MODULATORS OF ENaC EXPRESSION

Sequence Listing

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0315WOSEQ.txt created October 10, 2018 which is 484 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Field

The present embodiments provide methods, compounds, and compositions useful for inhibiting ENaC expression, which can be useful for treating, preventing, or ameliorating a disease associated with ENaC.

Background

The epithelial sodium channel (ENaC) is a channel made up of three subunits (typically α-ENaC, β- ENaC, and γ-ENaC; or SCNN1A, SCNN1B, and SCNN1G, respectively) that is expressed in several tissues, including the lungs. It allows passage of sodium ions across the epithelial cell membrane and is negatively regulated by chloride ions. In cystic fibrosis patients, the inhibition of ENaC is reduced due to decreased function of the chloride transporter, CFTR.

Summary Certain embodiments provided herein are directed to potent and tolerable compounds and compositions useful for inhibiting ENaC expression, which can be useful for treating, preventing, ameliorating, or slowing progression of lung disorders, e.g., cystic fibrosis, chronic obstructive pulmonary disease (COPD), chronic bronchitis, and asthma. Certain embodiments provided herein comprise modified oligonucleotides complementary to an α-ENaC nucleic acid that potently reduce α-ENaC expression in animals. Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.

As used herein, "2'-deoxynucleoside" means a nucleoside comprising 2'-H(H) ribosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2'-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

As used herein, "2 '-substituted nucleoside" or "2 -modified nucleoside" means a nucleoside comprising a 2 '-substituted or 2'-modified sugar moiety. As used herein, "2 '-substituted" or "2 -modified" in reference to a furanosyl sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.

As used herein, "administration" or "administering" refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to, administration by inhalation.

As used herein, "administered concomitantly" or "co-administration" means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.

As used herein, "animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

As used herein, "antisense activity" means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

As used herein, "antisense compound" means a compound comprising an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. As used herein, "antisense oligonucleotide" means an oligonucleotide having a nucleobase sequence that is at least partially complementary to a target nucleic acid.

As used herein, "ameliorate" in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.

As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety. As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

As used herein, "cEt" or "constrained ethyl" means a bicyclic sugar moiety, wherein the first ring of the bicyclic sugar moiety is a ribosyl sugar moiety, the second ring of the bicyclic sugar is formed via a bridge connecting the 4 '-carbon and the 2 '-carbon, the bridge has the formula 4'-CH(CH3)-0-2', and the methyl group of the bridge is in the S configuration. A cEt bicyclic sugar moiety is in the β-D configuration.

As used herein, "chirally enriched population" means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of such oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases are nucleobase pairs that are capable of forming hydrogen bonds with one another.

Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5 -methyl cytosine ( ^m C) and guanine (G). Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, "fully complementary" or "100% complementary" in reference to oligonucleotides means that such oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide. As used herein, "conjugate group" means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

As used herein, "conjugate linker" means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

As used herein, "contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

As used herein, "double-stranded antisense compound" means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an antisense oligonucleotide.

As used herein, "effective amount" means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

As used herein, "efficacy" means the ability to produce a desired effect.

As used herein "ENaC" means any ENaC (epithelial sodium channel) nucleic acid or protein. "ENaC nucleic acid" means any nucleic acid encoding an ENaC subunit. For example, in certain embodiments, an ENaC nucleic acid includes a DNA chromosomal region encoding ENaC, an RNA transcribed from DNA encoding ENaC (e.g., a pre-mRNA transcript), and an mRNA transcript encoding ENaC. In certain embodiments, an ENaC nucleic acid or protein is an α-ENaC or SCNN1A (sodium channel epithelial 1 alpha subunit) nucleic acid or protein. Herein, α-ENaC and SCNN1A are used interchangeably and have the same meaning.

As used herein, "expression" includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.

As used herein, "gapmer" means an oligonucleotide, such as an antisense oligonucleotide, comprising an internal segment having a plurality of nucleosides that support RNase H cleavage positioned between external segments, each having one or more nucleosides, wherein the nucleosides comprising the internal segment are chemically distinct from the immediately adjacent nucleoside or nucleosides comprising the external segments. The internal segment may be referred to as the "gap" or "gap segment" and the external segments may be referred to as the "wings" or "wing segments". As used herein, "hybridization" means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

As used herein, "individual" means a human or non-human animal selected for treatment or therapy.

As used herein, "inhibiting the expression or activity" refers to a reduction or blockade of the expression or activity relative to the expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

As used herein, the terms "intemucleoside linkage" means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein "modified intemucleoside linkage" means any intemucleoside linkage other than a naturally occurring, phosphate intemucleoside linkage. Non-phosphate linkages are referred to herein as modified intemucleoside linkages.

"Phosphorothioate linkage" means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate intemucleoside linkage is a modified

intemucleoside linkage. Modified intemucleoside linkages include linkages that comprise abasic nucleosides. As used herein, "abasic nucleoside" means a sugar moiety in an oligonucleotide or oligomeric compound that is not directly connected to a nucleobase. In certain embodiments, an abasic nucleoside is adjacent to one or two nucleosides in an oligonucleotide.

As used herein, "linker-nucleoside" means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

As used herein, "non-bicyclic modified sugar" or "non-bicyclic modified sugar moiety" means a modified sugar moiety that comprises a modification, such as a substitutent, that does not form a bridge between two atoms of the sugar to form a second ring.

As used herein, "linked nucleosides" are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).

As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligomeric compound are aligned.

As used herein, "modulating" refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating ENaC expression can mean to increase or decrease the level of an ENaC RNA and/or an ENaC protein in a cell, tissue, organ or organism. A "modulator" effects the change in the cell, tissue, organ or organism. For example, a compound that modulates ENaC expression can be a modulator that decreases the amount of an ENaC RNA and/or an ENaC protein in a cell, tissue, organ or organism.

As used herein, "MOE" means methoxyethyl. "2'-MOE" or "2'-0-methoxyethyl" means a 2'- OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl ring.

As used herein, "motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

As used herein, "naturally occurring" means found in nature.

As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). As used herein, a modified nucleobase is a group of atoms capable of pairing with at least one unmodified nucleobase. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases.

As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

As used herein, "nucleoside" means a moiety comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.

As used herein, "oligomeric compound" means a compound consisting of an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.

As used herein, "oligonucleotide" means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, liquids, powders, or suspensions that can be aerosolized or otherwise dispersed for inhalation by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water; sterile saline; or sterile buffer solution.

As used herein "pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

As used herein "pharmaceutical composition" means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an antisense compound and an aqueous solution. As used herein, "phosphorus moiety" means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.

As used herein "prodrug" means a therapeutic agent in a form outside the body that is converted to a differentform within the body or cells thereof. Typically conversion of a prodrug within the body is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.

As used herein, "R Ai compound" means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single -stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense oligonucleotides that act through RNase H.

As used herein, the term "single-stranded" in reference to an antisense compound means such a compound consisting of one oligomeric compound that is not paired with a second oligomeric compound to form a duplex. "Self-complementary" in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligomeric compound, wherein the oligonucleotide of the oligomeric compound is self-complementary, is a single-stranded compound. A single- stranded antisense or oligomeric compound may be capable of binding to a complementary oligomeric compound to form a duplex, in which case the compound would no longer be single-stranded.

As used herein, "standard cell assay" means the assay described in Example 3 and reasonable variations thereof.

As used herein, "standard in vivo experiment" means the procedure described in Example 4, 6, or 7, and reasonable variations thereof.

As used herein, "stereorandom chiral center" in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" means a 2'-OH(H) ribosyl moiety, as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H) moiety, as found in DNA (an "unmodified DNA sugar moiety"). As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or a sugar surrogate. As used herein, modified furanosyl sugar moiety means a furanosyl sugar comprising a non- hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain

embodiments, a modified furanosyl sugar moiety is a 2 '-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars. As used herein, "sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

As used herein, "target nucleic acid," "target RNA," "target RNA transcript" and "nucleic acid target" mean a nucleic acid that an antisense compound is designed to affect.

As used herein, "target region" means a portion of a target nucleic acid to which an antisense compound is designed to hybridize.

As used herein, "terminal group" means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

As used herein, "terminal wing nucleoside" means a nucleoside that is located at the terminus of a wing segment of a gapmer. Any wing segment that comprises or consists of at least two nucleosides has two termini: one that is immediately adjacent to the gap segment; and one that is at the end opposite the gap segment. Thus, any wing segment that comprises or consists of at least two nucleosides has two terminal nucleosides, one at each terminus.

As used herein, "therapeutically effective amount" means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.

As used herein, "treat" refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.

Certain Embodiments

Certain embodiments provide methods, compounds and compositions for inhibiting ENaC expression.

Certain embodiments provide compounds comprising or consisting of oligonucleotides complementary to an α-ENaC or SCN IA nucleic acid. In certain embodiments, the α-ENaC or SCNNIA nucleic acid has the sequence set forth in RefSeq or GenBank Accession No. NM_001038.5 (disclosed herein as SEQ ID NO: 1), the complement of NC_000012.12 truncated from nucleosides 6343001 to 6380000 (disclosed herein as SEQ ID NO: 2), or NG_011945.1 (disclosed herein as SEQ ID NO: 1957). In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

Certain embodiments provide a compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single -stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6 to 1954. For example, the nucleobase sequence of the modified oligonucleotide comprises or consists of any one of SEQ ID NOs 6, 7, etc.... or 1954. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 167. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 244. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 399. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 428. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 431. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 438. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 590. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 824. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 935. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1049. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1114. In certain

embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1124. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1134. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1139. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1145. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1170. In certain

embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1530. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1532. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1672. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1730. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1802. In certain

embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1832. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length. In certan embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 12 contiguous nucleobases of any of SEQ ID Numbers from 6 to 1954.

Certain embodiments provide a compound comprising a modified oligonucleotide 10 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single -stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide 11 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single -stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 11 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single -stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 12 to 30 linked nucleosides in length.

In certain embodiments, the compound comprises a modified oligonucleotide 30 linked nucleosides in length. In certain embodiments, the compound is an antisense compound or oligomeric compound.

Certain embodiments provide a compound comprising a modified oligonucleotide 16 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single -stranded. In certain embodiments, the compound is double -stranded. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single -stranded. |In certain embodiments, the compound is double-stranded.

In certain embodiments, compounds comprise or consist of modified oligonucleotides complementary to an intron of an α-ENaC nucleic acid transcript. In certain embodiments, modified oligonucleotides are complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 1 1, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, modified oligonucleotides are complementary to a sequence within nucleotides 4,497-5, 163; 5,634-16,290; 16,559- 17,759; 17,951-24, 120; 24,225-24,565; 24,730-25, 152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31, 198; or 31,275-31,747 of SEQ ID NO: 2. In certain embodiments, compounds comprise or consist of oligonucleotides having at least an 8, 9, 10, 1 1, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain embodiments, such oligonucleotides have at least an 8, 9, 10, 1 1, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 4,497-5, 163; 5,634-16,290; 16,559-17,759; 17,951-24, 120; 24,225-24,565; 24,730-25, 152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31, 198; or 31,275-31,747 of SEQ ID NO: 2. In certain embodiments, these compounds are antisense compounds or oligomeric compounds. Compounds comprising modified oligonucleotide complementary to nearly any portion of certain introns of an α-ENaC nucleic acid transcript, e.g., intron 4 of an α-ENaC pre-mRNA, are generally especially potent and tolerable. Thus, such certain introns can be considered hot spot regions for targeting an α-ENaC nucleic acid transcript.

In certain embodiments, compounds comprise or consist of modified oligonucleotides complementary to intron 4 or the 3 ' -UTR of an α-ENaC nucleic acid transcript. In certain embodiments, modified oligonucleotides are complementary to a sequence within nucleotides 17,951-24, 120; or 32, 129-33, 174 of SEQ ID NO: 2. In certain embodiments, compounds comprise or consist of oligonucleotides having at least an 8, 9, 10, 1 1, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion of intron 4 or the 3 '-UTR of an α-ENaC nucleic acid transcript. In certain embodiments, such oligonucleotides have at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 17,951-24, 120; or 32, 129-33, 174 of SEQ ID NO: 2. In certain embodiments, these compounds are antisense compounds or oligomeric compounds.

In certain embodiments, a compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having at least an 8, 9, 10, 1 1, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 19,022-19,037; 20,415-20,430; 21,750-21,766; 32,844-32,859; or 32,989-33,004 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and complementary within nucleotides 19,022-19,037; 20,415-20,430; 21,750-21,766; 32,844- 32,859; or 32,989-33,004 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length. In certain embodiments, a compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of the nucleobase sequence of any one of compound numbers 797308, 797495, 826763, 827307, 827359, or 827392 (SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593). In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 239. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 426. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1541. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1812. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 1113. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 593.

In certain embodiments, a compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of compound numbers 797308, 797495, 826763, 827307, 827359, or 827392 (SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593). In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of compound numbers 797308, 797495, 826763, 827307, 827359, or 827392 (SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593).

In certain embodiments, a compound comprising or consisting of a modified oligonucleotide complementary to α-ENaC is compound number 827359. Out of over 1,900 compounds that were screened as described in the Examples section below, compound numbers 797308, 797495, 826763, 827307, 827359, and 827392 emerged as the top lead compounds. In particular, compound number 827359 exhibited the best combination of properties in terms of potency and tolerability out of over 1,900 compounds.

Any of the foregoing oligonucleotides is a modified oligonucleotide comprising at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified sugar. In certain embodiments, at least one modified sugar comprises a 2'-MOE modification. In certain embodiments, at least one modified sugar is a bicyclic sugar, such as a cEt bicyclic sugar, an LNA bicyclic sugar, or an ENA bicyclic sugar.

In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified nucleobase, such as 5-methylcytosine.

In certain embodiments, any of the foregoing modified oligonucleotides comprises: a gap segment consisting of linked 2'-deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16 to 50 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NO: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length having a nucleobase sequence consisting of the sequence recited in any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 20-80 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593, wherein the modified oligonucleotide comprises

a gap segment consisting often linked 2'-deoxynucleosides;

a 5' wing segment consisting of five linked nucleosides; and

a 3' wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 20-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 16-80 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593, wherein the modified oligonucleotide comprises

a gap segment consisting often linked 2'-deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5 ' wing segment and the 3 ' wing segment; wherein the nucleosides of the 5' wing segment each comprise a cEt bicyclic sugar; wherein the nucleosides of the 3' wing segment each comprises a cEt bicyclic sugar; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16-80 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide according to one of the following formulas:

mCks mCks mCks Gds Ads Tds Ads Gds mCds Tds Gds Gds Tds Tks Gks Tk (SEQ ID NO: 1113);

Aks Aks Gks Tds Ads Tds Gds Gds Tds Gds mCds Ads Ads mCks Aks Gk (SEQ ID NO: 239);

Aks mCks Gks Ads Tds Tds Ads mCds Ads Gds Gds Gds Ads Tks Tks mCk (SEQ ID NO: 426);

Tks Gks mCks Ads Tds Ads Gds Gds Ads Gds Tds Tds mCds Tks mCks Tk (SEQ ID NO: 1541);

Aks Gks Aks Gds Tds Ads Ads Tds Gds Ads Ads Ads mCds mCks mCks Ak (SEQ ID NO: 1812);

mCks Gks Aks Tds Tds Ads mCds Ads Gds Gds Gds Ads Tds Tks mCks Ak (SEQ ID NO: 593);

wherein A = an adenine, mC = a 5-methylcytosine, G = a guanine, T = a thymine, k = a cEt sugar moiety, d = a 2'-deoxyribosyl sugar moiety, and s = a phosphorothioate internucleoside linkage.

