METHODS FOR EFFICIENT GENERATION OF GABAergic

INTERNEURONS FROM PLURIPOTENT STEM CELLS

CROSS REFERENCE TO RELATED APPLICATIONS

[001] This application claims benefit under 35 U.S. C. 119(e) of U.S. Provisional Patent Application Serial No. 61/901,541 filed on November 08, 2013, and U.S. Provisional Patent Application Serial No. 62/053,535 filed on September 22, 2014, the contents of each are incorporated herein incorporated by reference in their entity.

FIELD OF INVENTION

[002] One aspect of the present invention relates to an enhanced method for the generation of medial ganglionic eminence (MGE) cells from pluripotent stem cells. The method comprises a step of contacting the differentiating cells with an activator of FGF8 signaling. Another aspect of the present invention relates to the suppression of seizures in a subject by transplantation of MGE cells, or GABAergic interneurons, that are derived from human pluripotent stem cells. Also provided are methods for the isolation of MGE cells and interneurons from differentiation progenies of pluripotent stem cells.

BACKGROUND

[003] During early development, cortical interneuron progenitors arise from the ventral telencephalic area such as Medial Ganglionic Eminence (MGE) and Caudal Ganglionic Eminence (CGE) (Wonders CP, Anderson SA. Nat Rev Neurosci. 2006, 7: 687-696). Among these, MGE progenitors mostly generate parvalbumin-expressing interneurons or somatostatin-expressing interneurons comprising about 65% of the entire cortical interneuron population, whereas CGE cells mostly generate calretinin- expressing interneurons (Tamamaki N, et al. J Comp Neurol. 2003, 467:60-79).

[004] GABAergic interneurons regulate cortical neural networks by providing

inhibitory inputs, and their malfunction, resulting in failure to intricately regulate neural circuit balance, is implicated in brain diseases such as Schizophrenia, Autism and Epilepsy. During early development, GABAergic interneuron progenitors arise from the ventral telencephalic area such as Medial Ganglionic Eminence (MGE) and caudal ganglionic eminence (CGE) by the actions of secreted signaling molecules from nearby organizers, and migrate to their target sites where they form local synaptic connections.

[005] Methods for the generation of MGE cells from human pluripotent stem cells (hPSCs) are known in the art, however such methods do not consistently generate a large population of MGE cells (Nicholas CR, et al. Functional Maturation of hPSC- Derived Forebrain Interneurons Requires an Extended Timeline and Mimics Human Neural Development. Cell Stem Cell. 2013, 12:573-586; Maroof AM, et al. Directed differentiation and functional maturation of cortical interneurons from human embryonic stem cells. Cell Stem Cell. 2013, 12:559-572; and Liu Y, et al. Medial ganglionic eminence-like cells derived from human embryonic stem cells correct learning and memory deficits. Nat Biotechnol. 2013, 31 :440-447).

[006] Accordingly, there remains a need in the art for efficient and consistent

generation of MGE cells, which will lead to a better safety profile in therapeutic treatment, as MGE cells can be further differentiated into GABAergic interneurons. Dysfunction of interneurons has been implicated in various brain diseases such as Epilepsy, Schizophrenia and Autism (Arber CE, Li M. Frontiers in Cellular

Neuroscience 2013, 7), which are conditions awaiting more effective treatments. In addition, defined populations of MGE cells are a valuable resource for disease modeling and therapeutic screening.

SUMMARY

[007] Herein we show that sonic hedgehog (SHH) activation during early human neural development elicits a pleiotropic downstream cascade, by inducing rostralizing FGF8 signaling as well as caudalizing FGF15/19 signaling, as observed during early mouse development. The dual effect of SHH on rostral-caudal boundary

determination causes medial ganglionic eminence (MGE) derivation stochasticity depending on the fine balance of its downstream cascade. Thus, we tested the combination of early activation of SHH with the addition of an exogenous activator of FGF8 signaling (e.g. exogenous rostralizing factor FGF8) during differentiation of pluripotent stem cells, and assessed the effect on differentiation of the population of pluripotent stem cells. We have identified that adding exogenous activator of FGF8 consistently results in >80% by FACS of MGE cells from multiple hPSCs. The MGE cells generated share characteristics with their in vivo counterpart, such as

spontaneous differentiation into Lhx6-expressing and migrating GABAergic interneurons that can generate GAB A, fire action potentials and form functional GABAergic synaptic connections. Transplantation of human MGE cells into rodent brains yields well-contained neural grafts enriched with GABAergic interneurons that migrate in the host brain and mature to express somatostatin or parvalbumin. Thus, one aspect of the invention provides an enhanced method for the production of MGE cells from a population of pluripotent stem cells. The enhanced method adds an additional step to the basic differentiation protocol that uses a SMAD inhibitor to drive the cells towards neuroectoderm, and an activator of sonic hedgehog to drive the cells to differentiate into ventral telencephalic neuroectoderm. The additional step comprises contacting the pluripotent stem cells with an exogenous activator of FGF8 signaling during the differentiation protocol. The method represents a novel tool for generation of MGE cells for therapeutic use, and for use in developmental studies, disease modeling, bioassays, and drug screening.

[008] In addition, herein we demonstrate, for the first time, that transplantation of MGE cells derived from pluripotent stem cells successfully mature into GABAergic neurons, migrate throughout the hippocampus, and integrate into the host neural circuitry allowing receipt of excitatory inputs, and release of GABA that induces inhibition of spontaneous seizures. Accordingly, another aspect of the invention provides methods for suppression of seizure activity in a subject comprising administering MGE cells derived from pluripotent stem cells into a subject in need of treatment.

[009] In one aspect of the invention a method for the generation of a population of medial ganglionic eminence (MGE) cells from pluripotent stem cells is provided. The method comprises the steps of a) contacting a population of pluripotent stem cells with a SMAD inhibitor to generate a population of cells that express the

neuroectoderm cell marker Pax6, b) contacting the cells of step a) with an activator of sonic hedgehog (SHH) to generate a population of cells that express ventral telencephalic neuroectoderm marker FoxGl; and c) contacting the cells of step b) with an activator of FGF8 signaling to produce a population of cells that comprises an increased percentage of MGE cells that express the transcription factor NKX2.1 as compared to cells of step b) that have not been contacted with the FGF8 activator.

[0010] In certain embodiments, 50% or greater of the cells in the population of step c) express the MGE cell marker NKX2.1. In one embodiment, 60% or greater of the cells in the population of step c) express the MGE cell marker NKX2.1. In one embodiment, 70% or greater of the cells in the population of step c) express the MGE cell marker NKX2.1. In one embodiment, 80% or greater of the cells in the population of step c) express the MGE cell marker NKX2.1.

[0011] In certain embodiments, 10%> or less of the cells in the population of step c) express, the caudal ganglionic eminence (CGE) cell marker, CoupTFII. In certain embodiments, less 20%> or less, 25% or less, or 30%> or less, of the cells in the population express the caudal ganglionic eminence (CGE) cell marker, CoupTFII.

[0012] In one embodiment, the MGE cells further express the transcription factor 01ig2.

[0013] In one embodiment, the activator of FGF8 signaling is exogenous FGF8

protein, or an exogenous peptidomimmetic of FGF8 protein.

[0014] In one embodiment, the MGE cells are capable of differentiating into

GABAergic interneurons that express Lhx6 protein and Sox6.

[0015] In one embodiment, the activator of sonic hedgehog is smoothened agonist

(SAG).

[0016] In one embodiment, the inhibitor of SMAD comprises LDN193189 and

SB431542.

[0017] In one embodiment, the pluripotent stem cells are human cells.

[0018] In one embodiment, the pluripotent stem cells are embryonic stem cells.

[0019] In one embodiment, the pluripotent stem cells are induced pluripotent stem cells.

[0020] In one embodiment, pluripotent stem cells are cultured as embryoid bodies.

[0021] In one embodiment, the pluripotent stem cells are cultured in suspension.

[0022] In one embodiment, the pluripotent stem cells are cultured as adherent cells.

[0023] In one embodiment, the method further comprises contacting the population of pluripotent stem cells with an inhibitor of Wnt. [0024] In one embodiment, the method further comprises differentiating the population of cells comprising MGE cells into GABAergic interneurons that express the cell marker Lhx6 and Sox6.

[0025] In one embodiment, the MGE cells are differentiated by culturing the MGE for a time sufficient to allow for the MGE cells to spontaneously differentiate into

GABAergic interneurons.

[0026] In one embodiment, the GABAergic interneurons generates GABA.

[0027] In one embodiment, the GABAergic interneurons further differentiate to

express somatostatin or parvalbumin.

[0028] In one embodiment, the population of MGE cells are further enriched for

MGE cells, for example by selecting for and isolating the MGE cells from the population.

[0029] In another aspect of the invention, methods are provided for treatment of a neurological disorders comprising administering to a subject in need of treatment the isolated population of MGE cells obtained by a method of generation of a population of medial ganglionic eminence (MGE) cells from pluripotent stem cells. The method comprises the steps of a) contacting a population of pluripotent stem cells with a SMAD inhibitor to generate a population of cells that express the neuroectoderm cell marker Pax6, b) contacting the cells of step a) with an activator of sonic hedgehog (SHH) to generate a population of cells that express ventral telencephalic

neuroectoderm marker Dlxl; and c) contacting the cells of step b) with an activator of FGF8 signaling to produce a population of cells that comprises an increased percentage of MGE cells that express the transcription factor NKX2.1 as compared to cells that have not been contacted with the FGF8 activator.

[0030] In one embodiment, the subject in need of treatment is diagnosed as having seizures, or as having a neurological disorder selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, neuropathic pain, epilepsy, autism, and schizophrenia,

[0031] In one embodiment, the pluripotent stem cells are allogenic cells.

[0032] In one embodiment, the cells are administered by transplantation.

[0033] In yet another aspect of the invention, methods for suppression of spontaneous seizure activity in a subject are provided. The methods comprise administering MGE cells derived from pluripotent stem cells to a subject in need of treatment, e.g. MGE cells obtained by the method of a) contacting a population of pluripotent stem cells with a SMAD inhibitor to generate a population of cells that express the

neuroectoderm cell marker Pax6, b) contacting the cells of step a) with an activator of sonic hedgehog (SHH) to generate a population of cells that express ventral telencephalic neuroectoderm marker Dlxl .

[0034] In one embodiment, the subject is diagnosed as having epilepsy.

[0035] In one embodiment, the MGE cells are derived from human pluripotent stem cells.

[0036] In one embodiment, the MGE cells are derived from induced pluripotent stem cells.

[0037] In one embodiment, the MGE cells are derived from embryonic pluripotent stem cells.

[0038] In one embodiment, the pluripotent stem cells are allogenic cells.

[0039] In one embodiment, the MGE cells are further differentiated into GABAergic interneurons that express Lhx6 and Sox6 prior to administration to the subject.

[0040] In one embodiment, the population of MGE cells are further enriched for

MGE cells, for example by selecting for and isolating the MGE cells from the population.

[0041] In one embodiment, the cells are administered by transplantation.

[0042] BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figures la to lc are graphs showing directed differentiation of human PSCs into ventral telencephalic phenotype. Figure la, strong SHH signaling directs differentiating human H9 cells into MGE phenotype, assayed by

immunocytochemistry and cell counting after 25 days of differentiation (Mean + S.E.M.; n=4, P<0.05, two tailed t-test). MGE derivation was optimized from H9 cells by various combinations and timing of signaling activation, assayed by flow cytometry analysis after 25 days of differentiation. Fig. lb, real time PCR analysis of differentiating ES cells with or without 3 days' treatment with SAG (Mean + S.E.M.; n=4, P<0.05, two tailed t-test). Figure lc, FGF8 signaling further induced MGE phenotype at the expense of the CGE phenotype as shown by immunocytochemistry and cell counting analysis (Mean + S.E.M.; n=3, P<0.05, two tailed t-test). White scale bar: ΙΟΟμιη. [0044] Figures 2a to 2b are graphs depicting optimization of MGE derivation from PSCs. H9 hESCs were differentiated with LDN193189 and SB431542 as floating spheres and analyzed by whole mount immunocytochemistry at day 3 and day 7. Using this protocol, neuroectoderm starts to appear as early as d3, shown by Pax6 staining, and by day 7, the majority of cells express Pax6. (data not shown). Fig. 2a, real time PCR analysis of different treatment conditions, assayed after 25 days of differentiation (Mean + S.E.M.; n=4, P<0.05, two tailed t-test). Fig. 2b, SAG treatment during the 3rd week further enhanced MGE derivation, assayed after 25 days of differentiation (Mean + S.E.M.; n=3, P<0.05, two tailed t-test).

[0045] Figures 3a to 3c are graphs showing that FGF8 and FGF19 regulate

rostral/caudal identity of ventral telencephalic cells. Fig. 3a, FGF8 treatment induces MGE phenotype while FGF19 induces CGE phenotype, shown by

immunocytochemistry (not shown) and cell counting analysis after 3 weeks of differentiation (Mean + S.E.M.; n=3, P<0.05, two tailed t-test). No effect on diencephalic differentiation by FGF19 immunocytochemistry (not shown). Fig. 3b-3c FGF8 treatment increases FGF19 expression, but FGF19 treatment does not affect FGF8 expression. Real time PCR analysis of differentiating ES cells (Mean + S.E.M.; n=3, P<0.05, two tailed t-test).

[0046] Figures 4a to 4c show the optimized MGE derivation protocol efficiently

generates MGE cells from multiple PSC lines. Fig. 4a, a schematic overview of optimized MGE derivation protocols. Fig 4b, a graph gene expression analysis during MGE derivation of H9 cells, assayed by real time PCR (Mean + S.E.M.; n=3).

Combined and temporal treatment with IWP2, SAG and FGF8 results in robust induction of MGE cells from H9 and H7 hESCs as well as iPSC2497, assayed after 25 days of differentiation (immunocytochemistry, data not shown). Fig. 4c, FACS analysis of MGE generation of H9 cells after Nkx2.1 staining. Derived cells highly express independent ventral telencephalic marker 01ig2 and telencephalic marker FoxGl, assayed after 25 days of differentiation (immunocytochemistry, data not shown).

[0047] Figures 5 a to 5b are graphs indicating that human MGE cells generate

GABAergic interneurons. Fig 5 a, combined and temporal treatments with IWP2, SAG and FGF8 generate mostly GABAergic neurons from differentiating H9 cells, whereas in the absence of such treatment, few cells become GABAergic neurons. Immunocytochemistry and cell counting analysis after 6 weeks of differentiation (Mean + S.E.M.; n=4, P<0.05, two tailed t-test). H7 and iPSC2497-derived MGE cells also generate GABAergic neuron-enriched cultures (immunocytochemistry data not shown). Fig 5b, human PSC-derived MGE cells generate Lhx6+ neurons (Mean + S.E.M.; n=4, P<0.05, two tailed t-test. s. Human PSC-derived MGE cells generate Sox6+ GABAergic neurons. Some MGE-derived cells express Calbindin,

Parvalbumin or Somatostatin (immunocytochemistry data not shown).

[0048] Figures 6a to 6d indicate the migration property of human MGE cells. MGE or Cortical spheres derived from H9 hESCs were plated on Matrigel substrate and analyzed 5 days after plating by brightfield microscopy or immunocytochemistry (images not shown). Fig. 6a, Quantification of migrating cell numbers per sphere after 5 days in culture on Matrigel. Migrating cell numbers were normalized to total cell numbers in the sphere (Mean+S.E.M.; n=3, P<0.05, two tailed t-test). Fig. 6b, Image software was used to assess each cell migration distance between the edge of the sphere and the center of the migrating cell body (Mean+S.E.M.; n=3, P<0.05, two tailed t-test). Fig. 6c, Schematic of transplantation of control and MGE spheres (dotted circle) into the ventral telencephalon. The dotted line points to route of migration of cells that emanated from the spheres. Dotted squares outline panels/areas in which the numbers of migrating cells were quantified. Low magnification images (4.2x) of control and MGE sphere transplantations into El 3.5 CD1 telencephalon were taken (data not shown). Many cells were located close to the site of control sphere transplantation, and few cells were observed migrating from ventral to dorsal telencephalon. There was a decreased cell migration into dorsal telencephalon. In MGE sphere transplantation, many QDot® labeled cells migrated into the dorsal telencephalon. Images (lOx, 3 OX and 60X images) of the dorsal telencephalon were also taken (data not shown) showing cells labeled with QDot® nanocrystals and anti- NCAM. Fig. 6d, Quantification of relative NCAM positive cell numbers from cortical and MGE spheres in three panels of the telencephalon, after normalization using the average total cell numbers from parallel control and MGE spheres (*P< 0.001, n=7).

[0049] Figures 7a to 7b show graphs depicting migration analyses on mouse E14 cortical or MGE explant culture. Cortical or MGE explants were placed on thin layer of matrigel substrate and analyzed for 2 dimensional migration 5 days after plating by brightfield microscopy. Fig. 7a, Quantification of migrating cell numbers per total cell numbers in each sphere after 5 days in culture on Matrigel (Mean + S.E.M.; n=4, P<0.05, two tailed t-test). Fig 7b, ImageJ software was used to assess each cell migration distance between the edge of the sphere and the center of the migrating cell body (Mean + S.E.M.; n=3, P<0.05, two tailed t-test). Mouse MGE explant or human MGE spheres were embedded in matrigel substrate and their 3 dimensional migrations were analyzed 2 days after embedding (data not shown).

0] Figures 8a to 8f show functional properties of H9 MGE-derived GABAergic interneurons. a. GABA determination from MGE-derived neuronal cultures by HPLC analysis (Mean + S.E.M.; n=3). MGE-derived cells form synaptic connection, shown by overlap and juxtaposition of Synaptophysin foci with GABA staining after 6 weeks of differentiation (data not shown). Fig. 8b, Representative traces of action potential firings induced by depolarizing current injection (500 ms long) in H9-derived MGE cells after 6 weeks and 12 weeks of differentiation. Injected currents are indicated. Fig 8c, Traces showing currents evoked by voltage pulses. Membrane potential was held at -70 mV in voltage-clamp mode. Left, square voltage pulses from -70 mV to 20 mV in increments of 10 mV (20 ms long) induced both transient inward and sustained outward currents (1). Middle, the application of tetrodotoxin (1 μΜ) selectively blocked transient component (2). Sustained outward currents insensitive to tetrodotoxin are likely mediated by voltage-gated K+ channels (dotted line and open circle). Right, traces recorded under control conditions (1) were subtracted from currents recorded in the presence of tetrodotoxin (2) to calculate voltage-gated Na+ currents at different membrane potentials (filled circle). Fig. 8d, Current-voltage plots of voltage-dependent Na+ and K+ currents from traces as in f (filled and open circles, respectively; Mean ± S.E.M.; n = 4 cells). Fig. 8e, Traces showing

spontaneous postsynaptic currents. Left, spontaneous postsynaptic currents were recorded at -70 mV in voltage-clamp mode (upper trace). A lower trace is the average of spontaneous currents recorded in the same cell. Decay time constant (xD) was calculated by fitting the decay phase of the trace to a single exponential function (indicated by a dotted curve). Middle, the application of bicuculline (30 μΜ) blocked postsynaptic currents completely. Right, spontaneous postsynaptic currents were recovered fully after bicuculline washout. Fig. 8f, Summary plot of e. Numbers of spontaneous postsynaptic currents were counted, and frequency per minute was calculated for each condition (Mean + S.E.M.; n = 4 cells, * p < 0.05, paired t test).

[0051] Figure 9 shows a graph depicting graft volume analysis of cortical cells vs.

MGE cells from an experiment showing that transplanted MGE cells generate neural grafts enriched with GABAergic neurons. H9-derived MGE cells generate well- contained neural grafts, whereas untreated cells (cortical cells) generate large and disruptive grafts with rosette structures, as analyzed 5 weeks after transplantation (immunohistochemistry data not shown (Mean + S.E.M.; n=10, P<0.05, two tailed t- test). The experiment also showed that more grafted cells migrate in the host brain at 5 months after grafting. MGE cells generated neural graft, shown by double staining of human nucleus specific antibody with Nkx2.1 antibody, as analyzed 5 weeks post grafting. Some of the grafted cells retain Nkx2.1 or Lhx6 expression at 5 weeks after transplantation. MGE cells generate graft enriched with GABAergic neurons, as analyzed 5 weeks after transplantation. Immunocytochemistry analysis indicated that MGE cells derived neurons form synaptic connection in the host brain (data not shown). Immunohistochemistry analysis 5 months post grafting was also performed.

[0052] Figure 10 shows a graph depicting percentage of grafted cells.

Transplantation analysis of MGE cells was done. H9 MGE-derived grafted cells show migration out of the graft core as shown by immunocytochemistry analysis at 5 weeks and 5 months post grafting (data not shown), followed by cell counting analysis (Mean + S.E.M.; n=5, P<0.05, two tailed t-test). By immunohistochemistry analysis, many of the grafted cells express neuronal marker, β-tubulin. There are minorities of proliferating cells in MGE-derived grafts 5 weeks and 5 months after grafting, immunocytochemistry of alternate phenotypes on MGE grafts showed few astrocytes or oligodendrocytes are present at 5 weeks post grafting. Immunocytochemistry analysis on the expression of synaptic marker genes, Synaptophysin and PSD95 was also performed.

[0053] Figures 1 la to 1 lb show a schematic and graph indicating that transplanted human mGIN migrate robustly and integrate in adult epileptic brains. Fig. 11a overall experimental design. hPSC-derived MGE cells were transplanted into the

hippocampus of TLE mice. Behavioral analysis was conducted after 3 months PT and histology analysis at 4 months PT. Two weeks PT, transplanted cells display minimal migration, shown by human cytoplasm-specific antibody staining (data not shown). Fig. 1 lb, Quantification of migration of transplanted cells (Mean + S.E.M.; P<0.05, two tailed t-test) 2 week PT (n=3) and 4 month PT (n=8).

[0054] Figures 12a to 12 b show graphs indicating that transplanted human MGE cells generate GABAergic interneurons in adult epileptic brains.

Immunohistochemical analysis of transplanted cells was performed at 2 weeks and 4 months PT (data not shown) PT. Fig. 12a ,Cell counting analysis of 2 weeks PT vs. 4 months PT (Mean +S.E.M.; n=3, P<0.05, two tailed t-test). Fig. 12b, Cell counting analysis at 4 months PT (n=3); SST, somatostatin; PV, parvalbumin; Calr, calreticulin; NPY, neuropeptide Y; Calb, calbindin.

[0055] Figures 13a to 13g. Electrophysiological characterization of grafted human mGIN in the hippocampus. Fig. 13a, Top, a microscopic image showing the distribution of grafted human mGIN in the hippocampus. Channelrhodopsin 2 (ChR2)/GFP -expressing human MGE cells (green) transplanted into the cornu ammonis region 3 (CA3) of the hippocampus, migrate extensively to the CA1 and dentate gyrus (DG). The graft core is indicated by an asterisk. Strata oriens (s.o.), pyramidale (s.p.), and radiatum (s.r.) are also indicated. Bottom, confocal

microscopic images showing that the recorded grafted cell, labeled with biocytin- streptavidin, expresses ChR2-GFP. Fig. 13b, Whole-cell patch-clamp recordings were performed with grafted cells expressing ChR2-GFP. Grafted human mGIN were identified with green fluorescence in acute brain slices. Biocytin was included in the pipette solution to label the recorded cells. Left, representative traces of ChR2- mediated currents in a grafted cell. These inward currents were induced by blue light illuminations (470 nm, 1 s pulses, blue horizontal bar) with variable intensities (0.02- 0.61 mW/mm2) and recorded at -80 mV in voltage-clamp mode (V-clamp). Right, a summary graph showing the peak amplitude of ChR2 -mediated currents plotted versus light power. ChR2 currents were larger in human mGIN 4-5 months after transplantation (n = 16 cells) than in cells 2-3 months after implantation (n = 9 cells) (p < 0.001). Fig. 13c, Representative traces of action potentials (AP) evoked by short pulses of blue light illumination (1 ms, 12.5 mW/mm2, blue vertical line, left panel). These optogenetically-induced APs (oAP) were recorded in current-clamp mode (C- clamp) at approximate -85 mV and were detected in most grafted human mGIN examined (n = 18 cells, right panel). Fig. 13d, Summary plots of resting membrane potential (RMP), membrane resistance (Rm), and a fast component of membrane capacitance (Cm) of grafted human mGIN, which were examined 2, 4, or 5 months after transplantation (n = 6, 8, and 11 cells, respectively), as well as host adult hippocampal interneurons (Adult, > 3 months old, n = 4 cells). *** p < 0.001, adult versus all other groups. Fig. 13e, Representative traces showing currents induced by voltage pulses in a grafted cells. Membrane potential was held at -85 mV in voltage- clamp mode. Left, square voltage pulses from -85 mV to 5 mV with increment of 10 mV (50 ms long) induced both transient inward (Na+, a bracket) and sustained outward currents (K+, a vertical dotted line), which are likely to be mediated by voltage-gated Na+ and K+ channels, respectively. Right, the same trace was zoomed in to visualize the transient inward currents mediated by voltage-gated Na+ channels. Fig. 13f, A representative trace of spontaneous AP firings (sAP) in a grafted human mGIN. AP firings were recorded at RMP in current-clamp mode without current injection or withdrawal. A trace on the right is the average of sAP recorded in the same neuron. Fig. 13g, Left, spontaneous APs (sAP) were detected at RMP in 45 % of total 31 grafted cells examined. Right, a summary graph showing the average frequency of sAP (n = 14 cells). Error bars are SEM.

