGG GAG GGA CTT CGG CTA ACA TCG GANT CCG CAA GAG A.-T GTG 1248 Val Thr Gly Glu Gly Leu Ars Leu Thr Ser As ? Pro Gln Glu Asn Val 85 90 95 ATG GCC ATA TCG GAA ACG GTC GCC GAC GAT TTT ATT TAT GAG GCC GAT 1296 Met Ala Ile Ser Glu Thr Val Ala Asp Asp Phe Ile Tyr Glu Ala Asp 100 105 110 GTT ATG GTA ACG GAT CCC CAG GCA C-ART GCC ACC CTT CTG TTC CGC TCC 1344 Val Met Val Thr Asp Pro Gln Ala Asp Ala Thr Leu Leu Phe Arg Ser 115 120 125 GGT GAA GAC GGG TGG AGC TCG TAC ATG CTG CAG CTC GCT CTC GGT GCC 1392 Gly Glu Ases Gly Trp Ser Ser Tyr Met Leu Gln Leu Ala Leu Gly Ala 130 135 140 GGC GTT ATC CC-C CTG AAG GAT GCT AC-C GGC GGG G-A-k GGT GTC CTT AAT 1440 Gly Val. Ile Arg Leu Lys Asp Ala Ser Gly Gly Glu Gly Val Leu Asn 145 150 155 160 GTC GSA CGG-AAG GTC GAA GCG A-A-k CCG GGA G ? 1C ATA TAC CAT CTA AGA 1488 Val Glu Arg Lys Val Glu Ala Lys Pro Gly Asp Ile Tyr His Leu Arg 165 170 175 GTC AAA GCG GAA GGA ACC CGG CTT CAG GTT TAC TGG GGG CAG CAA TAT 1536 Val Lys Ala Glu Gly Thr Arg Leu Gln Val Tyr T= Gly Gln Gln Tyr 190180185 GAA CCG GTC ATT C-AT ACG GAA GCC GCT GCG CAT CGG ACG GGC CGC CTC 1584 Glu Pro Val Ile Asp Thr Glu Ala Ala Ala His Ars Thr Gly Arg Leu 195 200 205 GGG CTG CAC GTC TGG AAC GGT TCA GCG CTG TTT CAA AAC ATC CGG GTC 1632 Gly Leu His Val Trp Asn Gly Ser Ala Leu Phe Gln Asn Ile Arg Val 210 215 220 AGC GAT ATG TCT GI-7C A-kT ACG TTG GAG CCC ATC TCC TCC CAA GGA TTA 1680 Ser Asp Met Ser Gly Asn Thr Leu Glu Pro Ile Ser Ser Gln Gly Leu 225 230 235 240 TGG CAG CCG GAT TTG AAG GGG CTC AGA GGC ACG GGA GAG GAC GGG CTG 1728 Trp Gln Pro Asp Leu Lys Gly Leu Lys Gly Thr Gly Glu Asz Gly Leu 245 250 255 GAA GCC AAG APA GTA TTC CGG AP. C CAT GAG GCG GAT GTT GTG CTT C-AA 1776 Glu Ala Lys Lys Val Phe Arg Asn His Glu Ala Asc Val Val Leu Glu 260 265 270 GC-C GAT CTG ATC CTG AAC GGG CAA GGC TCG GCC GGC TTA TTA TTC AGA 1824 Gly Asp Leu Ile Leu Asn Gly Gln Gly Ser Ala Gly Leu Leu Phe Arg 275 280 285 AGC AkT GCG CAG GGA ACG GP. A GGG TAT GCC GCT GTT CTT CAG GC-A GAG 1872 Ser Asn Ala Gln Gly Thr Glu Gly Tyr Ala Ala Val Leu Gln Gly Glu 290 295 300 GGG GAG CGG GTA AGG GTC TAT TTA AAA AAG GCC GAC GGG ACG ATC CTT 1920 Gly Glu Arg Val Arg Val Tyr Leu Lys Lys Ala Asp Gly Thr Ile Leu 305 310 315 320 CAC C-Ak TCC CGT GTG ACT TAT CCG AGT CAA CGG C-PA AGC CGG CAT CAT 1968 His Glu Ser Ars Val Thr Tyr Pro Ser Gln Arg Glu Ser Arg His His 325 330 335 CTG C-AA GTA AAA GCG ATC GGG GP. A CGG ATT CAA ATA TTC GTA GAC GGT 2016 Leu Glu Val Lys Ala Ile Gly Glu Ars Ile Gln Ile Phe Val Asp Gly 340 345 350 TAT C-AG CCG GCT GCG ATC C-AC ATG GTC GAT ACG GCC TTC CCT AGC GC-A 2064 Tyr Glu Pro Ala Ala Ile Asp Met Val Asm Thr Ala Phe Pro