In certain embodiments, a compound comprises or consists of compound 827359 or salt thereof, a modified oligonucleotide having the following chemical structure:

[SEQ ID NO: 1 1 13]

In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding a-ENaC. In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises 2'-deoxyribonucleosides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleosides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing embodiments, the compound can be 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to

50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides in length. In certain embodiments, the compound comprises or consists of an oligonucleotide.

In certain embodiments, a compound comprises a modified oligonucleotide described herein and a conjugate group. In certain embodiments, the conjugate group is linked to the modified oligonucleotide at the 5' end of the modified oligonucleotide. In certain embodiments, the conjugate group is linked to the modified oligonucleotide at the 3 ' end of the modified oligonucleotide.

In certain embodiments, compounds or compositions provided herein comprise a salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

In certain embodiments, the compounds or compositions as described herein are active by virtue of having at least one of an in vitro IC50 of less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 65 nM, less than 60 nM, less than 55 nM, less than 50 nM, less than 45 nM, less than 40 nM, less than 35 nM, less than 30 nM, less than 25 nM, less than 20 nM, or less than 15 nM in a standard cell assay.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an alanine transaminase (ALT) or aspartate transaminase (AST) value of no more than 4 fold, 3 fold, 2 fold, or 1.5 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over control animals.

Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity less than about 40 centipoise (cP), less than about 30 cP, less than about 20 cP, less than about 15 cP, less than about 10 cP, less than about 5 cP, or less than about 3 cP, or less than about 1.5 cP. In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 15 mg/mL, 20 mg/mL, 25 mg/mL, or about 50 mg/mL. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20°C, about 21 °C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.

Any of the foregoing compounds can be used for treating, preventing, or ameliorating a disease associated with ENaC as further described herein. Certain Indications

Certain embodiments provided herein relate to methods of inhibiting ENaC expression, which can be useful for treating, preventing, or ameliorating a disease associated with ENaC in an individual, by administration of a compound that targets α-ENaC. In certain embodiments, the compound can be an a-ENaC inhibitor. In certain embodiments, the compound can be an antisense compound, oligomeric compound, or oligonucleotide complementary to α-ENaC. In certain embodiments, the compound can be any of the compounds described herein.

Examples of diseases associated with ENaC that are treatable, preventable, and/or ameliorable with the methods provided herein include cystic fibrosis, COPD, asthma, and chronic bronchitis.

In certain embodiments, a method of treating, preventing, or ameliorating a disease associated with a- ENaC in an individual comprises administering to the individual a compound comprising an α-ENaC inhibitor, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the compound comprises an antisense compound targeted to α-ENaC. In certain embodiments, the compound comprises an oligonucleotide complementary to an α-ENaC nucleic acid transcript. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the compound comprise a modified oligonucleotide complementary to an intron of an α-ENaC nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, the oligonucleotide is complementary to a sequence within nucleotides 4,497-5, 163; 5,634-16,290; 16,559-17,759; 17,951-24,120; 24,225-24,565; 24,730-25, 152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31, 198; or 31,275-31,747 of SEQ ID NO: 2. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 797308, 797495, 826763, 827307, 827359, or 827392. In any of the foregoing embodiments, the compound can be single -stranded or double -stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual via inhalation. In certain embodiments, administering the compound improves or preserves spirometry or mucociliary clearance.

In certain embodiments, a method of treating, preventing, or ameliorating cystic fibrosis, COPD, asthma, or chronic bronchitis comprises administering to the individual a compound comprising a modified oligonucleotide complementary to an α-ENaC nucleic acid, thereby treating, preventing, or ameliorating cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, the compound is an antisense compound targeted to α-ENaC. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the compound comprise a modified oligonucleotide complementary to an intron of an a- ENaC nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, the oligonucleotide is complementary to a sequence within nucleotides 4,497-5,163; 5,634-16,290; 16,559-17,759; 17,951-24, 120; 24,225-24,565; 24,730-25, 152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31,198; or 31,275- 31,747 of SEQ ID NO: 2. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide of 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 797308, 797495, 826763, 827307, 827359, or 827392. In any of the foregoing embodiments, the compound can be single -stranded or double -stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual via inhalation. In certain embodiments, administering the compound improves or preserves lung function. In certain such embodiments, spirometry or mucociliary clearance is imporved or preserved. In certain such embodiments, forced expiratory volume in one second (FEVi), FVC, or FEF25-75 is increased. In certain embodiments, pulmonary exacerbations, hospitalization rate or frequency, or antibiotic use is decreased. In certain embodiments, quality of life is improved, as measured by the respiratory questionnaire, CFQ-R. In certain embodiments, the individual is identified as having or at risk of having a disease associated with ENaC.

In certain embodiments, a method of inhibiting expression of α-ENaC in an individual having, or at risk of having, a disease associated with ENaC comprises administering to the individual a compound comprising an α-ENaC inhibitor, thereby inhibiting expression of α-ENaC in the individual. In certain embodiments, administering the compound inhibits expression of α-ENaC in the lung. In certain embodiments, the individual has, or is at risk of having cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, the compound comprises an antisense compound targeted to α-ENaC. In certain embodiments, the compound comprises an oligonucleotide complementary to an α-ENaC nucleic acid transcript. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the compound comprise a modified oligonucleotide complementary to an intron of an α-ENaC nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, the oligonucleotide is complementary to a sequence within nucleotides 4,497-5, 163; 5,634-16,290; 16,559-17,759; 17,951-24,120; 24,225-24,565; 24,730-25,152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31,198; or 31,275-31,747 of SEQ ID NO: 2. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 797308, 797495, 826763, 827307, 827359, or 827392. In any of the foregoing embodiments, the compound can be single -stranded or double -stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual via inhalation. In certain embodiments, administering the compound improves or preserves spirometry or mucociliary clearance. In certain embodiments, the individual is identified as having or at risk of having a disease associated with ENaC.

In certain embodiments, a method of inhibiting expression of α-ENaC in a cell comprises contacting the cell with a compound comprising an α-ENaC inhibitor, thereby inhibiting expression of α-ENaC in the cell. In certain embodiments, the cell is a lung cell. In certain embodiments, the cell is in the lung. In certain embodiments, the cell is in the lung of an individual who has, or is at risk of having cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, the compound comprises an antisense compound targeted to α-ENaC. In certain embodiments, the compound comprises an oligonucleotide complementary to an α-ENaC nucleic acid transcript. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the compound comprise a modified oligonucleotide complementary to an intron of an α-ENaC nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, the oligonucleotide is complementary to a sequence within nucleotides 4,497-5,163; 5,634-16,290; 16,559-17,759; 17,951-24, 120; 24,225-24,565; 24,730-25, 152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31,198; or 31,275- 31,747 of SEQ ID NO: 2. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 797308, 797495, 826763, 827307, 827359, or 827392. In any of the foregoing embodiments, the compound can be single -stranded or double -stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In certain embodiments, a method of increasing or improving spirometry or mucociliary clearance in the lung of an individual having, or at risk of having, a disease associated with ENaC comprises administering to the individual a compound comprising an α-ENaC inhibitor, thereby increasing or improving spirometry or mucociliary clearance in the lung of the individual. In certain such embodiments, forced expiratory volume in one second (FEVi), FVC, or FEF25-75 is increased. In certain embodiments, pulmonary exacerbations, hospitalization rate or frequency, or antibiotic use is decreased. In certain embodiments, quality of life is improved, as measured by the respiratory questionnaire, CFQ-R. In certain embodiments, the individual has, or is at risk of having, cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, the compound comprises an antisense compound targeted to α-ENaC. In certain embodiments, the compound comprises an oligonucleotide complementary to an α-ENaC nucleic acid transcript. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the compound comprise a modified oligonucleotide complementary to an intron of an α-ENaC nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, the oligonucleotide is complementary to a sequence within nucleotides 4,497-5,163; 5,634- 16,290; 16,559-17,759; 17,951-24,120; 24,225-24,565; 24,730-25,152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31,198; or 31,275-31,747 of SEQ ID NO: 2. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 797308, 797495, 826763, 827307, 827359, or 827392. In any of the foregoing embodiments, the compound can be single -stranded or double -stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual via inhalation. In certain embodiments, the individual is identified as having or at risk of having a disease associated with ENaC.

Certain embodiments are drawn to a compound comprising an α-ENaC inhibitor for use in treating a disease associated with ENaC. In certain embodiments, the disease is cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, the compound comprises an antisense compound targeted to α-ENaC. In certain embodiments, the compound comprises an oligonucleotide complementary to an α-ENaC nucleic acid transcript. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the compound comprise a modified oligonucleotide complementary to an intron of an α-ENaC nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, the oligonucleotide is complementary to a sequence within nucleotides 4,497-5, 163; 5,634-16,290; 16,559-17,759; 17,951-24, 120; 24,225-24,565; 24,730-25, 152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31, 198; or 31,275-31,747 of SEQ ID NO: 2. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 797308, 797495, 826763, 827307, 827359, or 827392. In any of the foregoing embodiments, the compound can be single -stranded or double -stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to a compound comprising an α-ENaC inhibitor for use in increasing or improving spirometry or mucociliary clearance of an individual having or at risk of having cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, the compound comprises an antisense compound targeted to α-ENaC. In certain embodiments, the compound comprises an oligonucleotide complementary to an α-ENaC nucleic acid transcript. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the compound comprise a modified oligonucleotide complementary to an intron of an α-ENaC nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, the oligonucleotide is complementary to a sequence within nucleotides 4,497-5, 163; 5,634-16,290; 16,559-17,759; 17,951-24,120; 24,225-24,565; 24,730-25, 152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31, 198; or 31,275-31,747 of SEQ ID NO: 2. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 797308, 797495, 826763, 827307, 827359, or 827392. In any of the foregoing embodiments, the compound can be single -stranded or double -stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to use of a compound comprising an α-ENaC inhibitor for the manufacture or preparation of a medicament for treating a disease associated with ENaC. Certain embodiments are drawn to use of a compound comprising an α-ENaC inhibitor for the preparation of a medicament for treating a disease associated with ENaC. In certain embodiments, the disease is cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, the compound comprises an antisense compound targeted to a- ENaC. In certain embodiments, the compound comprises an oligonucleotide complementary to an a-ENaC nucleic acid transcript. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the compound comprise a modified oligonucleotide complementary to an intron of an a-ENaC nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, the oligonucleotide is complementary to a sequence within nucleotides 4,497-5,163; 5,634-16,290; 16,559-17,759; 17,951-24, 120; 24,225-24,565; 24,730-25, 152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31,198; or 31,275- 31,747 of SEQ ID NO: 2. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 797308, 797495, 826763, 827307, 827359, or 827392. In any of the foregoing embodiments, the compound can be single -stranded or double -stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to use of a compound comprising an α-ENaC inhibitor for the manufacture or preparation of a medicament for increasing or improving spirometry or mucociliary clearance in an individual having or at risk of having cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, the compound comprises an antisense compound targeted to α-ENaC. In certain embodiments, the compound comprises an oligonucleotide complementary to an α-ENaC nucleic acid transcript. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the compound comprise a modified oligonucleotide complementary to an intron of an α-ENaC nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12 of an α-ENaC nucleic acid transcript. In certain such embodiments, the oligonucleotide is complementary to a sequence within nucleotides 4,497-5, 163; 5,634-16,290; 16,559-17,759; 17,951-24,120; 24,225-24,565; 24,730-25,152; 25,252-25,445; 25,564-30,595; 30,675-30,779; 30,838-30,995; 31,052-31,198; or 31,275-31,747 of SEQ ID NO: 2. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 239, 426, 1541, 1812, 1113, or 593. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 797308, 797495, 826763, 827307, 827359, or 827392. In any of the foregoing embodiments, the compound can be single -stranded or double -stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing methods or uses, the compound can be targeted to α-ENaC. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide 8 to 50 linked nucleosides in length, 10 to 30 linked nucleosides in length, 12 to 30 linked nucleosides in length, or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1, 2, or 1957. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, and at least one modified nucleobase. In certain such embodiments, the atleast one modified internucleoside linkage is a phosphorothioate internucleoside linkage, the at least one modified sugar is a bicyclic sugar or a 2'-MOE sugar, and the at least one modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked 2'-deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3 ' wing segment and wherein each terminal wing nucleoside comprises a modified sugar. In any of the foregoing embodiments, the modified oligonucleotide is 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1, 2, or 1957. In certain embodiments, the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar, and at least one modified nucleobase. In certain embodiments, the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage, the at least one modified sugar is a bicyclic sugar or a 2'-MOE sugar, and the at least one modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises agap segment consisting of linked 2'-deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment and wherein each terminal wing nucleoside comprises a modified sugar.

In any of the foregoing methods or uses, the compound comprises or consists of a modified oligonucleotide 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 6-1954, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked 2'-deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5 ' wing segment and the 3 ' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing methods or uses, the compound comprises or consists of a modified oligonucleotide 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 6-1954, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked 2'-deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5 ' wing segment and the 3 ' wing segment, wherein each terminal wing nucleoside comprises a modified sugar.

In any of the foregoing methods or uses, the compound comprises or consists a modified oligonucleotide 20 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 6-1954, wherein the modified oligonucleotide comprises

a gap segment consisting often linked 2'-deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and

a 3' wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5 -methylcytosine . In certain embodiments, the modified oligonucleotide consists of 20-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

In any of the foregoing methods or uses, the compound comprises or consists a modified oligonucleotide 16 to 50 linked nucleobases in length having a nucleobase sequence comprising or consisting of the sequence recited in any one of SEQ ID NOs: 6-1954, wherein the modified oligonucleotide comprises a gap segment consisting of 10 linked 2'-deoxynucleosides;

a 5' wing segment consisting of 3 linked nucleosides; and

a 3' wing segment consisting of 3 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5 -methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound comprises or consists a modified oligonucleotide 16 to 50 linked nucleobases in length having a nucleobase sequence comprising or consisting of the sequence recited in any one of SEQ ID NOs: 239, 426, 593, 1113, 1541, or 1812, wherein the modified oligonucleotide comprises

a gap segment consisting of 10 linked 2'-deoxynucleosides;

a 5' wing segment consisting of 3 linked nucleosides; and

a 3' wing segment consisting of 3 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5 -methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound has the following chemical structure:

[SEQ ID NO: 1113]

In any of the foregoing methods or uses, the compound can be administered via inahaltion. In certain embodiments, the compound of any of the foregoing methods or uses can be administered through injection or infusion. In certain embodiments, the compound of any of the foregoing methods or uses can be administered via subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. In certain embodiments, the compound of any of the foregoing methods or uses can be administered systemically. In certain embodiments, the compound of any of the foregoing methods or uses can be administered orally.

Certain Combinations and Combination Therapies

In certain embodiments, a first agent comprising the compound described herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, a first agent is designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are coadministered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.

In certain embodiments, one or more compounds or compositions provided herein are coadministered with one or more secondary agents. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared separately. In certain embodiments, a secondary agent is a bronchodilator, a corticosteroid, an antibiotic, a second compound comprising or consisting of a modified oligonucleotide, and/or a chloride channel (CFTR) modulator. In certain embodiments, a secondary agent is selected from: hypertonic saline, dornase alfa, ivacaftor, tezacaftor, and lumacaftor.