6] Figures 14a to 14g. Transplanted human MGE cells differentiate into

GABAergic interneurons in the epileptic hippocampus. Fig. 14 a, Left, microscopic images of a recorded human MGE cell in acute hippocampal slices. ChR2/GFP- expressing human MGE cells were identified with green fluorescence and labeled with biocytin-streptavidin (red) using recording pipettes. Right, blue light illumination (470 nm, 0.61 mW/mm2, blue horizontal bar) induces ChR2 -mediated currents recorded at -80 mV in voltage-clamp mode, confirming that the recorded cell is a grafted cell. Fig. 14 b, Analysis of action potential (AP) firings in human mGIN transplanted into the hippocampus. Top, a representative trace of AP firings in a ChR2/GFP-expressing grafted cell. APs were induced by depolarizing current injection near threshold (500 ms long) and recorded in current-clamp mode at approximate -85 mV. The amount of injected currents is indicated below the trace. For each grafted cell, the first AP (an arrowhead) was analyzed. Bottom, summary graphs showing the average AP threshold (left), after hyperpolarization (AHP, middle), and AP half-width (right) in human mGIN examined 2, 4, and 5 months after transplantation (n = 6, 8, and 11 cells, respectively) as well as host adult hippocampal interneurons. (Adult, > 3 month old, n = 4 cells). ** p < 0.01, adult versus all other groups; * p < 0.05, 5 month versus 4 month group; # p < 0.05, adult versus 2 or 4 month group. Error bars are SEM. Fig. 14 c, Representative traces (top row) and phase plots (bottom row) of four different types of AP firings recorded in grafted human mGIN in hippocampal slices. APs were induced by near-threshold

depolarizing current injections in GFP+ grafted cells and were recorded as in (b). Most grafted cells displayed either repetitive firings (type A, first column) or single AP firing (type B, second column) while delayed (type C, third column) or burst firing patterns (type D, fourth column) were observed in a small proportion of grafted cells. Repetitive AP firings could be induced by small current injections in type A cells (< 50 pA) whereas type B cells fires only a few APs, which required relatively larger current injections (> 50 pA). The amount of injected currents is indicated below the traces. Baseline membrane potential was approximately -85 mV. Fig. 14 d, A summary graph showing the proportion of grafted human MGE-derived cells displaying four different AP firing patterns (n = 31 cells). Fig. 14 e, Left, a summary plot of AP firings in human mGIN in the hippocampus. The number of AP firings was plotted versus injected currents (500 ms long). Note more frequent AP firings induced by small current injections in type A cells (n = 16 cells) than in type B cells (n = 10 cells). Right, the average membrane resistance (Rm) in type A was larger significantly than in type B cells. ** p < 0.01. Error bars are SEM. Fig. 14 f,

Examples of RNA profiles of three grafted cells from single-cell RT-PCR (scRT- PCR, top three rows). Intracellular contents of grafted cells were harvested individually after whole-cell patch-clamp recordings. Positive control with total RNA from the human brain as well as two negative controls (no RT control and no giga- seal formation) are also included in middle and bottom rows. M, size marker (300, 200 andlOO bp from top to bottom); PV, parvalbumin; CR, calreticulin; SST, somatostatin; VIP, vasoactive intestinal peptide; NPY, neuropeptide Y. Fig. 14 g, A summary plot of RNA profile of grafted human mGIN from scRT-PCR (n = 23 cells). 7] Figures 15a to 15g. Transplanted human mGIN receive glutamatergic inputs from host neurons. Images of human mGIN transplanted into the hippocampus were taken. The ChR2/GFP-expressing grafted cell was labeled with biocytin using a recording patch pipette. Grafted human mGIN were recorded in acute brain slices. Grafted cells, identified with green fluorescence, receive synaptic inputs from host neurons. The recorded cell was labeled with biocytin-streptavidin using patch pipettes. Fig. 15a, Blue light illumination induced inward currents, confirming that the recorded cell is a grafted cell expressing ChR2-GFP. ChR2 -mediated currents were induced and recorded as in Figure 14a. Confocal microscopic images showed dendrites of the recorded human mGIN Dendritic spines were present along neuron. Fig. 15b, Left, a representative trace of postsynaptic responses recorded in a GFP+ grafted cell. Spontaneous excitatory postsynaptic currents (sEPSCs) were recorded in GFP+ grafted cells at -85 mV in voltage-clamp mode. Right, a trace showing the average of sEPSCs recorded in the same cell. Decay time constant (xD) of sEPSC was calculated by fitting the decay phase of the trace to a single exponential function (red curve). Fig. 15c, The application of 10 μΜ NBQX inhibited sEPSC completely in the same grafted cell as in Fig. 15b , indicating that sEPSCs were mediated by

AMPA/kainate-type glutamate receptors and that the grafted cell receives functional synaptic inputs from host glutamatergic neurons, n = 4 cells. Fig. 15d, Two thirds of recorded human mGIN displayed spontaneous postsynaptic responses with the frequency > 0.1 Hz. Images of the cell bodies of GFP+ grafted cells and GFP- host hippocampal interneurons were obtained. The recorded cells were labeled with biocytin-streptavidin (red). Fig. 15f, Fig. 15g, Fig. 15h, Summary plots of the frequency (Fig. 15f), peak amplitude (Fig. 15g), and decay time constant (Fig. 15h) of sEPSC recorded in GFP+ grafted cells (n = 14) and GFP- host hippocampal interneurons (n = 10). No significant difference was detected between grafted and host cells (n.s.). Error bars are SEM. Immunohistochemistry analysis of human mGIN transplanted in the hippocampus. Hoechst (sky blue) was used as nuclear counter-stain, postsynaptic densities of GFP+ grafted cells (double-stained with ChR2-GFP and PSD), and presynaptic axon terminals (stained with synaptophysin, green) of GFP- cells were observed. TEM images showed that grafted human mGIN receive synaptic inputs from host cells. Transplanted cells, stained with DAB for human cytoplasm-specific antibodies display prominent postsynaptic densities, receiving inputs from DAB- host cells (no stain) (data not shown).

8] Figures 16a to 16h. Optogenetic stimulations of transplanted human mGIN induce GABAergic postsynaptic responses in host hippocampal neurons. Microscopic images were taken showing both a GFP+ grafted human MGE cell and a GFP- host pyramidal neuron in the CA3 of the hippocampus (Data not shown). These cells were labeled with biocytin-Streptavidin using recording pipettes (red). The grafted cell sends out projections towards the host pyramidal neuron. Microscopic images showed the soma and dendrites of the same GFP- pyramidal neuron as in the left image. Projections from grafted human mGIN are shown in the middle panel were observed (green, ChR2-GFP, data not shown). Fig. 16 a, Top, blue light illumination evokes AP firings in GFP+ mGIN expressing ChR2 and induces the release of GABA at axon terminals, generating postsynaptic responses in the recorded GFP- host neuron. Bottom left, blue light illumination (0.61 mW/mm2, blue horizontal bar) did not induce ChR2 -mediated current in GFP- host neurons at -80 mV in voltage-clamp mode, indicating the lack of ChR2 expression. Bicuculline (30 μΜ) was added to inhibit GABAergic responses in the recorded host neuron. Bottom right, the comparison of ChR2-currents between grafted and host cells (n = 25 and 27 cells, respectively), which received the same blue light illumination (0.61 mW/mm2). *** p < 0.001. Fig. 16 b, Left, representative traces of postsynaptic currents recorded in a GFP- host neuron. Postsynaptic responses were recorded at 0 mV in voltage-clamp mode and induced by photostimulations at 12.5 mW/mm2 (1 ms duration, blue vertical line). Blue light illumination was applied every 10 seconds. Right, these postsynaptic currents were completely inhibited by the application of GABAA receptor antagonist, bicuculline (30 μΜ) in the same neuron. Fig. 16c, Left, 44 % of total 27 GFP- host neurons displayed GABAA receptor-mediated inhibitory postsynaptic currents (IPSC) induced by photostimulations. Middle, a summary graph showing the average amplitude of IPSCs before and after the application of bicuculline as in (c). ** p < 0.01. Right, a plot showing the average synaptic latency of IPSCs induced optogenetically and recorded in GFP- host neurons (n = 10 neurons). The synaptic latency was quantified as the time interval between the start of photostimulations and the onset of synaptic responses. Fig. 16d, Left,

representative traces of postsynaptic currents recorded in a GFP- host neuron.

Postsynaptic currents were induced by blue light illuminations at 12.5 mW/mm2 (1 ms duration, blue vertical line) and recorded in voltage-clamp mode at -80, -60, -40, -20, and 0 mV. Right, a current-voltage plot of the postsynaptic responses. Peak amplitudes of postsynaptic currents were plotted versus holding potential (Vh, closed circles). Linear regression (a dotted line) reveals the reversal potential of the postsynaptic currents (Erev = -70 mV). The application of 30 μΜ bicuculline inhibited postsynaptic currents completely at all holding potentials examined (open circles), n = 3 neurons. Fig. 16e, Overlaid traces of quantal IPSCs (qlPSC) indicate both successes (red traces) and failures (black traces). qlPSCs were induced by blue light illuminations (blue vertical line) and recorded in GFP- host neurons as in (d). Fig. 16f, Summary plots showing the average potency (quantal size) and release probability (Pr) of qlPSCs. n = 6 neurons. Fig. 16g, A representative trace of IPSCs induced by train photostimulations. IPSCs were induced by blue light illumination applied at 1 Hz (12.5 mW/mm2, 1 ms duration, blue vertical lines) and recorded in GFP- host neurons at 0 mV in voltage-clamp mode. A trace on the right indicates the last evoked IPSC (a dotted circle), (i) A summary plot of IPSCs during 1 Hz train photostimulations as in Fig. 16h. The peak amplitude of IPSCs was normalized to the first IPSC (a dotted line; n = 3). Immunohistochemistry analysis of transplanted human mGIN was also done. Hoechst (sky blue) was used as nuclear counter-stain. Arrows in magenta indicate GABAergic presynaptic terminals of GFP+ grafted cells (double-stained with ChR2-GFP and VGAT) and inhibitory postsynaptic densities (stained with gephyrin, green) of GFP- cells were observed (data not shown). TEM images of grafted cells stained with DAB for human cytoplasm-specific antibodies were taken. DAB- host cells receives synaptic inputs from DAB+ grafted cells (data not shown).

9] Figures 17a to 17e. Transplanted mGIN reduce seizure activity and other behavioral abnormalities. Fig. 17a, Video-EEG analysis of naive mice (n=6), vehicle- injected control TLE mice (n=l 1) and MGE-transplanted TLE mice (n=9). Mean +S.E.M.; p < 0.05, ANOVA followed by post hoc analysis using non-parametric Kruskal- Wallis test. Right panel shows representative seizure EEG activity with high- frequency, high- voltage synchronized polyspikes. Fig. 17b, Y maze test (Mean ± S.E.M.; P<0.05, ANOVA followed by post hoc analysis using Fisher's LSD) of na ^' ive mice (n=9), vehicle-injected TLE control mice (n=10) and transplanted TLE (n=8), shown by % alternation as an indicative of short-term memory and total arm entry as an indicative of locomotor activity. Fig. 17c, Novel object recognition test (Mean ±S.E.M.; P<0.05, ANOVA followed by post hoc analysis using Fisher's LSD) of na ^' ive mice (n= 12), vehicle-injected TLE control mice (n=l 1) and transplanted TLE mice (n=8), shown by % time near a novel object compared to total time spent exploring objects and % number of visits near novel object among total number of visits exploring objects. Right panel shows representative tracing of mouse center point by Ethovision during trial. Fig. 17d, Locomotion test (Mean ±S.E.M.; P<0.05, ANOVA followed by post hoc analysis using Fisher's LSD) of na ^' ive mice (n=14), vehicle-injected control TLE mice (n=l 1) and MGE-transplanted TLE mice (n = 8), shown by the number of photobeam breaks in 15 min. Fig. 17e, Handling test (Mean + S.E.M.; P<0.05, ANOVA followed by post hoc analysis using Fisher's LSD) of na ^' ive mice (n=15), vehicle-injected TLE control mice (n=l 1) and transplanted TLE (n=10).

[0060] Figures 18a to 18b. FACS isolation of ENCAM+ cells after MGE

differentiation of human pluripotent stem cells. Fig. 18a, Representative FACS graph for isolating ENCAM+ cells. Left panel shows secondary antibody only control, and right panel show cells with ENCAM staining. Immunocytochemistry analysis of FACS isolated cells was also performed (data not shown). Fig. 18b, Cell counting analysis of FACS sorted cells (n=3). Immunohistochemistry at 4 month PT showed that Transplanted human mGIN migrate robustly and integrate in adult epileptic brains (data not shown).

[0061] Figure 19, is a graph of the quantification of transplanted cells in different areas of hippocampus. Mean +S.E.M (n=8). Counting trace and grid were used.

[0062] Figure 20 shows a graph indicating that mGIN transplantation does not affect Mossy fiber sprouting. Hippocampal brain sections from na ^' ive Nod-Scid mice, TLE control mice and transplanted TLE mice were stained using anti-ZnT3 antibody, to analyze mossy fiber sprouting. Quantification of Mossy fiber sprouting (n=7).

[0063] Figure 21 shows a schematic of the mechanisms of anti-epileptic effects of transplanted human PSC-derived mGIN. Transplanted human mGIN (graft) fire action potentials (AP) spontaneously (1) and receive excitatory synaptic inputs from host glutamatergic neurons (2). Grafted human mGIN release inhibitory

neurotransmitter GABA in an activity-dependent manner. Therefore, the activation of transplanted mGIN, either by spontaneous activity or by excitatory synaptic drive, increases inhibitory synaptic responses in host hippocampal neurons (host), suppressing exaggerated neural activity in the epileptic brain.

DETAILED DESCRIPTION [0064] One aspect of the present invention relates generally to an enhanced method for the production of medial ganglionic eminence (MGE) cells from pluripotent stem cells. The method comprises an additional step of contacting the pluripotent stem cells with an exogenous activator of FGF8 during the differentiation process. We have determined that addition of an exogenous activator of FGF8 generates a higher percentage of MGE cells as compared to in the absence of the activator. We note that less caudal ganglionic eminence (CGE) cells are produced. This highly efficient method for the generation of MGE cells provides a reliable source of MGE cells, or GABAergic interneurons derived therefrom, for therapeutic clinical use and for disease modeling.

[0065] Another aspect of the present invention provides methods for suppressing spontaneous seizure activity in a subject. The methods comprise administering MGE cells, which have been derived from pluripotent stem cells, into a subject in need of treatment.

[0066] Definitions

[0067] For convenience, certain terms employed herein, in the specification,

examples and appended claims are collected here. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. Unless explicitly stated otherwise, or apparent from context, the terms and phrases below do not exclude the meaning that the term or phrase has acquired in the art to which it pertains. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0068] The term "reprogramming" as used herein refers to a process that alters or reverses the differentiation state of a differentiated cell (e.g. a somatic cell).

Reprogramming refers to a process of driving the differentiation of a cell backwards to a more undifferentiated or more primitive type of cell.

[0069] The term "induced pluripotent stem cell" or "iPSC" or "iPS cell" refers to a cell derived from reprogramming of the differentiation state of a differentiated cell (e.g. a somatic cell) into a pluripotent cell. An induced pluripotent stem cell a) can self- renew, b) can differentiate to produce all types of cells in an organism, and c) is derived from a somatic cell. iPS cells have an ES cell-like morphology, growing as flat colonies with large nucleo-cytoplasmic ratios, defined borders and prominent nucleoli. In addition, iPS cells express one or more key pluripotency markers known by one of ordinary skill in the art, including but not limited to Alkaline Phosphatase, SSEA3, SSEA4, Sox2, Oct3/4, Nanog, T AI60, TRA 181 , TDGF 1 , Dnmt3b, FoxD3, GDF3, Cyp26al, TERT, and zfp42. IPS cells may be generated by providing the cell with "reprogramming factors", i.e., one or more, e.g., a cocktail , of biologically active factors that act on a cell to alter transcription, thereby reprogramming a cell to pluripotency. Examples of methods of generating and characterizing iPS cells may be found in, for example, Application Nos. US20090047263, US20090068742,

US20090191 159, US20090227032, US20090246875, and US20090304646, the disclosures of which are incorporated herein by reference.

[0070] The term "pluripotent" or "pluripotent stem cell" as used herein refers to a cell with the capacity, under different conditions, to differentiate to cell types

characteristic of all three germ cell layers (endoderm, mesoderm and ectoderm).

Pluripotent stem cells are characterized primarily by their ability to differentiate to all three germ layers, using, for example, a nude mouse teratoma formation assay.

Pluripotency is also evidenced by the expression of embryonic stem (ES) cell markers, although the preferred test for pluripotency is the demonstration of the capacity to differentiate into cells of each of the three germ layers. In some embodiments, a pluripotent cell is an undifferentiated cell. Pluripotent stem cells can be derived from any organism of interest, including, e.g. human, primate, non-human primate, canine, feline, murine, equine, porcine, avian, bovine etc.

[0071] The term "pluripotency" or a "pluripotent state" as used herein refers to a cell with the ability to differentiate into all three embryonic germ layers: endoderm (gut tissue), mesoderm (including blood, muscle, and vessels), and ectoderm (such as skin and nerve), and typically has the potential to divide in vitro for a long period of time, e.g., greater than one year or more than 30 passages.

[0072] The term "differentiated cell" is meant any primary cell that is not, in its

native form, pluripotent as that term is defined herein. The transition of a

differentiated cell to pluripotency requires a reprogramming stimulus beyond the stimuli that lead to partial loss of differentiated character in culture. In some embodiments, the term "differentiated cell" also refers to a cell of a more specialized cell type derived from a cell of a less specialized cell type (e.g., from an

undifferentiated cell or a reprogrammed cell) where the cell has undergone a cellular differentiation process such differentiated cell may be multipotent.

[0073] As used herein, the term "somatic cell" refers to any cell other than a germ cell, a cell present in or obtained from a pre-implantation embryo, or a cell resulting from proliferation of such a cell in vitro. Asomatic cell refers to any cells forming the body of an organism, as opposed to germline cells. There are adult somatic cells and embryonic somatic cells. In mammals, germline cells (also known as "gametes") are the spermatozoa and ova which fuse during fertilization to produce a cell called a zygote, from which the entire mammalian embryo develops. Every other cell type in the mammalian body— apart from the sperm and ova, the cells from which they are made (gametocytes) and undifferentiated stem cells— is a somatic cell: internal organs, skin, bones, blood, and connective tissue are all made up of somatic cells. In some embodiments the somatic cell is a "non-embryonic somatic cell", by which is meant a somatic cell that is not present in or obtained from an embryo and does not result from proliferation of such a cell in vitro. In some embodiments the somatic cell is an "adult somatic cell", by which is meant a cell that is present in or obtained from an organism other than an embryo or a fetus or results from proliferation of such a cell in vitro.

[0074] As used herein the term "isogenic cell" or "isogenic cells" refers to a cell/s originating from a common source or having the same genetic makeup. For example, when comparing the effect of activator of FGF8 signaling on a population of cells as compared to a population of cells not treated with the FGF8 activator, the isogenic population of cells is derived from the same source as the test population and has been treated the same as the test population, i.e. an "isogenic population of cells", also referred to herein as a control population of cells

[0075] As used herein, the term "adult cell" refers to a cell found throughout the body after embryonic development.

[0076] In the context of cell ontogeny, the term "differentiate", or "differentiating" is a relative term meaning a "differentiated cell" is a cell that has progressed further down the developmental pathway than its precursor cell. Thus in some embodiments, a reprogrammed cell as this term is defined herein, can differentiate to lineage- restricted precursor cells (such as a ectodermal stem cell), which in turn can differentiate into other types of precursor cells further down the pathway (such as an tissue specific precursor, for example, a neuronal cell precursor such a an MGE cell), and then to an end-stage differentiated cell, which plays a characteristic role in a certain tissue type, e.g. a GABAergic interneuron, and may or may not retain the capacity to proliferate further.

[0077] The term "embryonic stem (ES) cell" is used to refer to a cell that a) can self- renew, b) can differentiate to produce all types of cells in an organism (pluripotent), and c) is derived from a developing organism or is an established ES cell line which was derived from a developing organism. Embryonic stem cells may be obtained from the inner cell mass of the embryonic blastocyst (see US Patent Nos. 5,843,780, 6,200,806, which are incorporated herein by reference). Such cells can similarly be obtained from the inner cell mass of blastocysts derived from somatic cell nuclear transfer (see, for example, US Patent Nos. 5,945,577, 5,994,619, 6,235,970, which are incorporated herein by reference). In culture, ES cells typically grow as flat colonies with large nucleo- cytoplasmic ratios, defined borders and prominent nucleoli. In addition, hES cells express SSEA-3, SSEA-4, TKA-1-60, TRA-1-81, and Alkaline Phosphatase, but not SSEA-1. Examples of methods for identifying and characterizing ES cells may also be found in, for example, US Patent No. 7,029,913, which is incorporated herein by reference in its entirety.

[0078] The term "expression" refers to the cellular processes involved in producing RNA and proteins and as appropriate, secreting proteins, including where applicable, but not limited to, for example, transcription, translation, folding, modification and processing. "Expression products" include RNA transcribed from a gene and polypeptides obtained by translation of mRNA transcribed from a gene.

[0079] The term "exogenous" refers to a substance in addition to the amount of the substance normally present in and secreted from a cell; e.g. exogenous addition of a substance to cell culture medium means the substance was not excreted from the cell. The term "exogenous" when used herein also refers to a nucleic acid (e.g. a nucleic acid encoding a FGF8 transcription factor) or a protein (e.g., FGF8 polypeptide) that has been introduced by a process involving the hand of man into a biological system such as a cell or organism in which it is not normally found or in which it is found in lower amounts. A substance (e.g. a nucleic acid encoding FGF8) will be considered exogenous if it is introduced into a cell or an ancestor of the cell that inherits the substance. In contrast, the term "endogenous" refers to a substance that is native to the biological system or cell.

[0080] As used herein, "embryoid body", "embryoid bodies", "EBs" or "EB cells" refers to a morphological, three-dimensional, or organoid-type structure comprised of a population of undifferentiated and differentiated cells which are derived from pluripotent stem cells (e.g., primate pluripotent stem cells (pPS), embryonic stem (ES) ceils, induced pluripotent stem (IPS) cells) that have undergone differentiation. Under culture conditions suitable for EB formation, ES cells proliferate and form small mass of cells that begin to differentiate. In the first phase of differentiation, usually corresponding, to about days 1 -4 of differentiation for human cells, the small mass of cells forms a layer of endodermal cells on the outer layer, and is considered a "simple embryoid body." In the second phase, usually corresponding to about days 3-20 post- differentiation for human cells, "complex embryoid bodies" are formed, which are characterized by extensive differentiation of ectodermal and mesodermal cells and derivative tissues. As used herein, the term "embryoid bodies" or "EB" encompasses both simple and complex embryoid bodies unless otherwise required by context. The determination of when embryoid bodies have formed in a culture of ES/iPS cells is routinely made by persons of skill in the art by, for example, visual inspection of the morphology, detection of cell markers. Floating masses of about 20 cells or more (e.g., ES/iPS cells) are considered to be suspension embryoid bodies, (see. e.g., Schmit R., et al, 1991, Genes Dev. 5:728-740; Doetschman, T. C, et al, 1985, J.

Embryol. Exp. Morph. 87:27-45). Suspension EBs can be plated onto an adherent substrate to generate adherent EBs.

[0081] As used herein, "medial ganglionic eminence (MGE) precursor cell(s)" or "MGE neural precursor cells," refer to a population of mitotic and post-mitotic cells that express the markers expressed by cells in the MGE region of the developing brain. In general MGE precursor cells express markers such as, homeobox gene Nkx2.1, LIM- homeobox genes Lhx6, Lhx7, or Lhx8. MGE precursor cells are capable of differentiating into GABAergic intemeurons under suitable differentiation condition.

[0082] As used herein, "caudal ganglionic eminence (CGE) precursor cell(s)" or

"CGE neural precursor cells," refer to a population of mitotic and post-mitotic cells that express the markers expressed by cells in the CGE region of the developing brain. Such neural progenitor cells are found within CGE domain, a posterior region where the MGE and LGE domains fuse. The CGE precursor cells produce cortical interneurons in the striatum, neocortex and limbic system. In addition, these cells develop into oligodendrocytes that migrate into the cortex. In general CGE precursor cells express markers such as, Dlxl distal-less homeobox; Dlx2 distal-less homeobox 2; Gsx2 (Gsh2) GS homeobox; Nr2fl ("COUP-TF1") and COUP TFII nuclear receptor subfamily 2, group F, member 1 and II. CGE precursor cells are capable of differentiating into cortical interneurons under suitable differentiation condition and do not express homeobox gene Nkx2.1.

[0083] The term "isolated" or "partially purified" as used herein refers, in the case of a nucleic acid or polypeptide, to a nucleic acid or polypeptide separated from at least one other component (e.g., nucleic acid or polypeptide) that is present with the nucleic acid or polypeptide as found in its natural source and/or that would be present with the nucleic acid or polypeptide when expressed by a cell, or secreted in the case of secreted polypeptides. A chemically synthesized nucleic acid or polypeptide or one synthesized using in vitro transcription/translation is considered "isolated".

[0084] The term "isolated cell" as used herein refers to a cell that has been removed from an organism in which it was originally found or a descendant of such a cell. Optionally the cell has been cultured in vitro, e.g., in the presence of other cells.

Optionally the cell is later introduced into a second organism or re -introduced into the organism from which it (or the cell from which it is descended) was isolated.

[0085] The term "isolated population" with respect to an isolated population of cells as used herein refers to a population of cells that has been removed and separated from a mixed or heterogeneous population of cells. In some embodiments, an isolated population is a substantially pure population of cells.

[0086] The term "substantially pure", with respect to a particular cell population, refers to a population of cells that is at least about 75%, at least about 80%, at least about 85%o, at least about 90%>, or at least about 95%> pure, with respect to the cells making up a total cell population. With regard to a population of differentiated MGE cells, refers to a population of cells that contain fewer than about 30%, of CGE cells. In some embodiments, fewer than about 25%>, or 20%>, or 15%>, or 10%>, or 8%>, or 7%>, or 5%, or 1% of CGE cells. [0087] The terms "enriching" or "enriched" are used interchangeably herein and mean that the yield (fraction) of cells of one type is increased by at least 10% over the fraction of cells of that type in the starting culture or preparation.

[0088] The term "cell culture medium" (also referred to herein as a "culture medium" or "medium") as referred to herein is a medium for culturing cells containing nutrients that maintain cell viability and support proliferation. The cell culture medium may contain any of the following in an appropriate combination: salt(s), buffer(s), amino acids, glucose or other sugar(s), antibiotics, serum or serum replacement, and other components such as peptide growth factors, etc. Cell culture media ordinarily used for particular cell types are known to those skilled in the art. Examples of cell culture medium include Minimum Essential Medium (MEM), Eagle's Medium, Duibecco's Modified Eagle Medium (DMEM), Duibecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM F12), FIO Nutrient Mixture, Ham's FIO Nutrient Mix, Ham's F12 Nutrient Mixture, Medium 199, RPMI, RPMI 1640, reduced serum medium, basal medium (BME), DMEM/F12 (1 : 1), Neurobasal medium, and the like, and combinations thereof. The medium or cell culture medium may be modified by adding one or more factors, such as, supplements, differentiation factors, anti- apoptotic agents.

[0089] The terms "decrease" , "reduced", "reduction" , "decrease" or "inhibit" are all used herein generally to mean a decrease by a statistically significant amount.

However, for avoidance of doubt, ""reduced", "reduction" or "decrease" or "inhibit" means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%>, or at least about 30%>, or at least about 40%>, or at least about 50%), or at least about 60%>, or at least about 70%>, or at least about 80%>, or at least about 90% as compared to a reference level. The reference level is a control level in the absence of agent/treatment, e.g. with respect to siezures, a decrease in the number of seizures experienced by a subject in the absence of treatment with MGE cells.

[0090] The terms "increased" /'increase" or "enhance" or "activate" are all used

herein to generally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms "increased", "increase" or "enhance" or "activate" means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%>, or at least about 80%>, or at least about 90%> or up to and including a 100% increase or any increase between 10- 100% as compared to a reference level, or at least about a 2-fold, or at least about a 3- fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. The reference level is a control level in the absence of

agent/treatment, e.g. with respect to an increase in MGE cells, there is an increase in the number of MGE cells produced as compared to the absence of treatment with an exogenous factor of FGF8.

[0091] The term "statistically significant" or "significantly" refers to statistical

significance and generally means a two standard deviation (2 SD) below normal, or lower, concentration of the marker. The term refers to statistical evidence that there is a difference. It is defined as the probability of making a decision to reject the null hypothesis when the null hypothesis is actually true. The decision is often made using the p-value.