Ser Gly 355 360 365 TAT CAC GGT GTT ATG GCC AGC TCC GGA ATC GCT TAT TTT CAA GAC GTT 2112 Tyr His Gly Val Met Ala Ser Ser Gly Ile Ala Tyr Phe Gln Asp Val 370 375 380 TAT ATA ACG CCC TAT GCC AGC TAC TAT ACC GAG AAG TAT CGG CCG CAG 2160 Tyr Ile Thr Pro Tyr Ala Se- Tyr Tyr Thr Glu Lys Tyr Arg Pro Gln 385 390 395 400 TAT CAT TAC AGT CCG ATT CGG GGC TCG GCA AGC GAT CCG SAC GC-A CTG 2208 Tyr His Tyr Ser Pro Ile Arg Gly Ser Ala Ser Asn Pro Asn Gly Leu 405 410 415 GTA TAT TTT GAA GGG GAG TAT CAT CTC TTT CAC CAG GAC GGC GGA CAG 2256 Val Tyr Phe Glu Gly Glu Tyr His Leu Phe His Gln Asp Gly Gly Gln 420 425 430 TGG GCG CAT GCT GTC AGC CGG GAT CTG ATT CAT TGG AAA CGG CTG CCG 2304 Trp Ala His Ala Val Ser Arg Asp Leu Ile His Trp Lys Ars Leu Pro 435 440 445 ATT GCC CTG CCA TGS AAT GAT CTC GGi CAT GTC TGG TCC GC-C TCC GCG 2352 Ile Ala Leu pro Trp Asn Asp Leu Gly His Val GlySerAlaSer 450 455 460 <BR> <BR> <BR> <BR> GTT GCC GAT ACA ACG AAC GCT TCG GGT TTG TTC GGA AGC TCC GGA GGC 2400 Val Ala Asp Th-Thr Asn Ala Ser Gly Leu Phe Gly Ser Ser Gly Gly 465 470 475 480 AP. GGA CTG ATC C-CC TAC TAT ACC TCC TAC ABAT CCG GAC CGG CAT SAC 2448 Lys Gly Leu Ile Ala Tyr Tyr Thr Ser Tyr Asn Pro Asp Arg His Asn 485 490 495 GGC AAT CAA AAA ATC GGT CTT GCG TAC AGC ACC GAC CGC GGG CGG ACT 2496 Gly Asn Gln Lys Ile Gly Leu Ala Tyr Ser Thr Asp Arg Gly Arg Thr 500 505 510 TGG AAG TAC TCG G. 3A GAG CAT CCC GTT GTC ATT GAA AAT CCG GGG AAG 2544 Trp Lys Tyr Se~ Glu Glu His Pro Val Val Ile Glu Asa Pro Gly Lys 515 520 525 ACC GGC GAG GAT CCG GGC GGA TGG GAT TTC CGC GAT CCG AkG GTC GTC 2592 Thr Gly Glu Ase po Gly Gly Trp Asp Phe Ars Asp Pro Lys Val Val 530 535 540 CGG GAT GAG GCC AAT AAT CGC TGG GTG ATG GTT GTA TCG GGC GGC C-AC 2640 Arg Asp Glu Ala Asn Asa Arg Trp Val Met Val Val Ser Gly Gly Asp 545 550 555 560 CAT ATC CGG TTG TTC ACC TCT ACC AAT CTG CTG AAT TGG ACC TTG ACC 2688 His Ile Arg Leu Phe Thr Ser Thr Asn Leu Leu Asn Trp Thr Leu Thr 565 570 575 GAT CAA TTC GGA TAC GGA GCT TAC ATC CGC GGA GGC GTA TGG GAA TGT 2736 aSp Gln Phe Gly Tyr Gly Ala Tyr Ile Arg Gly Gly Val Trp Glu Cys 580 585 590 CCG GAC CTG TTT CAG CTT CCG GTC GAA GGG AGC AAA AAG CGC AAA TGG 2784 Pro Asp Leu Phe Gln Leu Pro Val Glu Gly Ser Lys Lys Arg Lys Trp 595 600 605 GTG CTG ATG ATC AGC ACC GGT GCC P. AT CCG AAC ACG CAG GGC TCC GAT 2832 Val Leu Met Ile Ser Thr Gly Ala Asn Pro Asn Thr Gln Gly Ser Asp 610 615 620 GCC GAA TAT TTC ATC GGT GAC TTG ACG CCC GAA GGC AAA TTC ATT A. A. C 2880 Ala Glu Tyr Phe Ile Gly Asp Leu Thr Pro Glu Gly Lys Phe Ile Asn 625 630 635 640 GAC AAT CCG GCA GGC ACT GTC CTG AAG ACG GAT TGG GGC AXA GAZ TAC 2928 Asp Asn Pro Ala Gly Thr Val