Certain embodiments are directed to the use of a compound comprising a modified oligonucleotide complementary to an α-ENaC nucleic acid transcript as described herein in combination with a secondary agent. In particular embodiments such use is in a method of treating a patient suffering from cystic fibrosis, COPD, asthma, or chronic bronchitis or in the preparation or manufacture of a medicament for treating cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, a secondary agent is a bronchodilator, a corticosteroid, an antibiotic, or a chloride channel (CFTR) modulator. In certain embodiments, a secondary agent is selected from: hypertonic saline, dornase alfa, ivacaftor, tezacaftor, and lumacaftor. Certain embodiments are directed to the use of a compound comprising a modified oligonucleotide complementary to an α-ENaC nucleic acid transcript as described herein in combination with two or more secondary agents. In particular embodiments such use is in a method of treating a patient suffering from cystic fibrosis, COPD, asthma, or chronic bronchitis or in the preparation or manufacture of a medicament for treating cystic fibrosis, COPD, asthma, or chronic bronchitis. In certain embodiments, two or more secondary agents are selected from bronchodilators, corticosteroids, antibiotics, and chloride channel (CFTR) modulators. In certain embodiments, two or more secondary agents are selected from: hypertonic saline, dornase alfa, ivacaftor, tezacaftor, and lumacaftor.

Certain embodiments are drawn to a combination of a compound comprising a modified oligonucleotide complemetary to an α-ENaC nucleic acid transcript as described herein and a secondary agent, such as a secondary agent selected from: hypertonic saline, dornase alfa, ivacaftor, tezacaftor, and lumacaftor. In certain embodiments, such a combination of a compound comprising a modified oligonucleotide complemetary to an α-ENaC nucleic acid transcript as described herein and a secondary agent, such as a secondary agent selected from: hypertonic saline, dornase alfa, ivacaftor, tezacaftor, and lumacaftor is useful for improving or preserving spirometry or mucociliary clearance and/or treating cystic fibrosis, COPD, asthma, or chronic bronchitis.

Certain embodiments are drawn to a combination of a compound comprising a modified oligonucleotide complemetary to an α-ENaC nucleic acid transcript as described herein and two or more secondary agents, such as secondary agents selected from: hypertonic saline, dornase alfa, ivacaftor, tezacaftor, and lumacaftor. In certain embodiments, such a combination of a compound comprising a modified oligonucleotide complemetary to an α-ENaC nucleic acid transcript as described herein and two ore more secondary agents, such as secondary agents selected from: hypertonic saline, dornase alfa, ivacaftor, tezacaftor, and lumacaftor is useful for improving or preserving spirometry or mucociliary clearance and/or treating cystic fibrosis, COPD, asthma, or chronic bronchitis.

In certain embodiments the compound comprising a modified oligonucleotide complemetary to an a-

ENaC nucleic acid transcript as described herein and the secondary agent are used in combination treatment by administering the two agents simultaneously, separately or sequentially. In certain embodiments the two agents are formulated as a fixed dose combination product. In other embodiments the two agents are provided to the patient as separate units which can then either be taken simultaneously or serially (sequentially).

In certain embodiments the compound comprising a modified oligonucleotide complemetary to an a-

ENaC nucleic acid transcript as described herein and two or more secondary agents are used in combination treatment by administering the three or more agents simultaneously, separately or sequentially. In certain embodiments the three or more agents are formulated as a fixed dose combination product. In other embodiments the three or more agents are provided to the patient as separate units which can then either be taken simultaneously or serially (sequentially). Certain Compounds

In certain embodiments, compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound or antisense compound is single-stranded. Such a single- stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

In certain embodiments, a compound or antisense compound is double-stranded. Such double- stranded compounds comprise a first oligomeric compound comprising or consisting of a first modified oligonucleotide having a region complementary to a target nucleic acid and a second oligomeric compound comprising or consisting of a second oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the first oligonucleotide is 100% complementary to the second oligonucleotide. In certain embodiments, the first and second oligonucleotides include non-complementary, overhanging nucleosides. In certain embodiments, the first modified oligonucleotide comprises unmodified ribosyl sugar moieties as those found in RNA. In such embodiments, thymine nucleobases in the first and/or second oligonucleotide are replaced by uracil nucleobases. In certain embodiments, the first and/or second oligomeric compound comprises a conjugate group. In certain embodiments, the first modified oligonucleotide is 12-30 linked nucleosides in length and the second oligonucleotide is 12-30 linked nucleosides in length. In certain embodiments, the second oligonucleotide is modified. In certain embodiments, the first modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 6-1954.

Examples of single-stranded and double -stranded compounds include but are not limited to oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single -stranded siRNAs (ssRNAs), and microRNA mimics.

In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain embodiments, a compound described herein comprises an oligonucleotide 10 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 22 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 21 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 to 30 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits in length, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 linked subunits in length, or a range defined by any two of the above values. In some embodiments the linked subunits are nucleotides, nucleosides, or nucleobases.

In certain embodiments, the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

In certain embodiments, compounds may be shortened or truncated. For example, a single subunit may be deleted from the 5 ' end (5 ' truncation), or alternatively from the 3' end (3 ' truncation). A shortened or truncated compound targeted to an α-ENaC nucleic acid may have two subunits deleted from the 5 ' end, or alternatively may have two subunits deleted from the 3 ' end, of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.

When a single additional subunit is present in a lengthened compound, the additional subunit may be located at the 5 ' or 3 ' end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5 ' end (5 ' addition), or alternatively to the 3 ' end (3 ' addition), of the compound. Alternatively, the added subunits may be dispersed throughout the compound.

It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305- 7309; Gautschi et al. J. Natl. Cancer Inst . March 2001, 93 :463-471 ; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry and motif can make large differences in one or more of the many properties required for clinical development (Seth et al. J Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 201 1, 133, 16642).

In certain embodiments, compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single- stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double- stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post- transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term "RNAi" is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to an α-ENaC nucleic acid transcript described herein. In certain embodiments, the compound can be double -stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 6-1954 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 6-1954 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on an α-ENaC nucleic acid to which any of SEQ ID NOs: 6-1954 is complementary, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2'-F) or contains an alkoxy group (such as a methoxy group; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2' -OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and at least one 2 '-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.

In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length. In certain embodiments, the first or second strand of the compound can comprise a conjugate group.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to an α-ENaC nucleic acid described herein. In certain embodiments, the compound is single-stranded. In certain embodiments, such a compound is a single -stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 6-1954. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on a-ENaC to which any of SEQ ID NOs: 6-1954 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2'- F) or contains an alkoxy group (such as a methoxy group; 2' -OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and at least one 2 '-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugate group.

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (<S), as a or β, such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. All tautomeric forms of the compounds provided herein are included unless otherwise indicated.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the ¾ hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: ² H or H in place of ¾, ¹³ C or ¹⁴ C in place of ¹² C, ¹⁵ N in place of ¹⁴ N, ¹⁷ 0 or ¹⁸ 0 in place of ¹⁶ 0, and ³³ S, ⁴ S, ⁵ S, or ⁶ S in place of ² S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging. Certain Mechanisms

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to an α-ENaC target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity. In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently "DNA- like" to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA -induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, a pre-mRNA and corresponding mRNA are both target nucleic acids of a single compound. In certain such embodiments, the target region is entirely within an intron of a target pre-mRNA. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. Target nucleic acid sequences that encode α-ENaC include, without limitation, the following: RefSEQ No. NM_001038.5; the complement of NC_000012.12 truncated from nucleosides 6343001 to 6380000; and NG_011945.1 (SEQ ID Nos: 1, 2, and 1957, respectively). Hybridization

In some embodiments, hybridization occurs between a compound disclosed herein and an a-ENaC nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules. Hybridization can occur under varying conditions. Hybridization conditions are sequence -dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with an α-ENaC nucleic acid.

Complementarity

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, oligonucleotides complementary to an α-ENaC nucleic acid comprise nucleobase that are non-complementary with the a-ENaC nucleic acid, yet may be tolerated provided that the compound remains able to specifically hybridize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of an α-ENaC nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the compounds provided herein, or a specified portion thereof, are, are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an α-ENaC nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to an α-ENaC nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.

For example, a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a compound which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489). In certain embodiments, compounds described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a compound may be 100% complementary to an α-ENaC nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

In certain embodiments, compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments selectivity of the compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5 '-end of the gap segment. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 '-end of the gap segment. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5 '-end of the wing segment. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3 '-end of the wing segment. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, or 12 from the 5'-end of the oligonucleotide. In certain such embodiments, the mismatch is at position , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, or 12 from the 3 '-end of the oligonucleotide.

The location of a non-complementary nucleobase may be at the 5 ' end or 3 ' end of the compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

In certain embodiments, compounds described herein that are, or are up to 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an α-ENaC nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an α-ENaC nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein also include those which are complementary to a portion (a defined number of contiguous nucleobases within a region or segment) of a target nucleic acid. In certain embodiments, the compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Certain Compounds

In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).

I. Modifications

A. Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.

1. Modified Sugar Moieties

In certain embodiments, sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including but not limited to substituents at the 2', 4', and/or 5 ' positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2 '-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2'-F, 2'-OCH ₃ ("OMe" or "O-methyl"), and 2'-0(CH ₂ )20CH ₃ ("MOE"). In certain embodiments, 2' -substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cio alkoxy, O- C1-C10 substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(R _m )-alkyl, O-alkenyl, S- alkenyl, N(R _m )-alkenyl, O-alkynyl, S-alkynyl, N(R _m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, 0(CH ₂ ) ₂ SCH ₃ , 0(CH ₂ ) ₂ 0N(R _m )(R„) or OCH ₂ C(=0)-N(R _m )(R„), where each R _m and R„ is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2'- substituent groups described in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221 ; and Cook et al., U.S. 6,005,087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N0 ₂ ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4 '-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g. , methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5 '-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5 '-methyl (R or S), 5'- vinyl, and 5 '-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non- bridging sugar substituent, for example, 2'-F -5 '-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101 157 and Rajeev et al., US2013/0203836.).

In certain embodiments, a 2'-substituted nucleoside or 2'- non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 '-substituent group selected from: F, NH ₂ , N ₃ , OCF _3, OCH ₃ , 0(CH ₂ ) ₃ NH ₂ , CH ₂ CH=CH ₂ , OCH ₂ CH=CH ₂ , OCH ₂ CH ₂ OCH ₃ , 0(CH ₂ ) ₂ SCH ₃ , 0(CH ₂ ) ₂ ON(R _m )(R„), 0(CH ₂ ) ₂ 0(CH ₂ ) ₂ N(CH ₃ ) ₂ , and N-substituted acetamide (OCH ₂ C(=0)-N(R _m )(R _n )), where each R _m and R _n is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.

In certain embodiments, a 2'-substituted nucleoside or 2'- non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 '-substituent group selected from: F, OCF _3j OCH ₃ , OCH ₂ CH ₂ OCH ₃ , 0(CH ₂ ) ₂ SCH ₃ , 0(CH ₂ ) ₂ ON(CH ₃ ) ₂ , 0(CH ₂ ) ₂ 0(CH ₂ ) ₂ N(CH ₃ ) ₂ , and OCH ₂ C(=0)-N(H)CH ₃ ("NMA").

In certain embodiments, a 2'-substituted nucleoside or 2'- non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 '-substituent group selected from: F, OCH ₃ , and OCH ₂ CH ₂ OCH ₃ . Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, may be referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2 '-substituted or 2-modified sugar moieties are referred to as 2 '-substituted nucleosides or 2-modified nucleosides.

Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4' to 2' bridging sugar substituents include but are not limited to: 4'-CH2-2', 4'- (CH ₂ ) ₂ -2', 4'-(CH ₂ ) ₃ -2', 4'-CH ₂ -0-2' ("LNA"), 4'-CH ₂ -S-2', 4'-(CH ₂ ) ₂ -0-2' ("ENA"), 4'-CH(CH ₃ )-0-2' (referred to as "constrained ethyl" or "cEt" when in the S configuration), 4'-CH ₂ -0-CH ₂ -2', 4'-CH ₂ -N(R)-2', 4'-CH(CH ₂ OCH ₃ )-0-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., U.S. 7,399,845, Bhat et al., U.S. 7,569,686, Swayze et al., U.S. 7,741,457, and Swayze et al., U.S. 8,022, 193), 4'- C(CH ₃ )(CH ₃ )-0-2' and analogs thereof (see, e.g., Seth et al, U.S. 8,278,283), 4'-CH ₂ -N(OCH ₃ )-2' and analogs thereof (see, e.g., Prakash et al., U.S. 8,278,425), 4'-CH ₂ -0-N(CH ₃ )-2' (see, e.g., Allerson et al., U.S.

7,696,345 and Allerson et al, U.S. 8,124,745), 4'-CH ₂ -C(H)(CH ₃ )-2' (see, e.g., Zhou, et al, J. Org.

Chem.,2009, 74, 118-134), 4'-CH ₂ -C(=CH ₂ )-2' and analogs thereof (see e.g. , Seth et al., U.S. 8,278,426), 4'-C(R _a R _b )-N(R)-0-2', 4'-C(R _a R _b )-0-N(R)-2', 4'-CH ₂ -0-N(R)-2', and 4'-CH ₂ -N(R)-0-2', wherein each R, R _a , and R¾ is, independently, H, a protecting group, or Ci-Ci ₂ alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).

In certain embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(R _a )(Rb)] _n -, -[C(Ra)(Rb)] _n -0-, -C(Ra)=C(Rb)-, -C(R,)=N-, -C(=NR,)-, - C(=0)-, -C(=S)-, -0-, -Si(Ra) ₂ -, -S(=0) _x -, and -N(Ra)-;

wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each Ra and R¾ is, independently, H, a protecting group, hydroxyl, Ci-Ci ₂ alkyl, substituted Ci-Ci ₂ alkyl, C ₂ -Ci ₂ alkenyl, substituted C ₂ -Ci ₂ alkenyl, C ₂ -Ci ₂ alkynyl, substituted C ₂ -Ci ₂ alkynyl, C5-C ₂ o aryl, substituted C5-C ₂ o aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJJ ₂ , SJi, N ₃ , COOJi, acyl (C(=0)- H), substituted acyl, CN, sulfonyl (S(=0) ₂ -Ji), or sulfoxyl (S(=0)-Ji); and

each Ji and J ₂ is, independently, H, Ci-Ci ₂ alkyl, substituted Ci-Ci ₂ alkyl, C ₂ -Ci ₂ alkenyl, substituted

C ₂ -Ci ₂ alkenyl, C ₂ -Ci ₂ alkynyl, substituted C ₂ -Ci ₂ alkynyl, C5-C ₂ o aryl, substituted C5-C ₂ o aryl, acyl (C(=0)- H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, Ci-Ci ₂ aminoalkyl, substituted Ci- Cu aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al, J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun. , 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al, Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J Am. Chem. Soc, 20017, 129, 8362-8379; Elayadi et al., ; Wengel et a., U.S. 7,053,207; Imanishi et al., U.S.