[0092] A "marker" as used herein is used to describe the characteristics and/or

phenotype of a cell. Markers can be used for selection of cells comprising

characteristics of interests. Markers will vary with specific cells. Markers are characteristics, whether morphological, functional or biochemical (enzymatic) characteristics of the cell of a particular cell type, or molecules expressed by the cell type. In some embodiments, such markers are proteins, and possess an epitope for antibodies or other binding molecules available in the art, and thus can be monitored by FACs analysis, and immunocytochemistry. However, a marker may consist of any molecule found in a cell including, but not limited to, proteins (peptides and polypeptides), lipids, polysaccharides, nucleic acids and steroids. Examples of morphological characteristics or traits include, but are not limited to, shape, size, and nuclear to cytoplasmic ratio. Examples of functional characteristics or traits include, but are not limited to, the ability to adhere to particular substrates, ability to incorporate or exclude particular dyes, ability to migrate under particular conditions, and the ability to differentiate along particular lineages. Markers may be detected by any method available to one of skill in the art, including for example, detection of nucleic acid, e.g. mRNA, e.g. by quantitative PCR. [0093] As used herein, the term "ectoderm" is meant the germ layer formed during animal embryogenesis that gives rise to the nervous system, tooth enamel, epidermis, hair, nails, and linings of mucosal tissues.

[0094] As used herein the term "Wnts" it is meant the family of highly conserved secreted signaling molecules which play key roles in both embryogenesis and mature tissues. The human Wnt gene family has at least 19 members (Wnt-1 , Wnt-2, Wnt- 2B/'Wnt-13, Wnt-3, Wnt3a, Wnt-4, Wnt~5A, Wnt-5B, Wnt-6, Wnt-7A, Wnt-7B, Wnt-8A, Wnt-8B, Wnt- 9A/Wnt-14, Wnt-9B Wnt- 15, Wnt-lOA, Wnt-1 OB, Wnt-11, Wnt- 16). Wnt proteins modulate cell activity by binding to Wnt receptor complexes that include a polypeptide from the Frizzled (Fz) family of proteins and a polypeptide of the low-density lipoprotein receptor (LDLR)-related protein (LRP) family of proteins. Once activated by Wnt binding, the Wnt receptor complex will activate one or more intracellular signaling cascades. These include the canonical Wnt signaling pathway: the Wnt planar cell polarity (Wnt PCP) pathway: and the Wnt-calcium (Wnt/Ca2+) pathway.

[0095] As used herein, culturing under "non-adherent conditions" it is meant culturing under conditions that suppress the adhesion of cells to the vessel in which they are cultured, e.g., the bottom of a tissue culture plate or flask. In some instances, the cells are naturally non-adherent, i.e., they will not adhere to a surface unless the surface is coated with a matrix composition, e.g., fibronectin, laminin, poly-ornitliin, poly- lysine, collagen IV, matrigel, and polycarbonate membranes. In some instances, cells may be maintained in a non-adherent state by agitating the culture.

[0096] As used herein, culturing under "adherent conditions" it is meant culturing under conditions that promote the adhesion of cells to the container in which they are cultured, e.g. the bottom of a tissue culture plate or flask. In some instances, cells may be induced to adhere to the container simply by keeping the culture stationary. In some instances, the wall of the container to which it is desirable to promote adhesion may be coated with a composition to which the cells may adhere, e.g., fibronectin, laminin, poly-ornithin, poly-lysine, collagen IV, matrigel, and polycarbonate membranes.

[0097] The terms "individual", "subject", "host", and "patient" are used

interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans. [0098] A "variant" polypeptide means a biologically active polypeptide as defined below having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with a native sequence polypeptide. Such variants include polypeptides wherein one or more amino acid residues are added at the N- or C -terminus of, or within, the native sequence; from about one to forty amino acid residues are deleted, and optionally substituted by one or more amino acid residues: and derivatives of the above polypeptides, wherein an amino acid residue has been covalently modified so that the resulting product has a non -naturally occurring amino acid. Ordinarily, a biologically active variant will have an amino acid sequence having at least about 90%) amino acid sequence identity with a native sequence polypeptide, at least about 95%, or at least about 99%. The variant polypeptides can be naturally or non-naturally glycosylated, i.e., the polypeptide has a glycosylation pattern that differs from the glycosylation pattern found in the corresponding naturally occurring protein. The variant polypeptides can have post-translational modifications not found on the natural polypeptide. In certain embodiments, a variant polypeptide of FGF8 protien is used in methods of the invention.

[0099] As used herein, the term "treating" and "treatment" refers to administering to a subject an effective amount of a composition (e.g. comprising MGE cells) so that the subject has a reduction in at least one symptom of the disease or an improvement in the disease, for example, beneficial or desired clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, stabilized (e.g., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission , whether detectable or undetectable. The effect may be prophylactic. One of skill in the art realizes that a treatment improves the disease condition, and is not intended to be a complete cure for the disease. The treatment is "effective" if the progression of a disease is reduced or halted.

[00100] As used herein, the terms "administering," and "introducing" are used

interchangeably in the context of the placement of cells as disclosed herein, by a method or route which results in at least partial localization of the cells at a desired site, surgical or non-surgical administration (e.g. systemic administration). The cells can be administered directly to a tissue of interest, or alternatively be administered by any appropriate route which results in delivery to a desired location in the subject where at least a portion of the cells remain viable. The period of viability of cells after administration to a subject can be as short as a few hours, e. g. twenty-four hours, to a few days, to as long as several years.

[00101] The term "transplantation" as used herein refers to surgical introduction of the cells, e.g. transplant to brain, e.g. transplant into the ventral telencephalon.

[00102] As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not.

[00103] As used herein the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional

characteristic(s) of that embodiment of the invention.

[00104] The term "consisting of refers to compositions, methods, and respective

components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[00105] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus for example, references to "the method" includes one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth. For example, reference to a "SHH activator", or "a SMAD inhibitor" includes a plurality of such activators or inhibitors and reference to "the WNT inhibitor" includes reference to one or more WNT inhibitor and equivalents thereof known to those skilled in the art, and so forth, it is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

[00106] Methods for generating MGE precursor cells from pluripotent stem cells are well known to those of skill in the art and include for example those described by Nicholas CR, et al. Cell Stem Cell, 2013, 12:573-586; Maroof AM, et al. Cell Stem Cell, 2013, 12:559-572; and Liu Y, et al. Nat Biotechnol. 2013, 31 :440-447, which are herein incorporated by reference in their entirety. We have identified that adding a step of incubating the differentiating cells with an exogenous activator of FGF8 signaling enhances the number of MGE cells produced by the differentiating cell population.

[00107] As used herein, an "activator of FGF8 signaling" refers to a protein, peptide, nucleic acid or compound, that activates signaling normally activated by secreted fibroblast growth factor 8 (FGF8) protein. Fibroblast growth factor 8 is a protein that in humans is encoded by the FGF8 gene (FGF8 fibroblast growth factor 8 (androgen- induced) (Homo sapiens (human) Gene ID: 2253, mRNA NM OO 1206389; protein NP 001193318). FGF8 protein is important and necessary for setting up and maintaining the midbrain/hindbrain border (or mesencephalon/met-encephalon border) which plays the vital role of "organizer" in development, like the Spemann "organizer" of the gastrulating embryo. FGF8 is expressed in the region where Otx2 and Gbx2 cross inhibit each other and is maintained expression by this interaction. Once expressed, the FGF8 induces other transcription factors to form cross-regulatory loops between cells, thus the border is established. Through development, the FGF8 goes to regulate the growth and differentiation of progenitor cells in this region to produce ultimate structure of midbrain and hindbrain (Harris WA, Sanes DH, Reh TA, 2011, Development of the Nervous System, Third Edition. Boston: Academic Press, pp. 33-34). FGF8 is sufficient to induce the repatterning of midbrain and hindbrain structure (Crossley PH, Martin GR, 1995, The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo Development 121 (2): 439-51; See also, Gemel J, Gorry M, Ehrlich GD, MacArthur CA, 1996. Structure and sequence of human FGF8". Genomics 35 (1): 253-7. Xu J, Liu Z, Ornitz DM, 2000, Temporal and spatial gradients of FGF8 and Fgfl7 regulate proliferation and differentiation of midline cerebellar structures Development 127 (9): 1833-43).

[00108] In one embodiment, the exogenous activator of FGF8 signaling is exogenous FGF8 protein (SEQ ID NO: 1), or variant, or functional fragment thereof.

[00109] The FGF8 protein/peptide may be natural or recombinant. In one

embodiment, the exogenous activator of FGF8 signaling is a peptidomimmetic of exogenous FGF8 protein. FGF8 protein or peptide may be added to the culture (i.e. contacting cells with FGF8) at concentrations ranging from 1-5000 ng/ml, e.g. 10- 1000 ng/ml, or 100-1,000 ng/ml. [00110] In one embodiment, the activator of FGF8 signaling is present in the culture medium at a concentration of 10 ng/ml, 100 ng/ml. 200 ng/ml, 300 ng/ml, 400 ng/ml, 500 ng/ml, 1 ug/ml, 1.5 μg/ml, 2 μg/ml, 2.5 μg/ml, or 5 μg/ml.

[00111] The activator of FGF8 signaling may be added any time throughout the

differentiation process. In one embodiment the activator of FGF8 signaling is added concurrently with the SHH activator. In one embodiment the activator of FGF8 signaling is added after the SHH activator. In one embodiment, the activator of FGF8 signaling is added within days or within weeks after contacting the cells with the SHH activator (e.g. within 1 day up to 20 days). In one embodiment, the activator of FGF8 signaling is added about 1 week after the addition of the SHH activator. After addition, the activator of FGF8 signaling is typically present through to the completion of the differentiation of the cells to cells that express MGE cell markers, wich occurs typically in about three weeks.

[00112] Pluripotent stem cells suitable for use in the present invention include, for example, the human embryonic stem cell line H9 (NIH code: WA09), the human embryonic stem cell line HI (NIH code: WAOl), the human embryonic stem cell line H7 (NIH code: WA07), and the human embryonic stem cell line SA002 (Cellartis, Sweden). Also suitable for use in the present invention are cells that express at least one of the following markers characteristic of pluripotent cells: ABCG2, cripto, CD9, FoxD3, Connexin43, Connexin45, Oct4, Sox2, Nanog, hTERT, UTF-I, ZFP42, SSEA-3, SSEA-4, Tral-60, Tral-81. Methods for the isolation of pluripotent stem cells from tissues based on marker analysis are well known to those of skill in the art, e.g. non-embryonic pluripotent stem cells can be isolated from the blood as described in for example, WO 2012/106367, and US 2011/0044961.

[00113] In some embodiments, the population of pluripotent stem cells is a population of induced pluripotent stem cells (iPSCs) that are produced by reprogramming of somatic cells. In some embodiments, the somatic cell is a human cell. In some embodiments, a somatic cells are diseased somatic cells, for example when producing GABAergic neurons to study disease, e.g., cells obtained from a subject with a pathology, or from a subject with a genetic predisposition to have, or be at risk of a disease or disorder. One can use any method for reprogramming a somatic cell, methods of which are well known in the art, for example, as disclosed in international patent applications; WO2007/069666; WO2008/118820; WO2008/124133; WO2008/151058; WO2009/006997; and U.S. Patent Applications US2010/0062533; US2009/0227032; US2009/0068742; US2009/0047263; US2010/0015705;

US2009/0081784; US2008/0233610; US7615374; U.S. Patent Application No:

12/595,041, EP2145000, CA2683056, AU8236629, 12/602,184, EP2164951, CA2688539, US2010/0105100; US2009/0324559, US2009/0304646,

US2009/0299763, US2009/0191159, the contents of each are incorporated herein in their entirety by reference. The iPSCs may be produced by viral-induction or chemical induction e.g., as disclosed in EP1970446, US2009/0047263,

US2009/0068742, and 2009/0227032, which are incorporated herein in their entirety by reference.

[00114] PSCs can be propagated continuously in culture, using culture conditions that promote proliferation without promoting differentiation. Exemplary stem cell medium is made with 80% DMEM (such as Knockout DMEM "KG DMEM"), 20% of either defined fetal bovine serum (FBS, Hyclone) or serum replacement (e.g., knockout serum replacement ( SR)), 1% non-essential amino acids (NEAA), 1 % pen-strep- glutamine (1 mM L-glutamine), 0.0008% β-mercaptoethanol, and IQng/ml FGF-basic (bFGF). Such medium can also be used in the differentiation protocols as the medium base to add differentiation factors to, e.g. SMAD inhibitor, wnt inhibitor, exogenous FGF8.

[00115] The PSCs can be expanded in the undifferentiated state by culturing in an environment that inhibits differentiation. Traditionally, PSCs are cultured on a layer of feeder cells derived from embryonic or fetal tissue of the mouse. Culture plates are plated with 375,000 irradiated mouse embryonic fibroblasts (MEFs) per well

(irradiated to inhibit proliferation but permit synthesis of factors that support pPS cells), and used 5 h to 10 days after plating. In certain embodiments, human feeder cells may also be used.

[00116] In some embodiments, the PSCs cells are maintained in an undifferentiated state without feeder cells. The environment for feeder- free cultures includes a suitable culture substrate, particularly an extracellular matrix such as Matrigei® or laminin. The PSCs are plated at 15,000 cells cm ² (optimally 90,000 cm ² to 170,000 cm ). Feeder- free cultures are supported by a nutrient medium containing factors that support proliferation of the cells without differentiation. Such factors may be introduced into the medium by culturing the medium with cells secreting such factors, such as irradiated (-4,000 tad) primary mouse embryonic fibroblasts, telomerized mouse fibroblasts, or human feeder cells derived from pPS cells. Medium can be conditioned by plating the feeders at a density of ~5-6x 104 cm in a serum free medium such as KO DMEM supplemented with 20% serum replacement and 4 to 8 ng/mL bFGF. Medium that has been conditioned for 1-2 days is supplemented with further bFGF, and used to support PSC culture for 1 -2 days. Features of the feeder- free culture method are further discussed in International Patent Publications

WO99/20741 & WOOl/51616; and Xu et al, Nat. BiotechnoL, 2001, 19:971which are herein incorporated by reference.

[00117] For differentiation into MGE cells, the PSCs may be cultured in suspension as embryoid bodies, or as adherent culture of embryoid bodies in serum free media.

[00118] In one embodiment, the PSCs are grown in low adherent flasks in serum free media thereby allowing for the suspension embryoid bodies to form. The cells may be cultured in the presence of neural inducing supplements, such as B27 or NS21, or SMAD inhibitors.

[00119] In one embodiment, the cells are cultured in suspension for a period of at least 1 hr, 3 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 36 hrs, 48 hrs, 2 days, 3 days, or more, before the neural inducing agent (e.g. SMAD inhibitor) and activator of SHH supplement are added to the culture medium.

[00120] In one embodiment the PSCs are grown in low adherent flasks for formation of suspension embryoid bodies. After formation of embryoid bodies the cells are cultured for about two weeks (day 0 to day 14) in the presence of a neural inducing SMAD inhibitor to generate a population of cells that express the neuroectoderm marker Pax6 (Pax6+ cells). An anti-apoptotic agent can optionally be added to the culture, e.g. a ROCK inhibitor. In some embodiments, an inhibitor of WNT is also added to the culture.

[00121] In embodiments of the invention, an activator of sonic hedgehog (SHH) is added to the culture early (e.g. at day 0 or within about 5 days) to generate cells that express the ventral telencephalic marker FoxGl . The SHH activator may be present throughout the differentiation process.

[00122] In one embodiment, after about a week in culture with the neural inducer (e.g.

SMAD inhibitor, and SHH activator) the cells are contacted with an activator of FGF8 signaling, e.g. exogenously added FGF8 protein, for a period of about 1 weeks before transferring the cells to an adherent culture, e.g. grown on polyornithine and fibronectin) still in the presence of exogenous FGF8, and allowed to continue their differentiation for a total of about 3 weeks in culture (day 0 to day 21) in order to generate a population of cells with an enhanced number of MGE cells as compared to isogenic cultures that were not contacted with an exogenous activator of FGF8 signaling, e.g. FGF8.

[00123] In certain embodiments, the cells are further differentiated into GABAergic interneurons that express Sox6 by placement in a differentiation media containing GDNF, BDNF, and DAPT (Nicholas, et al, 2013, Cell Stem Cell, 12:573-586).

[00124] Example Rho-associated protein kinase (ROCK) inhibitors include, but are not limited to, Y27632, HA- 100, H- 1152, (+)-trans-4-( 1 -aminoethyl)- 1 -(pyridin-4- ylaminocarbony I ) cyclohexane dihydro-chloride monohydrate (described in

WO0007835 L WO00057913), imidazopyridine derivatives (described in U.S. Pat. No. 7,348,339), substituted pyrimidine and pyridine derivatives (described in U.S. Pat. No. 6,943,172) and substituted isoquinoline-sulfonyl compounds (described in EP00187371), or GSK429286A, or Thiazovivin, or an analog or derivative thereof. The anti-apoptotic agent may be present at a concentration of at least about 0.1 uM, at least about 0.3 uM, at least about 0.5 uM, at least about 1.0 uM, at least about 1.3 uM, at least about 1.5 uM, at least about 2.0 uM, at least about 2.3 uM, at least about 2.5 uM, at least about 3 uM, at least about 3.5uM, at least about 4 uM, at least about 4.5uM, at least about 5.0uM, at least about 5.5uM, at least about 6 uM, at least about at least about 7.5uM, at least about 8.5uM, at least about 10 uM, at least about 15 uM, at least about 20 uM, at least about 30 uM, at least about 40 uM, at least about 50, uM, at least about 60 uM.

[00125] In some embodiments, the inhibitor of SMAD may be present at a

concentration of at least about 0.001 uM, at least about 0.003 uM, at least about 0.005 uM, at least about 0.01 uM, at least about 0.05 uM, at least about 0.1 uM, at least about 0.2 uM, at least about 0.3 uM, at least about 0.5 uM, at least about 1 uM, at least about 1.5uM, at least about 3 uM, at least about 4 uM, at least about 5.0uM, at least about 6 uM, at least about 7.5uM, at least about 8.5uM, at least about 10 uM, at least about 15 uM, at least about 20 uM, at least about 30 uM, at least about 40 uM, at least about 50, uM, at least about 60 uM. [00126] In certain embodiments, the inhibitor of SMAD is an inhibitor of TGF-β signaling. For example, the SMAD inhibitor may be an ALK inhibitor, or antibody or a fragment thereof that binds to a TGF-β receptor. In some embodiments, the inhibitor of TGF-β signaling is a small molecule inhibitor, e.g. the inhibitor of TGF-β signaling may be LY364947 (SD208), SM16, SB-505124, ALK5 Inhibitor II, SB-431542, LY2157299 , LDN-193189, A83-Q1, (+)-ITD-l , ITD-1 (ethyl 4-([l ,l'-biphenyl]-4- yl)-2,7,7-trimethyl-5-oxo-l,4,5,6,7,8- hexahydroquinoline-3-carboxyfate), or ITDts.

[00127] In one embodiment, the SMAD inhibitor is BMPRIA-Fc, Noggin, or

derivatives thereof.

[00128] In one embodiment, the SMAD inhibitor is an inhibitor of a bone

morphogenic proteins (BMP) pathway, such as, dorsomorphin. Signal transduction through BMP receptors results in mobilization of the SMAD family members.

Inhibitors of BMP signaling can readily be identified by one of ordinary skill in the art by competitive binding assays to the BMP receptors, or by measuring

relocalization of SMAD.

[00129] In one embodiment, the SMAD inhibitor is an Activin inhibitor, Nodal

inhibitor, or GDF signaling pathway inhibitor. Exemplary activin inhibitors include SB431542, Follistatin, A8301, DMH1, Dorsomorphin, K02288, and SB505124. In certain cases, inhibitors of Nodal, such as, SB431542, Lefty, or Cerebrus may be used. In certain cases, SB431542, D4476, GW788388, LY364947, RepSox,

SB525334, SD208 may be used to inhibit GDF signaling pathway.

[00130] In certain embodiments, two or more SMAD inhibitors may be included in the cell culture medium.

[00131] In embodiments of the methods described herein, an activator of sonic

hedgehog signaling is present in the medium for culturing cells in order to induce cells that express Dlxl or Dlx2. In one embodiment, the cells exposed to sonic the hedgehog activator express FoxGl . The activator of sonic hedgehog signaling may be present at a concentration of at least, about 0.001 uM, at least about 0.003 uM, at least about 0.005 uM, at least about 0.01 uM, at least about 0.05 uM, at least about 0.1 uM, at least about 0.2 uM, at least about 0.3 uM, at least about 0.5 uM, at least about 1 uM, at least about 1.5uM, at least about 3 uM, at least about 4 uM, at least about 5.0 uM, at least about 6 uM, at least about 7.5 uM, at least about 8.5 uM, at least about 10 uM, at least about 15 uM, at least about 20 uM, at least about 30 uM, at least about 40 uM, at least about 50, uM, at least about 60 uM, 1 mM, 2, mM, 3 mM.

[00132] Antibodies for ventral telencephalic marker Dlxl or Dlx2 are commercially available, e.g. Dlx-2a antibody WQ6 is a mouse monoclonal IgG2a provided at 100 μg/ml; raised against recombinant Dlx-2 of human origin available from Santa Cruz Biotechnology (SCBT), CA (Magdalena A. Petryniak et al. Neuron. Aug 2, 2007; 55(3): 417-433; and Melo et al. Journal of Comparative Neurology, Dlxl, Dlx2, Pax6, Brn3b, and ChxlO homeobox gene expression defines the retinal ganglion and inner nuclear layers of the developing and adult mouse retina2003, 461(2): 187-204, 23).

[00133] The activator of sonic hedgehog (SHH) signaling may be SHH, or a derivative thereof. In certain embodiments, the activator of sonic hedgehog signaling is a small molecule, such as, pumorphamine, SAG smoothened agonist, Hh-Agl.5, or derivatives and analogs thereof.

[00134] In one embodiment the SHH activator is added within 2, days, 3 days, 4 days, 5 days, or 7 days after initiation of the differentiation protocol with the SMAD inhibitor.

[00135] In certain embodiments of the methods described herein, an inhibitor of Wnt signaling may be present in the medium for culturing cells. Wnt inhibitors are agents that downregulate expression or activity of wnt. Agents of interest may interact directly with, wnt, e.g. drugs, i.e., small molecules, blocking antibodies, etc., or may interact with wnt associated proteins, e.g. Wnt co- receptors LRP5/6 and the transmembrane protein xemen. A number of wnt inhibitors have been described and are known in the art. Wnt inhibitors of interest interfere with the interaction between soluble, extracellular Wnt proteins, and the frizzled receptors that are present on the surface of normal cells. Such agents include, without limitation, soluble frizzled polypeptides comprising the wnt binding domains: soluble frizzled related polypeptides; wnt specific antibodies; frizzled specific antibodies: and other molecules capable of blocking extracellular wnt signaling.

[00136] Among the known wnt inhibitors are members of the Dickkopf (Dkk) gene family (see Krupnik et al. Gene, 1999, 238(2):301-13), Members of the human Dkk gene family include Dkk-1 , Dkk-2, Dkk-3, and Dkk-4, and the Dkk- 3 related protein Soggy (Sgy). Other inhibitors of wnt include Wise (Itasaki et al Development, 2003,130(18):4295-30), which is a secreted protein. The Wise protein physically interacts with the Wnt co-receptor, lipoprotein receptor-related protein 6 (LRP6), and is able to compete with WntS for binding to LRP6, inhibitors may also include derivatives, variants, and biologically active fragments of native inhibitors. In certain embodiments, the Wnt inhibitor may be a small molecule such as, C 1-7, IWP analogs, IWR analogs, XAV939, 53 AH , Wnt-C59, IWP2, and IWP4, XAV939, ICGOOl, IWR-l-endo, Wnt-C59, LGK-974, FH535, WIKI4, and IWP-L.

[00137] In certain embodiments, the Wnt inhibitor is present in the culture medium at a concentration of 10 ng/ml, 200 ng/ml, 300 ng/ml, 400 ng/ml, 500 ng/ml, 1 ug/ml, 1.5 μg/ml, 2 μg/ml, 2.5 μg/ml, or 5 μg/ml for example, at a concentration of 500 ng/ml-

[00138] In one exemplary embodiment, in a 3 week human PSC differentiation culture, SMAD inhibitor LDN193189 is present in the PSC culture at 100 nM form day 0 to day 14 and SMAD inhibitor SB431542 is present in the culture at concentration of 10 micromolar from day 0 to day 7 to induce cells that express Pax6; cells are also treated with the Wnt inhibitor IWP2 at 5 micromolar from day 0 to day 7 and with SHH activator SAG at 0.1 um from day 0 to day 21 to induce cells that express ventral telencephalic neuroectoderm marker FoxGl . The cultured cells are further treated with exogenous FGF8 protein, an activator of FGF8 signaling, at lOOng/ml from day 8 to day 21. The culture is grown as suspension embryoid bodies from day 0 to day 14 prior to being transferred to an adherent embryoid body culture at day 21 to generate a culture with enhanced number of MGE cells that express the marker Nkx2.1. Those of skill in the art understand that the timing and concentrations may vary and that one of skill in the art can monitor for the expression of the indicated markers at each step in the differentiation protocol to make any necessary

adjustments.

[00139] The cell populations cultured according to the methods disclosed herein may be monitored to assess changes in the cells imparted by culturing (e.g., during one or more time points in the culture method disclosed herein) so as to characterize the cell population produced. For example, the production of Pax 6 positive, FoxGl positive, and Nkx2,l positive cells. The expression of certain markers can be determined by detecting the presence or absence of the marker transcript or protein expression.

Alternatively, the expression of certain markers can be determined by measuring the level at which the marker is present in the cells of the cell culture or cell population. In such processes, the measurement of marker expression can be qualitative or quantitative. One method of quantitating the expression of markers that are produced by marker genes is through the use of quantitative PCR. (Q-PCR). Methods of performing Q-PCR are well known in the art.

[00140] Other methods which are known in the art can also be used to quantitate

marker gene expression. For example, the expression of a marker gene product can be detected by using antibodies specific for the marker gene product of interest by e.g. FACS analysis or immunocytochemistry. In certain processes, the expression of marker genes characteristic of the cell population of interest as well as the lack of significant expression of marker genes characteristic of pluripotent stem cells and other cell types may be determined (e.g. CGE cells, COUPII).

[00141] Generation of MGE precursor cells may be determined by monitoring

expression of Nkx2.1 and Olig 2 gene. As such, the MGE precursor cells produced by the processes described herein express the Nkx2.1 marker gene, thereby producing the Nkx2.1 gene product. The MGE precursor cells produced by the methods described herein may express FoxGl and do not express PAX6. In some embodiments the MGE cells do not express FoxGl .

[00142] In some embodiments, the monitoring of generation of MGE precursor cells may be carried out by performing functional analysis of the cells of interest. For example, MGE precursor cells generated by the methods described herein can further differentiate into GABAergic interneurons in vivo or in vitro that express the markers Lhx6 and Sox6, and that for example express GABA, somatostatin, or parvalbumin.