Leu Lys Thr Asp Trp Gly Lys Glu Tyr 645 650 655 TAT GCA TCG ATG TCT TTC TCC C-AT ATG CCG GAC GG^v CGA AGA ATC ATG 2976 Tyr Ala Ser Met Ser Phe Ser Asp Met Pro Asp Gly Ars Ars Ile Met 660 665 670 CTG GCC TGG ATG ACC AAT TGG GAT TAT CCG TTC AGC TTT CCG ACA ACG 3024 Leu Ala Trp Met Thr Asn Trp Asp Tyr Pro Phe Ser Phe Pro Thr Thr 685675680 GGG TGG AAG GGG CAG CTG AGC ATT CCG AGA CAA GTG TCG CTT GAG GAG 3072 Gly Trp Lys Gly Gln Leu Ser Ile Pro Ars Gln Val Ser Leu Lys Glu 700690695 ACG GAG GAG GC-A ATC CGG ATG CAT CAG ACT CCG ATT GAA GAG CTC GCT 3120 Thr Glu Glu Gly Ile Arg Met His Gln Thr Pro Ile Glu Glu Leu Ala 705 710 715 720 CAG CTC CC-A AGC CCC GTT CTG CAC ATC ACC AAC CGC GAG GTG GGG GAC 3168 Gln Leu Arg Ser Pro Val Leu His Ile Thr Asn Arg Glu Val Gly Asp 725 730 735 TTC CGG CGA AAA TCT GCT CA. CAC ATC AGG CGC TTA TGA 3213 Phe Arg Arg Lys Ser Ala Gln Arg Asp His Ile Arg Ars Leu * 740 745 750 AATCGAGGCG GAGCTGGAGC TGCCGCCP. AC CGGAGCCGCC TCCGAATTTG GGTTCCGGCT 3273 GCGTGAAGGT GACGGGCAGA GGACGCTTGT CGGTTACCGC GCAGCCGGCA GCAAGATGTT 3333 CGTAGACCGC TCCGCATCCG GCATC-ACGC-A TTTCTCGGAC TTGTTCTCTA CGCTGCACGA 3393 AGCCCCGCTC AAGCCTGAAG GCAACCGGAT CAAGCTGCGA ATATTGGTGG ATGAATCCTC 3453 GGTAGAAGTG TTCGGCAATG ACGC-CAGC-GT CGTATTCTCC GATGTCATCT TCCCGGATCC 3513 GGCCAC-CAGA GGCATGAGCT TTTACAGTGA GGGCGGGAAG GTGAAGGTGG TATCGCTTCA 3573 TTTGGAGGGAGGATGAGGCGAAAGAGCCGCGGGTCGTTAT3633AGTCCATGCATTGCAG CATA GGATACCGAG ACGCTTGAGC TATCCTTGGG ACAGACCAAA CCGCTCTTTG CTTCCATTGA 3693 TAACGGACAG GGTP. AAGGGG CAGACGGGAT C 3724 (2) INFORMATION FOR SEQ ID NC: 2: (i) SEQUENCE CHARACTERISTICS : (A) LENGTH: : 751 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Met Met Lys Trp Phe Ala Lys Leu Ile Leu Ser Leu Ser Leu Ala Val 1 5 10 15 Val Met Ala Ala Ser Ser Ala Ala Ile Ser Phe Gly Ala Ser Asn Ser 20 25 30 Ser Leu Asp Thr His Ala Ser Leu Val Thr Gln Leu Asp Ser Ala Ala 35 40 45 Ser Glu Ala Ala Glu Gly Lys Ser Ala Met Ile Asn Glu Ser Ala Ile 50 55 60 Asn Ser Asn Val Thr Gly Trp Lys Leu His Gly Lys Gly Ars Met Glu 65 70 75 so Val Thr Gly Glu Gly Leu Arg Leu Thr Ser Asp Pro Gln Glu Asn Val 85 90 95 Met Ala Ile Ser Glu T. m-r Val Ala Asp Asp Phe Ile Tyr Glu Ala Asp 100 105 110 Val Met Val Thr Asp Pro Gln Ala Ase alla Thr Leu Leu Phe Arg Ser 115 120 125 Gly Glu Asp Gly T r--o Ser Ser Tyr Met Leu Gln Leu Ala Leu Gly Ala 130 135 140 Gly Val Ile Arg Leu Lys Asp Ala Ser Gly Gly Glu Gly Val Leu Asn 145 150 155 160 Val Glu Arg Lys Val Glu Ala Lys Pro Gly Asp Ile Tyr His Leu Arg 165 170 175 Val Lys Ala Glu Gly Thr Arg Leu Gln Val Tyr T---,) Gly Gln Gln Tyr 180 185 190 Glu Pro Val Ile Aso Thr Glu Ala Ala Aia : iis Arg Thr Gly