6,268,490; Imanishi et al. U.S. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. 6,794,499; Wengel et al., U.S. 6,670,461; Wengel et al., U.S. 7,034,133; Wengel et al., U.S. 8,080,644; Wengel et al., U.S. 8,034,909; Wengel et al, U.S. 8,153,365; Wengel et al., U.S. 7,572,582; and Ramasamy et al., U.S. 6,525,191;; Torsten et al., WO 2004/106356;Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. 7,547,684; Seth et al., U.S. 7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S. 7,750,131; Seth et al., U.S. 8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S. 8,546,556; Seth et al., U.S. 8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727..

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the a-L configu

LNA (β-D-configuration) a-Z-LNA (a-Z-configuration) bridge = 4'-CH ₂ -0-2' bridge = 4'-CH ₂ -0-2'

a-L-methyleneoxy (4'-CH2-0-2') or a-L-LNA bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 '-substituted and 4'-2' bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2'- position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5' position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified

tetrahydropyrans include but are not limited to hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), manitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro

F-HNA

("F-HNA", see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S.

8,796,437; and Swayze et al., U.S. 9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

wherein, independently, for each of said modified THP nucleoside:

Bx is a nucleobase moiety;

T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;

qi, q2, q3, q4, qs, qe and q7 are each, independently, H, Ci-Ce alkyl, substituted Ci-Ce alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and

each of Ri and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJJ ₂ , SJi, N ₃ , OC(=X)Ji, OC(=X)NJiJ ₂ , NJ ₃ C(=X)NJiJ ₂ , and CN, wherein X is O, S or

NJi, and each Ji, J2, and J3 is, independently, H or Ci-Ce alkyl.

In certain embodiments, modified THP nucleosides are provided wherein qi, q2, q3, q4, qs, qe and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,5 the term "morpholino" means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are refered to herein as "modifed morpholinos."

In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid ("PNA"), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem. , 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides). 2. Modified Nucleobases

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6- azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-C]¾) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N- benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N- benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size- expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al. , Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications , Crooke, S T. and Lebleu, B., Eds., CRC Press, 1993, 273- 288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manohara et al., US2003/0158403; Manoharan et al., US2003/0175906;; Dinh et al, U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S.

5, 134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler et al., U.S. 5,484,908; Matteucci et al., U.S. 5,502, 177; Hawkins et al., U.S. 5,525,711; Haralambidis et al., U.S.

5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594, 121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S.

5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. 6,005,096.

In certain embodiments, compounds comprise or consist of a modified oligonucleotide complementary to an α-ENaC nucleic acid comprising one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5- methylcytosine.

B. Modified Intemucleoside Linkages

In certain embodiments, compounds described herein having one or more modified intemucleoside linkages are selected over compounds having only phosphodiester intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

In certain embodiments, compounds comprise or consist of a modified oligonucleotide complementary to an α-ENaC nucleic acid comprising one or more modified intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage. The two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing intemucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond ("P=0") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus containing intemucleoside linking groups include but are not limited to methylenemethylimino (-CH2-N(C]¾)-0-CH2-), thiodiester , thionocarbamate (-0-C(=0)(NH)-S-); siloxane (-O-S1H2-O-); and Ν,Ν'-dimethylhydrazine (-CH2- N(CH3)-N(CH3)-). Modified intemucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.

Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (<Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein "B" indicates a nucleobase:

(Rp) (S _p )

Unless otherwise indicated, chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

Neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates,

MMI (3'-CH ₂ -N(CH ₃ )-0-5'), amide-3 (3'-CH ₂ -C(=0)-N(H)-5'), amide-4 (3'-CH ₂ -N(H)-C(=0)-5'), formacetal (3'-0-CH2-0-5'), methoxypropyl, and thioformacetal (3'-S-CH2-0-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

II. Certain Motifs

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns or motifs of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

A. Certain Sugar Motifs

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein. In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external segments or "wings" and a central or internal segment or "gap." The three segments of a gapmer motif (the 5 '-wing, the gap, and the 3 '-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are immediately adjacent to the gap (the 3 '-terminal wing nucleoside of the 5 '-wing and the 5'- terminal wing nucleoside of the 3 ' -wing) differ from the sugar moiety of the adj acent gap nucleosides . In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5 '-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer each comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer each comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer each comprise 3-5 nucleosides. In certain embodiments, the nucleosides of the wings of a gapmer are all modified nucleosides. In certain such embodiments, the sugar moieties of the wings of a gapmer are all modified sugar moieties.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is a 2'-deoxynucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are 2'-deoxynucleosides and the terminal wing nucleosides immediately adjacent to the gap comprise modified sugar moieties. In certain such embodiments, each nucleoside of the gap is a 2'-deoxynucleoside. In certain such embodiments, each nucleoside of each wing comprises a modified sugar moiety.

In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2 '-modification. In certain embodiments, a modified oligonucleotide can comprise a sugar motif described in Swayze et al., US2010/0197762; Freier et al., US2014/0107330; Freier et al., US2015/0184153; and Seth et al., US2015/0267195.

B. Certain Nucleobase Motifs

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 '-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3 '-end of the oligonucleotide. In certain embodiments, the block is at the 5 '-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 '-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2- thiopyrimidine and a 5-propynepyrimidine.

C. Certain Internucleoside Linkage Motifs

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P=0). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage . In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (<Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (<Sp) phosphorothioates, and the gap comprises at least one <Sp, <Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.

In certain embodiments, oligonucleotides comprise a region having an alternating intemucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified intemucleoside linkages. In certain such embodiments, the intemucleoside linkages are phosphorothioate intemucleoside linkages. In certain embodiments, all of the intemucleoside linkages of the oligonucleotide are phosphorothioate intemucleoside linkages. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester or phophate and phosphorothioate. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester or phosphate and phosphorothioate and at least one intemucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate intemucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.

In certain embodiments, oligonucleotides comprise one or more methylphosponate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosponate linkages. In certain embodiments, one methylphosponate linkage is in the gap of an oligonucleotide having a gapmer sugar motif.

In certain embodiments, it is desirable to arrange the number of phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate intemucleoside linkages and the number and position of phosphodiester intemucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate intemucleoside linkages may be decreased and the number of phosphodiester intemucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate intemucleoside linkages may be decreased and the number of phosphodiester intemucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate intemucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester intemucleoside linkages while retaining nuclease resistance.

III. Certain Modified Oligonucleotides

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, intemucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modifications, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a region of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions or segments, A, B, and C, wherein region or segment A consists of 2-6 linked nucleosides having a specified sugar motif, region or segment B consists of 6-10 linked nucleosides having a specified sugar motif, and region or segment C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of 20 for the overall length of the modified oligonucleotide. Unless otherwise indicated, all modifications are independent of nucleobase sequence except that the modified nucleobase 5- methylcytosine is necessarily a "C" in an oligonucleotide sequence.

In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X<Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

IV. Certain Conjugated Compounds

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker that links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3' and/or 5 '-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3'-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3'-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5'-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5'-end of oligonucleotide s . Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearanceln certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g. , fluorophores or reporter groups that enable detection of the oligonucleotide .

Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett, 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1 11 1-1 1 18; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic, a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), -an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), ₌ a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi: 10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

/. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (<S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain compounds, a conjugate group is a single chemical bond (i.e. conjugate moiety is attached to an oligonucleotide via a conjugate linker through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups . One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-l-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted Ci- Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5- methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker- nucleosides are typically linked to one another and to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker- nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, a compound may comprise (1) amodified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker- nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is more than 30. Alternatively, an compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate may comprise one or more cleavable moieties, typically within the conjugate linker. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group. In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to one another and/or to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxy nucleoside that is attached to either the 3' or 5 '-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

3. Certain Cell-Targeting Conjugate Moieties

In certain embodiments, a conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, a conjugate group has the general formula:

|Ligand— ether]— [Branching group ]— [Conjugate Linker ]— [Cleavable Moiety]— I

Cell-targeting moiety wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.

In certain embodiments, the cell-targeting moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.

In certain embodiments, each tether of a cell-targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group. In certain embodiments, each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length.

In certain embodiments, each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian lung cell.

In certain embodiments, each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al, "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chemistry, 2003, 14, 18-29, or Rensen et al., "Design and Synthesis of Novel N- Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, 47, 5798-5808, which are incorporated herein by reference in their entirety). In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, such as sialic acid, a-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-0-methyl-D- mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N-glycoloyl-a- neuraminic acid. For example, thio sugars may be selected from 5-Thio- -D-glucopyranose, methyl 2,3,4-tri- O-acetyl-l-thio-6-O-trityl-a-D-glucopyranoside, 4-thio- -D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl- 2-deoxy- 1 ,5 -dithio-a-D-g/wco-heptopyranoside . In certain embodiments compounds described herein comprise a conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939- 945; Pavia et al., Int JPep Protein Res, 1983, 22, 539-548; Lee et al, Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycobiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al, Glycoconj J, 2004, 21, 227-241; Lee et al, BioorgMed Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., BioorgMed Chem, 2007, 15, 7661-7676; Khorev et al., BioorgMed Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798- 5808; Rensen et al., Arterioscler Thromb Vase Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., J Am Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International applications WO1998/013381; WO2011/038356; WO1997/046098; WO2008/098788; WO2004/101619; WO2012/037254; WO2011/120053; WO2011/100131; WO2011/163121;

WO2012/177947; WO2013/033230; WO2013/075035; WO2012/083185; WO2012/083046; WO2009/082607; WO2009/134487; WO2010/144740; WO2010/148013; WO1997/020563; WO2010/088537; WO2002/043771; WO2010/129709; WO2012/068187; WO2009/126933; WO2004/024757; WO2010/054406; WO2012/089352; WO2012/089602; WO2013/166121; WO2013/165816; U.S. Patents 4,751,219; 8,552, 163; 6,908,903; 7,262, 177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications US2011/0097264; US2011/0097265; US2013/0004427; US2005/0164235; US2006/0148740; US2008/0281044; UUSS22001100//00224400773300;; UUSS22000033//00111199772244;; US2006/0183886; US2008/0206869; US2011/0269814; US2009/0286973; US2011/0207799; US2012/0136042; US2012/0165393; US2008/0281041; US2009/0203135; US2012/0035115; US2012/0095075; US2012/0101148; US2012/0128760; US2012/0157509; US2012/0230938; US2013/0109817; US2013/0121954; US2013/0178512;

US2013/0236968; US2011/0123520; US2003/0077829; US2008/0108801; and US2009/0203132. Compositions and Methods for Formulating Pharmaceutical Compositions Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Certain embodiments provide pharmaceutical compositions suitable for aerosolization and/or dispersal by a nebulizer or inhaler. Such devices are well known in the art. In certain such embodiments, the pharmaceutical composition is a solid comprising particles of compounds that are of respirable size. A solid particulate composition can optionally contain a dispersant which serves to facilitate the formation of an aerosol, e.g., lactose. Solid pharmaceutical compositions comprising an oligonucleotide can also be aerosolized using any solid particulate medicament aerosol generator known in the art, e.g., a dry powder inhaler. In certain embodiments, the powder employed in the inhaler consists of the compound comprising the active compound or of a powder blend comprising the active compound, a suitable powder diluent, and an optional surfactant.

In certain embodiments, the pharmaceutical composition is a liquid. In certain such embodiments, the liquid is administered as an aerosol that is produced by any suitable means, such as with a nebulizer or inhaler. See, e.g., U.S. Pat. No. 4,501,729. Nebulizers are devices that transform solutions or suspensions into an aerosol mist and are well known in the art. Suitable nebulizers include jet nebulizers, ultrasonic nebulizers, electronic mesh nebulizers, and vibrating mesh nebulizers. Companies such as PARI and Vectura sell some types of such suitable nebulziers. In certain embodiments, the aerosol is produced by a metered dose inhaler, which typically contains a suspension or solution formulation of the active compound in a liquefied propellant. Inhalers suitable for dispensing liquid aerosol also include certain inhalers sold by Respimat (See, e.g., Anderson, IntJ Chron Obstruct Pulmon Dis. 1, 251 (2006).) Pharmaceutical compositions suitable for aerosolization can comprise propellants, surfactants, co-solvents, dispersants, preservatives, and/or other additives or excipients.

A compound described herein complementary to an α-ENaC nucleic acid can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier and/or additional components such that the pharmaceutical composition is suitable for aerosolization by a nebulizer. In certain embodiments, a pharmaceutically acceptable diluent is phosphate buffered saline. Accordingly, in one embodiment, employed in the methods described herein is a

pharmaceutical composition comprising a compound complementary to an α-ENaC nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is phosphate buffered saline. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

EXAMPLES

The Examples below describe the screening process used to identify lead compounds targeted to a- ENaC. Out of over 1,900 oligonucleotides that were screened, many potent and tolerable oligonucleotides were identified, and compounds 797308, 797495, 826763, 827307, 827359, and 827392 emerged as the top lead compounds. In particular, compound 827359 exhibited the best combination of properties in terms of potency and tolerability.

Non-limiting disclosure and incorporation by reference

Although the sequence listing accompanying this filing identifies each sequence as either "RNA" or "DNA" as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as "R A" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2' -OH sugar moiety and a thymine nucleobase could be described as a DNA having an RNA sugar, or as an RNA having a DNA nucleobase.

Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of unmodified or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence "ATCGATCG" encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG" and those having some DNA bases and some RNA bases such as "AUCGATCG" and compounds having other modified nucleobases, such as "AT ^m CGAUCG," wherein ""C indicates a cytosine base comprising a methyl group at the 5-position.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Effect of modified oligonucleotides complementary to α-ENaC in vitro

Modified oligonucleotides complementary to one or more human α-ENaC nucleic acids were designed and tested for their effect on α-ENaC mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

Cultured Hep3B cells at a density of 20,000 cells per well were transfected using electroporation with

2,000 nM of modified oligonucleotide or no modified oligonucleotide for untreated controls. After approximately 24 hours, RNA was isolated from the cells and α-ENaC mRNA levels were measured by quantitative real-time PCR. Human primer probe set hSCNNlA_LTS01170 (forward sequence

ACATCCCAGGAATGGGTCTTC, designated herein as SEQ ID NO: 3; reverse sequence

ACTTTGGCCACTCCATTTCTCTT, designated herin as SEQ ID NO: 4; probe sequence

TGCTATCGCGACAGAACAATTACACCGTC, designated herein as SEQ ID: 5) was used to measure mRNA levels. α-ENaC mRNA levels were normalized to total RNA content, as measured by

RIBOGREEN®. Results are presented in the tables below as normalized α-ENaC mRNA level, relative to untreated control cells (these conditions describe a "Standard Cell Assay").

The modified oligonucleotides in the tables below each have a 3-10-3 phosphothiorate cEt gapmer motif. The modified oligonucleotides are 16 nuceobases in length, wherein the central gap segment contains ten 2'-deoxynucleosides and is flanked by wing segments on the 3' and 5' ends, each containing three cEt nucleosides. All cytosine residues throughout each modified oligonucletoide are 5-methyl cytosines. The internucleoside linkages are all phosphorothioate internucleoside linkages.

Each modified oligonucleotide listed in the tables below is 100% complementary to the human a- ENaC nucleic acid sequence of GenBank Number NM_001038.5 (designated herein as SEQ ID NO: 1), the complement of GenBank Number NC_000012.12, truncated from nucleosides 6343001 to 6380000

(designated herein as SEQ ID NO: 2), and/or GenBank Number NG_011945.1 (designated herein as SEQ ID NO: 1957). "Start Site" indicates the 5'-most nucleoside of the designated α-ENaC nucleic acid to which the oligonucleotide is complementary. "Stop Site" indicates the 3 '-most nucleoside of the human α-ENaC nucleic acid to which the oligonucleotide is complementary. 'N/A' indicates that the modified oligonucleotide is not complementary to that particular nucleic acid with 100% complementarity. Several oligonucleotides match two or more sites on the mRNA, as shown in the tables below. As shown below, modified oligonucleotides complementary to human α-ENaC reduced the amount of human α-ENaC mRNA in vitro.