[00143] In some embodiments, the population of MGE cells is further enriched,

isolated and/or purified, e.g. by using an affinity tag (e.g. anti-ENCAM antibody) and FACS sorting.

[00144] In some embodiments the population of MGE cells are further enriched by screening for and isolating the MGE precursor cells, e.g. by isolating MGE precursor cells using Nkx2.1 -specific molecular beacon live cell mRNA probes (See Bao et al, Fluorescent probes for live-cell RNA detection, Annu Rev. Biomed. Engin. 2009, 11 : 25-47; and Ricardo and Vaca J. Nucleic acids vol. 2011 : Article ID 741723: 1-15), and Fluorescence-activated cell sorting (FACS) analysis. Example molecular becon probe sequences that bind to Nkx2.1 , include but are not limited to the molecular beacons having the following sequences: CGCGATCAAACCCATTTGAATCACCAAAGATCGCG (SEQ ID NO: 34);

CGCGATCGGCCAGGTTGTTAAGAAGATCGCG (SEQ ID NO 35);

CGCGATCGAAGCGGTGAGGCAGAGCGGATCGCG (SEQ ID NO 36)

CGCGATCCCCGGCGTCCTCTCACGATCGCG (SEQ ID NO 37);

CGCGATCATGGTGCCGTAGTCCGAGGATCGCG (SEQ ID NO: 38);

CGCGATCCAGACACTGAGAACGGAGTCGATCGCG (SEQ ID NO: 39);

CGCGATCGATTCGGCGGCGGCTGGATCGCG (SEQ ID NO: 40);

CGCGATCGCCTTCCCACTGCCTCCGGATCGCG (SEQ ID NO 41); and

CGCGATCACCACATCGGGCTTCGCTGGATCGCG (SEQ ID NO 42); which correspond to beacons having stem loop structure and sequence that is complimentary to Nkx2.1 mRNA at start positions 1,623;1,420; 1,348; 1,314; 1,265; 229; 186; 122; 103; respectively, see for e.g. SEQ ID NO: 44).

[00145] In one embodiment, the population of MGE cells are differentiated into

GABAergic interneurons, and the GABAergic interneurons are further enriched by isolating the GABAergic interneurons using antibody against markers of immature interneurons, e.g. PCPTPl (Faux, C, et al., Differential gene expression in migrating cortical interneurons during mouse forebrain development. J Comp Neurol, 2010, 518(8): p. 1232-48) or CXCR4 (Meechan et al. PNAS, 2012, 109(45): 18601-08606) followed by FACS analysis. Antibodies against PCPTPl and CXCR4 are known in the art and are commercially available.

[00146] Another aspect of the invention relates to the use of the MGE cells in order to treat neurodegenerative diseases, wherein the MGE cells that have been derived from pluripotent stem cells are derived using an activator of FGF8 signaling, such as FGF8.

[00147] In addition, herein we demonstrate, for the first time, that transplantation of MGE cells, derived from pluripotent stem cells, successfully migrate throughout the hippocampus, mature into GABAergic neurons, and integrate into the host neural circuitry allowing receipt of excitatory inputs, and release of GABA, which in turn induces inhibition of spontaneous seizures.

[00148] Thus, in still another aspect of the invention methods for suppression of

seizure activity in a subject are provided. The methods comprise administering to a subject in need of treatment MGE cells that have been derived from pluripotent stem cells, for example using the methods described herein, wherein the presence of MGE cell in the population is enhanced, e.g. to greater than 80% MGE cells. [00149] In one embodiment, the population of MGE cells used in the transplantation are derived from PSCs without using an activator of FGF8 signaling.

[00150] In certain embodiments the MGE cell population is further enriched by

screening for and isolating the MGE precursor cells prior administration of the MGE cells for inhibition of seizure activity.

[00151] In one embodiment, the population of MGE cells is differentiated into

GABAergic interneurons. In certain embodiments, the GABAergic interneurons are further enriched by isolating the GABAergic interneurons prior to administration of the interneurons for inhibition of seizure activity.

[00152] Routes of administration suitable for the methods of the invention include local administration. Generally, local administration results in of the cells being delivered to a specific location as compared to the entire body of the subject, whereas, systemic administration results in delivery of the cells to essentially the entire body of the subject. Exemplary modes of administration include, but are not limited to, injection, infusion, instillation, inhalation, or ingestion. "Injection" includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion. One method of local administration is by intracranial injection.

[00153] In the context of administering MGE cells as disclosed herein, the term

"administering" includes transplantation of such a cell in a subject. As used herein, the term "transplantation" refers to the process of implanting or transferring at least one cell to a subject. The term "transplantation" includes, e.g., autotransplantation (removal and transfer of cell(s) from one location on a patient to the same or another location on the same patient, e.g. after differentiation into MGE cells),

allotransplantation (transplantation between members of the same species), and xenotransplantation (transplantations between members of different species).

[00154] Methods for transplanting neuronal grafts in the brain or other localized area are known in the art. See for example, WO2010108665A "Promotion of neuronal integration in neural stem cell grafts. Conventional techniques for grafting are also described in, for example, Bjorklund et al. (Neural Grafting in the Mammalian CNS, eds. Elsevier, 1985, pp 169-178), Leksell et al. (Acta Neurochir., 1980, 52: 1-7) and Leksell et al. (J. Neurosurg., 1987, 66:626-629). In certain embodiments,

identification and localization of the injection target regions will generally be done using a non-invasive brain imaging technique (e.g., MRI) prior to implantation (see, for example, Leksell et al, J. Neurol. Neurosurg., 1985, Psychiatry, 48: 14-18).

[00155] In one embodiment the MGE cells are transplanted into the ventral

telencephalon of the brain.

[00156] In one embodiment, the transplantation therapies involve the intraparenchymal intracerebral grafting of the replacement cell populations into the lesioned region of the nervous system, or at a site adjacent to the site of injury. In one embodiment, the therapeutic cells are delivered to a specific site by stereotaxic injection.

[00157] Briefly, administration of cells into selected regions of a patient's brain may be made by drilling a hole and piercing the dura to permit the needle of a microsyringe to be inserted. Alternatively, the cells can be injected into the brain ventricles or intrathecally into a spinal cord region. The cell preparation of the invention permits grafting of the cells to any predetermined site in the brain or spinal cord. It also is possible to effect multiple grafting concurrently, at several sites, using the same cell suspension, as well as mixtures of cells.

[00158] Following in vitro cell culture differentiation and optional further isolation as described herein, the cells are prepared for implantation. In one embodiment, the cells are suspended in a compatible carrier, such as cell culture medium (e.g., Eagle's minimal essential media), phosphate buffered saline, Hanks balanced salt solution, or artificial cerebrospinal fluid (aCSF). Those of skill in the art are well versed in determining dose. Cell density is generally about 10 ⁴ to about 10 ⁷ cells/μΐ, and in one embodiment about 25,000 to about 100,000 cells/μΐ. The volume of cell suspension to be implanted will vary depending on the site of implantation, treatment goal, and cell density in the solution. For example, for treatments in which cells are implanted into the brain parenchyma, about 5-60 μΐ of cell suspension may be administered in each injection. Several injections may be used in each host, particularly if the lesioned brain region is large. Alternatively, administration via intraventricular injection, for example, will accommodate relatively larger volumes and larger cell numbers (See, for example, Madrazo et al, New Engl. J. Med., 1987, 316:831-834; Penn et al, Neurosurgery, 1988, 22:999-1004). [00159] In some embodiments, the cells are encapsulated within permeable membranes prior to implantation. Encapsulation provides a barrier to the host's immune system and inhibits graft rejection and inflammation. Several methods of cell encapsulation may be employed. In some instances, cells will be individually encapsulated. In other instances, many cells will be encapsulated within the same membrane. Several methods of cell encapsulation are well known in the art, such as described in

European Patent Publication No. 301,777, or U.S. Pat. Nos. 4,353,888, 4,744,933, 4,749,620, 4,814,274, 5,084,350, and 5,089,272.

[00160] For administration to a subject, a population of MGE cells, or differentiated progeny derived from such MGE cells can be provided in any pharmaceutically acceptable composition. These pharmaceutically acceptable compositions comprise a population of cells, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents.

[00161] In one method of cell encapsulation, the isolated cells are mixed with sodium alginate and extruded into calcium chloride so as to form gel beads or droplets. The gel beads are incubated with a high molecular weight (e.g., MW 60-500 kDa) concentration (0.03-0.1% w/v) polyamino acid (e.g., poly-L-lysine) to form a membrane. The interior of the formed capsule is re-liquified using sodium citrate. This creates a single membrane around the cells that is highly permeable to relatively large molecules (MW ~200-400 kDa), but retains the cells inside. The capsules are incubated in physiologically compatible carrier for several hours in order that the entrapped sodium alginate diffuses out and the capsules expand to an equilibrium state. The resulting alginate-depleted capsules is reacted with a low molecular weight polyamino acid which reduces the membrane permeability (MW cut-off ~40-80 kDa).

[00162] As used here, the term "pharmaceutically acceptable" refers to those

compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The term "pharmaceutically-acceptable carrier" means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient,

manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.

[00163] Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation. The terms such as "excipient", "carrier", "pharmaceutically acceptable carrier" or the like are used interchangeably herein.

[00164] As used herein, a "subject" means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters.

Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. Patient or subject includes any subset of the foregoing, e.g., all of the above, but excluding one or more groups or species such as humans, primates or rodents. In certain embodiments of the aspects described herein, the subject is a mammal, e.g., a primate, e.g., a human. The terms, "patient" and "subject" are used interchangeably herein.

[00165] Preferably, the subject is a mammal. Mammals other than humans can be advantageously used as subjects that represent animal models of disorders associated with neural disfuntion. In addition, the methods and compositions described herein can be used to treat domesticated animals and/or pets.

[00166] In methods of treatment of the invention, a subject can be one who has been previously diagnosed with or identified as suffering from or having a disorder characterized with a disease for which the MGE stem cell based therapy would be useful. Thus in some embodiments, the methods further comprise selecting a subject with a disease that would benefit from a stem cell based therapy, e.g. a subject diagnosed as having a neurological disease or disorder.

[00167] As used herein, the term "neurological disease" or "neurological disorder" comprises a disease or a state characterized by a central nervous system (CNS) having abnormal inhibitory neuron signaling, e.g. a lack of neurotransmitter secreted by GABA neurons. Non-limiting examples of such neurological disorders include, e.g. Alzheimer's disease, Parkinson's disease, Huntington's disease, Autism, epilepsy, schizophrenia, and autism.

[00168] Methods for the diagnosis of such neurological disorders are well known to those of skill in the art. For example, epilepsy may be diagnosed by details of the patients medical history, blood tests, EEG tests, and brain imaging tests such as CT and MRI scans. An MRI of the brain is considered the standard radiology procedure to see the characteristic abnormalities associated with medial temporal lobe epilepsy. Genetic testing can also be done.

[00169] In certain embodiments, the amelioration of symptoms is measured by

monitoring a decrease in seizure activity. For example, a patient can be monitored over a given period of time and the frequency of seizures assessed over that defined time period before and after treatment. Suppression of seizure activity may be indicated at a decrease of about 10%, about 30%>, about 50%>, about 60%>, about 70%>, about 80%), or more, as compared to frequency observed prior to treatment.

[00170] In certain embodiments, the amelioration of symptoms is measured by

monitoring for an increase in cognitive ability, e.g. in Alzheimer's disease or

Epilepsy. Improved cognitive ability may be indicated at an increase of about 10%, about 30%, about 50%>, about 60%>, about 70%>, about 80%>, or more, as compared to cognitive ability observed prior to treatment.

[00171] In certain embodiments, the amelioration of symptoms is measured by

monitoring for improved motor neuron movement, e.g. in Parkinson's disease, Huntington's disease. Improved motor neuron control may be indicated at an increase in ability to voluntarily control muscle movement by about 10%, about 30%, about 50%), about 60%o, about 70%>, about 80%>, or more, as compared to voluntary movement observed prior to treatment.

[00172] In certain embodiments, the amelioration of symptoms is measured by

monitoring for decreased anxiety or in hallucinations, e.g. in schizophrenia, a decrease of about 10%>, about 30%>, about 50%>, about 60%>, about 70%>, about 80%>, or more, as compared to frequency observed prior to treatment.

[00173] Methods for monitoring seizure disorders are well known in the art and

include for example those described in US 8684921, which describes methods for detecting, assessing, and managing epilepsy using a multi-variate, metric-based classification analysis, which is herein incorporated by reference in its entirety.

[00174] In one aspect of the invention, a method for suppression of spontaneous

seizure activity is provided. The method comprises administering to a subject in need MGE cells that are derived from pluripotent stem cells. In one embodiment the subject has epileptic seizures. In one embodiment, the subject is diagnosed as having temporal lobe epilepsy.

[00175] Epileptic seizures are characterized by unpredictable abnormal electrical discharge, loss of consciousness and convulsions, and they are experienced by one in 26 individuals at some point in their lifetime (Jensen, 2014 of Example 2 references). One of the most common forms of seizures is temporal lobe epilepsy (TLE), characterized by epileptic abnormalities in the hippocampus, parahippocampal gyrus and amygdala (Engel, 2001 of Example 2 references). About one third of patients with TLE exhibit intractable seizures that cannot be controlled by anti-epileptic drugs (AEDs) (Engel, 2002 of Example 2 references), and surgical resection of the seizure focus may be necessary (Christoph, 2008 of Example 2 references). Patients who are not candidates for surgery must live with ongoing seizures - in many cases, multiple events in a single day. Although AEDs can reduce or eliminate seizures for the more fortunate patients, these medicines are associated with diverse and troublesome side effects, including weight gain, metabolic acidosis, hepatotoxicity, movement disorders, and mental status changes (Cramer et al., 2010 of Example 2 references; Walia et al., 2004 of Example 2 references).

[00176] A key pathological feature of human TLE is synaptic reorganization, including neuronal loss and gliosis in CA1 and hilus, granule cell dispersion, and mossy fiber sprouting in the dentate gyrus (Wieser, 2004 of Example 2 references). Examination of excised epileptic tissue from TLE patients has revealed a loss of GABAergic interneurons (de Lanerolle et al., 1989of Example 2 references; Marco et al., 1996 of Example 2 references; Spreafico et al., 1998 of Example 2 references). It is believed that a decrease in GABA-mediated inhibition is a critical contributing factor in epilepsy.

[00177] Using highly efficient methods for generating medial ganglionic eminence (MGE) cells from human PSCs as described herein, we transplanted a homogeneous cell population of human MGE cells into pilocarpine-induced TLE mice, a well- characterized model of human TLE (Curia et al., 2008 of Example 2 references) and extensively characterized the biology of human PSC-derived maturing GABAergic interneurons (mGIN) within the epileptic brain. mGIN actively migrate, spreading throughout the entire host hippocampus. Using optogenetic approaches and ultrastructural studies, we have demonstrated that grafted mGIN integrate into the dysfunctional host circuitry, receive excitatory inputs and, in turn, induce inhibitory responses in host neurons by releasing GABA. This ultimately resulted in the reversal of behavioral abnormalities in TLE mice, including spontaneous seizures as well as comorbid cognitive impairment, hyperactivity, and aggressiveness. Accordingly, administration of pluripotent stem cell derived MGE cells address a desperate need for new therapies for seizure disorders.

[00178] In some embodiments of the present invention may be defined in any of the following numbered paragraphs:

[00179] Paragraph 1. A method for the generation of a population of medial ganglionic eminence (MGE) cells from pluripotent stem cells comprising the steps of a) contacting a population of pluripotent stem cells with a SMAD inhibitor to generate a population of cells that express the neuroectoderm cell marker Pax6, b) contacting the cells of step a) with an activator of sonic hedgehog (SHH) to generate a population of cells that express ventral telencephalic neuroectoderm marker Dlxl or Dlxl2; and c) contacting the cells of step b) with an activator of FGF8 signaling to produce a population of cells that comprises an increased percentage of MGE cells that express the transcription factor NKX2.1 as compared to cells of step b) that have not been contacted with the FGF8 activator.

[00180] Paragraph 2. The method of paragraph 1, wherein population of cells of step b) comprises less than 30% of caudal ganglionic eminence (CGE) cells that express the cell marker, CopuTFII.

[00181] Paragraph 3. The method of any of paragraphs 1-2, wherein the MGE cells further express the transcription factor 01ig2.

[00182] Paragraph 4. The method of any of paragraphs 1-3, wherein the activator of

FGF8 signaling is exogenous FGF8 protein, or an exogenous peptidomimmetic of

FGF8 protein.

[00183] Paragraph 5. The method of any of paragraphs 1-4, wherein the MGE cells are capable of differentiating into GABAergic interneurons that express Lhx6 protein and Sox6.

[00184] Paragraph 6. The method of any of paragraphs 1-5, wherein the activator of sonic hedgehog is smoothened agonist (SAG).

[00185] Paragraph 7. The method of any of paragraphs 1-6, wherein the inhibitor of

SMAD comprises LDN193189 and SB431542.

[00186] Paragraph 8. he method of any of paragraphs 1-7, wherein the pluripotent stem cells are human cells.

[00187] Paragraph 9. The method of any of paragraphs 1-8, wherein the pluripotent stem cells are embryonic stem cells.

[00188] Paragraph 10. The method of any of paragraphs 1-9, wherein the pluripotent stem cells are induced pluripotent stem cells.

[00189] Paragraph 11. The method of any of paragraphs 1-10, wherein the pluripotent stem cells are cultured as embryoid bodies.

[00190] Paragraph 12. The method of any of paragraphs 1-11, wherein the pluripotent stem cells are cultured in suspension.

[00191] Paragraph 13. The method of any of paragraphs 1-12, wherein the pluripotent stem cells are cultured as adherent cells. [00192] Paragraph 14. The method of any of paragraphs 1-13, wherein step a) further comprises contacting the population of pluripotent stem cells with an inhibitor of Wnt.

[00193] Paragraph 15. The method of any of paragraphs 1-14, further comprising

differentiating the population of cells comprising MGE cells into GABAergic interneurons that express the cell marker Lhx6 and Sox6.

[00194] Paragraph 16. The method of paragraph 15, wherein the MGE cells are

differentiated by culturing the MGE for a time sufficient to allow for the MGE cells to spontaneously differentiate into GABAergic interneurons.

[00195] Paragraph 17. The method of any of paragraphs 14-16, wherein the

GABAergic interneurons express GABA.

[00196] Paragraph 18. The method of any of paragraphs 14-17, wherein the

GABAergic interneurons further differentiate to express somatostatin or parvalbumin.

[00197] Paragraph 19. An isolated population of cells produced by the method of any of paragraphs 1-18, wherein the isolated population of cells are derived from pluripotent stem cells.

[00198] Paragraph 20. A method for treatment of a neurological disorder comprising administering to a subject in need of treatment the isolated population of cells of paragraph 19.

[00199] Paragraph 21. The method of paragraph 20, wherein the subject in need of treatment is diagnosed as having seizures.

[00200] Paragraph 22. The method of paragraph 21, wherein the subject is diagnosed as having a neurological disorder selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, neuropathic pain, epilepsy, autism, and schizophrenia,

[00201] Paragraph 23. The method of any of paragraphs 19-22, wherein the pluripotent stem cells are allogenic cells.

[00202] Paragraph 24. The method of any of paragraphs 19-23, wherein the cells are administered by transplantation.

[00203] Paragraph 25. A method for suppression of spontaneous seizure activity in a subject comprising administering MGE cells derived from pluripotent stem cells into a subject in need of treatment. [00204] Paragraph 26. The method paragraph 25, wherein the subject is diagnosed as having epilepsy.

[00205] Paragraph 27. The method of any of paragraphs 25-26, wherein the MGE cells are derived from human pluripotent stem cells.

[00206] Paragraph 28. The method of any of paragraphs 25-27, wherein the MGE cells are derived from induced pluripotent stem cells.

[00207] Paragraph 29. The method of any of paragraphs 25-27, wherein the MGE cells are derived from embryonic pluripotent stem cells.

[00208] Paragraph 30. The method of any of paragraphs 25-29, wherein the pluripotent stem cells are allogenic cells.

[00209] Paragraph 31. The method of paragraph 25, wherein the MGE cells are

obtained by the method any of the claims 1-14.

[00210] Paragraph 32. The method of any of paragraphs 25-31, wherein the MGE cells are further differentiated into GABAergic interneurons that express Lhx6 and Sox6 prior to administration to the subject.

[00211] Paragraph 33. The method of any of paragraphs 1-32, wherein the cells are administered by transplantation.

[00212] Paragraph 34. The method of any of paragraphs 1-33, wherein either the MGE cells or interneurons are further isolated from the population by a selection procedure.

[00213] Paragraph 35. The method of any of paragraphs 1-33, wherein the MGE cells in the population are further enriched by purification.

[00214] Paragraph 36. The method of paragraph 34, wherein the MGE cells are

purified using a molecular probe against NKx2.1.

[00215] Paragraph 37. The method of paragraph 36, wherein the molecular porbe is has a nucleotide sequence selected from the group consisting of: SEQ ID NO: 34,

SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39,

SEQ ID NO: 40, SEQ ID NO: 41; and SEQ ID NO: 42.

[00216] Paragraph 38. The method of any of paragraphs 1-33, wherein the GABAergic interneurons in the population are isolated using an antibody against PCPTP1 or

CXCR4 and FACS analysis.

[00217] Pargraph 39: A Method for the isolation of MGE cells from a population of cells wherein the method comprises contacting the cells with a Nkx2.1 specific molecular beacon that binds to live cell mRNA and isolating cells that bind the molecular beacon.

[00218] Paragraph 40. A Method for the isolation of GABAergic interneurons from a population of cells wherein the method comprises contacting the cells with an antibody against PCPTP1 or CXCR4, and isolating the cells that bind the antibody, eg. by using FACS analysis.

[00219] It is understood that the foregoing detailed description and the following

examples are illustrative only and are not to be taken as limitations upon the scope of the invention. Various changes and modifications to the disclosed embodiments, which will be apparent to those of skill in the art, may be made without departing from the spirit and scope of the present invention. Further, all patents, patent applications, and publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the

methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the correctness of the dates or contents of these documents.

[00220] EXAMPLE 1

[00221] Here we show that SHH activation during early human neural development elicits a pleiotropic downstream cascade, by inducing rostralizing FGF8 signaling as well as caudalizing FGF15/19 signaling, as observed during early mouse development [6, 20-24]. Such dual effect of SHH on rostral-caudal boundary determination can cause MGE derivation stochasticity depending on the fine balance of its downstream cascade. Thus, by combining early activation of SHH with exogenous rostralizing factor FGF8, we reliably induced MGE cells using early and strong SHH activation (>80% by FACS) from multiple hPSCs. These cells shared characteristics with their in vivo counterpart, such as spontaneous differentiation into Lhx6-expressing and migrating GABAergic interneurons that can generate GABA, fire action potentials and form functional GABAergic synaptic connections. Transplantation of human MGE cells into rodent brains yields well-contained neural grafts enriched with GABAergic interneurons that migrate in the host brain and mature to express somatostatin or parvalbumin.

[00222] Methods

[00223] PSC culture and differentiation

[00224] Human PSC cells (H9 ESCs (WA09, WiCell, Madison, WI, passage 45-55), H7 ESC (WA07, WiCell, passage 41-51) and iPSC2497 (a kind gift from Dr. Fred Gage, [14], passage 30-40) were maintained on Matrigel (BD, San Hose, CA) in mTeSR media (Invitrogen, Calsbad, CA) with lOng/ml bFGF (Peprotech, Rocky Hill, NJ), and passaged using Dispase (Stem Cell Technologies, Vancouver, BC, Canada). For differentiation, PSCs were trypsinized and grown as floating aggregates in low adherent flasks in KSR media (20% knockout serum replacement, DMEM, 2mM L- glutamine and 10 μΜ β-mercaptoethanol (all from Invitrogen)). Rock inhibitor (Y- 27632, 10 μΜ, Tocris, Bristol, United Kingdom) was added on the first day of differentiation. After two weeks of floating culture, cells were transferred to polyornithine (PLO; 15 mg/ml; Sigma, St. Louis, MO) and fibronectin (FN; 1 mg/ml; Sigma, St. Louis, MO) coated surfaces. For neural induction, cells were treated with LDN193189 (100 nM, Stemgent, Cambridge, MA) from dO to dl4 and with

SB431542 (10 μΜ, Tocris) from dO to d7 [25]. For MGE induction, cells were treated with IWP2 (5 μΜ, EMD Millipore) from dO to d7, with SAG (0.1□ DM, EMD Millipore) from dO to d21, and with FGF8 (lOOng/ml, Peprotech) from d8 to d21. After 3 weeks of differentiation, cells were trypsinized and droplets of 10,000 cells/ μΐ transferred to PLO/FN-coated coverslips in differentiation media (N3 media [26] with lOng/ml GDNF (Peprotech), lOng/ml BDNF (Peprotech) and 2.5 μΜ DAPT (Tocris)) for further differentiation and maturation.

[00225] For Matrigel two dimensional migration analysis, MGE cells or control cells (Pax6+ cells without IWP2, SAG and FGF8 treatment) were trypsinized at day 21 of differentiation and reaggregated in low attachment round bottom 96 well plate in differentiation media (10,000 cells per well). MGE spheres or cortical spheres were plated on coverslips coated with 1 : 100 diluted Matrigel in differentiation media after 25 days of further differentiation and analyzed 5 days after plating. For analysis of migrating cell numbers, total cell numbers that migrated out of the spheres were counted, and then the cells were trypsinized to count the total cell numbers for normalization. For measuring migration distances, ImageJ software was used to assess each cell migration distance between the edge of the sphere and the center of the migrating cell body. Some of the spheres were also fixed for

immunocytochemistry analysis.

[00226] For Matrigel two dimensional migration analysis of mouse explant, El 3.5 embryos were removed one at a time from anesthetized CD1 dams, brains were isolated, embedded in 8% low gelling temperature agarose (Sigma) and cut at a thickness of 300 μιη on a vibratome in the coronal plane. Both cortical and medial ganglionic eminence (MGE) regions were punched out from these coronal sections using a micro-punch (Guide wire and tube assembly, 19 gauge; Inner Diameter 0.027", Small Parts Inc. Miami Lakes, FL) and collected in Neurobasal medium. El 3.5 cortex or MGE explants were plated on coverslips coated withl : 100 diluted Matrigel, and analyzed the same way as the human spheres.

[00227] For Matrigel three dimensional migration analysis, MGE explants or human MGE spheres were embedded in undiluted 3D matrigel matrix, cultured in differentiation media and their migration was analyzed 2 days after embedding.