Arg Leu 195 200 205 Gly Leu His Val Trp Asn Gly Ser Ala Leu Phe Gln Asn Ile Arg Val 210 215 220 Ser Asp Met Ser Gly Asn Thr Leu Glu Pro Ile Se- Ser Gln Gly Leu 225 230 235 240 Trp Gln Pro Asp Leu Lys Gly Leu Lys Gly Thr Gly Glu Asp Gly Leu 245 250 255 Glu Ala Lys Lys Val Phe Arg Asn His Glu Ala Ass Val Val Leu Glu 260 265 270 Gly Asp Leu Ile Leu Asn Gly Gln Gly Ser Ala Gly Leu Leu Phe Arg 275 280 285 Ser Asn Ala Gln Gly Thr Glu Gly Tyr Ala Ala Val Leu Gln Gly Glu 290 295 300 Gly Glu Arg Val Arg Val Tyr Leu Lys Lys Ala Asp Gly Thr Ile Leu 305 310 315 320 His Glu Ser Arg Val Thr Tyr Pro Ser Gln Arg Glu Ser Arg His His 325 330 335 Leu Glu Val Lys Ala lie Gly Glu Arg Ile Gon tale Phe Val Asp Gly 340 345 350 Tyr Glu Pro Ala Ala Ile Asp Met Val Asp Thr Ala Phe Pro Ser Gly 355 360 365 Tyr His Gly Val Met Ala Ser Ser Gly Ile Ala Tvr Phe Gln Asp Val 370 375 380 Tyr Ile Thr Pro Tyr Ala Ser Tyr Tyr Thr Glu Lys Tyr Arg Pro Gln 385 390 395 400 Tyr His Tyr Ser Pro Ile Ars Gly Ser Ala Ser Asz Pro As-i Gly Leu 405 410 415 Val Tyr Phe Glu Gly Glu Tyr His Leu Phe His Gln Asp Gly Gly Gln 420 425 430 Trp Ala His Ala Val Ser Art as Leu Ile His T= Lys Arg Leu Pro 435 440 445 Ile Ala Leu Pro Trp Asn As ? Leu Gly His Val T Ser G1y Ser Ala 450 455 460 Val Ala Asp Thr Thr Asn Ala Ser Gly Leu Phe Gly Ser Ser Gly Gly 465 470 475 480 Lys Gly Leu Ile Ala Tyr Tyr Thr Ser Tyr Asn Pro Asp Arg His Asn 485 490 495 Gly Asn Gln Lys Ile Gly Leu Ala Tyr Ser Thr Asp Ars Gly Arg Thr 500 505 510 Trp Lys Tyr Ser Glu Glu His Pro Val Val Ile Glu Asn Pro Gly LYS 515 520 525 Thr Gly Glu Asp Pro Gly Gly Trp Asp Phe Arg Asp Pro Lys Val Val 530 535 540 Arg Asp Glu Ala Asn Asn Arg Trp Val Met Val Val Ser Gly Gly Asp 545 550 555 560 His Ile Arg Leu Phe Thr Ser Thr Asn Leu Leu Asn Trp Thr Leu Thr 565 570 575 Asp Gln Phe Gly Tyr Gly Ala Tyr Ile Arg Gly Gly Val Trp Glu Cys 580 585 590 Pro Asp Leu Phe Gln Leu Pro Val Glu Gly Ser Lys Lys Arg Lys Trp 595 600 605 Val Leu Met Ile Ser Thr Gly Ala Asn Pro Asn Thr Gln Gly Ser Asp 610 615 620 Ala Glu Tyr Phe Ile Gly Asp Leu Thr Pro Glu Gly Lvs Phe Ile Asn 625 630 635 640 Asp Asn Pro Ala Gly Thr Val Leu Lys Thr Asp Trp Gly Lys Glu Tyr 645 650 655 Tyr Ala Ser Met Ser Phe Ser Asp Met Pro Asp Gly Arg Arg Ile Met 660 665 670 Leu Ala Trp Met Thr Asn Trp Asp Tyr Pro Phe Ser Phe Pro Thr Thr 675 680 685 Gly Trp Lys Gly Gln Leu Ser Ile Pro Arg Gln Val Ser Leu Lys Glu 690 695 700 Thr Glu Glu Gly Ile Arg Met His Gln Thr Pro Ile Glu Glu Leu Ala 705 710 715 720 Gin Leu Arg Ser Pro Val Leu His Ile Thr Asn Arg Glu Val Gly Asp 725 730 735 Phe Arg Arg Lys Ser Ala Gln Arg Asp His Ile Arg Arg Leu * 740 745 750