Table 1: Percent level of human α-ENaC mRNA

797087 141 156 CTCAATTAAAGGTGAG 150 4402 4417 27

797088 142 157 TCTCAATTAAAGGTGA 73 4403 4418 28

797089 147 162 TAGCATCTCAATTAAA 61 4408 4423 29

797090 151 166 TCATTAGCATCTCAAT 104 4412 4427 30

797091 158 173 AGGAATCTCATTAGCA 70 4419 4434 31

797092 168 183 TGGAAGCGACAGGAAT 94 4429 4444 32

797093 177 192 GGCCAGGGATGGAAGC 100 4438 4453 33

797094 213 228 GTGCAGCGGCCTGGCT 73 4474 4489 34

797095 221 236 CCTGACAGGTGCAGCG 71 4482 4497 35

235 250 5163 5178

797096 CTCCAGCTTGTTCCCC 41 36

295 310 5223 5238

237 252 5165 5180

797097 TCCTCCAGCTTGTTCC 49 37

297 312 5225 5240

238 253 5166 5181

797098 CTCCTCCAGCTTGTTC 58 38

298 313 5226 5241

240 255 5168 5183

797099 TGCTCCTCCAGCTTGT 26 39

300 315 5228 5243

242 257 5170 5185

797100 CCTGCTCCTCCAGCTT 19 40

302 317 5230 5245

244 259 5172 5187

797101 GTCCTGCTCCTCCAGC 21 41

304 319 5232 5247

797102 251 266 GTCTAGGGTCCTGCTC 41 5179 5194 42

797103 258 273 TGCAGAGGTCTAGGGT 27 5186 5201 43

797104 268 283 TGGTATGGGCTGCAGA 18 5196 5211 44

797105 277 292 CATGAGACCTGGTATG 85 5205 5220 45

797106 311 326 GGCTAGAGTCCTGCTC 78 5239 5254 46

797107 329 344 CTGGAGTGGACTGTGG 73 5257 5272 47

797108 403 418 CGCCGTGGGCTGCTGG 60 5331 5346 48

797109 424 439 CTCGATCAGGGCCTCC 33 5352 5367 49

797110 438 453 TAGGAGCGGTGGAACT 51 5366 5381 50

797111 440 455 GGTAGGAGCGGTGGAA 32 5368 5383 51

797112 447 462 AGCTCTCGGTAGGAGC 84 5375 5390 52

797113 454 469 CTCGAAGAGCTCTCGG 34 5382 5397 53

797114 462 477 CAGAAGAACTCGAAGA 48 5390 5405 54

797115 534 549 CAGAAGGCCGTCTTCA 30 5462 5477 55

797116 537 552 GCCCAGAAGGCCGTCT 41 5465 5480 56

797117 554 569 TGCAGAGCCACAGCAC 47 5482 5497 57

797118 561 576 CCAAAGGTGCAGAGCC 17 5489 5504 58

797119 568 583 CATCATGCCAAAGGTG 26 5496 5511 59

797120 576 591 TGCCAGTACATCATGC 45 5504 5519 60

797121 583 598 GCCGAATTGCCAGTAC 20 5511 5526 61 797122 592 607 GAAAAGCAGGCCGAAT 49 5520 5535 62

797123 604 619 GAAGTACTCTCCGAAA 36 5532 5547 63

797124 642 657 TCCGAGTTGAGGTTGA 25 5570 5585 64

797125 651 666 ACGAGCTTGTCCGAGT 23 5579 5594 65

797126 682 697 ATTGAGGGTGCAGATG 58 5610 5625 66

797127 704 719 TAATTTCCGGGTACCT 30 16289 16304 67

797128 736 751 TGTGATGCGGTCCAGC 24 16321 16336 68

797129 760 775 GTACAGGTCAAAGAGC 20 16345 16360 69

797130 765 780 TATTTGTACAGGTCAA 20 16350 16365 70

797131 767 782 TGTATTTGTACAGGTC 13 16352 16367 71

797132 778 793 GGTGAAGGAGCTGTAT 35 16363 16378 72

797133 785 800 CGAGAGTGGTGAAGGA 72 16370 16385 73

797134 793 808 GCCGGCCACGAGAGTG 101 16378 16393 74

797135 802 817 GCTGCGGGAGCCGGCC 59 16387 16402 75

797136 809 824 CGCGACGGCTGCGGGA 38 16394 16409 76

797137 817 832 CCGCAGGTCGCGACGG 74 16402 16417 77

797138 880 895 TCGACGGGCCCCGTGA 41 16465 16480 78

797139 890 905 CGCTACGGGCTCGACG 20 16475 16490 79

797140 901 916 GCTGGAGGCCACGCTA 21 16486 16501 80

797141 942 957 TTCCAGTCCTTCCAGT 45 16527 16542 81

797142 950 965 AGCCGATCTTCCAGTC 44 16535 16550 82

797143 961 976 GCACAGCTGGAAGCCG 30 N/A N/A 83

797144 977 992 CCGATTTGTTCTGGTT 19 17763 17778 84

797145 984 999 AAGCAGTCCGATTTGT 74 17770 17785 85

797146 1002 1017 GATGAGTATGTCTGGT 18 17788 17803 86

797147 1016 1031 CCGCATCCACCCCTGA 27 17802 17817 87

797148 1044 1059 ATGTAGTGGAAGCGGT 59 17830 17845 88

797149 1057 1072 CGACAGGATGTTGATG 45 17843 17858 89

797150 1066 1081 TGGCAGCCTCGACAGG 24 17852 17867 90

797151 1077 1092 GGCAGAGTCTCTGGCA 39 17863 17878 91

797152 1087 1102 CTCCAGGGATGGCAGA 60 17873 17888 92

797153 1111 1126 GATGAAGTTGCCCAGC 24 17897 17912 93

797154 1118 1133 AGGCGAAGATGAAGTT 51 17904 17919 94

797155 1128 1143 TTGAAGCGGCAGGCGA 48 17914 17929 95

797156 1143 1158 TTGCAGGAGACCTGGT 45 17929 17944 96

797157 1156 1171 GTAATTCGCCTGGTTG 102 N/A N/A 97

797158 1163 1178 AGTGAGAGTAATTCGC 53 N/A N/A 98

797159 1227 1242 ATCCAGAGGTTGGAGT 105 24183 24198 99

797160 1235 1250 TGGAAGACATCCAGAG 50 24191 24206 100

797161 1244 1259 TTCCAGGCATGGAAGA 68 24200 24215 101

797162 1256 1271 GACCGTTGTTGATTCC 28 N/A N/A 102 797163 1264 1279 CAGGGACAGACCGTTG 22 N/A N/A 103

797164 1272 1287 CGCAGCATCAGGGACA 14 24569 24584 104

797165 1289 1304 AGTCATTCTGCTCTGC 9 24586 24601 105

797166 1293 1308 ATGAAGTCATTCTGCT 27 24590 24605 106

797167 1297 1312 GGGAATGAAGTCATTC 37 24594 24609 107

797168 1315 1330 AGTCACTGTGGACAGC 20 24612 24627 108

797169 1330 1345 CATTACCCGGGCCCCA 53 24627 24642 109

797170 1355 1370 AGGCAGGTTCATCCTG 54 24652 24667 110

797171 1362 1377 TCCATAAAGGCAGGTT 48 24659 24674 111

797172 1370 1385 CACCATCATCCATAAA 48 24667 24682 112

797173 1373 1388 AGCCACCATCATCCAT 31 24670 24685 113

797174 1377 1392 TTAAAGCCACCATCAT 39 24674 24689 114

797175 1384 1399 CCGCAAGTTAAAGCCA 24 24681 24696 115

797176 1391 1406 CGCCAGGCCGCAAGTT 18 24688 24703 116

797177 1414 1429 CCTCATGCTGATGGAG 40 24711 24726 117

797178 1429 1444 GTCCAGGGTTTCCTTC 48 N/A N/A 118

797179 1439 1454 CCCCAAGTCTGTCCAG 49 25159 25174 119

797180 1449 1464 CCATAATCGCCCCCAA 15 25169 25184 120

797181 1465 1480 ATTCTTGGTGCAGTCG 18 25185 25200 121

797182 1475 1490 CATCACTGCCATTCTT 30 25195 25210 122

797183 1482 1497 ACAGGAACATCACTGC 22 25202 25217 123

797184 1495 1510 GTAAAGGTTCTCAACA 84 25215 25230 124

797185 1502 1517 TTGAAGGGTAAAGGTT 57 25222 25237 125

797186 1524 1539 ATACACACCTGCTGTG 87 N/A N/A 126

797187 1533 1548 CAGGAGTGAATACACA 65 25447 25462 127

797188 1552 1567 GATCATGCTCTCCTGG 13 25466 25481 128

797189 1563 1578 CCACACTCCTTGATCA 36 25477 25492 129

797190 1570 1585 GGCACAGCCACACTCC 29 25484 25499 130

797191 1573 1588 GTAGGCACAGCCACAC 18 25487 25502 131

797192 1578 1593 AAGATGTAGGCACAGC 17 25492 25507 132

797193 1586 1601 GCGGATAGAAGATGTA 20 25500 25515 133

797194 1613 1628 AGTCACAGTACTCCAC 40 25527 25542 134

797195 1623 1638 TGCTTTCTGTAGTCAC 39 25537 25552 135

797196 1631 1646 AGGAACTGTGCTTTCT 48 25545 25560 136

797197 1644 1659 TAGCAGTACCCCCAGG 51 N/A N/A 137

797198 1651 1666 CTTATAGTAGCAGTAC 42 30597 30612 138

797199 1663 1678 GTCAACCTGGAGCTTA 14 30609 30624 139

797200 1671 1686 GAGGAGAAGTCAACCT 66 30617 30632 140

797201 1684 1699 GCCCAGGTGGTCTGAG 43 30630 30645 141

797202 1692 1707 GTGAAACAGCCCAGGT 55 30638 30653 142

797203 1700 1715 GGCACTTGGTGAAACA 77 30646 30661 143 797204 1707 1722 GGCTTCCGGCACTTGG 22 30653 30668 144

797205 1715 1730 CGCTGCATGGCTTCCG 23 N/A N/A 145

797206 1731 1746 AGCTGGTAGCTGGTCA 49 30782 30797 146

797207 1739 1754 CAGCAGAGAGCTGGTA 52 30790 30805 147

797208 1746 1761 GAGTAACCAGCAGAGA 47 30797 30812 148

797218 1875 1890 TTGTAGTTCAGCTCCT 41 31231 31246 149

797219 1885 1900 AGAATTGGTTTTGTAG 55 31241 31256 150

797220 1895 1910 AGGGAGACTCAGAATT 101 31251 31266 151

797221 1919 1934 ACAGGAGGGTGACCAT 41 31748 31763 152

797222 1941 1956 CTCCACTGGCTGCCCA 56 31770 31785 153

797223 1948 1963 CCACAGGCTCCACTGG 69 31777 31792 154

797224 1950 1965 AACCACAGGCTCCACT 64 31779 31794 155

797225 1955 1970 AGCCGAACCACAGGCT 139 31784 31799 156

797226 1963 1978 CACCGAGGAGCCGAAC 76 31792 31807 157

797227 1971 1986 ACAGACAACACCGAGG 24 31800 31815 158

797228 1978 1993 CTCCACCACAGACAAC 46 31807 31822 159

797229 1988 2003 GCTCAGCCATCTCCAC 63 31817 31832 160

797230 1997 2012 CAAAGACGAGCTCAGC 99 31826 31841 161

797231 2005 2020 CAGCAGGTCAAAGACG 96 31834 31849 162

797232 2017 2032 GAACATGATGACCAGC 22 31846 31861 163

797233 2024 2039 GCATGAGGAACATGAT 41 31853 31868 164

797234 2037 2052 AACCTTCGGAGCAGCA 18 31866 31881 165

797235 2045 2060 GGCTTCGGAACCTTCG 19 31874 31889 166

797236 2052 2067 CAGTATCGGCTTCGGA 19 31881 31896 167

797237 2060 2075 CTGGAGACCAGTATCG 35 31889 31904 168

797238 2104 2119 TGCCAGGGTGGAGGCT 81 31933 31948 169

797239 2127 2142 CAGAAGTGGGAAGGAG 63 31956 31971 170

797240 2151 2166 AAGGACAGAGACATGG 33 31980 31995 171

797241 2187 2202 GTCAAGGCTGGAGAGG 33 32016 32031 172

797242 2218 2233 GCCCAGGGTGGCATAG 76 32047 32062 173

797243 2259 2274 GAGGAACTGGCCCCTG 58 32088 32103 174

797244 2268 2283 GGACAGGTGGAGGAAC 76 32097 32112 175

797245 2275 2290 CCCCAGAGGACAGGTG 73 32104 32119 176

797246 2304 2319 GAGAAACCTCTCCTTC 64 32133 32148 177

797247 2329 2344 ACCAGAGGAGCATCTG 34 32158 32173 178

797248 2350 2365 TGCCAGGGCCAGCACC 50 32179 32194 179

797249 2358 2373 TTCAATCTTGCCAGGG 28 32187 32202 180

797250 2366 2381 GCACATCCTTCAATCT 36 32195 32210 181

797251 2377 2392 GAGGAAGCCCTGCACA 51 32206 32221 182

797252 2394 2409 AGTTTGGGCGGCTCTG 54 32223 32238 183

797253 2402 2417 TCAACGGCAGTTTGGG 22 32231 32246 184 797254 2409 2424 CCACACATCAACGGCA 23 32238 32253 185

797255 2427 2442 ACCCATCTTGCTTCCC 22 32256 32271 186

797256 2446 2461 AGCAACTTCCTGAGCC 36 32275 32290 187

797257 2461 2476 AGCTACTGTTCTTGGA 23 32290 32305 188

797258 2481 2496 CACTTCTGGGCAGCTT 14 32310 32325 189

797259 2488 2503 GCCAAGGCACTTCTGG 41 32317 32332 190

797260 2501 2516 GTACAGGGCTGGAGCC 65 32330 32345 191

797261 2522 2537 GTTCAGAGGCAGTACC 24 32351 32366 192

797262 2529 2544 CCAGAGTGTTCAGAGG 17 32358 32373 193

797263 2550 2565 AGCCGCAGTTGGGTGG 28 32379 32394 194

797264 2558 2573 AGAGACTTAGCCGCAG 12 32387 32402 195

797265 2565 2580 GGGAAAAAGAGACTTA 21 32394 32409 196

797266 2576 2591 GGCTGATCCAAGGGAA 14 32405 32420 197

797267 2590 2605 TCCAAGTTTCGCTTGG 85 32419 32434 198

797268 2598 2613 GTCAAAGCTCCAAGTT 26 32427 32442 199

797269 2611 2626 AGGAAAGTTCCTTGTC 21 32440 32455 200

797270 2626 2641 TATCAGCGGTTTCTTA 52 32455 32470 201

797271 2675 2690 GGAAACCCGTGCATGC 27 32504 32519 202

797272 2684 2699 CGCTGGGCAGGAAACC 25 32513 32528 203

797273 2694 2709 CTTAAGCCGTCGCTGG 31 32523 32538 204

797274 2716 2731 GGCCAGGCCAGTCGGG 64 32545 32560 205