[00228] Slice transplantation analysis

[00229] E 13.5 embryos were collected by hysterotomy of deeply anesthetized CD 1 dams (Ketamine, 50 mg/kg and Xylazine, 10 mg/kg; i.p.) and decapitated

immediately. Embryonic brains were isolated and embedded in 8% low gelling temperature agarose (Sigma). Coronal slices (250-300 μιη thick) of telencephalon were prepared and transferred to polycarbonate membrane filters (Invitrogen) in sterile six well plates containing Neurobasal medium (Invitrogen). Control spheres and MGE spheres, that were prepared as described above and pre-labeled with QDot 655 nanocrystals (Invitrogen) according to the manufacturer's instructions (cells incubated in ΙΟηΜ labeling solution at 37°C for an hour), were inserted using fine tungsten needles into the ventral telencephalon of CD1 slices under a high power stereomicroscope. Slices were cultured for 48 hours, fixed in zinc fixative (BD Pharmingen) and processed for paraffin wax histology. NCAM

immunohistochemistry was performed on 20 μιη thick paraffin sections with a mouse monoclonal anti-NCAM antibody raised against CD56 positive cells of human origin (SantaCruz) and mounted with DAPI (Vector Laboratories). Other antibodies used were mouse anti-human cytoplasm antibody (Stem Cell Inc.) and cy3 -conjugated anti- human Nuclei antibody (Millipore). Images were captured from an FSX100 microscope (Olympus The number of NCAM+ cells that migrated from ventral to dorsal telencephalon in the three panels depicted in the schema was determined by ImageJ software and average values obtained. Statistical significance of differences between groups was analyzed by two-tailed Student's t-test (Prism6; GraphPad software). Results were expressed as mean ± SD and statistical significance was reported at P<0.05.

[00230] FACS analysis

[00231] Differentiated cells were trypsinized and fixed in Fix/Perm solution (BD) for 30 min., and incubated with blocking buffer (PBS with O. lmg/ml BSA and 0.1% Saponin (both from Sigma, St. Louis, MO)) for 10 minutes. Blocked cells were incubated with primary antibody (anti-Nkx2.1; Epitomics) in blocking buffer for 30 minutes. After washing with PBS, Alexa 647-conjugated secondary antibodies (Invitrogen) were added (1 : 1000) and incubated for another 15 minutes. Some samples were incubated only with secondary antibody as control. After washing with PBS, cells were suspended in blocking buffer and analyzed using a FACSAria (BD Biosciences, San Jose, CA). Flowjo (Tree Star, Ashland, Or) software was used to analyze raw data. Ten thousand cells were used per analysis.

[00232] Real time PCR analysis

[00233] Total RNA was prepared using Trizol (Invitrogen) and Purelink RNA mini kit (Invitrogen). cDNA from total RNA was generated using the SuperScriptTM II RT (Invitrogen, Carlsbad, CA) and oligo (dT) primers. For quantitative analysis of the expression level of mRNAs, real-time PCR analyses were performed using the DNA engine OpticonTM (MJ Research, Waltham, MA) and SYBR green I (Molecular Probes, OR). Primers were designed using the MacVector software (Oxford

Molecular Ltd.: primers sequences are available upon request). PCR were performed in 25 μΐ containing 0.5 mM of each primer, 0.5 X SYBR Green I (Molecular Probes), and 1 μΐ of cDNA. Fifty cycles consisting of 95oC for 30 sec, 55°C for 30 sec, 72°C for 30 sec, and 79°C for 5 sec. were performed. Primer dimers were melted at 79oC before measuring the fluorescent signals after each cycle. The mRNA expression level for each gene was normalized against that of the GAPDH gene. The relative values were calculated by setting the normalized value of control as 1. [00234] Immunocytochemistry & immunohistochemistry

[00235] For immunofluorescence staining, fixed cells or tissue sections were incubated with blocking buffer (PBS, 10 % normal donkey serum (NDS)) containing

0.1%Triton for 10 minutes. Cells were then incubated overnight at 4°C with primary antibodies diluted in PBS containing 2% NDS. The primary antibody list can be found in table 1. After rinsing with PBS, samples were incubated with fluorescent dye- labeled secondary antibodies (Alexa 488- Alexa 594 - or Alexa 647-labeled IgG; Invitrogen, Carlsbad, CA) in PBS containing 2% NDS for 30 minutes at room temperature. After rinsing with PBS, Hoechst 33342 (4 mg/ml) was used for counterstaining, and coverslips/tissues sections were mounted onto slides in Mowiol 4-88 (Calbiochem, Gibbstown, NJ). Confocal analysis was performed using an Olympus DSU Spinning Disc Confocal on an 1X81 inverted microscope (Center Valley, PA).

[00236] Cell counting and statistical analysis

[00237] Cells were counted using the Stereolnvestigator image capture equipment and software (Microbright Field, Williston, VT). For counting of cells on cover slips, an optical fractionator probe was used with a 500μιη x 500 Dm grid size and ΙΟΟμιη x 100mm counting frame (>40 counting sites with >1000 total cells counted per sample) at 40x magnification. Covers lips from 3-4 independent differentiations were used for analysis. For statistical analysis, we performed t-test (alpha=0.05) comparing control vs. sample using Prism6 software (Graph Pad).

[00238] HPLC assay

[00239] Cellular GABA content was measured by HPLC from MGE cells and cortical cells as control after 60 days of differentiation, as described previously [26]. Cells were homogenized, using a tissue dismembrator, in 100-750 μΐ of 0.1M TCA supplemented with 10-2 M sodium acetate, 10-4 M EDTA, 5ng/ml isoproterenol (as internal standard) and 10.5 % methanol (pH 3.8). Samples were spun in a

microcentrifuge at 10000 X g for 20 minutes. Supernatants were collected and analyzed by HPLC while protein determination was performed on the pellets for normalization of the HPLC data. Amino Acids were determined by the Waters AccQ- Tag system utilizing a Waters 474 Scanning Fluorescence Detector. The Empower 2 software was used to control the HPLC gradient profile and data acquisition. [00240] Electrophysiological analysis

[00241] MGE cells were differentiated for 6 or 12 weeks in differentiation media and transferred into a recording chamber that was continuously perfused with artificial cerebrospinal fluid containing 130 mM NaCl, 2.5 mM KC1, 2.5 mM CaC12, 1 mM MgS04, 1.25 mM NaH2P04, 26 mM NaHC03, and 10 mM glucose with 95 % 02 and 5 % C02 at a rate of 1 mL per minute at room temperature (21-23°C). Whole-cell patch clamp recordings were performed at 24-25°C using an EPC-9 amplifier and Pulse v8.8 software (HEKA Elektronik). The patch electrodes (2-3 MD resistance) were filled with a solution of 140 mM KC1, 5 mM NaCl, 1 mM MgC12, 10 mM HEPES, 0.2 mM EGTA, 2 mM Mg ATP, and 0.5 mM Na GTP (285 mOsm, adjusted to pH 7.3 with KOH). Liquid junction potential of 3.1 mV was not corrected. Series resistance was compensated at 50-60 %. Offline data analysis was performed using the Clampfit 9 program (Molecular Devices). Reagents were purchased from Tocris Bioscience (tetrodotoxin) or Sigma- Aldrich (bicuculline methochloride).

[00242] Transplantation analyses

[00243] The Animal Care and Use Committee at McLean Hospital approved all animal procedures. H9-derived MGE cells at 5 weeks of differentiation were trypsinized and suspended to a final concentration of 50,000 cells/ μΐ in transplantation media (HBSS with lOng/ml GDNF, lOng/ml BDNF and 20μΜ Boc-Asp(OMe) fluoromethyl ketone (BAF; Sigma-Aldrich)). One μΐ was injected into each striatum of NOD SCID mice (from the bregma: AP +0.05, L +0.18, V -0.30, IB 9) using a 22-gauge, 5 ml

Hamilton syringe and a Kopf stereotaxic frame (Kopf Instruments, Tujunga, CA). Cortically induced cells without signaling pathway activation were also transplanted as control (n=10). Before surgery, mice received an i.p. injection of acepromazine (3.3mg/kg, PromAce, Fort Dodge, IA) and atropine sulfate (0.2 mg/kg, Phoenix Pharmaceuticals, St. Joseph, MO) followed by anesthesia with an i.p. injection of ketamine (60 mg/kg, Fort Dodge) and xylazine (3 mg/kg, Phoenix Pharmaceuticals). Transplanted mice were terminally anesthetized with an i.p. overdose of pentobarbital (150 mg/kg, Sigma) and perfused intracardially with heparin saline (0.1% heparin in saline) followed by formaldehyde (4%) 5 weeks or 5 months post grafting. Brains were removed, postfixed in 4% formaldehyde, equilibrated in 20% sucrose, and 40- mm coronal slices obtained using a freezing microtome. The Stereolnvestigator image-capture equipment and software (MicroBrightField) were used for cell counting and estimation of total cell number in the graft using the serial section manager tool from every 6th sections. Total graft volume was also measured using the Stereo Investigator with the Cavalieri estimator probe and serial section manager tool from every 6th sections.

[00244] Results

[00245] MGE cell specification from hPSCs recapitulates in vivo signaling pathways

[00246] During early development, signaling molecules from organizers direct early neuroectoderm phenotype specification. Thus, to optimize the phenotype specification of MGE cells from hPSCs, we sought to understand temporal and combinatorial regulations by relevant signaling molecules. H9 cells were differentiated as floating spheres in the presence of LDN193189 and SB431542 to facilitate differentiation into neuroectodermal lineages of hPSCs [25]. Inhibition of Wnt signaling was shown to induce telencephalic identity during neural plate formation [27, 28], and thus, we used IWP2, a chemical inhibitor of Wnt signaling, to enhance rostralization of early neuroectoderm and subsequently to inhibit dorsalization of neuroectoderm[29]. We first tested the dosage of SHH signaling on phenotype specification of early neuroectoderm, since the degree of SHH activation regulates the subregional identity of LGE vs. MGE within the ventral telencephalon [23]. At ΙΟηΜ SAG (Smoothened agonist), there was modest increase in MGE specification, but at lOOnM SAG, there was significantly higher induction of the MGE phenotype (Fig. la). However, when we analyzed the expression of isll, a general ventral telencephalic marker that is expressed in both MGE- and LGE-derived cells, there was no significant difference between lOnM and lOOnM SAG, suggesting that with high SHH activation, the number of MGE cells increased at the expense of LGE cells. Thus, we used lOOnM SAG for subsequent MGE induction experiments.

[00247] We next tested the optimal treatment time frame of each signaling molecules.

Since we observed most of the cells express Pax6 by day 7 of differentiation (Fig. 2a- 2b), we tested whether modulation of Wnt and SHH signaling is optimal during or after neuroectoderm formation. With treatment starting at day 0 of differentiation, there was a significant increase in MGE specification compared to treatment starting at day 7 (data not shown; IWP + SAG 6.77% vs. 24%), suggesting that

regionalization signaling during early differentiation is more efficient than after neuroectoderm formation. Differentiating hPSCs were also treated with IWP2 or SHH alone or in combination. With single molecule treatment, there was only a mild increase in MGE specification, but the combination of Wnt blocker and SHH activator yielded a synergistic increase in MGE specification (data not sown; 5.16% or 0.79% vs. 24%; with a day 0 start day). We observed similar results with Nkx2.1 mR A expression levels by real time PCR (Fig. 2a). Since SHH continues to be required for Nkx2.1 expression, even after initial specification of ventral telencephalic identity [30], we tested whether additional treatment with SHH is beneficial for MGE induction. SAG treatment in the 3rd week of differentiation increased Nkx2.1 level mildly but significantly (FACS analysis data not shown).

48] Conflicting results from recent studies on early activation of the SHH pathway [17, 18] prompted us to investigate the downstream events triggered by SHH activation during early differentiation. As expected from previous studies [31, 32], there was strong induction of Glil activator by SHH activation, as well as strong Gli3 expression reduction (Fig. lb). Repression of Gli3 is accompanied by induction of the rostralizing signal FGF8 [6, 31], but at the same time, early SHH activation also induced the expression of FGF15/19 (Fig. lb), which antagonizes the rostralizing effect of FGF8 during mouse telencephalic development, [22, 24]. Thus, to compensate the effect of FGF15/19 induction by strong SHH activation, we tested the effect of exogenous addition of FGF8, to shift the balance toward rostralization. In the absence of FGF8 signaling, both MGE and CGE phenotypes appear, as shown by Nkx2.1 expression and CoupTFII expression (Fig. lc, images not shown). FGF treatment in the 2nd and/or 3rd week of differentiation significantly increased MGE differentiation at the expense of CGE differentiation (Fig. lc, dimages not shwon), successfully counteracting SHH-induced caudalizing effect of FGF 15/19.

Furthermore, applying FGF 19 exogenously instead of FGF8, resulted in most of the cells taking up CGE identity (Fig. 3a, images not shown), further supporting the role of FGF8/FGF19 signaling in determining rostral/caudal telencephalic identity.

Exogenous addition of FGF 19 increased diencephalic differentiation as shown by Nkx2.2 expression (images not shown; 0.61 +0.38%) Nkx2.2+/total cells vs. 4.19 +0.77% Nkx2.2+/total cells for FGF8-treated and FGF19-treated cells, respectively, n=4), but diencephalic cells remained a minority even with FGF 19 treatment, suggesting that employment of early Wnt inhibitor successfully rostralized the early neuroectoderm to telencephalic identity. Since it has been reported that FGF8 can induce FGF19 expression during CNS development [33], we tested such possibility in our system. Exogenous application of FGF8 did increase FGF19 expression mildly but significantly, whereas exogenous application of FGF19 had no effect on FGF8 expression (Fig 3b amd 3 c).

[00249] Generated CGE cells express another CGE marker Sp8 (images not shown;

61.76 + 7.86% Sp8+/total cells, n=4). CoupTFII+ cells seldom co-express Nkx2.1 (images not shown) further supporting their CGE identity rather than dorsolateral or caudal MGE nor co-express diencephalic marker Nkx2.2 (data not shown). After further differentiation, these CoupTFII-expressing cells generated VIP-expressing or Calretinin-expressing neurons (Suppl. Fig. 3d and f; 10.46 +1.35% VIP+/total cells and 16.77 +5.36% Calretinin+/total cells, n=4), consistent with their CGE identity [1], whereas only a few stratal projection neurons and no Somatostatin-expressing nor Parvalbumin-expressing neurons were present (images (data not shown); 1.42 +0.49% Isll+/total cells and 1.06 +0.54% Darpp32+/total cells, n=4).

[00250] Optimized induction conditions efficiently generate MGE cells from multiple hPSCs

[00251] Thus, our optimized conditions employ blocking Wnt signaling in the 1st and 2nd week of differentiation, strong activation of the SHH pathway for the 1st three weeks of differentiation and FGF8 signaling in the 2nd and 3rd week of

differentiation (Fig. 4a). Real time PCR analysis under these optimal conditions showed that pluripotent stem cell markers Nanog and Oct4 expression is

downregulated by day 3, and expression of ventral telencephalic markers Nkx2.1 , GSX2, DLX2 become evident starting at day 14, followed by expression of the postmitotic MGE marker Lhx6 at day 21 (Fig. 4b). We differentiated two human embryonic stem cell (hESC) lines (H7 and H9) and one induced pluripotent stem cell (iPSC) line (iPSC2497) using MGE-inducing signals, and observed efficient MGE derivation (Nkx2.1+) at day 25 of differentiation, whereas in absence of MGE- inducing signals (IWP2, SAG and FGF8) all cells were of the dorsal telencephalic fate (Pax6+) (data not shown). FACS analysis revealed that more than 80% of the total cells were induced to the MGE phenotype (Fig. 4c). Further immunocytochemistry analysis (data not shown) revealed that the majority of induced cells also express independent MGE markers 01ig2 (71.8+3.7% of total cells, n=4) and FoxGl

(89.8+2.0% of total cells, n=4).

[00252] Human MGE cells generate GABAergic interneurons

[00253] Further differentiation of MGE cells efficiently generated GABAergic

neurons, based on GAD expression (Fig. 5a and data not shown; 69.1+4.1%>

GAD+/total cells with 86.3+ 4.0% -tubulin+/total cells), whereas without this treatment, few GAD expressing neurons were observed (Fig. 5a and data not shown). In fact, absence of MGE inducing signaling yielded mostly glutamatergic neurons after differentiation (data not shown), as expected from their Pax6+ dorsal

telencephalic identity. Robust induction of GABAergic neurons was also observed from H7- and iPSC2497-derived neurons under our optimized conditions (data not shown; 88.8+2.1% vs. 84.4+3.4% GABA+/ -tubulin+ cells. p=0.32, n=4). These GABAergic neurons express Lhx6, showing their MGE origin, however under control conditions no Lhx6-expressing cells were observed (Fig. 5b). H7 and iPSC2497 cells also robustly generated Lhx6+ neurons under MGE-generating conditions (data not shown; 77.6+4.5% vs. 74.4+3.0% Lhx6+/ -tubulin+ cells. p=0.56, n=4). In addition, these GABAergic neurons co-express Sox6 (data not shown; 88.2+2.5%) Sox6+/ GABA+ cells. p=, n=4), that was recently shown to be very specific marker for human MGE-derived interneurons [34]. Some of these cells expressed Calbindin (22.23 ± 6.0%) total cells, n=4; data not shown), which is expressed in some of the migrating interneurons. Some of these cells express more mature interneuron markers Parvalbumin (0.87 ± 0.32% of total cells, n=4; data not shown) and Somatostatin (1.53 ± 0.57%) of total cells, n=4; data not shown) at this time point, as would be predicted from their MGE origin. We also observed the presence of minority of cells with alternate phenotypes at this time point (data not shown; 0.86 +0.38%

Nkx2.2+/total cells, 1.24 +0.47% isll+/total cells, 0.32+0.16% ER81+/total cells, 0.63+0.36% ChAT+/total cells, 2.75+1.05% Tbrl+/total cells, n=4). No midbrain dopaminergic neurons are observed (data not shown), consistent with our and other's previous study showing activation of Wnt signaling is important for specification of midbrain dopaminergic neurons [35, 36], whereas in the current protocol active inhibition of Wnt signaling was employed. Very few VIP-expressing or Calretinin- expressing cells were observed at this time point (data not shown). In addition, there were small number of olig2-expressing cells (2.86+1.37% total cells, n=4), but few mature astrocyte or oligodendrocyte differentiation observed at this time point (data not shown), as expected from the long time it takes for human glia cells to mature [37-39]. In the absence of FGF8 treatment, many CGE cells were generated as determined by Immunocytochemistry after 25 days of differentiation without FGF8 treatment; Immunocytochemistry after 60 days of differentiation with or without FGF8 treatment; and Immunocytochemistry after 60 days of differentiation without FGF8 treatment (data not shown).

[00254] Immunocytochemistry analysis on MGE cells at day 60 of differentiation: few Glutamatergic neurons are generated from MGE cells, whereas many glutamatergic neurons are generated from Pax6+ cells differentiated without added

ventralizing/rostralizing signaling modulations (data not shown).

[00255] During embryonic development, interneurons show robust tangential

migration all the way to the developing cortex. We therefore tested whether hPSC- derived interneurons show such migratory characteristics. We reaggregated MGE- derived cells or uninduced control cells in low attach round bottom 96 well plates, and plated spheres on Matrigel coated surfaces. Five days after plating, migration out of MGE cells clusters was observed compared to control clusters, and was expressed in terms of migrating cell numbers and migration distances (Fig. 6a to 6b). Similar migration pattern was observed on matrigel-coated surfaces using mouse cortical vs. MGE explant culture (Fig. 7a to 7b. In addition, when we embedded MGE explant and human MGE sphere in 3 dimensional matrigel matrixes, they also showed comparable migration pattern (data not shown).

[00256] Heterochronic micro-transplants were performed to test whether human MGE cells can migrate toward the cortex as in the case of in vivo development. Control and MGE spheres pre-labeled with QDot® nanocrystals were transplanted into the ventral telencephalon (MGE) of slices prepared from El 3.5 CD1 embryos and cultured for two days. Slices were processed for paraffin histology and 20 μιη thick sections were used for immunohistochemistry and subsequent analysis. We binned the migration into three panels and performed a precise quantification of cell migration along the rostro-caudal axis in control and MGE sphere transplantations (Fig. 6c). Transplanted cells were detected by QDot® fluorescence and additionally human NCAM, human nuclei and human cytoplasm markers (data not shown). Cells that emanated from MGE spheres migrated robustly (data not shown) and a significant number of cells that were QDot® positive (data not shown) and NCAM positive (data not shown) were found in the dorsal telencephalon. In sharp contrast, cells from control spheres were found close to the transplantation site (data not shown). QDot® positive (data not shown) and NCAM positive (data not shown) cells were markedly reduced in the dorsal telencephalon in control sphere transplantations. Migratory cell morphology was detected with human NCAM and human cytoplasm antibodies at high

magnifications (data not shown). A human nucleus marker was used to further characterize identification and visualization of cell migration from transplanted control and MGE spheres (data not shown). While fewer cells migrated from control spheres (data not shown), robust cell migration was observed from MGE spheres (data not shown), depicting robust migration in the ventral telencephalon en route to the dorsal telencephalon. Cell counting analysis of migrating NCAM+ cells showed significantly more MGE cells compared to control cells along the route of tangential migration from ventral to dorsal telencephalon (Fig. 6d).

57] HPLC analysis showed that generated interneurons produce robust GABA levels compared to control cells (Fig. 8a). One important functional characteristic of neurons is synapse formation to communicate with other neurons. Thus, we tested whether these MGE-derived neurons are able to form synaptic connections.

Immunocytochemistry analysis followed by confocal microscopy showed that GABA-expressing neurites co localized or juxtaposed with Synaptophysin foci, a presynaptic protein (data not shown). Next, we examined whether MGE-derived cells have neuronal membrane properties using whole-cell patch clamp technique (data not shown). In current-clamp mode, injection of depolarizing currents to 6-week-old cells induced action potential firings in 4 out of 5 cells, whereas for 12-week-old cells all 10 cells examined fired action potential (Fig. 8b). Most 6-week-old cells displayed single action potentials, whereas 12-week-old cells started to show repetitive action potentials with uniform interspike intervals (one out of ten cells). Moreover, in voltage-clamp mode, voltage pulses evoked both transient inward currents and sustained outward currents, which were activated at membrane potential > -40 mV in all 6 cells examined (Fig. 8c to 8d). Rapidly desensitizing inward currents were completely blocked by tetrodotoxin, a voltage-gated Na+ channel blocker, suggesting these cells express voltage-gated Na+ channels. Next, we examined spontaneous postsynaptic currents to determine whether these cells form functional synapses. In voltage-clamp mode at -70 mV, spontaneous currents were detected in all 11 cells examined. These currents were blocked almost completely by bicuculline, a

GABAA receptor inhibitor (Fig. 8e to 8f), indicating that the inhibitory

neurotransmitter GABA mediated most of the spontaneous postsynaptic activities recorded in these cells. These results suggest that cells derived from hESCs form functional GABAergic synapses.

[00258] Human MGE-derived cells generate well-contained neural grafts enriched with GABAergic neurons

[00259] To analyze the in vivo behavior of human MGE-derived cells, we transplanted H9-derived interneurons at 5 weeks of differentiation into the striatum of NOD SCID mice. Control cells with dorsal telencephalic patterning were also transplanted for comparison. Whereas control cells massively proliferate and form big grafts with rosette structures (Fig. 6a-d) reminiscing of their massive proliferation during human brain development, MGE-derived cells form well-contained grafts (data not shown). Supporting this observation, the average graft volume of cortical cells was 2.22 + 0.64mm3, whereas that of MGE-derived cells was 0.21 + 0.07 mm3 (Fig. 9). Five weeks post grafting, some cells were observed to have migrated out of the MGE graft core into the host brain, but, more cells migrated out of the graft core five months after grafting (data not shown, Fig. 10; 4810 + 1309 cells per graft (n=10) for 5 week grafts and 5438+2082 cells per graft (n=5) for 5 months grafts), sometimes with no graft core at all with even distribution of the grafted cells throughout the entire striatum (data not shown). MGE-derived cells generated mostly neural grafts, shown by co-labeling of human nucleus with NeuN (data not shown; 77.5+7.0%

NeuN+/Human Nuclei+ cells) and β-tubulin (data not shown). Some of the these cells retained Nkx2.1 expression (data not shown; 27.57 + 7.83% Nkx2.1+/Human Nuclei+ cells) at 5 weeks post transplantation, and some of them expressed the MGE-derived interneuron specific transcription factor Lhx6 (data not shown; 22.53+2.78%

Lhx6+/Human Nuclei+ cells), which is expressed in all MGE-derived migrating immature interneurons and subsequently is down regulated in some of mature MGE- derived interneurons [1]. Transplanted cells generated grafts largely composed of GABAergic interneurons, shown by coexpression of GABA with human NCAM and human nuclei (data not shown; 58.97 + 4.52%>GABA+/human Nuclei+ cells). At 5 weeks post grafting, there were small portion of immature proliferating cells present in the graft, which was further reduced by 5 months post grafting (data not shown; 5.59+3.46% and 1.05 +0.74% Ki67+/Human Nuclei+ cells, respectively). There are minority of cells with alternate phenotypes as shown in data not shown (0.69 +0.38% Nkx2.2+/Human Nuclei+ cells, 4.48 +1.02% CoupTFII+/Human Nuclei+ cells, 0.72+0.31% ER81+/Human Nuclei+ cells, 0.89+0.52% Darpp32+/Human Nuclei+ cells, 0.95+0.33% Tbrl+/Human Nuclei+ cells and 1.05+0.62% ChAT+/Human Nuclei+ cells). There were few astrocytes or oligodendrocytes at this time point (data not shown). PSD95 foci overlapped with human specific NCAM+ fibers (data not shown), suggestive of glutamatergic synaptic connection from the host to the graft. Synaptic connection with the host brain was also indicated by co-localization or juxtaposition of human NCAM with Synaptophysin foci (data not shown). In the same line, many VGAT foci were observed juxtaposed with Gephyrin foci (data not shown), and Synaptophysin foci with PSD95 foci (data not shown). In addition, in 5 months old grafts, parvalbumin-expressing or somatostatin-expressing neurons are often observed (data not shown; 15.7+6.1% Parvalbumin+/Human Nuclei+ cells and 17.7+5.9% Somatostatin+/Human Nuclei+ cells), confirming the developmental potential of generated MGE cells.

[00260] Example I Discussion

[00261] Efficient generation of homogeneous populations of specific differentiated progenies of hPSCs is an important prerequisite to realize the full potential of hPSCs for disease modeling, regenerative medicine and bioassays [12]. In this study, employing a stepwise combined and temporal regulation of dorsolateral and rostrocaudal signaling pathways we achieved a very effective and homogeneous differentiation of hPSCs to MGE cells and then to GABAergic interneurons. Recent reports of efficient derivation of MGE cells showed conflicting results on the effect of timing of SHH activation, one study employing early activation of SHH for efficient induction of MGE cells [17], but the other showing that only late activation of SHH resulted in efficient MGE induction with early SHH activation mainly resulting in no MGE induction[18], though both study employed highly similar signaling modulation such as double SMAD inhibition (SB431542 along with BMP inhibitor Noggin or LDN193189), Wnt inhibition (DKK1) and strong SHH activation. In this study, we showed the pleiotropic effect of strong SHH signaling activation during early human neural differentiation, resulting in activation of mutually antagonizing signals. We also identified exogenous FGF8 addition as a way to overcome such pleiotropic and stochastic induction of MGE cell type by strong SHH activation and generated reliable populations of MGE cells, regardless of stochastic shift in SHH downstream signaling.