797275 2725 2740 GAGCAGTGTGGCCAGG 18 32554 32569 206

797276 2732 2747 TACTGGAGAGCAGTGT 24 32561 32576 207

797277 2744 2759 AGACATCTGTGCTACT 10 32573 32588 208

797278 2757 2772 CAAGAGGAGGAGCAGA 46 32586 32601 209

797279 2765 2780 CCCAAGTTCAAGAGGA 68 32594 32609 210

797280 2803 2818 CCTAAGTAACAAAGGG 44 32632 32647 211

797281 2811 2826 GGGAATTGCCTAAGTA 44 32640 32655 212

797282 2857 2872 ACTTACCCGGGTCTGC 77 32686 32701 213

797283 2864 2879 TGCCTTTACTTACCCG 34 32693 32708 214

797284 2883 2898 GCTAGAGGAGCCCTGG 60 32712 32727 215

797285 2890 2905 GTATGAGGCTAGAGGA 70 32719 32734 216

797286 2897 2912 GGCACGGGTATGAGGC 71 32726 32741 217

797287 2914 2929 GGGCATGGCTCTGTGA 34 32743 32758 218

797288 2937 2952 AAAGACACAGGGCAGA 27 32766 32781 219

797289 2944 2959 AGGTATGAAAGACACA 17 32773 32788 220

797290 2952 2967 ACATGTAGAGGTATGA 17 32781 32796 221

797291 2962 2977 TCTCAAGCAGACATGT 20 32791 32806 222

797292 2969 2984 GGAAATATCTCAAGCA 15 32798 32813 223

797293 2983 2998 AACTTTCAGGCTGAGG 15 32812 32827 224

797294 3013 3028 CATAGGAGTTCTCTGG 10 32842 32857 225 797295 3020 3035 AGGGATGCATAGGAGT 19 32849 32864 226

797296 3033 3048 GAGCAGGGTTCTAAGG 60 32862 32877 227

797297 3046 3061 AGTAATGGTGTCTGAG 12 32875 32890 228

797298 3053 3068 TCACAAAAGTAATGGT 26 32882 32897 229

797299 3072 3087 CAAGATGTGGCAGAAG 58 32901 32916 230

797300 3079 3094 GGGAAGACAAGATGTG 22 32908 32923 231

797301 3093 3108 AGTGATCAATTTTGGG 22 32922 32937 232

797302 3103 3118 GAGAAGGCGGAGTGAT 61 32932 32947 233

797303 3118 3133 GCTACGGGAGCCCAGG 27 32947 32962 234

797304 3127 3142 TTATAGTGTGCTACGG 13 32956 32971 235

797305 3134 3149 GCAGATGTTATAGTGT 21 32963 32978 236

797306 3144 3159 CAACACTCCAGCAGAT 53 32973 32988 237

797307 3151 3166 GCAACAGCAACACTCC 6 32980 32995 238

797308 3160 3175 AAGTATGGTGCAACAG 9 32989 33004 239

797309 3167 3182 TACAAGAAAGTATGGT 11 32996 33011 240

797310 3180 3195 GGAGACACAAATGTAC 37 33009 33024 241

797311 3199 3214 TTACAGTCTAGTTGGG 20 33028 33043 242

797312 3209 3224 CGCAAGGCACTTACAG 13 33038 33053 243

797313 3227 3242 CAAGATTCAGTCCCTG 15 33056 33071 244

797314 3234 3249 AAACGGGCAAGATTCA 21 33063 33078 245

797315 3241 3256 CATACATAAACGGGCA 19 33070 33085 246

797316 3248 3263 CATGGAGCATACATAA 52 33077 33092 247

797317 3255 3270 GGCTAGACATGGAGCA 39 33084 33099 248

797318 3263 3278 GGATGATGGGCTAGAC 18 33092 33107 249

797319 3271 3286 TCCAAGCAGGATGATG 82 33100 33115 250

797320 3282 3297 TGCCTACTTGCTCCAA 51 33111 33126 251

797321 3291 3306 TTGAGCTCCTGCCTAC 21 33120 33135 252

797322 3293 3308 TATTGAGCTCCTGCCT 52 33122 33137 253

797323 3294 3309 TTATTGAGCTCCTGCC 35 33123 33138 254

797324 N/A N/A AATCAGTTTTCTGAGG 80 2644 2659 255

797325 N/A N/A AAGGATAAATCAGTTT 98 2651 2666 256

797326 N/A N/A AGAAACTGACCCTTCC 75 2668 2683 257

797327 N/A N/A CCTAATGAAGAAACTG 78 2676 2691 258

797328 N/A N/A CTTCATTGTCCTAATG 103 2685 2700 259

797329 N/A N/A AGCTGGATTTTTCTTC 68 2697 2712 260

797330 N/A N/A GAAGGGACAGCTGGAT 64 2705 2720 261

797331 N/A N/A CATGATACCTCCCCTT 47 2722 2737 262

797332 N/A N/A TGATACTGCTCATGAT 73 2732 2747 263

797333 N/A N/A TCCTAGCACCTCCCTT 57 4867 4882 264

797334 N/A N/A ACCTTTCGAGTTTTGT 26 4882 4897 265

797335 N/A N/A TGATAGGGCCACCTTT 47 4892 4907 266 797336 N/A N/A CTAGAACGGCCTCTCC 48 4918 4933 267

797337 N/A N/A CCGGAGCTGGGCTTCC 69 4934 4949 268

797338 N/A N/A CAAAAGTGCCGGAGCT 36 4942 4957 269

797339 N/A N/A CAGCAGACCTGCGGGA 33 4966 4981 270

797340 N/A N/A CTGGAGCCAGCAGACC 16 4973 4988 271

797341 N/A N/A CCACATTCTCCCACTC 50 5011 5026 272

797342 N/A N/A TCCCACCCTGCGCCCA 82 5024 5039 273

797343 N/A N/A GGCCATGCCCATGTCC 65 5037 5052 274

797344 N/A N/A CCCGAGTGAGGCTGCC 22 5056 5071 275

797345 N/A N/A GGCTGAGCTCTGGGCC 72 5101 5116 276

797346 N/A N/A GGTCAGGGTCAAGGCT 50 5113 5128 277

797347 N/A N/A CCCCGGAGTGGATTGG 71 5139 5154 278

797348 N/A N/A GGCCTTTCGGCTTGAG 72 15860 15875 279

797349 N/A N/A GGCGAGTGTCGGTGGC 43 15873 15888 280

797350 N/A N/A GGTCATCCCGCCCTGA 40 15897 15912 281

797351 N/A N/A CGGTACCCAGGTCATC 51 15906 15921 282

797352 N/A N/A CGTGACCGCGGTACCC 57 15914 15929 283

797353 N/A N/A GGTGAGGGCCTCGGCC 88 15934 15949 284

797354 N/A N/A CGGAACTTGTCTGCCC 45 15968 15983 285

797355 N/A N/A GGGAACCCGGAACTTG 85 15975 15990 286

797356 N/A N/A CCTAGAAGGGAACCCG 38 15982 15997 287

797357 N/A N/A GCCCGGACCTAGAAGG 82 15989 16004 288

797358 N/A N/A AGAGAGGCAGGAGGCG 104 16034 16049 289

797359 N/A N/A TTGAAGGAGAGAGGCA 52 16041 16056 290

797360 N/A N/A GTGGACTGTTTATTGA 67 16053 16068 291

797361 N/A N/A GGACACTGTGGACTGT 51 16060 16075 292

797362 N/A N/A GCCCAGCCGGGACACT 71 16069 16084 293

797363 N/A N/A CCACGGCGAGCCCAGC 69 16078 16093 294

797364 N/A N/A GCGGAGGCCACGGCGA 83 16085 16100 295

797365 N/A N/A CGGGAAGGCGGAGGCC 78 16092 16107 296

797366 N/A N/A AAACAGGTGTGTCCGC 77 16108 16123 297

797367 N/A N/A GTGAAGGGTAAACAGG 77 16117 16132 298

797368 N/A N/A GGCCGTCCGGCGGTGA 55 16129 16144 299

797369 N/A N/A GGAGAAGCCTGGGCGG 83 16170 16185 300

797370 N/A N/A GTCCATCCCGGAGAAG 63 16179 16194 301

797371 N/A N/A CGGGAGGCCGGTCCAT 52 16189 16204 302

797372 N/A N/A GGTCAGGGTCCTCATC 79 16212 16227 303

797373 N/A N/A AGCGAGTGTCTGGCCC 94 16234 16249 304

797374 N/A N/A GAAGAGGGTCAGGCCA 52 16260 16275 305

797375 N/A N/A GAGTAATTCCTGGTTG 103 N/A N/A 306

797376 N/A N/A TGTCTTTAAAACGGAC 112 3040 3055 307 797377 N/A N/A GAGGAGATAGGCCTGC 42 3098 3113 308

797378 N/A N/A AAAAAGGGCTGGAGGA 113 3291 3306 309

797379 N/A N/A AATCAGACCCAAAAAG 134 3301 3316 310

797380 N/A N/A GAGGAGGGTCAGAGAA 69 3315 3330 311

797381 N/A N/A TTGCAGGAATGTGGGC 80 3593 3608 312

797382 N/A N/A GGCCAGGAATGTGTAA 103 3632 3647 313

797383 N/A N/A GGACATTCTGTTCTTT 97 3667 3682 314

797384 N/A N/A GACAATAGAGAGGGAC 93 4090 4105 315

797385 N/A N/A GCAGAAAGAGGGAGAC 85 4103 4118 316

5154 5169

797386 346 361 GTTCCCCTTCATGAGC 26 317

5274 5289

5157 5172

797387 349 364 CTTGTTCCCCTTCATG 15 318

5277 5292

797388 N/A N/A AGTAAGCTGGAGGCTC 69 5784 5799 319

797389 N/A N/A TGCAAGCACTCCCTCC 40 5932 5947 320

797390 N/A N/A GAAAAGGGATGCAGCT 81 5967 5982 321

797391 N/A N/A AGCATTTTAGCCTGGG 20 6265 6280 322

797392 N/A N/A TATACAAAAGCACTCA 62 6422 6437 323

797393 N/A N/A GAATTATTCATGAATC 42 6523 6538 324

797394 N/A N/A TGGAATATACGAAGGG 24 6782 6797 325

797395 N/A N/A CATATTTTCAACCACA 25 7349 7364 326

797396 N/A N/A TAATACTGCCCACCTC 76 7746 7761 327

797397 N/A N/A TTGATTTAGATTCATT 61 8239 8254 328

797398 N/A N/A ACTTAAAGTGTAATGG 89 8562 8577 329

797399 N/A N/A TGCCTGATCCCTACTT 59 8574 8589 330

797400 N/A N/A GAAAAATATGTCTGTG 53 9080 9095 331

797401 N/A N/A AGCCGTGGGAGCCGCC 31 9458 9473 332

797402 N/A N/A GTCCAGGACGGAGCAG 32 9587 9602 333

797403 N/A N/A AAGACATCCGATCTTG 92 10021 10036 334

797404 N/A N/A CACTAAACAGAAAGCA 38 10042 10057 335

797405 N/A N/A GCATAAGATAAGACGG 15 10454 10469 336

797406 N/A N/A CACAAACCTGTGACAA 48 10544 10559 337

10638 10653

797407 N/A N/A CTCCTGCCACCCTACG 66 10661 10676 338

10684 10699

10642 10657

10665 10680

797408 N/A N/A CTCCCTCCTGCCACCC 50 339

10688 10703

10711 10726

10645 10660

797409 N/A N/A CACCTCCCTCCTGCCA 43 340

10668 10683 10691 10706

10648 10663

797410 N/A N/A ACGCACCTCCCTCCTG 30 341

10671 10686

10651 10666

797411 N/A N/A CCTACGCACCTCCCTC 54 342

10674 10689

10654 10669

797412 N/A N/A CACCCTACGCACCTCC 59 343

10677 10692

10657 10672

797413 N/A N/A TGCCACCCTACGCACC 29 344

10680 10695

797414 N/A N/A GAAGAATCCAGATCCC 56 10944 10959 345

797415 N/A N/A AGGAAGAATCCAGATC 118 10946 10961 346

797416 N/A N/A GCGAATTTGCCTTTCT 40 10973 10988 347

797417 N/A N/A TGAGAAAATACTCAGT 31 11051 11066 348

797418 N/A N/A TCTGAGATGTAGGGCC 41 11208 11223 349

797419 N/A N/A CTCCAACCACCACACT 73 11307 11322 350

797420 N/A N/A TGGCACAGCTAGCAAA 65 11337 11352 351

797421 N/A N/A CTTTAGGCTAAAACTT 101 11469 11484 352

797422 N/A N/A CACTATGCATGAAGAA 40 11521 11536 353

797423 N/A N/A GACAAGTGGGCTGCCT 27 11611 11626 354

11860 11875

797424 N/A N/A TTAATTGTTAAAAGAA 72 355

12660 12675

11862 11877

797425 N/A N/A ATTTAATTGTTAAAAG 103 356

12662 12677

11863 11878

797426 N/A N/A TATTTAATTGTTAAAA 113 357

12663 12678

11866 11881

797427 N/A N/A CATTATTTAATTGTTA 127 358

12666 12681

797428 N/A N/A AAAGAATGGCAAGCAT 25 11937 11952 359

797429 N/A N/A GGTTGAAGGTGTGTTT 36 11988 12003 360

797430 N/A N/A TGTCAAACCTGAGTGG 76 12309 12324 361

797431 N/A N/A CAACATCTCGACTGTC 25 12321 12336 362

797432 N/A N/A GATAGAGATAGCATTC 71 12401 12416 363

797433 N/A N/A ACAGACAAAACCAGTT 85 12417 12432 364

797434 N/A N/A TGGCAATCATAGCTAG 38 12731 12746 365

797435 N/A N/A CGACGAAACCTTGTAT 53 12931 12946 366

797436 N/A N/A AAGAATGGTAATCTGC 57 13042 13057 367

797437 N/A N/A GCCAAAAAGCCTGAAG 28 13125 13140 368

797438 N/A N/A TCATAGCCATTTTATT 83 13148 13163 369

13168 13183

797439 N/A N/A AAAGATTTGTACATGA 23 370

13483 13498

797440 N/A N/A ATATTAAGAAGGAATG 71 13566 13581 371 797441 N/A N/A TACGATCATTTTGGAA 42 13770 13785 372

13832 13847

797442 N/A N/A GAACAGACCTACATTT 74 373

14129 14144

797443 N/A N/A CAGACCTACATTTTTT 48 14126 14141 374

797444 N/A N/A ACCGTATGTAGTAGGC 10 14152 14167 375

797445 N/A N/A AACAAATAATCCCTAG 88 14172 14187 376

797446 N/A N/A TCTAGAAGATGGAAGA 56 14238 14253 377

797447 N/A N/A GAACCATAAACACTCT 19 14251 14266 378

797448 N/A N/A CTATACAGGCAAAAAT 80 14304 14319 379

797449 N/A N/A CAAAAGTGTGCCACCA 31 14828 14843 380

797450 N/A N/A ATGGATTCAACACAAT 26 14993 15008 381

15184 15199

797451 N/A N/A AAATTAATTGCATTTC 103 382

15212 15227

797452 N/A N/A TTGCATTTCCGTCTCA 23 15205 15220 383

15214 15229

797453 N/A N/A AAAAATTAATTGCATT 86 384