62] Salient features of our procedure include; first, a more efficient ventral telencephalic phenotype induction achieved by early modulation of Wnt and SHH signaling pathways even before neuroectoderm formation is completed, in line with the previous report [17]. This is consistent with previous developmental studies, where early inhibition of Wnt signaling is important for telencephalic induction of neural plate [27, 28] and early SHH signaling in anterior neural plate at the gastrula stage induces prospective ventral telencephalon, [40] even prior to neural tube formation. Maroof et al., also showed that early SHH activation is more effective in ventralization as illustrated by higher Nkx2.1 induction (>80% vs. about 50%; early vs. late SHH activation), [18] although they failed to fully derive MGE cells using early SHH activation and instead generated diencephalic cells. Second, the combined use of dorsoventral as well as rostrocaudal modulation using developmentally relevant signaling pathways resulted in accumulative increase of MGE induction, into very homogeneous populations. Here we have employed i) induction of neuroectoderm formation by double-SMAD inhibition [25], ii) inhibition of Wnt signaling, which otherwise caudalize [27, 28] and dorsalize [29] differentiating neuroectoderms, iii) strong activation of SHH signaling, resulting in MGE induction at the expense of LGE induction with mild SHH signaling, and iv) activation of FGF8 signaling, which induces the MGE phenotype at the expense of the more caudal CGE phenotype. In a previous study [41], a method using Activin A was shown to induce CGE type cells from mouse and human pluripotent stem cells, generating another important class of cortical interneurons. In the present study, we provide an alternate method to generate human CGE cells that express CoupTFII as well as Sp8 by employing step-wise approach that recapitulates normal embryonic development. To our knowledge, this is the most efficient and massive generation of human CGE cells (upto 80% of total cells). Such combined and temporal activation was also observed during

differentiation of mouse ESCs [23], suggesting the conserved nature of early neural phenotype specification between these two species. In the absence of such signaling molecule modulation, most of the cells take up a dorsal telencephalic identity, in agreement with previous observation of human PSCs differentiation [5, 42].

[00263] In early brain development, FGF8 is expressed in the anterior neural ridge and is known to play an important role in determining rostral-caudal boundary whereby increased expression shifts the MGE and CGE boundary posteriorly [6]. SHH induces the ventral phenotype in the telencephalon by repressing Gli3 function [20], which represses FGF8 expression [21] and could indirectly induce FGF8 expression through repression of Gli3, indirectly exerting rostralizing activity. However, to complicate matters, it was also shown that SHH induces FGF15/19 expression in the forebrain development [22, 24], which was shown to antagonize the function of FGF8 during ventral telencephalic development [22, 23]. These developmental studies imply that small stochastic shift in SHH downstream signaling result in drastic shift of generated differentiation progenies, and demonstrate the power of developmental knowledge to reliably direct specific neural subtype differentiation.

[00264] MGE-derived interneurons show the ability to spontaneously differentiate into Lhx6-expressing GABAergic interneurons, showing them as phenotype-specified neural progenitors with intrinsic properties to become GABAergic interneurons. Enriched expression of Lhx6 after differentiation further demonstrates the MGE characteristic of derived progenitors, since Lhx6 expression is not observed in the preoptic area in the ventral telencephalon where Nkx2.1 is also expressed [43] nor in CGE-derived interneurons [1]. Derivation of a homogeneous MGE population was further confirmed by the limited presence of CoupTFII-expressing cells as well as the paucity of Pax6-expressing progenitors. The migratory property observed by these hPSC-derived interneurons on matrigel substrate and on El 3.5 telencephalic slices well recapitulates their in vivo counterparts (Suppl. Fig. 5a-e and [44-46]).

Remarkably, human MGE-derived neurons displayed physiological and

electrophysiological properties consistent with GABAergic interneurons such as their ability to produce GABA, formation of synaptic connection and generation of action potentials and GABAergic post-synaptic activity. Even though postmitotic neuronal markers such as GAD and β -tubulin were robustly expressed at 6 weeks of differentiation, not all cells at this stage were able to fire action potentials, while at 12 weeks of differentiation all cells tested were able to. This long-term maturation process has been reported before [17, 47], and is likely to reflect the long-term maturation process of human brain development. The small proportions of MGE- derived interneurons that mature to express somatostatin and parvalbumin at 6 weeks of differentiation is also in line with this notion of long-term maturation of human neurons. Such early developing interneurons before full maturation will be of great value for cell replacement therapy with its migratory functions and for modeling neurodevelopmental disease such as schizophrenia enabling us to model early developmental time point during which the developing brains is known to be more susceptible to environmental challenge [48-50], and many known schizophrenia risk genes are highly expressed [51-53].

[00265] Another significant finding of this study is that hPSC-derived interneurons not only generated well-integrated grafts with migratory properties. This is in contrast with transplantation of control cells without MGE inducing signals, which extensively proliferated and generated large grafts with rosette structures in the striatum, reminiscent of their massive proliferation during human dorsal telencephalic development. Furthermore, we found that hPSC-derived MGE grafts were enriched with GABAergic interneurons that mature to express somatostatin and parvalbumin. Recent studies have shown the potential of GABAergic interneurons as sources for novel cellular therapies for epilepsy [54], Parkinson's disease [46] and injury-induced neuropathic pain[55]. Considering that optimal cell sources for such therapy is limiting, the development of a homogeneous population of human GABAergic interneurons now can allow for the clinic.

[00266] In summary, functional and authentic human MGE cells and GABAergic interneurons recapitulating the in vivo ventral telencephalic development can be efficiently generated in vitro by developmentally relevant dorsoventral and rostrocaudal modulation. This novel strategy will be useful in regenerative medicine, developmental studies, disease modeling, bioassay, and drug screening.

[00267] Table 1. Antibody list used in the experiments.

CoupTFII Mouse 1/1000 Persus Proteomics

FoxGl Rabbit 1/500 Abeam

GABA Rabbit 1/1000 Sigma

GAD 65/67 Rabbit 1/1000 Millipore

Glutamate Rabbit 1/15000 Sigma

Isll Mouse 1/1000 DSHB

Lhx6 Rabbit 1/1000 Gift from Dr. Pachnis

NCAM Mouse 1/1000 SCBT

Nestin Mouse 1/1000 Millipore

Neuropeptide Y Sheep 1/5000 Millipore

Nkx2.1 (TTF1) Rabbit 1/2000 Epitomics

Nucleus Mouse 1/1000 Millipore

01ig2 Rabbit 1/500 Millipore

Parvalbumin Mouse 1/5000 Millipore

Pax6 Rabbit 1/200 Covance

Pax6 Mouse 1/1000 DSHB

PSD-95 Rabbit 1/1000 Cell Signaling

PSD-95 Mouse 1/1000 Neuro Mab

Somatostatin Rat 1/5000 Millipore

Synaptophysin Rabbit 1/2000 Pierce

Synaptophysin Mouse 1/500 Abeam

VGLUT Mouse 1/1000 DSHB

NeuN Mouse 1/500 Chemicon

VGAT Rabbit 1/1000 Synaptic Systems

Gephyrin Mouse 1/1000 Synaptic Systems

Human Cytoplasm Mouse 1/500 Stem Cells Inc

NKX2.2 Mouse 1/1000 DSHB

SP8 Goat 1/500 SBT

ER81 Goat 1/1000 SCBT

Tbrl Rabit 1/500 Abeam

ChAT Goat 1/500 Millipore

DARPP32 Rabbit 1/500 SCBT VIP Rabbit 1/1000 Immunostar, Inc.

Pitx3 Rabbit 1/1000 Gift from Dr.Burbach

TH Sheep 1/1000 Pelfreez

Ki67 Mouse 1/1000 Millipore

Sox6 Rabbit 1/1000 Millipore

Somatostatin Goat 1/1000 SCBT

CNPase Mouse 1/1000 Sigma

GFAP Rabbit 1/1000 Dako

[00268] References for Example 1

[00269] 1. Wonders CP, Anderson SA. The origin and specification of cortical interneurons. Nat Rev Neurosci. 2006;7:687-696.

[00270] 2. Tamamaki N, Yanagawa Y, Tomioka R et al. Green fluorescent

protein expression and colocalization with calretinin, parvalbumin, and somatostatin in the GAD67-GFP knock-in mouse. J Comp Neurol. 2003;467:60-79.

[00271] 3. Chiang C, Litingtung Y, Lee E et al. Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature. 1996;383:407-413.

[00272] 4. Fuccillo M, Rallu M, McMahon AP et al. Temporal requirement for hedgehog signaling in ventral telencephalic patterning. Development. 2004; 131 :5031 -

5040.

[00273] 5. Li XJ, Zhang X, Johnson MA et al. Coordination of sonic hedgehog and Wnt signaling determines ventral and dorsal telencephalic neuron types from human embryonic stem cells. Development. 2009;136:4055-4063.

[00274] 6. Fukuchi-Shimogori T, Grove EA. Neocortex Patterning by the

Secreted Signaling Molecule FGF8. Science. 2001;294: 1071-1074.

[00275] 7. Garel S, Huffman KJ, Rubenstein JL. Molecular regionalization of the neocortex is disrupted in Fgf8 hypomorphic mutants. Development. 2003 ; 130: 1903- 1914.

[00276] 8. Sussel L, Marin O, Kimura S et al. Loss of Nkx2.1 homeobox gene function results in a ventral to dorsal molecular respecification within the basal telencephalon: evidence for a transformation of the pallidum into the striatum.

Development. 1999;126:3359-3370. [00277] 9. Liodis P, Denaxa M, Grigoriou M et al. Lhx6 activity is required for the normal migration and specification of cortical interneuron subtypes.

2007;27:3078-3089.

[00278] 10. Arber CE, Li M. Cortical intemeurons from human pluripotent stem cells: prospects for neurological and psychiatric disease. Frontiers in Cellular

Neuroscience. 2013;7.

[00279] 11. Castiglioni V, Onorati M, Rochon C et al. Induced pluripotent stem cell lines from Huntington's disease mice undergo neuronal differentiation while showing alterations in the lysosomal pathway. Neurobiol Dis. 2012;46:30-40.

[00280] 12. Bellin M, Marchetto MC, Gage FH et al. Induced pluripotent stem cells: the new patient? Nat Rev Mol Cell Biol. 2012;13:713-726.

[00281] 13. Matsui T, Akamatsu W, Nakamura M et al. Regeneration of the

damaged central nervous system through reprogramming technology: Basic concepts and potential application for cell replacement therapy. Exp Neurol. 2012.

[00282] 14. Brennand KJ, Simone A, Jou J et al. Modelling schizophrenia using human induced pluripotent stem cells. Nature. 201 1;473:221-225.

[00283] 15. Lee G, Ramirez CN, Kim H et al. Large-scale screening using familial dysautonomia induced pluripotent stem cells identifies compounds that rescue

IKBKAP expression. Nat Biotechnol. 2012;30: 1244-1248.

[00284] 16. Egawa N, Kitaoka S, Tsukita K et al. Drug screening for ALS using patient-specific induced pluripotent stem cells. Sci Transl Med. 2012;4: 145ral04.

[00285] 17. Nicholas CR, Chen J, Tang Y et al. Functional Maturation of hPSC-

Derived Forebrain Intemeurons Requires an Extended Timeline and Mimics Human

Neural Development. Cell Stem Cell. 2013;12:573-586.

[00286] 18. Maroof AM, Keros S, Tyson JA et al. Directed differentiation and functional maturation of cortical intemeurons from human embryonic stem cells. Cell

Stem Cell. 2013;12:559-572.

[00287] 19. Liu Y, Weick JP, Liu H et al. Medial ganglionic eminence-like cells derived from human embryonic stem cells correct learning and memory deficits. Nat

Biotechnol. 2013;31 :440-447.

[00288] 20. Rallu M, Machold R, Gaiano N et al. Dorsoventral patterning is

established in the telencephalon of mutants lacking both Gli3 and Hedgehog signaling. Development. 2002;129:4963-4974. [00289] 21. Aoto K, Nishimura T, Eto K et al. Mouse GLI3 regulates Fgf8 expression and apoptosis in the developing neural tube, face, and limb bud. Dev Biol. 2002;251 :320-332.

[00290] 22. Borello U, Cobos I, Long JE et al. FGF15 promotes neurogenesis and opposes FGF8 function during neocortical development. Neural Dev. 2008;3: 17.

[00291] 23. Danjo T, Eiraku M, Muguruma K et al. Subregional specification of embryonic stem cell-derived ventral telencephalic tissues by timed and combinatory treatment with extrinsic signals. J Neurosci. 2011;31 : 1919-1933.

[00292] 24. Ishibashi M, McMahon AP. A sonic hedgehog-dependent signaling relay regulates growth of diencephalic and mesencephalic primordia in the early mouse embryo. Development. 2002;129:4807-4819.

[00293] 25. Chambers SM, Fasano CA, Papapetrou EP et al. Highly efficient

neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling.

Nat Biotechnol. 2009;27:275-280.

[00294] 26. Chung S, Moon J-I, Leung A et al. ES cell-derived renewable and functional midbrain dopaminergic progenitors. Proceedings of the National Academy of Sciences. 2011;108:9703-9708.

[00295] 27. Houart C, Caneparo L, Heisenberg C et al. Establishment of the

telencephalon during gastrulation by local antagonism of Wnt signaling. Neuron.

2002;35:255-265.

[00296] 28. Nordstrom U, Jessell TM, Edlund T. Progressive induction of caudal neural character by graded Wnt signaling. Nat Neurosci. 2002;5:525-532.

[00297] 29. Gunhaga L, Marklund M, Sjodal M et al. Specification of dorsal

telencephalic character by sequential Wnt and FGF signaling. Nat Neurosci.

2003;6:701-707.

[00298] 30. Gulacsi A, Anderson SA. Shh maintains Nkx2.1 in the MGE by a

Gli3 -independent mechanism. Cereb Cortex. 2006; 16 Suppl l :i89-95.

[00299] 31. Hebert JM, Fishell G. The genetics of early telencephalon patterning: some assembly required. Nat Rev Neurosci. 2008;9:678-685.

[00300] 32. Ruiz i Altaba A, Palma V, Dahmane N. Hedgehog-Gli signalling and the growth of the brain. Nat Rev Neurosci. 2002;3:24-33.

[00301] 33. Gimeno L, Martinez S. Expression of chick Fgfl 9 and mouse Fgf 15 orthologs is regulated in the developing brain by Fgf8 and Shh. Developmental dynamics : an official publication of the American Association of Anatomists.

2007;236:2285-2297.

[00302] 34. Ma T, Wang C, Wang L et al. Subcortical origins of human and

monkey neocortical interneurons. Nat Neurosci. 2013;16: 1588-1597.

[00303] 35. Chung S, Leung A, Han BS et al. Wntl-lmxla forms a novel

autoregulatory loop and controls midbrain dopaminergic differentiation

synergistically with the SHH-FoxA2 pathway. Cell Stem Cell. 2009;5:646-658.

[00304] 36. Kriks S, Shim JW, Piao J et al. Dopamine neurons derived from human

ES cells efficiently engraft in animal models of Parkinson's disease. Nature.

2011;480:547-551.

[00305] 37. Krencik R, Weick JP, Liu Y et al. Specification of transplantable

astroglial subtypes from human pluripotent stem cells. Nat Biotechnol. 201 1;29:528- 534.

[00306] 38. Wang S, Bates J, Li X et al. Human iPSC-derived oligodendrocyte progenitor cells can myelinate and rescue a mouse model of congenital

hypomyelination. Cell Stem Cell. 2013;12:252-264.

[00307] 39. Hu BY, Du ZW, Zhang SC. Differentiation of human oligodendrocytes from pluripotent stem cells. Nature protocols. 2009;4: 1614-1622.

[00308] 40. Gunhaga L, Jessell TM, Edlund T. Sonic hedgehog signaling at

gastrula stages specifies ventral telencephalic cells in the chick embryo. Development.

2000;127:3283-3293.

[00309] 41. Cambray S, Arber C, Little G et al. Activin induces cortical

interneuron identity and differentiation in embryonic stem cell-derived telencephalic neural precursors. Nature communications. 2012;3:841.

[00310] 42. Mariani J, Simonini MV, Palejev D et al. Modeling human cortical development in vitro using induced pluripotent stem cells. Proceedings of the

National Academy of Sciences. 2012.

[00311] 43. Flames N, Pla R, Gelman DM et al. Delineation of multiple subpallial progenitor domains by the combinatorial expression of transcriptional codes. J

Neurosci. 2007;27:9682-9695.

[00312] 44. Wichterle H, Garcia- Verdugo JM, Herrera DG et al. Young neurons from medial ganglionic eminence disperse in adult and embryonic brain. Nat

Neurosci. 1999;2:461-466. [00313] 45. Alvarez-Dolado M, Calcagnotto ME, Karkar KM et al. Cortical inhibition modified by embryonic neural precursors grafted into the postnatal brain. J Neurosci. 2006;26:7380-7389.

[00314] 46. Martinez-Cerdeno V, Noctor SC, Espinosa A et al. Embryonic MGE precursor cells grafted into adult rat striatum integrate and ameliorate motor symptoms in 6-OHDA-lesioned rats. Cell Stem Cell. 2010;6:238-250.

[00315] 47. Johnson MA, Weick JP, Pearce RA et al. Functional Neural

Development from Human Embryonic Stem Cells: Accelerated Synaptic Activity via Astrocyte Coculture. The Journal of Neuroscience. 2007;27:3069-3077.

[00316] 48. Aguilar-Valles A, Luheshi GN. Alterations in cognitive function and behavioral response to amphetamine induced by prenatal inflammation are dependent on the stage of pregnancy. Psychoneuroendocrinology. 2011;36:634-648.

[00317] 49. Piper M, Beneyto M, Burne TH et al. The neurodevelopmental

hypothesis of schizophrenia: convergent clues from epidemiology and

neuropathology. Psychiatr Clin North Am. 2012;35:571-584.

[00318] 50. Li Q, Cheung C, Wei R et al. Prenatal immune challenge is an

environmental risk factor for brain and behavior change relevant to schizophrenia: evidence from MRI in a mouse model. PLoS One. 2009;4:e6354.

[00319] 51. Xu B, Ionita-Laza I, Roos JL et al. De novo gene mutations highlight patterns of genetic and neural complexity in schizophrenia. Nat Genet. 2012;44: 1365- 1369.

[00320] 52. Lin M, Pedrosa E, Shah A et al. RNA-Seq of human neurons derived from iPS cells reveals candidate long non-coding RNAs involved in neurogenesis and neuropsychiatric disorders. PLoS One. 201 l;6:e23356.

[00321] 53. Gilman SR, Chang J, Xu B et al. Diverse types of genetic variation converge on functional gene networks involved in schizophrenia. Nat Neurosci.

2012;15: 1723-1728.

[00322] 54. Baraban SC, Southwell DG, Estrada RC et al. Reduction of seizures by transplantation of cortical GABAergic interneuron precursors into Kvl . l mutant mice. Proc Natl Acad Sci U S A. 2009;106: 15472-15477.

[00323] 55. Braz JM, Sharif-Naeini R, Vogt D et al. Forebrain GABAergic neuron precursors integrate into adult spinal cord and reduce injury-induced neuropathic pain.

Neuron. 2012;74:663-675. 2 [00324] EXAMPLE 2

[00325] Methods

[00326] PSC culture and differentiation into MGE cells

[00327] Human H7 ESC (WA07, WiCell, passage 41-51) was maintained on Matrigel (BD, San Hose, CA) in mTeSR media (Invitrogen, Calsbad, CA) with lOng/ml bFGF (Peprotech, Rocky Hill, NJ), and passaged using Dispase (Stem Cell Technologies, Vancouver, BC, Canada). For differentiation, PSCs were trypsinized and grown as floating aggregates in low adherent flasks in KSR media (20% knockout serum replacement, DMEM, 2mM L-glutamine and 10 μΜ β-mercaptoethanol (all from Invitrogen)). Rock inhibitor (Y-27632, 10 μΜ, Tocris, Bristol, United Kingdom) was added on the first day of differentiation. After two weeks of floating culture, cells were transferred to polyornithine- (PLO; 15 mg/ml; Sigma, St. Louis, MO) and fibronectin- (FN; 1 mg/ml; Sigma, St. Louis, MO) coated surfaces in N3 media. For MGE induction, cells were treated with LDN193189 (100 nM, Stemgent, Cambridge, MA) from dO to dl4, with SB431542 (10 μΜ, Tocris) from dO to d7, with IWP2 (5μΜ, EMD MiUipore) from dO to d7, with SAG (0.1 μΜ, EMD MiUipore) from dO to d21, and with FGF8 (lOOng/ml, Peprotech) from d8 to d21 (Kim et al, 2014). After 3 weeks of differentiation, cells were transferred to differentiation media (N3 media (Chung et al.) with lOng/ml GDNF (Peprotech), lOng/ml BDNF (Peprotech) and 2.5μΜ DAPT (Tocris). At day 25 of differentiation, cells were subject to a fluorescence-activated cell sorting (FACS). Cells were trypsinized and incubated with anti-ENCAM antibody (BD) in FACS media (phenol-free, Ca ⁺⁺ , Mg ⁺⁺ -free Hank's buffered saline solution (HBSS; Invitrogen, Carlsbad, CA) containing Penicillin- Streptomycin, 20 mM D-Glucose and 2% fetal bovine serum) for 20 min, followed by incubation for 10 min with Alexafluor-568-conjugated anti-rat IgM antibodies (Invitrogen, Carlsbad, CA). All washing steps were performed in FACS media. Cells were filtered through cell strainer caps (35μιη mesh) to obtain a single cell suspension (5 x 106 cells/ ml for sorting), followed by FACS using FACS Aria (BD Biosciences, San Jose, CA) and FACSDiva software (BD Biosciences, San Jose, CA). Debris, dead cells and doublets were excluded by forward and side scatter gating. ENCAM positivity was determined compared to negative controls lacking the primary antibody and lacking primary and secondary antibodies. A portion of sorted cells were plated on PLO/FN-coated coverslips for immunocytochemical analysis and the rest were resuspended in transplantation media (HBSS with lOng/ml GDNF, lOng/ml BDNF and 20μΜ Boc-Asp(OMe) fluoromethyl ketone (BAF; Sigma-Aldrich)) and used for transplantation.

[00328] Induction of temporal lobe epilepsy (TLE) in Nod-Scid mice

[00329] The Animal Care and Use Committee at McLean Hospital approved all animal procedures. The mice were housed with 12 hr light/dark cycles with free access to food and water. For induction of TLE, 7-week old male and female Nod-Scid mice (Charles River Laboratory) were injected with 400mg/kg Pilocarpine i.p., 30 minutes after N-methylscopolamine bromide (1 mg/kg, ip) administration to reduce peripheral cholinergic effects (Mazzuferi et al.). To limit the duration of status epilepticus (SE) and extent of damage in the hippocampus, diazepam (10 mg/kg) was injected ip 90 min after seizure induction. The severity of convulsive responses was monitored and classified according to the modified Racine scale (Shibley and Smith, 2002). Ten days after pilocarpine injection, mice that showed stage 3, 4 or 5 seizure were subject to 7 days of continuous video monitoring of spontaneous recurrent seizure (SRS) using Eco Black Box security camera system (Lorex Technology). Mice showing SRS with stage 3, 4 or 5 during the 7-day recording period were designated as "TLE mice" in this study, and they were randomly assigned for subsequent transplantation and behavioral analysis.

[00330] Transplantation of hMGE cells into hippocampus of TLE model mice.

[00331] FACS-sorted hESC-derived MGE cells or the same volume of transplantation media as described above were injected into hippocampus of TLE mice using a Leica Angle Two digital stereotaxic instrument (Leica Biosystems) fitted with a

Cunningham Mouse Adaptor (Stoelting, Inc, Downers Grove, IL). TLE mice were anesthetized using an induction chamber supplied with 4-5 % isoflurane (Sigma) mixed with 0.8-1 L/min oxygen using a calibrated vaporizer. Animals were then administered continuous isoflurane (1-2%) mixed with oxygen (0.8-1.0 L/min) via snout mask for the duration of anesthesia. Body temperature was maintained using air-activated iron oxide heat packets. Cell suspensions or control vehicle injections were disseminated throughout the hippocampus with one rostral injection and three caudal injections (Hunt et al., 2013) at the following coordinates: AP 1.75 mm, L +2.3 mm, V -1.7 mm for rostral CA3 site; AP 3.25 mm, L +3.0 mm, V -3.65 mm, -2.9 mm and -2.0 mm for the three caudal sites along the dorso-ventral axis of the

hippocampus in this coronal plane. Injection coordinates were verified by ink injections as well as cell injection followed by histological analysis 1-2 weeks after transplantation. A total of 5 x 104 MGE cells in a 0.5 μΐ volume were delivered to each target coordinate. Sterile, stainless steel bone screw recording electrodes (diameter 0.5mm, length 1.1mm; Plastics One) soldered with lead wire were placed epidurally through rostral burr holes in the skull (AP 1.75 mm, L +2.3 mm), and reference electrodes were implanted caudal to lambda. Electrodes were cemented in place with a rapid-curing dental cement (DenMat Holdings, Lompoc, CA).

[00332] Behavioral analysis

[00333] Mice were maintained under a 12-hours light/dark cycle with water and food available ad libitum. All behavioral tests were done during the light phase of the light/dark cycle.

[00334] Continuous Video-EEG recording of transplanted mice

[00335] Three months after transplantation, seizure activity of control or MGE- transplanted TLE mice was recorded using a MP 150 Biopac data acquisition System, EEG100C EEG amplifier module and AcqKnowledge 4.0 EEG Acquisition and Reader Software (BIOPAC Systems Inc.) along with Eco Black Box security camera system (Lorex Technology). EEG seizures with high-frequency, high-voltage synchronized polyspike profiles with amplitudes greater than 2-fold background and a duration of greater than 15 sec (Hunt et al., 2013) were analyzed using

AcqKnowledge 4.0 EEG Acquisition and Reader Software (BIOPAC Systems Inc.) by investigators who were blind to treatment conditions. This was followed by confirmation of EEG seizure activity by video recording. Each animal was recorded over 5-10 days, totaling 42 days for naive mice (n=6), 79 days for control TLE mice (n=l 1), and 83 days for MGE-transplanted TLE mice (n=9). The mice with more than 15,000 surviving human nucleus+ cells in each hippocampi were included in the behavioral analysis (One mouse from MGE-transplanted group did not meet this criterion and was excluded. It showed mild seizure activity with 0.7 seizure per day).

[00336] Y maze

[00337] We used a three-arm Y maze for this study: each arm 3 cm wide, 40 cm in length, and with a wall height of 12 cm. Mice were initially placed within one arm, and the sequence and number of entries was recorded for each mouse over a 10 min period. The percentage of triads in which all three arms are represented (i.e., ABC, CAB or BCA, but not BAB for example), was recorded as a spontaneous alternation to estimate short-term memory. The number of arm entries was used as an indicator of locomotor activity. Arms were cleaned between tests to remove odors and residues. Y maze test was done under normal ambient room lighting.

[00338] Novel object recognition test

[00339] For a training session, each mouse was placed into an open field box (42 x 42 x 31 cm) containing two identical objects and allowed to freely explore for 3 min. One hour after the training session, one of the familiar objects was replaced with a novel object (defined as the test session). The time that each animal spent exploring the novel object compared to the familiar object was recorded and traced using Ethovision software (Noldus, Wageningen, The Netherlands), using a 3 cm radius around each object as the "interaction zone". The test box and objects were cleaned between sessions. Results are expressed as recognition index (% time = time duration near novel object/[time duration near novel object + time duration near familiar object] x 100). The percentage visit frequency is calculated as follows (% frequency = number of visit to novel object/[number of visit to novel object+number of visit to familiar object] x 100).