15530 15545

15216 15231

797454 N/A N/A AAAAAAATTAATTGCA 106 385

15532 15547

15217 15232

797455 N/A N/A AAAAAAAATTAATTGC 67 386

15533 15548

797456 N/A N/A TAACAAACTGAACAAG 73 15574 15589 387

797457 N/A N/A TGTTTCGGGTGCGGCC 62 15731 15746 388

797458 N/A N/A CCAAAGACTGTTCTAA 44 15749 15764 389

797459 N/A N/A ACCCACCCCGCCTCCC 100 15769 15784 390

797460 N/A N/A TTAGAATCTCCAACTC 52 15804 15819 391

797461 N/A N/A GGTCAGGAAAGGAGCG 22 16629 16644 392

797462 N/A N/A GGTGTTATTTTAATTA 84 16730 16745 393

797463 N/A N/A AAAAGCTTGGGCACCA 27 16749 16764 394

797464 N/A N/A CAAGAGCTGGGACTAG 65 17403 17418 395

797465 N/A N/A AAAGAATGAGTGATCT 65 17676 17691 396

797466 N/A N/A GTCAACAAGCATTTCC 15 18034 18049 397

797467 N/A N/A GGCATTTTTTTAGTCA 59 18046 18061 398

797468 N/A N/A CAAGATCCATGCTTCC 14 18218 18233 399

797469 N/A N/A GGATGATGTGATACAT 9 18734 18749 400

797470 N/A N/A CAATCTAAGAAATAGG 24 18757 18772 401

797471 N/A N/A TCCAAATGCCTAGAAC 16 18859 18874 402

797472 N/A N/A GGCGGACTCAGGCTTA 75 19484 19499 403

797473 N/A N/A TGACAGTTAGAGGAAC 30 19515 19530 404

19535 19550

797474 N/A N/A GGAAAGCACAGGTGTC 29 405

19617 19632

797475 N/A N/A AGGGAAAGCACAGGTG 41 19537 19552 406 19619 19634

19541 19556

797476 N/A N/A GCATAGGGAAAGCACA 33 407

19623 19638

19543 19558

797477 N/A N/A GGGCATAGGGAAAGCA 33 408

19625 19640

19545 19560

797478 N/A N/A GAGGGCATAGGGAAAG 60 409

19627 19642

19548 19563

797479 N/A N/A GGTGAGGGCATAGGGA 40 410

19630 19645

19552 19567

797480 N/A N/A ATCGGGTGAGGGCATA 34 411

19634 19649

19569 19584

797481 N/A N/A ACAGAGCAAAGGGAGG 24 412

19652 19667

19571 19586

797482 N/A N/A ACACAGAGCAAAGGGA 45 413

19654 19669

19573 19588

797483 N/A N/A GCACACAGAGCAAAGG 19 414

19656 19671

19575 19590

797484 N/A N/A AGGCACACAGAGCAAA 25 415

19658 19673

19579 19594

797485 N/A N/A AGGCAGGCACACAGAG 26 416

19662 19677

19583 19598

797486 N/A N/A GGGGAGGCAGGCACAC 46 417

19666 19681

797487 N/A N/A GCACAGGTGTCCATGG 34 19612 19627 418

797488 N/A N/A GGAATAGTTACATGTG 10 19866 19881 419

797489 N/A N/A ACCCGATAGCTGGTTG 19 20416 20431 420

797490 N/A N/A TCACACTATTAATTAG 89 20435 20450 421

797491 N/A N/A ACTGAACGATTTTAAA 64 20606 20621 422

797492 N/A N/A CCATGCTAAGGAGTAC 30 20650 20665 423

20864 20879

797493 N/A N/A GTACAGGGTTTCTTTT 62 424

27928 27943

797494 N/A N/A TTAAATGGTGTGACCA 10 21648 21663 425

797495 N/A N/A ACGATTACAGGGATTC 9 21751 21766 426

797496 N/A N/A AGCTGTATTAGCTCAC 71 21771 21786 427

797497 N/A N/A GTTACTTACTTAATCT 17 21895 21910 428

797498 N/A N/A AACAAGTATTAGATGT 93 21923 21938 429

797499 N/A N/A GCACAGACTCCAGAAT 41 21970 21985 430

797500 N/A N/A CAGTATAATGTGATGG 5 22302 22317 431

797501 N/A N/A GAGATACACACTAAGC 5 22344 22359 432

797502 N/A N/A CAGCGGTGGAGAAACA 31 22750 22765 433

797503 N/A N/A ATGGAAAGCAGGCACA 8 22774 22789 434 797504 N/A N/A AAGTATAATGGTGGGT 32 22799 22814 435

797505 N/A N/A TAAAATGTAGGATGAT 86 23033 23048 436

797506 N/A N/A ACTAAAGAGAAGAGGG 68 23136 23151 437

797507 N/A N/A AGCAAATCACAGGTTC 5 23303 23318 438

797508 N/A N/A CAGTACCAAGTGTTTC 17 23442 23457 439

797509 N/A N/A AGGAGATAGAGGAGAT 39 23589 23604 440

797510 N/A N/A CTTAAACTCCTACAGG 59 24017 24032 441

797511 N/A N/A AGCTCAAGGTAAGTAC 98 24277 24292 442

797512 N/A N/A TCCCAGTCAGCATCCT 89 24733 24748 443

797513 N/A N/A CCCCAGGGTCCACCCT 75 24902 24917 444

797514 N/A N/A CTCACATACACAACCC 64 25321 25336 445

26098 26113

797515 N/A N/A CTGCAGGTTGTTTTTA 26 446

26434 26449

797516 N/A N/A AATGGATACAGTATGT 98 26688 26703 447

797517 N/A N/A AGTCAAAAGGAAAGAG 25 26848 26863 448

797518 N/A N/A CAAACAACTCAACTGT 24 26864 26879 449

797519 N/A N/A AGCATGAACTCCAGGA 11 26959 26974 450

797520 N/A N/A AAATGCAACAGACTGT 30 27542 27557 451

797521 N/A N/A ACCCAAATCCCTACCA 46 27624 27639 452

797522 N/A N/A GATATAAATTATCTCA 88 27780 27795 453

797523 N/A N/A GCTAATGAGTACAAGG 9 28243 28258 454

797524 N/A N/A ACCATACGGATGAACC 13 28742 28757 455

797525 N/A N/A TCAAAAAAGGTTAAAC 90 28996 29011 456

797526 N/A N/A ATGTACAATGGTGATG 34 29040 29055 457

29535 29550

797527 N/A N/A AAAGAAAAATGGGAAC 87 458

29852 29867

797528 N/A N/A TTATAATGATGCCTTA 78 30466 30481 459

797529 N/A N/A CCCAAGAGGTCTCCCA 58 30522 30537 460

797530 N/A N/A CATAATACCCAGAGAA 57 30895 30910 461

797531 N/A N/A CACTCATACACATAAT 68 30905 30920 462

797532 N/A N/A TGTCACCCAGAGAAAA 66 31564 31579 463

797533 N/A N/A AGGTACATTGACGATG 85 31720 31735 464

Table 2: Percent level of human α-ENaC mRNA

826070 1 16 GACGCAGACAGGCAAG 76 4262 4277 465

826071 5 20 TTTAGACGCAGACAGG 67 4266 4281 466

826090 52 67 GTGAACTGGGAGTACT 91 4313 4328 467

826091 53 68 GGTGAACTGGGAGTAC 57 4314 4329 468

826110 145 160 GCATCTCAATTAAAGG 86 4406 4421 469

826111 163 178 GCGACAGGAATCTCAT 66 4424 4439 470

826130 195 210 GGAGCCCGCCCGCTGG 60 4456 4471 471

826131 216 231 CAGGTGCAGCGGCCTG 79 4477 4492 472

826150 282 297 CCCTCCATGAGACCTG 30 5210 5225 473

826151 283 298 CCCCTCCATGAGACCT 19 5211 5226 474

826170 354 369 TCACGCTTGTTCCCCT 25 5282 5297 475

826171 355 370 CTCACGCTTGTTCCCC 17 5283 5298 476

826190 439 454 GTAGGAGCGGTGGAAC 88 5367 5382 477

826191 441 456 CGGTAGGAGCGGTGGA 64 5369 5384 478

826209 565 580 CATGCCAAAGGTGCAG 43 5493 5508 479

826210 566 581 TCATGCCAAAGGTGCA 45 5494 5509 480

826229 606 621 CTGAAGTACTCTCCGA 23 5534 5549 481

826230 607 622 GCTGAAGTACTCTCCG 26 5535 5550 482

826249 702 717 ATTTCCGGGTACCTGT 33 N/A N/A 483

826250 703 718 AATTTCCGGGTACCTG 40 16288 16303 484

826267 791 806 CGGCCACGAGAGTGGT 62 16376 16391 485

826268 792 807 CCGGCCACGAGAGTGG 58 16377 16392 486

826287 828 843 GGCAGAGTCCCCCGCA 35 16413 16428 487

826288 830 845 GCGGCAGAGTCCCCCG 38 16415 16430 488

826307 914 929 TGTTGTCCCGCAAGCT 42 16499 16514 489

826308 916 931 GTTGTTGTCCCGCAAG 26 16501 16516 490

826325 979 994 GTCCGATTTGTTCTGG 31 17765 17780 491

826326 980 995 AGTCCGATTTGTTCTG 58 17766 17781 492

826345 1017 1032 ACCGCATCCACCCCTG 42 17803 17818 493

826346 1018 1033 CACCGCATCCACCCCT 41 17804 17819 494

826365 1113 1128 AAGATGAAGTTGCCCA 41 17899 17914 495

826366 1115 1130 CGAAGATGAAGTTGCC 55 17901 17916 496

826385 1162 1177 GTGAGAGTAATTCGCC 65 N/A N/A 497

826386 1164 1179 AAGTGAGAGTAATTCG 29 N/A N/A 498

826405 1281 1296 TGCTCTGCGCGCAGCA 62 24578 24593 499

826406 1282 1297 CTGCTCTGCGCGCAGC 58 24579 24594 500

826425 1354 1369 GGCAGGTTCATCCTGC 140 24651 24666 501

826426 1356 1371 AAGGCAGGTTCATCCT 63 24653 24668 502

826445 1405 1420 GATGGAGGTCTCCACG 67 24702 24717 503

826446 1416 1431 TTCCTCATGCTGATGG 24 24713 24728 504

826465 1497 1512 GGGTAAAGGTTCTCAA 25 25217 25232 505 826466 1500 1515 GAAGGGTAAAGGTTCT 63 25220 25235 506

826485 1579 1594 GAAGATGTAGGCACAG 32 25493 25508 507

826504 1656 1671 TGGAGCTTATAGTAGC 30 30602 30617 508

826505 1661 1676 CAACCTGGAGCTTATA 42 30607 30622 509

826524 1733 1748 AGAGCTGGTAGCTGGT 67 30784 30799 510

826525 1736 1751 CAGAGAGCTGGTAGCT 75 30787 30802 511

826564 1992 2007 ACGAGCTCAGCCATCT 57 31821 31836 512

826565 1993 2008 GACGAGCTCAGCCATC 16 31822 31837 513

826584 2046 2061 CGGCTTCGGAACCTTC 23 31875 31890 514

826603 2216 2231 CCAGGGTGGCATAGGC 28 32045 32060 515

826604 2217 2232 CCCAGGGTGGCATAGG 42 32046 32061 516

826623 2360 2375 CCTTCAATCTTGCCAG 31 32189 32204 517

826624 2390 2405 TGGGCGGCTCTGAGAG 49 32219 32234 518

826643 2464 2479 ATCAGCTACTGTTCTT 32 32293 32308 519

826644 2476 2491 CTGGGCAGCTTCATCA 33 32305 32320 520

826662 2575 2590 GCTGATCCAAGGGAAA 35 32404 32419 521

826681 2610 2625 GGAAAGTTCCTTGTCA 40 32439 32454 522

826682 2612 2627 TAGGAAAGTTCCTTGT 32 32441 32456 523

826701 2679 2694 GGCAGGAAACCCGTGC 74 32508 32523 524

826702 2681 2696 TGGGCAGGAAACCCGT 64 32510 32525 525

826721 2832 2847 AGCCCTCGGGAGTCAG 27 32661 32676 526

826722 2835 2850 CCTAGCCCTCGGGAGT 62 32664 32679 527

826741 2896 2911 GCACGGGTATGAGGCT 69 32725 32740 528

826742 2949 2964 TGTAGAGGTATGAAAG 31 32778 32793 529

826761 3012 3027 ATAGGAGTTCTCTGGC 16 32841 32856 530

826780 3101 3116 GAAGGCGGAGTGATCA 65 32930 32945 531

826781 3117 3132 CTACGGGAGCCCAGGA 22 32946 32961 532

826799 3143 3158 AACACTCCAGCAGATG 40 32972 32987 533

826800 3145 3160 GCAACACTCCAGCAGA 19 32974 32989 534

826817 3212 3227 GACCGCAAGGCACTTA 51 33041 33056 535

826818 3213 3228 TGACCGCAAGGCACTT 19 33042 33057 536

826836 3235 3250 TAAACGGGCAAGATTC 41 33064 33079 537

826837 3236 3251 ATAAACGGGCAAGATT 71 33065 33080 538

826856 N/A N/A TTGTCCTAATGAAGAA 95 2680 2695 539

826857 N/A N/A TCCCCTTGGAAGGGAC 66 2713 2728 540

826876 N/A N/A AGGATCTGTGTCTCAG 19 4815 4830 541

826877 N/A N/A GTCCTAGCACCTCCCT 15 4868 4883 542

826896 N/A N/A CCCTAGAACGGCCTCT 27 4920 4935 543

826897 N/A N/A CTTCCCTAGAACGGCC 19 4923 4938 544

826916 N/A N/A ACCCGAGTGAGGCTGC 13 5057 5072 545

826917 N/A N/A GAACCCGAGTGAGGCT 60 5059 5074 546 826936 N/A N/A CCACACAGAGCCCGTG 66 2463 2478 547

826937 N/A N/A AGCCGGGAAGGCCTCC 72 2486 2501 548

826956 N/A N/A CCCAAAAAGGGCTGGA 66 3294 3309 549

826957 N/A N/A GCCAAGTGGTGAGCAA 74 3338 3353 550

826976 N/A N/A GTTGAATCTGGCAGCC 64 4517 4532 551

826977 N/A N/A TGGGACTGGTTCCTTT 109 4536 4551 552

826996 N/A N/A TGGCAAAGAGCACCGA 51 6348 6363 553

826997 N/A N/A CCAGACCCAACATTGG 87 6361 6376 554

827016 N/A N/A GTCCGTAACGCACCTT 36 6807 6822 555

827017 N/A N/A CTTTCTTAGTCCGTAA 41 6815 6830 556

827036 N/A N/A GACTACAAGGTCAAGT 77 7660 7675 557

827056 N/A N/A ATTCACTGCGCTCCCG 44 8755 8770 558

827057 N/A N/A TCGGTAGGAGTCATTC 15 8767 8782 559

827076 N/A N/A ACAGAAGAGCCCATGC 55 9484 9499 560

827077 N/A N/A TCTTACCCCGGTGGCC 53 9507 9522 561

827096 N/A N/A CCCTACGCGCCTCCCT 92 10629 10644 562