[00340] Locomotion test

[00341] The home cage (7 1/2" x 11 1 2" x 5") containing an individual mouse was placed in the center of a photobeam activity system (PAS) monitoring frames (San Diego Instruments) with 4x8 photobeam configuration for 15 min under standard overhead lighting conditions. Total photobeam break numbers were detected by PAS software.

[00342] Handling test

[00343] Aggressiveness of the mice was assessed as described previously (Hunt et al, 2013) with some modifications. Each of the following three tasks was performed for 15 sec: 1) nonstressful handling (stroking slowly along the back of the mouse in the direction of the grain of fur), 2) stressful handling (vigorous stroking against the grain of the fur), 3) pinching at the tail base with a rubber-ended forceps (Fine Science tools). Reaction to each handling was scored by investigators blinded to treatment conditions using the following rating scale: 1- initial struggle, but calmed within 15 sec, 2- struggle for more than 15 sec, 3- struggle for more than 15 sec and exhibiting one or more defensive reactions (piloerection, flattening of the ears against the head, attempt to bite or back away from the experimenter), and 4- struggled for more than 15 sec and exhibited flight behavior (loud vocalization or wild running). Summation of these three scores provided a total aggressiveness score for each mouse.

[00344] Immunohistochemistry, Cell counting and statistical analysis

[00345] Transplanted mice were terminally anesthetized with an ip overdose of

pentobarbital (150 mg/kg, Sigma) and perfused transcardially with heparin saline (0.1% heparin in saline) followed by formaldehyde (4%) 2 weeks or 4 months post grafting. Brains were removed, postfixed in 4% formaldehyde for 12 hours, equilibrated in 20% sucrose/PBS solution, and then sectioned coronally at 40- Dm using a freezing microtome. For immunofluorescence staining, tissue sections were incubated with blocking buffer (PBS, 10% normal donkey serum (NDS)) containing 0.1%Triton for 10 minutes. Cells were then incubated overnight at 4°C with primary antibodies diluted in PBS containing 2% NDS. The primary antibody list can be found in Table SI . After rinsing with PBS, samples were incubated with fluorescent dye- labeled secondary antibodies (Alexa 488- Alexa 568- or Alexa 647-labeled IgG; Invitrogen, Carlsbad, CA) in PBS containing 2% NDS for 30 minutes at room temperature. After rinsing with PBS, Hoechst 33342 (4 mg/ml) was used for counterstaining, and tissue sections were mounted onto slides in Mowiol 4-88 (Calbiochem, Gibbstown, NJ). Confocal analysis was performed using an Olympus DSU Spinning Disc Confocal on an 1X81 inverted microscope (Center Valley, PA), installed with MetaMorph software. Stereolnvestigator image-capture equipment and software (Microbright Field, Williston, VT) were used for cell counting and estimation of total cell number in the graft using the optical fractionator workflow from every 12th sections. A 400μιη x 400μιη grid was used along with 200μιη x 200μιη counting frame. For migration analysis, human Nuclei+ cells within 400μιη, between 400-800μιη, 800-1200μιη ΟΓ1200-Ι600μιη from injection tract were counted using separate markers.

[00346] To assess mossy fiber sprouting, Timm scores were determined as previously described (Shibley and Smith, 2002), with 0 for no ZnT3 staining in granule cell layer, 1 for patchy staining in granule cell layer, 2 for punctate staining in molecular layer and 3 for continuous staining in molecular layer. [00347] For statistical analysis, we performed a t-test (alpha=0.05) for comparison of two groups using Prism6 software (Graph Pad). For multiple sample comparison, we performed analysis of variance (ANOVA) with an alpha level of 0.05 to determine possible statistical differences between group means. When significant differences were found, post hoc analysis was performed using Fisher's LSD (a = 0.05) again using Prism6 software. For samples with unequal variances, non-parametric Kruskal- Wallis test was performed using Prism6 software.

[00348] Transmission Electron Microscopy (TEM)

[00349] For TEM analysis, mice were perfused in 4%PFA/0.5%Glutaldehyde solution, and brains were removed, postfixed in the same fixative, and 40 Dm coronal slices obtained using a vibrating microtome. Immunohistochemistry was performed as described above, using anti-human cytoplasm antibody and biotinylated anti-mouse antibody, followed by an ABC kit (Vector) and a diaminobenzidine (DAB) substrate kit (Vector) with Nickel intensification according to manufacturer's instruction. DAB- stained brain slices were post-fixed in an aqueous solution of 1% osmium tetroxide (Os04, Electron Microscopy Sciences) and 1% potassium ferrocyanide (Electron Microscopy Sciences) for one hour, followed by embedding in Embed 812 epoxy resin (Electron Microscopy Sciences) using standard ethanol gradient dehydration and propylene oxide:resin gradient infiltration and polymerization protocols. Ultrathin (70-80 nm) sections were cut from graft core region and collected on 200 mesh copper grids (Electron Microscopy Sciences) previously cleaned ultrasonically in acetone. Images were acquired on a JEOL 1200EX TEM operating at 80 kV accelerating voltage.

[00350] Electrophysiology, optogenetic stimulations and Neurolucida tracing

[00351] For electrophysiological studies, MGE cells were infected with lentivirus that express ChR2 (H134R)-GFP fusion protein under the control of synapsin promoter (UPenn vector core facility) at day 14 of differentiation. Transduction efficiency was 26.3 ± 4.7 % (n = 4). The cells underwent FACS and were transplanted as described above. Two to five months after transplantation, acute brain slices containing the hippocampus were prepared using a vibrating microtome for electrophysiological analysis. After recovery, brain slices were placed in the recording chamber and continuously perfused at the rate of 1 mL per minute with the artificial cerebrospinal fluid containing 130 mM NaCl, 2.5 mM KC1, 2.5 mM CaC12, 1 mM MgS04, 1.25 mM NaH2P04, 26 mM NaHC03, and 10 mM glucose with 95 % 02 and 5 % C02. Whole-cell patch-clamp recordings were performed at 31-33°C using EPC-9 amplifier and Pulse v8.8 software (HEKA Elektronik). For recording grafted MGE-derived neurons (GFP+ cells) and host hippocampal interneurons, the patch electrodes (~5 MOhm resistance) were filled with solution containing 150 mM K-gluconate, 5 mM NaCl, 1 mM MgC12, 10 mM HEPES, 0.2 EGTA, 2 mM MgATP, 0.5 mM NaGTP, and 5 mM biocytin (290 mOsm, adjusted to pH 7.3 with KOH). For recording GFP- host hippocampal neurons, the patch electrodes were filled with solution containing 140 mM Cs-methanesulfonate, 5 mM NaCl, 1 mM MgC12, 10 mM HEPES, 0.2 EGTA, 2 mM MgATP, 0.5 mM NaGTP, 5 mM QX 314 chloride, and 5 mM biocytin (290 mOsm, adjusted to pH 7.3 with CsOH). Liquid junction potential of 15.5 and 8.9 mV was corrected for the K-gluconate-based and Cs-based pipette solutions, respectively. Series (access) resistance was not compensated. Blue collimated light- emitting diode (LED) with 470 nm peak wavelength (M470L2, Thorlabs) was used for photostimulations of grafted MGE-derived cells expressing ChR2-GFP. Brain slices in the recording chamber were illuminated through a 40 x water-immersion objective lens (IR-Achroplan, Carl Zeiss). Illumination area was 0.26 mm2 and was centered at the cell patched for recording.

[00352] Offline data analysis was performed using Clampfit 9 program (Molecular Devices). Reagents were purchased from Tocris Bioscience (QX 314 chloride, biocytin, and NBQX) or Sigma-Aldrich (ATP, GTP, and bicuculline methochloride). For statistical analyses of electrophysiological data, we used ANOVA with

Bonferroni's simultaneous multiple comparisons. Statistical analysis was performed with Minitabl6 software (Minitab) and p < 0.05 was considered statistically significant.

[00353] After electrophysiological recordings, brain slices were fixed in 4 %

paraformaldehyde at 4°C overnight. Recorded cells loaded with biocytin were labeled with streptavidin, Alexa 568 conjugate (20 μg/mL in PBS, Molecular Probes) as described previously (Cho et al, 2013). Images of biocytin/streptavidin-labelled cells were taken with z-stack function using Leica TSC SP8 confocal microscope. The confocal images were then used for neuron tracing with Neurolucida software (Microbright Field, Williston, VT).

[00354] Single cell reverse transcription-polymerase chain reaction (scRT-PCR) [00355] After whole-cell patch-clamp recording for more than 20 minutes, the recording pipettes were withdrawn slowly for the formation of outside-out patch. Intracellular contents (~ 6 μΐ) were expelled from the pipettes and collected in Eppendorf tubes containing 1.0 μΐ RNaseOUT (40 U/ μΐ, Invitrogen) and 1.5 μΐ nuclease-free water and stored at -20 °C. Samples were first treated with TurboDNase (Invitrogen) that is compatible with high-salt recording solutions to remove genomic DNA contamination, followed by reverse transcription using Superscript III

(Invitrogen) with pool of gene-specific outside primers (Table 3) in 20ul reaction according to manufacturer's instruction. cDNAs were subject to 25 cycles (95°C, 2 min; 25 cycles of (95°C, 20 s; 55°C, 20s; 72°C, 20s); 72°C, 5min) of pre- amplification using pool of gene-specific outside primers and GoTaq DNA

polymerase (Promega) in 50 μΐ reaction. In the second round of PCR, 1 μΐ each cDNA was amplified using nested primers (Table S2) and GoTaq DNA polymerase

(Promega) with 30 cycles (95°C, 2 min; 30 cycles of (95°C, 20 s; 55°C, 20s; 72°C, 20s); 72°C, 5min) in 25 μΐ reaction. To check the possibility of mRNA contamination from surrounding tissues, recording patch pipettes were inserted into the same brain slices containing the hippocampus without the formation of tight giga-seal and its contents was analyzed likewise and did not show any signal above background level (n = 3). As a positive control, we used 1 ng of total human brain RNA and all primers successfully amplified cDNA with correct size.

[00356] A decreased GABA induced inhibition of has repeatedly been demonstrated in TLE animal models (Cossart et al., 2001; Hirsch et al., 1999; Kobayashi and

Buckmaster, 2003). Therefore, one possible therapeutic approach is to increase (the inhibitory neurotransmitter) GABA-mediated inhibition to suppress hyperexcitable neurons during seizure initiation. Early work exploring the potential for inhibitory neural grafts in controlling epileptic activity has shown promise and has inspired further studies (Fine et al, 1990; Lindvall and Bjorklund; Loscher et al, 1998). More recent experiments have shown that mouse GABAergic interneuron precursors engrafted into the TLE mouse brain decreased seizure activity (Baraban et al., 2009; Hattiangady et al., 2008; Hunt et al., 2013; Maisano et al., 2012).

[00357] However, for human TLE patients, it is critical to develop optimal human cell sources that can integrate into host circuitry, increase GABA-mediated inhibitory tone, and thereby reduce seizure activity in the epileptic brain. However, efficient translation of hPSC-derived interneurons could be hampered by their well-known, protracted maturation (Le Magueresse and Monyer, 201; Nicholas et al., 2013) For example, parvalbumin+ neurons acquire fast-spiking property only after postnatal maturation into early adolescence in mice (Doischer et al., 2008 o; Okaty et al., 2009).

[00358] Results

[00359] Human mGIN extensively migrate within the epileptic brain.

[00360] Human MGE cells were generated by in vitro differentiation of H7 human embryonic stem cells according to our optimized procedure (Kim et al., 2014), and purified by FACS using anti-ENCAM antibody prior to transplantation (Fig. 11a). Most of the FACS-sorted cells expressed the MGE markers Nkx2.1 and 01ig2, as well as the early neural marker nestin, but no cells were positive for the pluripotent stem cell marker SSEA4 (data not shown, Fig. 18). We generated a mouse model for temporal lobe epilepsy (TLE) by injecting Nod-Scid mice with 400mg/kg doses of pilocarpine. Animals demonstrating Racine stage 3-5 seizure activity upon induction with pilocarpine were further screened for occurrence of spontaneous recurrent seizures (SRS) over 7 days using continuous video monitoring starting 10 days after pilocarpine injection. Mice having at least one SRS during this 7-day screening period were used for further experiments and denoted as "TLE mice" in this study. Human MGE cells were disseminated throughout most of the hippocampus by depositing volumes of cell suspension within the rostral and caudal hippocampus bilaterally using 4 separate targets on each side as reported previously (Hunt et al, 2013) (Fig. 11a). Histological analysis showed that 2 weeks post-transplantation (PT), cells were primarily clustered near the injection site (59, 027±18,724 total human nucleus+ cells per mouse, n=3; data not shown). At 4 months PT, however, transplanted mGIN extensively migrated, becoming well integrated within the host hippocampus

(74,913±15,417 total human nucleus+ cells per mouse, n=8;data not shown and Fig. 19), without significant difference in the total surviving cell numbers compared to 2 weeks PT (p=0.58). At the transplantation core, grafted cells comprise 30.7 ± 4.7 of total cells (n = 6 mice). Stereo logical analysis demonstrated migration of transplanted human mGIN greater than 1.6 mm from the site of injection (Fig. 1 lb). At 2 weeks PT, most cells expressed GABA, Sox6 as well as Nkx2.1 (immunocytochemistry data not shown), with a minority of cells expressing the more mature neuronal marker NeuN (data not shown). However, at 4 months PT, the majority of cells expressed NeuN as well as GABA and Sox6 (immunocytochemistry data not shown) The expression of precursor marker Nkx2.1 was significantly diminished at 4 months PT compared to 2 weeks PT (Fig. 12a and data not shown), whereas the mature interneuron marker Lhx6 was significantly increased at 4 months PT compared to 2 weeks PT (Fig.12a and data not shown). In addition, proliferating cell marker Ki67 was significantly decreased after 4 month PT compared to 2 weeks PT (Fig. 12 a and data not shown). Further, at 4 month PT, GABAergic interneurons were found to have matured to express somatostatin, parvalbumin, calretinin, neuropeptide Y and calbindin (Fig. 12b, data not shown). As seen during in vivo embryonic development, interneuron maturation was not synchronous and cells with simple bipolar morphology and cells with more complex neurites coexist at this time point (data not shown). Transplanted cells generated very small numbers of astrocytes (GFAP+; Fig. 2b and data not shown) or oligodendrocyte lineage cells (01ig2+; Fig. 12b and data not shown).

[00361] Functional integration of human mGIN into the epileptic brain.

[00362] Electrophysiological and morphological analyses were used to determine whether transplanted human MGE cells develop into functional GABAergic neurons and integrate into host neural circuitry. Human MGE cells, transduced with lentivirus to stably express channelrhodopsin-2 (ChR2) (H134R)-GFP fusion under a synapsin promoter, were transplanted into the hippocampus of TLE mice. Two to five months after transplantation, grafted human MGE-derived cells were identified with green fluorescence in acute brain slices containing the hippocampus (GFP+ cells, Fig. 13a). All 31 GFP+ cells displayed typical ChR2 -mediated currents induced by blue light illumination (Fig. 13b), indicating that recorded GFP+ cells were indeed human MGE-derived cells expressing ChR2. Consistently, short pulses of blue light illumination evoked action potential (AP) firings in most GFP+ cells (Fig. 13c), suggesting that grafted GFP+ cells can be activated by photostimulation in brain slice preparations. Passive membrane properties of GFP+ human mGIN, including resting membrane potential (RMP) and membrane resistance (Rm), were similar to those reported previously (Nicholas et al, 2013) (Fig. 13d). Unlike the previous report, however, we did not observe an increasing trend of the membrane capacitance (Cm) of the grafted cells (Fig. 13d). This discrepancy may be due to the different experimental conditions that human MGE cells were transplanted into the brain in our study whereas they were grown in culture in the previous report. Thus, our findings reflect the membrane properties of human MGE cells under more physiological conditions. Compared to host hippocampal interneurons in adult mice, RMP was significantly depolarized in grafted mGIN (p < 0.001), suggesting that grafted cells were not fully mature at this time point. However, there was no significant difference in Rm and Cm between human mGIN vs. host interneurons. When voltage pulses were applied, grafted human mGIN showed rapidly desensitizing inward currents activated at membrane potential > -40 mV (Fig. 3e), indicating the expression of voltage-gated Na+ channels. In current-clamp mode, 45% of human mGIN displayed spontaneous AP firings at resting membrane potential at 2.0 ± 0.2 Hz (Fig. 13f and 13g), suggesting that some of the grafted mGIN generate tonic firings. Furthermore, the injection of depolarizing currents induced AP firings in all human mGIN examined (Fig. 14a and 14b). As for passive membrane properties, grafted mGIN displayed less mature biophysical properties of AP firings compared to the host interneurons in terms of after-hyperpolarization and AP width (Fig. 14b), consistent with their well-known protracted maturation (Nicholas et al., 2013), whereas there was no significant difference in AP threshold. When grouped based on AP firing, most human mGIN displayed repetitive (type A, 52%>) or single AP firing (type B, 32%) whereas delayed (13%>) or burst firing pattern (3%>) was also observed in a small proportion of transplanted cells (Fig. 14c). Furthermore, while more frequent AP firings were induced by small current injections (< 50 pA) in repetitive-firing type A cells, type B cells generated only 1-3 AP firings induced by much larger current injections (> 50 pA, Fig. 14e). As expected, Rm was significantly larger in type A cells than in type B cells (Fig. 14e), accounting for different firing patterns of these cells.

63] After recording, we collected the intracellular contents of the recorded cells and performed single-cell RT-PCR to examine the RNA profile of transplanted human mGIN (Fig. 14f). Most grafted cells expressed glutamate decarboxylase (GAD) and Sox6 while some grafted cells also expressed other GABAergic neuronal markers including parvalbumin, calreticulin, somatostatin, vasoactive intestinal peptide, and neuropeptide Y (Fig. 14g). We also performed morphological analysis with biocytin-labeled human mGIN and found characteristic neuronal morphologies with various patterns of neuronal processes and RNA profile of GAD67; GAD65; parvalbumin; calreticulin; somatostatin; , vasoactive intestinal peptide,, neuropeptide Y; and or Sox6 was determined. Our results demonstrate that transplanted human MGE cells develop into mGIN with diverse electrophysiological, biochemical and morphological properties in the epileptic hippocampus.

[00364] We then investigated whether grafted human mGIN possessed functional postsynaptic mechanisms allowing synaptic transmission from host neurons. Using confocal microscopic imaging, we observed postsynaptic dendritic spines in biocytin- labeled grafted cells, suggesting that they may receive excitatory synaptic inputs (Fig. 15b). Consistently, in acute hippocampal slices, two thirds of 21 GFP+ mGIN showed spontaneous postsynaptic currents at -85 mV in voltage-clamp mode at a frequency > 0.1 Hz (Fig. 15b and Fig. 15b). Moreover, these currents were inhibited completely by NBQX, an AMPA/kainite-type glutamate receptor antagonist (Fig. 15C), indicating that they were mediated by excitatory neurotransmitter glutamate. There were no significant differences in biophysical properties of spontaneous postsynaptic activities between grafted human mGIN and host hippocampal interneurons (Fig. 15e to 15g, and data not shown). These results suggest that most human mGIN transplanted into the hippocampus, have functional postsynaptic machinery, receiving excitatory synaptic inputs from host glutamatergic neurons. Immunocytochemistry analysis also showed that many postsynaptic PSD95+ puncta on GFP+ grafted cells were juxtaposed with presynaptic synaptophysin puncta (data not shown, 2.18 ± 0.56 PSD95+ puncta/10 μιη GFP+ dendrite (n=22 dendrite segments)), suggesting the formation of host glutamatergic synapses onto transplanted human mGIN. Further confirmation of functional synapse formation between host and transplanted neurons was obtained from ultrastructural analysis by Transmission Electron Microscopy (TEM). Examination of hippocampal areas in brain slices immunostained with diaminobenzidine (DAB) for human cytoplasm (human cytoplasm+) showed excitatory synaptic connections with host neurons (data not shown). These combined electrophysiological and ultrastructural data demonstrate functional synaptic integration of grafted mGIN into host parenchyma.

[00365] Activation of human mGIN induces GABA-mediated inhibitory postsynaptic responses in host hippocampal neurons.

[00366] We next investigated whether grafted human mGIN also have functional presynaptic machinery to release GABA and induce inhibitory postsynaptic responses in host hippocampal neurons (Fig. 16a). To this end, we used optogenetic approaches to selectively stimulate ChR2-expressing transplanted cells in hippocampal slices (Fig. 16c). Blue light illumination induced ChR2 -mediated inward current and AP firings in GFP+ grafted cells (Fig. 13c), whereas the same photostimulation did not induce such currents in any GFP- cells tested (Fig. 16c), suggesting that grafted cells can be selectively activated in acute brain slices with this approach. Under these conditions, short pulses of photostimulation, activating ChR2-expressing grafted cells, induced postsynaptic responses in 44% of total 27 GFP+ cells (Fig. 16b and 16c). The recorded postsynaptic currents showed a short synaptic delay, indicating

monosynaptic origin (Cho et al, 2013). Furthermore, these synaptic responses were inhibited completely by bicuculline, a GABAA receptor antagonist (Fig. 16b and 16c), suggesting that they were mediated by inhibitory neurotransmitter GABA. The current- voltage relationship revealed the reversal potential of these currents at -70 ± 3 mV (Fig. 16d), consistent with the estimated reversal potential of chloride ion (-65 mV under our experimental conditions). In some GFP- cells, photostimulation induced probabilistic quantal responses (Fig. 16e and 16f), confirming their synaptic nature. Moreover, train photostimulation at 1 Hz induced postsynaptic responses without significant reduction in peak amplitude (Fig. 16g and 16h), suggesting that the repetitive activation of grafted mGIN can consistently induce GABAergic responses in GFP- cells. Considering that grafted cells constitutes 30.7+4.7% of total cells at the graft core, where the density of GFP+ cells is highest, the majority of the recorded GFP- cells would be host hippocampal neurons. Thus, our results suggest that the activation of transplanted human MGE-derived cells can generate inhibitory postsynaptic responses in host hippocampal neurons. Imaging studies provided further evidence for the formation of inhibitory synaptic connections onto host neurons by transplanted human mGIN. Fluorescence microscopy showed that many of the presynaptic VGAT+ puncta on GFP+ mGIN were juxtaposed with postsynaptic Gephyrin+ puncta (data not shown). TEM ultrastructural studies also identified symmetric synaptic contacts between presynaptic grafted cells and postsynaptic host neurons (data not shown). Taken together, these results suggest that grafted human mGIN have presynaptic machinery to release GABA and inhibit host hippocampal neurons as well as postsynaptic machinery to receive excitatory inputs from host neurons, being well integrated into the host hippocampal circuitry and regulating host inhibitory balance.

[00367] Transplanted maturing human GABAergic interneurons reduce seizure

activity in epileptic mice and ameliorate behavioral abnormalities.

[00368] Our electrophysiological findings suggest that transplanted human MGE cells integrate into host hippocampal circuitry and may be sufficient to exert anti-epileptic effects by releasing inhibitory neurotransmitter GABA and suppressing hippocampal activity. Therefore, we next investigated the therapeutic potential of transplanted human MGE cells for preventing seizures in our TLE mouse model. Seizure activity of engrafted TLE mice was analyzed 3 months after transplantation by continuous EEG-video monitoring. Vehicle-injected control TLE mice with sham surgery (n=l 1) showed seizure EEG activity with high-frequency, high- voltage synchronized polyspikes (Fig. 14a), having a seizure event frequency of 1.92 ± 0.45 seizures/day. mGIN-grafted TLE mice (n=9), however, showed significantly reduced seizure event frequency of 0.13 ± 0.07 seizure/day; in five animals in this group, seizure activity was eliminated entirely (Fig. 14a). Seizure EEG activity was confirmed by simultaneous video recording, which showed clonus and rearing and falling of the mice (Racine stage 3-5; Video. SI). Na ^' ive Nod-Scid mice without pilocarpine injection did not show any seizure EEG activity during the monitoring (n=6). The duration of seizures was not significantly different between control TLE mice and mGIN-grafted TLE mice (39 ± 2.7sec vs. 42.8 ± 8.7 sec, n = 4-10, p = 0.6083).

[00369] Because epilepsy patients frequently suffer from comorbid cognitive

impairment and psychiatric symptoms (Brooks-Kayal et al., 2013), we analyzed the effect of human mGIN transplantation on various behaviors of TLE mice. Previous studies have shown that these animals, similar to TLE patients, show cognitive deficits (Groticke et al, 2007), which could be reversed by engrafting mouse embryonic MGE cells (Hunt et al., 2013). Therefore, for the present experiments we tested whether transplanted mGIN can affect cognitive function of TLE mice in a similar manner. Using a Y maze memory task, TLE mice (n=10) showed significant deficits in short-term working memory compared to na ^' ive mice (n=9). This deficit was dramatically reduced after mGIN transplantation (n=8); there was no significant difference in total arm entry among test groups (Fig. 14b). As an independent measure of learning and memory, a novel object recognition test was performed. One hour after a 3 -minute training session using 2 identical objects, one of the objects was replaced with a novel object, and the time spent to explore the novel object, expressed as the percentage of the total time spent to explore either object, was analyzed.

Vehicle-injected control TLE mice (n=l 1) showed significantly decreased time exploring the novel object compared to the naive mice (n=8), whereas this deficit was reversed after mGIN transplantation (n=8; Fig. 14c). The percentage of the number of visits (frequency) to the novel object compared to total number of visits to either object showed a similar trend, though it did not reach significance.

[00370] In addition to cognitive deficits, hyperactivity and aggressiveness have been reported in the pilocarpine-induced rodent model of TLE (Muller et al., 2009; Rice et al., 1998). The present experiments demonstrated that control TLE mice (n = 11) displayed significantly higher locomotor activity compared to the naive mice (n=14) as measured using a photobeam activity system. Animals engrafted with human mGIN demonstrated a significant attenuation of this abnormality (n=8; Fig. 14d). Pilocarpine-induced TLE mice also showed increased agitation and aggressive behavior even during routine handling. The hypervigilance and aggressiveness displayed by vehicle-injected control TLE mice (n=l 1) was normalized to levels comparable to naive mice (n=15) after transplantation (Fig. 14e and data not shown).

[00371] While fetal MGE cell transplantation has demonstrated proof-of-principle for cell-based therapy of epilepsy (Hattiangady et al, 2008; Hunt et al, 2013), clinical application is limited by the lack of standardized and reliable cell sources as well as ethical controversies associated with using fetal cells. Human PSC technology offers the potential to provide cell sources that are well-characterized, quality-controlled, and virtually unlimited in supply, as long as efficacious progenies can be proficiently derived. We have utilized optimized differentiation of human PSCs into MGE cells (Kim et al., 2014), and report here previously unknown functional efficacy of mGIN to reduce epileptic activity and comorbid behavioral abnormalities in the epileptic brain even before they attain full maturity. Considering full electrophysiological maturation of human GABAergic interneurons could take years (Le Magueresse and Monyer, 2013; Nicholas et al, 2013), our findings using human mGIN provide a major step towards developing an efficient and novel cell-based therapy for treating intractable epilepsy. [00372] We have demonstrated that PSC-derived human mGIN migrate extensively within the epileptic hippocampus, integrate into host circuitry and reduces seizure activity and other behavioral abnormalities. The primary mechanisms of the functional effects of grafted mGIN are suggested by our electrophysiological studies (Fig. 21). Although they are not fully mature, approximately half of transplanted human MGE cells fire spontaneous action potentials (AP) at ~2 Hz, indicating that they are tonically active even without extrinsic synaptic inputs. Moreover, transplanted human mGIN fully integrate into the hippocampal circuitry, receiving excitatory synaptic inputs from host glutamatergic neurons and therefore activated by host signals. In turn, our optogenetic studies revealed that grafted human mGIN release inhibitory neurotransmitter GABA in an activity-dependent manner.

Therefore, the activation of transplanted mGIN, either by spontaneous activity or by excitatory synaptic drive, would increase inhibitory synaptic responses in host hippocampal neurons, shifting excitation toward inhibition and suppressing exaggerated neural activity in the epileptic brain. Consistent with previous work (Hunt et al, 2013), we did not observe significant changes in mossy fiber sprouting by human MGE transplantation compared to control TLE mice (Fig. 20), suggesting that regulation of inhibitory balance by grafted cells may be sufficient to exert the anti-epileptic effects observed in this study.

[00373] Cell therapy for epilepsy offers a number of advantages over conventional therapies. Distinct cell types can be precisely engrafted into brain substructures (Bjarkam et al., 2010), averting the acute and long-term systemic adverse effects seen with AEDs. Further, neural grafts, with their ability to integrate within the host circuitry, would circumvent the need for daily dosing and sluggish titration required with AED administration. A self-regulating therapeutic system of mGIN grafts would eliminate the need of carrying devices to monitor and control seizures. Temporal lobectomy has been used as a last-resort intervention for intractable epilepsy, but is associated with surgical morbidity and permanent dysfunction. High-precision stereotactic engraftment of stem cells, however, is less invasive and leaves functional neural tissue undisturbed.

[00374] Here we have demonstrated the biology and utility of human PSC-derived mGIN to ameliorate the symptoms of a prevalent and debilitating neuropsychiatric disease. Before transition into the clinic setting, the question of 'dosing' of MGE cell grafts will need to be addressed. Interestingly, it has been reported that an increase in inhibition reaches a plateau with relatively low numbers of transplanted interneurons (Southwell et al, 2010). This suggests that larger numbers of interneurons are unlikely to result in adverse effects, but at the same time, smaller, less intrusive deposits of cells may produce an optimal response. In addition, further evaluation of long-term graft survival and safety should be assessed before undertaking clinical applications. Porcine human simulation neurosurgery is presently underway to establish such criteria prior to human trials (Cunningham et al., unpublished data). In addition, isolation and purification of cortical interneuron populations using appropriate cell surface markers will facilitate the generation of quality-controlled cell sources for human trials. With prudent preclinical testing, this technology holds promise as a therapeutic approach for TLE as well as other intractable diseases of the central nervous system. 75] Table2. Antibody list used in the experiments for Example 2.

Synaptophysin Rabbit 1/2000 Pierce

Synaptophysin Mouse 1/500 Abeam

ENCAM Rat 1/1000 BD

NeuN Mouse 1/500 Chemicon

VGAT Rabbit 1/1000 Synaptic Systems

Gephyrin Mouse 1/1000 Synaptic Systems

Human Cytoplasm Mouse 1/500 Stem Cells Inc

Ki67 Mouse 1/1000 Millipore

Sox6 Rabbit 1/1000 Millipore

Somatostatin Goat 1/1000 SCBT

GFAP Rabbit 1/1000 Dako

CoupTFII Mouse 1/1000 Persus Proteomics

SSEA4 Mouse 1/1000 SCBT

Cy3 -Human Nucleus Mouse 1/1000 Millipore

ZnT3 Rabbit 1/1000 Gift from Dr. Palmiter

VIP Rabbit 1/1000 ImmunoStar

[00376] Table 3. Primer list of Example 2.

Outside primers

GAD67 Forward ATACCTCTTCCAGCCAGAC (SEQ ID NO: 2)

Reverse GCTCGCCATTGAAAACCATC(SEQ ID NO: 3)

Parvalbumin Forward ACCTGTCTGCTAAAGAAACC (SEQ ID NO: 4)

GGGGATGGGGGAGTAAAAAATAAC (SEQ ID

Reverse NO: 5)

Somatostatin Forward CAACCAGACGGAGAATGATG (SEQ ID NO: 6)

Reverse GCTGAAGACTTGGAGGATTAG (SEQ ID NO: 7)

Neuropeptide Y Forward TAGGTAACAAGCGACTGGGG (SEQ ID NO: 8)

GGGCTGAAAATAGGAAAAGGC (SEQ ID NO:

Reverse 9)

Calretinin Forward AAGGCAAGGAAAGGCTCTGG (SEQ ID NO: 10) Reverse CCGTTCAAGTCAAACATCCG (SEQ ID NO: 11)

Vasoactive intestinal peptide Forward TCTTCTCACAGACTTCGGC (SEQ ID NO: 12)

Reverse CATTTGTTTTCTAAGGCGGG (SEQ ID NO: 13)

ATACAAACCCCGACCGAAACGCAC (SEQ ID

Forward NO: 14)

Sox6

Reverse CCGCCATCTGTCTTCATAC (SEQ ID NO: 15)

GAD65 Forward AACACCACTTTGTCTCTGAG (SEQ ID NO: 16)

Reverse GGTAGTTTGGCACACCTAAC (SEQ ID NO: 17)

Nested primers

GAD67 Forward GCAGTATGATGTCTCCTACG (SEQ ID NO: 18)

Reverse GTATTCAGCCAGTTCCAGG (SEQ ID NO: 19)

TGCTGGAGACAAAGATGGGGAC (SEQ ID NO:

Forward 20)

Parvalbumin

ATTGGGTGTTCAGGGCAGAGAG (SEQ ID NO: Reverse 21)

Somatostatin Forward GCAGGATGAAATGAGGCTTG (SEQ ID NO: 22)

CAGGATGTGAAAGTCTTCCAG (SEQ ID NO: Reverse 23)

Neuropeptide Y Forward GCTGCGACACTACATCAAC (SEQ ID NO: 24)

CTCATTTCCCATCACCACATTG(SEQ ID NO: Reverse 25)

Calretinin Forward TCCTGCCAACCGAAGAGAAC (SEQ ID NO: 26)

Reverse TAGCCACTCCTGTCTGTGTC (SEQ ID NO: 27)

Vasoactive intestinal peptide Forward CTCTTTACAGGGCACCTTC(SEQ ID NO: 28)

Reverse GGTCTTCTGAGATGTTACTGC(SEQ ID NO: 29)

Sox6 Forward AGCAACTGATGAGGTCTCG (SEQ ID NO: 30)

Reverse CACCAGGATACACAACACC (SEQ ID NO: 31)

GAD65 Forward AAATCGTAGGTGTTGGCTC (SEQ ID NO: 32)

Reverse GATACCCAGTTTGAGGTTCC (SEQ ID NO: 33) [00377] References Example 2

[00378] Baraban, S.C., Southwell, D.G., Estrada, R.C., Jones, D.L., Sebe, J.Y., Alfaro- Cervello, C, Garcia- Verdugo, J.M., Rubenstein, J.L., and Alvarez-Buylla, A. (2009). Reduction of seizures by transplantation of cortical GABAergic interneuron precursors into Kvl . l mutant mice. Proc Natl Acad Sci U S A 106, 15472-15477.

[00379] Bjarkam, C.R., Glud, A.N., Margolin, L., Reinhart, K., Franklin, R., Deding, D., Ettrup, K.S., Fitting, L.M., Nielsen, M.S., Sorensen, J.C., et al. (2010). Safety and function of a new clinical intracerebral microinjection instrument for stem cells and therapeutics examined in the Gottingen minipig. Stereotactic and functional neurosurgery 88, 56-63.

[00380] Brooks-Kayal, A.R., Bath, K.G., Berg, A.T., Galanopoulou, A.S., Holmes, G.L., Jensen, F.E., Kanner, A.M., O'Brien, T.J., Whittemore, V.H., Winawer, M.R., et al. (2013). Issues related to symptomatic and disease-modifying treatments affecting cognitive and neuropsychiatric comorbidities of epilepsy. Epilepsia 54 Suppl 4, 44- 60.

[00381] Chen, K.G., Mallon, B.S., McKay, R.D., and Robey, P.G. (2014). Human pluripotent stem cell culture: considerations for maintenance, expansion, and therapeutics. Cell Stem Cell 14, 13-26.

[00382] Christoph, C.H. (2008). Temporal lobe resection—does the prospect of seizure freedom outweigh the cognitive risks? Nat Clin Pract Neurol 4, 66-67.

[00383] Chung, S., Moon, J. -I., Leung, A., Aldrich, D., Lukianov, S., Kitayama, Y., Park, S., Li, Y., Bolshakov, V.Y., Lamonerie, T., et al. (2011). ES cell-derived renewable and functional midbrain dopaminergic progenitors. Proceedings of the National Academy of Sciences 108, 9703-9708.

[00384] Cossart, R., Dinocourt, C, Hirsch, J.C., Merchan-Perez, A., De Felipe, J., Ben-Ari, Y., Esclapez, M., and Bernard, C. (2001). Dendritic but not somatic

GABAergic inhibition is decreased in experimental epilepsy. Nature neuroscience 4, 52-62.

[00385] Cramer, J.A., Mintzer, S., Wheless, J., and Mattson, R.H. (2010). Adverse effects of antiepileptic drugs: a brief overview of important issues. Expert Rev Neurother 10, 885-891.

[00386] Curia, G., Longo, D., Biagini, G., Jones, R.S., and Avoli, M. (2008). The pilocarpine model of temporal lobe epilepsy. J Neurosci Methods 172, 143-157. [00387] de Lanerolle, N.C., Kim, J.H., Robbins, R.J., and Spencer, D.D. (1989).

Hippocampal interneuron loss and plasticity in human temporal lobe epilepsy. Brain Res 495, 387-395.

[00388] Doischer, D., Hosp, J.A., Yanagawa, Y., Obata, K., Jonas, P., Vida, I., and

Bartos, M. (2008). Postnatal differentiation of basket cells from slow to fast signaling devices. J Neurosci 28, 12956-12968.

[00389] Engel, J. (2001). A Proposed Diagnostic Scheme for People with Epileptic

Seizures and with Epilepsy: Report of the ILAE Task Force on Classification and

Terminology. Epilepsia 42, 796-803.

[00390] Engel, J. (2002). Epilepsy in the world today: medical point of view. Epilepsia

43 Suppl 6, 12-13.

[00391] Fine, A., Meldrum, B.S., and Patel, S. (1990). Modulation of experimentally induced epilepsy by intracerebral grafts of fetal GABAergic neurons.

Neuropsychologia 28, 627-634.

[00392] Groticke, I., Hoffmann, K., and Loscher, W. (2007). Behavioral alterations in the pilocarpine model of temporal lobe epilepsy in mice. Exp Neurol 207, 329-349.

[00393] Hattiangady, B., Rao, M.S., and Shetty, A.K. (2008). Grafting of striatal precursor cells into hippocampus shortly after status epilepticus restrains chronic temporal lobe epilepsy. Exp Neurol 212, 468-481.

[00394] Hirsch, J.C., Agassandian, C, Merchan-Perez, A., Ben-Ari, Y., DeFelipe, J.,

Esclapez, M., and Bernard, C. (1999). Deficit of quantal release of GABA in experimental models of temporal lobe epilepsy. Nature neuroscience 2, 499-500.

[00395] Hunt, R.F., Girskis, K.M., Rubenstein, J.L., Alvarez-Buylla, A., and Baraban,

S.C. (2013). GABA progenitors grafted into the adult epileptic brain control seizures and abnormal behavior. Nature neuroscience 16, 692-697.

[00396] Jensen, F.E. (2014). Epilepsy in 2013: Progress across the spectrum of

epilepsy research. Nat Rev Neurol 10, 63-64.

[00397] Kim, T.-G., Yao, R., Monnell, T., Cho, J.-H., Vasudevan, A., Koh, A.,

Peeyush, K.T., Moon, M., Datta, D., Bolshakov, V.Y., et al. (2014). Efficient

Specification of Intemeurons from Human Pluripotent Stem Cells by Dorsoventral and Rostrocaudal Modulation. STEM CELLS 32, 1789-1804.

[00398] Kobayashi, M., and Buckmaster, P.S. (2003). Reduced inhibition of dentate granule cells in a model of temporal lobe epilepsy. J Neurosci 23, 2440-2452. [00399] Le Magueresse, C, and Monyer, H. (2013). GABAergic Interneurons Shape the Functional Maturation of the Cortex. Neuron 77, 388-405.

[00400] Lindvall, O., and Bjorklund, A. (1992). Intracerebral grafting of inhibitory neurons. A new strategy for seizure suppression in the central nervous system.

Advances in neurology 57, 561-569.

[00401] Loscher, W., Ebert, U., Lehmann, H., Rosenthal, C, and Nikkhah, G. (1998).

Seizure suppression in kindling epilepsy by grafts of fetal GABAergic neurons in rat substantia nigra. J Neurosci Res 51, 196-209.

[00402] Maisano, X., Litvina, E., Tagliatela, S., Aaron, G.B., Grabel, L.B., and

Naegele, J.R. (2012). Differentiation and functional incorporation of embryonic stem cell-derived GABAergic interneurons in the dentate gyrus of mice with temporal lobe epilepsy. J Neurosci 32, 46-61.

[00403] Mallon, B.S., Chenoweth, J.G., Johnson, K.R., Hamilton, R.S., Tesar, P.J.,

Yavatkar, A.S., Tyson, L.J., Park, K., Chen, K.G., Fann, Y.C., et al. (2013).

StemCellDB: the human pluripotent stem cell database at the National Institutes of

Health. Stem cell research 10, 57-66.

[00404] Marco, P., Sola, R.G., Pulido, P., Alijarde, M.T., Sanchez, A., Ramon y Cajal,

S., and DeFelipe, J. (1996). Inhibitory neurons in the human epileptogenic temporal neocortex. An immunocytochemical study. Brain 119 ( Pt 4), 1327-1347.

[00405] Mazzuferi, M., Kumar, G., Rospo, C, and Kaminski, R.M. (2012). Rapid epileptogenesis in the mouse pilocarpine model: video-EEG, pharmacokinetic and histopatho logical characterization. Exp Neurol 238, 156-167.

[00406] Muller, C.J., Groticke, I., Bankstahl, M., and Loscher, W. (2009). Behavioral and cognitive alterations, spontaneous seizures, and neuropathology developing after a pilocarpine-induced status epilepticus in C57BL/6 mice. Exp Neurol 219, 284-297.

[00407] Nicholas, C.R., Chen, J., Tang, Y., Southwell, D.G., Chalmers, N., Vogt, D.,

Arnold, CM., Chen, Y.J., Stanley, E.G., Elefanty, A.G., et al. (2013). Functional

Maturation of hPSC-Derived Forebrain Interneurons Requires an Extended Timeline and Mimics Human Neural Development. Cell Stem Cell 12, 573-586.

[00408] Okaty, B.W., Miller, M.N., Sugino, K., Hempel, CM., and Nelson, S.B.

(2009). Transcriptional and electrophysiological maturation of neocortical fast- spiking GABAergic interneurons. J Neurosci 29, 7040-7052. [00409] Rice, A.C., Floyd, C.L., Lyeth, B.G., Hamm, R.J., and DeLorenzo, R.J.

(1998). Status epilepticus causes long-term NMDA receptor-dependent behavioral changes and cognitive deficits. Epilepsia 39, 1148-1157.

[00410] Shibley, H., and Smith, B.N. (2002). Pilocarpine-induced status epilepticus results in mossy fiber sprouting and spontaneous seizures in C57BL/6 and CD-I mice.

Epilepsy Res 49, 109-120.

[00411] Southwell, D.G., Froemke, R.C., Alvarez-Buylla, A., Stryker, M.P., and

Gandhi, S.P. (2010). Cortical plasticity induced by inhibitory neuron transplantation.

Science (New York, NY) 327, 1145-1148.

[00412] Spreafico, R., Battaglia, G., Arcelli, P., Andermann, F., Dubeau, F., Palmini,

A., Olivier, A., Villemure, J.G., Tampieri, D., Avanzini, G., et al. (1998). Cortical dysplasia: an immunocytochemical study of three patients. Neurology 50, 27-36.

[00413] Walia, K.S., Khan, E.A., Ko, D.H., Raza, S.S., and Khan, Y.N. (2004). Side effects of antiepileptics~a review. Pain practice : the official journal of World

Institute of Pain 4, 194-203.

[00414] Wieser, H.G. (2004). ILAE Commission Report. Mesial temporal lobe

epilepsy with hippocampal sclerosis. Epilepsia 45, 695.

[00415] Yu, D.X., Marchetto, M.C., and Gage, F.H. (2013). Therapeutic translation of aspics for treating neurological disease. Cell Stem Cell 12, 678-688.

[00416] Sequences

[00417] FGF8 homosapiens protein

[00418] 1 maedgdpfak livetdtfgs rvrvrgaetg lyicmnkkgk liaksngkgk dcvfteivle

[00419] 61 nnytalqnak yegwymaftr kgrprkgskt rqhqrevhfm krlprghhtt eqslrfef n

[00420] 121 yppftrslrg sqrtwapepr (SEQ ID NO : 01 )

[00421] FGF8 homosapiens protein Nucleic acid: Human fibroblast growth factor 8

(FGF8) gene, exon 3 and complete cds. ACCESSION U47011

[00422] 1 ctcgagctcc ccacttcctg ggcttctggg gctggggtct tagcatcttc tcccaggcct

[00423] 61 cccctccccc ataggtggct gccctggggc cagggaaccg aagtcctggg ggggtgagag

[00424] 121 gggcaggtgg ggagacgggt ggccagactg gtgggcagga ggccagagca ggccaggctc

[00425] 181 tgggcccctc tctctgtctt tctgcgttgg ggcccagccc tccgtagaca accatgtgtc

[00426] 241 actgctgcct gggaaggaca ggaagttgcc gggtgggctg cgagttgtga gggattagag [00427] 301 agcgggtgcc caggcagggg ggtggggctg cggctcctgc ccacctcgcc atctgctggg

[00428] 361 gtgcccacct gctgtctggg gccgctcgcc ctctgcctct gctggggggg ctctgtaacg

[00429] 421 tggtgtctgg ctcccctacc tgcagagcaa cggcaaaggc aaggactgcg tcttcacgga

[00430] 481 gattgtgctg gagaacaact acacagcgct gcagaatgcc aagtacgagg gctggtacat

[00431] 541 ggccttcacc cgcaagggcc ggccccgcaa gggctccaag acgcggcagc accagcgtga

[00432] 601 ggtccacttc atgaagcggc tgccccgggg ccaccacacc accgagcaga gcctgcgctt

[00433] 661 cgagttcctc aactacccgc ccttcacgcg cagcctgcgc ggcagccaga ggacttgggc

[00434] 721 ccccgagccc cgatagtgct gcctggccct ccccacaatg ccagaccgca gagaggctca

[00435] 781 tcctgtaggg cacccaaaac tcaagcaaga tgagctgtgc gctgctctgc aggctgggga

[00436] 841 ggtgctgggg gagccctggg ttccggttgt tgatattgtt tgctgttggg tttttgctgt

[00437] 901 tttttttttt tttttttttt ttaaaacaaa agagaggctc tatttttgta ttccacttgg

[00438] 961 ctgtggtgtc tgtcttctta actctcagaa agctccatta gtggcctaga ctgggattcc

[00439] 1021 ggctgggggt ttgcgggggt ggggggcttt ctctagcctg tgctgctgag gccccagtac

[00440] 1081 ctccagggcc agttggctgg gcagccaggg actccactgc acccccaggt ggggcaggga

[00441] 1141 ggaaaggact gtgacatagg gcagtcctct tagaagtggg tatcagactg gtggctatta

[00442] 1201 aatgattgaa atatttattt aacttgcata ttaaaaatgt gtgctggaga gtgagtcctg

[00443] 1261 ccggggtcag cccctccctc caaccttgcc ccagctggtg ggcggctggg agacgcagat

[00444] 1321 gaccaggtgc cagctctgac cacagcctcc ctccagccta aagacacctg cctgtcaacc

[00445] 1381 atccccatca ctgtcacttg aggggttttc ctgcaaggac agaagcaggg aaaggggcaa

[00446] 1441 gaagaggctc ttagctagtc cttggagctc tcagatgtgt acctcctagc actttacaga

[00447] 1501 ggtcattgct aacacttccc caggccacct cagggccaga aataatggat gtgctagggc

[00448] 1561 tagagctgta atcatggatt taatcctctt aaaaagtgct tctctgagtg cctaggtcca

[00449] 1621 tgtgggagac aggttggaga ttccagaact tgctctttct gagactcagg ctccagaaaa

[00450] 1681 tgaaagaaaa gagcagctgc cagggtccaa ggtgggggca tattggaggg ggaccaccaa

[00451] 1741 gactggtgtt gacaatggtg atgtgggaca agtgttaacc ttgggtgata tggtgagata

[00452] 1801 gctgtgggca gaaagcactg agctgaggtg cggcgaggag cctggggaac tgtcttccag

[00453] 1861 gaagaggctg cccacctcgg aggatgggct ggcgggagag gagctgggca ccggatggca

[00454] 1921 ccagaaggga agctcatagg cctagcgcag aactaaaggc agtcatagcc ttggggagaa

[00455] 1981 gcaggaggcc gtatgtggag ggagggaggg ctgctgtggg agtggtggag caggtcatgg

[00456] 2041 tgtgggcaga gaagggaatg ggcaagggtg caggtgtgtg tttgcgtgtg gactggtgag

[00457] 2101 actggtgtcc tgccacaccg agggagagcc caggccccac ggcagtttcc tgagtgcaga

[00458] 2161 gctggcccag gcttcatcgc tgaggcctcc cattagggct gctcctgctt ccttccttgt

[00459] 2221 ggatgccctg ggctggtccc acagcccagc tactgagcca gtctaga (SEQ ID NO: 43) [00460] Sequence of NkX2.1 mR A NCBI Reference Sequence: NM 001079668.2

[00461] 1 ctgacagaca cgtagaccaa cagtgcggcc ccagggttcg tccccagact cgctcgctca

[00462] 61 tttgttggcg actggggctc agcgcagcga agcccgatgt ggtccggagg cagtgggaag

[00463] 121 gcgcggggct gggaggccgc ggcgggaggg aggagcagcc ccggcaggct cagccgccgc

[00464] 181 cgaatcatgt cgatgagtcc aaagcacacg actccgttct cagtgtctga catcttgagt

[00465] 241 cccctggagg aaagctacaa gaaagtgggc atggagggcg gcggcctcgg ggctccgctg

[00466] 301 gcggcgtaca ggcagggcca ggcggcaccg ccaacagcgg ccatgcagca gcacgccgtg

[00467] 361 gggcaccacg gcgccgtcac cgccgcctac cacatgacgg cggcgggggt gccccagctc

[00468] 421 tcgcactccg ccgtgggggg ctactgcaac ggcaacctgg gcaacatgag cgagctgccg

[00469] 481 ccgtaccagg acaccatgag gaacagcgcc tctggccccg gatggtacgg cgccaaccca

[00470] 541 gacccgcgct tccccgccat ctcccgcttc atgggcccgg cgagcggcat gaacatgagc

[00471] 601 ggcatgggcg gcctgggctc gctgggggac gtgagcaaga acatggcccc gctgccaagc

[00472] 661 gcgccgcgca ggaagcgccg ggtgctcttc tcgcaggcgc aggtgtacga gctggagcga

[00473] 721 cgcttcaagc aacagaagta cctgtcggcg ccggagcgcg agcacctggc cagcatgatc

[00474] 781 cacctgacgc ccacgcaggt caagatctgg ttccagaacc accgctacaa aatgaagcgc

[00475] 841 caggccaagg acaaggcggc gcagcagcaa ctgcagcagg acagcggcgg cggcgggggc

[00476] 901 ggcgggggca ccgggtgccc gcagcagcaa caggctcagc agcagtcgcc gcgacgcgtg

[00477] 961 gcggtgccgg tcctggtgaa agacggcaaa ccgtgccagg cgggtgcccc cgcgccgggc

[00478] 1021 gccgccagcc tacaaggcca cgcgcagcag caggcgcagc accaggcgca ggccgcgcag

[00479] 1081 gcggcggcag cggccatctc cgtgggcagc ggtggcgccg gccttggcgc acacccgggc

[00480] 1141 caccagccag gcagcgcagg ccagtctccg gacctggcgc accacgccgc cagccccgcg

[00481] 1201 gcgctgcagg gccaggtatc cagcctgtcc cacctgaact cctcgggctc ggactacggc

[00482] 1261 accatgtcct gctccacctt gctatacggt cggacctggt gagaggacgc cgggccggcc

[00483] 1321 ctagcccagc gctctgcctc accgcttccc tcctgcccgc cacacagacc accatccacc

[00484] 1381 gctgctccac gcgcttcgac ttttcttaac aacctggccg cgtttagacc aaggaacaaa

[00485] 1441 aaaaccacaa aggccaaact gctggacgtc tttctttttt tcccccccta aaatttgtgg

[00486] 1501 gttttttttt ttaaaaaaag aaaatgaaaa acaaccaagc gcatccaatc tcaaggaatc

[00487] 1561 tttaagcaga gaagggcata aaacagcttt ggggtgtctt tttttggtga ttcaaatggg

[00488] 1621 ttttccacgc tagggcgggg cacagattgg agagggctct gtgctgacat ggctctggac

[00489] 1681 tctaaagacc aaacttcact ctgggcacac tctgccagca aagaggactc gcttgtaaat

[00490] 1741 accaggattt tttttttttt ttgaagggag gacgggagct ggggagagga aagagtcttc

[00491] 1801 aacataaccc acttgtcact gacacaaagg aagtgccccc tccccggcac cctctggccg [00492] 1861 cctaggctca gcggcgaccg ccctccgcga aaatagtttg tttaatgtga acttgtagct

[00493] 1921 gtaaaacgct gtcaaaagtt ggactaaatg cctagttttt agtaatctgt acattttgtt

[00494] 1981 gtaaaaagaa aaaccactcc cagtccccag cccttcacat tttttatggg cattgacaaa

[00495] 2041 tctgtgtata ttatttggca gtttggtatt tgcggcgtca gtctttttct gttgtaactt

[00496] 2101 atgtagatat ttggcttaaa tatagttcct aagaagcttc taataaatta tacaaattaa

[00497] 2161 aaagattctt tttctgatta aaaaaaaaaa aaaaaaa (SEQ ID NO: 44).

[00498] REFERENCES

[00499] The references cited throughout the specification and Exampli

incorporated herein in their entirety by reference.