827097 N/A N/A CTGCCACCCTACGCGC 53 10635 10650 563

827116 N/A N/A GCCTACCGCATGAAGC 42 11082 11097 564

827117 N/A N/A GGGCATAACACTAGAT 42 11100 11115 565

827136 N/A N/A TGGACAAGGTTTGACA 65 11623 11638 566

827137 N/A N/A GGTTACACCCCCGGCG 60 11650 11665 567

827156 N/A N/A GCTACATTAACCACCG 31 12134 12149 568

827157 N/A N/A TTGAAAGAGCCCCCAC 26 12166 12181 569

827176 N/A N/A CAGGAACTATGGTATT 18 12690 12705 570

827177 N/A N/A GCAATCATAGCTAGCA 116 12729 12744 571

827196 N/A N/A TTTATGAACAGACCTA 19 14134 14149 572

827197 N/A N/A GTAGGCACTTTATGAA 28 14142 14157 573

827215 N/A N/A GCATAGATGGTCAACT 43 14438 14453 574

827216 N/A N/A GGAGAGACAATAGATC 31 14488 14503 575

827235 N/A N/A GGCTTGAGTGCCGCTT 17 15852 15867 576

827236 N/A N/A CCGCAGGCGAGTGTCG 63 15878 15893 577

827255 N/A N/A ACTAATGGGAACTTCC 47 17363 17378 578

827256 N/A N/A CAAGAGATTTGTCCCA 39 17420 17435 579

827275 N/A N/A GAGCAGCAGGAGTTCG 45 18126 18141 580

827276 N/A N/A CCTCAGATCCAGCAGT 50 18147 18162 581

827294 N/A N/A ATACATCCAGAGTCAC 25 18724 18739 582

827295 N/A N/A GATACATCCAGAGTCA 31 18725 18740 583

827313 N/A N/A CTCCGGAAAATAAACG 25 19270 19285 584

827314 N/A N/A GGAGATGGCTCCGGAA 55 19278 19293 585

827333 N/A N/A ACCATGGACTTTCTGT 18 19686 19701 586

827334 N/A N/A AACCATGGACTTTCTG 42 19687 19702 587 827352 N/A N/A CTAACTGGAATAGTTA 89 19872 19887 588

827353 N/A N/A ACTAACTGGAATAGTT 60 19873 19888 589

827372 N/A N/A ATCATAGTATTCAGCC 18 21087 21102 590

827373 N/A N/A AAAAAGGTGGTGTATC 50 21111 21126 591

827391 N/A N/A ATTACAGGGATTCATT 26 21748 21763 592

827392 N/A N/A CGATTACAGGGATTCA 20 21750 21765 593

827409 N/A N/A GGCCAGTAAGAGTGAA 90 22013 22028 594

827410 N/A N/A GAATCAGTATAATGTG 11 22306 22321 595

827428 N/A N/A TGCCCCCATGGAAAGC 54 22781 22796 596

827429 N/A N/A CTGCCCCCATGGAAAG 32 22782 22797 597

827448 N/A N/A CTGCAGTAGGACTGCA 80 23326 23341 598

827467 N/A N/A AAGCAGGGAGCTTCTC 80 24227 24242 599

827468 N/A N/A CGCCATGGAGCAAGCA 95 24238 24253 600

827487 N/A N/A TGCAACACTGAGAGGG 45 26035 26050 601

827488 N/A N/A GGACAATTCCTTGACA 38 26078 26093 602

827507 N/A N/A GACAATCCGCTGCCTT 15 27116 27131 603

827508 N/A N/A AGGTAGGGATGGACGC 15 27147 27162 604

827527 N/A N/A GGGACTTGCTAATGAG 50 28250 28265 605

827528 N/A N/A TGGGACTTGCTAATGA 48 28251 28266 606

827546 N/A N/A GTCCACTAACTGATAA 52 28839 28854 607

827547 N/A N/A GGTGATGTCACTTCGG 12 29031 29046 608

827566 N/A N/A CACATAATACCCAGAG 61 30897 30912 609

827567 N/A N/A GGATAGGGTTGTGTCA 57 30925 30940 610

Table 3: Percent level of human α-ENaC mRNA

SEQ SEQ SEQ SEQ

a-ENaC SEQ

Compound ID: 1 ID: 1 ID: 2 ID 2:

Sequence ID Number Start Stop (% Start Stop

control) NO Site Site Site Site

797494 N/A N/A TTAAATGGTGTGACCA 12 21648 21663 425

797524 N/A N/A ACCATACGGATGAACC 37 28742 28757 455

826074 25 40 GGCGGACTCTGGGCAG 135 4286 4301 611

826075 28 43 GAAGGCGGACTCTGGG 121 4289 4304 612

826076 29 44 AGAAGGCGGACTCTGG 119 4290 4305 613

826077 31 46 TGAGAAGGCGGACTCT 75 4292 4307 614

826078 32 47 CTGAGAAGGCGGACTC 70 4293 4308 615

826079 33 48 CCTGAGAAGGCGGACT 163 4294 4309 616

826081 36 51 GGACCTGAGAAGGCGG 46 4297 4312 617

826094 73 88 AAGGAGGGCTCCCGAG 111 4334 4349 618

826095 74 89 GAAGGAGGGCTCCCGA 196 4335 4350 619

826096 81 96 TCCGAAGGAAGGAGGG 197 4342 4357 620 826097 83 98 TTTCCGAAGGAAGGAG 89 4344 4359 621

826098 85 100 GTTTTCCGAAGGAAGG 125 4346 4361 622

826099 88 103 GGAGTTTTCCGAAGGA 149 4349 4364 623

826100 91 106 CCGGGAGTTTTCCGAA 59 4352 4367 624

826101 92 107 GCCGGGAGTTTTCCGA 98 4353 4368 625

826114 167 182 GGAAGCGACAGGAATC 162 4428 4443 626

826115 169 184 ATGGAAGCGACAGGAA 118 4430 4445 627

826116 170 185 GATGGAAGCGACAGGA 145 4431 4446 628

826117 171 186 GGATGGAAGCGACAGG 143 4432 4447 629

826118 172 187 GGGATGGAAGCGACAG 82 4433 4448 630

826119 175 190 CCAGGGATGGAAGCGA 95 4436 4451 631

826120 176 191 GCCAGGGATGGAAGCG 54 4437 4452 632

826121 180 195 GCCGGCCAGGGATGGA 74 4441 4456 633

826134 226 241 GTTCCCCTGACAGGTG 74 N/A N/A 634

826135 228 243 TTGTTCCCCTGACAGG 68 N/A N/A 635

826136 229 244 CTTGTTCCCCTGACAG 102 N/A N/A 636

826137 230 245 GCTTGTTCCCCTGACA 15 N/A N/A 637

826138 232 247 CAGCTTGTTCCCCTGA 30 N/A N/A 638

826139 233 248 CCAGCTTGTTCCCCTG 77 N/A N/A 639

826140 249 264 CTAGGGTCCTGCTCCT 55 5177 5192 640

826141 254 269 GAGGTCTAGGGTCCTG 44 5182 5197 641

826154 292 307 CAGCTTGTTCCCCTCC 33 5220 5235 642

826155 310 325 GCTAGAGTCCTGCTCC 82 5238 5253 643

826156 312 327 GGGCTAGAGTCCTGCT 134 5240 5255 644

826157 315 330 GGAGGGCTAGAGTCCT 91 5243 5258 645

826158 320 335 ACTGTGGAGGGCTAGA 50 5248 5263 646

826159 321 336 GACTGTGGAGGGCTAG 59 5249 5264 647

826160 322 337 GGACTGTGGAGGGCTA 34 5250 5265 648

826161 331 346 CCCTGGAGTGGACTGT 50 5259 5274 649

826174 360 375 TGCTCCTCACGCTTGT 27 5288 5303 650

826175 362 377 CCTGCTCCTCACGCTT 33 5290 5305 651

826176 363 378 CCCTGCTCCTCACGCT 51 5291 5306 652

826177 386 401 GCGCCGCAGGTTCGGG 51 5314 5329 653

826178 405 420 TCCGCCGTGGGCTGCT 52 5333 5348 654

826179 407 422 CCTCCGCCGTGGGCTG 50 5335 5350 655

826180 411 426 TCCTCCTCCGCCGTGG 31 5339 5354 656

826181 422 437 CGATCAGGGCCTCCTC 33 5350 5365 657

826194 446 461 GCTCTCGGTAGGAGCG 44 5374 5389 658

826195 448 463 GAGCTCTCGGTAGGAG 94 5376 5391 659

826196 451 466 GAAGAGCTCTCGGTAG 114 5379 5394 660

826197 453 468 TCGAAGAGCTCTCGGT 41 5381 5396 661 826198 456 471 AACTCGAAGAGCTCTC 30 5384 5399 662

826199 457 472 GAACTCGAAGAGCTCT 95 5385 5400 663

826200 466 481 GTTGCAGAAGAACTCG 27 5394 5409 664

826201 467 482 TGTTGCAGAAGAACTC 44 5395 5410 665

826213 575 590 GCCAGTACATCATGCC 34 5503 5518 666

826214 577 592 TTGCCAGTACATCATG 58 5505 5520 667

826215 580 595 GAATTGCCAGTACATC 46 5508 5523 668

826216 581 596 CGAATTGCCAGTACAT 27 5509 5524 669

826217 582 597 CCGAATTGCCAGTACA 26 5510 5525 670

826218 585 600 AGGCCGAATTGCCAGT 102 5513 5528 671

826219 587 602 GCAGGCCGAATTGCCA 34 5515 5530 672

826220 589 604 AAGCAGGCCGAATTGC 51 5517 5532 673

826233 626 641 TGTTGAGGCTGACGGG 14 5554 5569 674

826234 628 643 GATGTTGAGGCTGACG 28 5556 5571 675

826235 639 654 GAGTTGAGGTTGATGT 64 5567 5582 676

826236 641 656 CCGAGTTGAGGTTGAT 32 5569 5584 677

826237 643 658 GTCCGAGTTGAGGTTG 28 5571 5586 678

826238 644 659 TGTCCGAGTTGAGGTT 65 5572 5587 679

826239 645 660 TTGTCCGAGTTGAGGT 40 5573 5588 680

826240 647 662 GCTTGTCCGAGTTGAG 19 5575 5590 681

826253 731 746 TGCGGTCCAGCTCCTC 42 16316 16331 682

826254 734 749 TGATGCGGTCCAGCTC 88 16319 16334 683

826255 737 752 CTGTGATGCGGTCCAG 38 16322 16337 684

826256 739 754 CTCTGTGATGCGGTCC 20 16324 16339 685

826257 740 755 GCTCTGTGATGCGGTC 43 16325 16340 686

826258 759 774 TACAGGTCAAAGAGCG 52 16344 16359 687

826259 761 776 TGTACAGGTCAAAGAG 18 16346 16361 688

826260 762 777 TTGTACAGGTCAAAGA 41 16347 16362 689

826271 798 813 CGGGAGCCGGCCACGA 55 16383 16398 690

826272 800 815 TGCGGGAGCCGGCCAC 23 16385 16400 691

826273 803 818 GGCTGCGGGAGCCGGC 147 16388 16403 692

826274 804 819 CGGCTGCGGGAGCCGG 70 16389 16404 693

826275 805 820 ACGGCTGCGGGAGCCG 104 16390 16405 694

826276 807 822 CGACGGCTGCGGGAGC 101 16392 16407 695

826277 808 823 GCGACGGCTGCGGGAG 52 16393 16408 696

826278 810 825 TCGCGACGGCTGCGGG 52 16395 16410 697

826291 834 849 GGGTGCGGCAGAGTCC 46 16419 16434 698

826292 858 873 GGCGGGACCCTCAGGC 37 16443 16458 699

826293 877 892 ACGGGCCCCGTGAGGC 85 16462 16477 700

826294 879 894 CGACGGGCCCCGTGAG 49 16464 16479 701

826295 882 897 GCTCGACGGGCCCCGT 27 16467 16482 702 826296 883 898 GGCTCGACGGGCCCCG 64 16468 16483 703

826297 889 904 GCTACGGGCTCGACGG 33 16474 16489 704

826298 891 906 ACGCTACGGGCTCGAC 35 16476 16491 705

826311 952 967 GAAGCCGATCTTCCAG 43 16537 16552 706

826312 953 968 GGAAGCCGATCTTCCA 64 16538 16553 707

826313 954 969 TGGAAGCCGATCTTCC 161 16539 16554 708

826314 956 971 GCTGGAAGCCGATCTT 80 16541 16556 709

826315 958 973 CAGCTGGAAGCCGATC 41 16543 16558 710

826316 968 983 TCTGGTTGCACAGCTG 38 N/A N/A 711

826317 969 984 TTCTGGTTGCACAGCT 53 N/A N/A 712

826318 970 985 GTTCTGGTTGCACAGC 19 N/A N/A 713

826329 983 998 AGCAGTCCGATTTGTT 45 17769 17784 714

826330 985 1000 GAAGCAGTCCGATTTG 72 17771 17786 715

826331 986 1001 AGAAGCAGTCCGATTT 92 17772 17787 716

826332 987 1002 TAGAAGCAGTCCGATT 124 17773 17788 717

826333 988 1003 GTAGAAGCAGTCCGAT 50 17774 17789 718

826334 989 1004 GGTAGAAGCAGTCCGA 18 17775 17790 719

826335 994 1009 TGTCTGGTAGAAGCAG 25 17780 17795 720

826336 995 1010 ATGTCTGGTAGAAGCA 35 17781 17796 721

826349 1022 1037 CCCTCACCGCATCCAC 32 17808 17823 722

826350 1025 1040 ACTCCCTCACCGCATC 68 17811 17826 723

826351 1026 1041 CACTCCCTCACCGCAT 128 17812 17827 724

826352 1028 1043 ACCACTCCCTCACCGC 33 17814 17829 725

826353 1032 1047 CGGTACCACTCCCTCA 49 17818 17833 726

826354 1033 1048 GCGGTACCACTCCCTC 69 17819 17834 727

826355 1034 1049 AGCGGTACCACTCCCT 24 17820 17835 728

826356 1045 1060 GATGTAGTGGAAGCGG 36 17831 17846 729

826369 1123 1138 GCGGCAGGCGAAGATG 49 17909 17924 730

826370 1126 1141 GAAGCGGCAGGCGAAG 55 17912 17927 731

826371 1129 1144 GTTGAAGCGGCAGGCG 97 17915 17930 732

826372 1130 1145 GGTTGAAGCGGCAGGC 30 17916 17931 733

826373 1134 1149 ACCTGGTTGAAGCGGC 20 17920 17935 734

826374 1136 1151 AGACCTGGTTGAAGCG 44 17922 17937 735

826375 1138 1153 GGAGACCTGGTTGAAG 68 17924 17939 736

826376 1146 1161 TGGTTGCAGGAGACCT 143 17932 17947 737

826389 1232 1247 AAGACATCCAGAGGTT 80 24188 24203 738

826390 1250 1265 TGTTGATTCCAGGCAT 53 24206 24221 739

826391 1251 1266 TTGTTGATTCCAGGCA 43 24207 24222 740

826392 1252 1267 GTTGTTGATTCCAGGC 31 24208 24223 741

826393 1254 1269 CCGTTGTTGATTCCAG 15 24210 24225 742

826394 1255 1270 ACCGTTGTTGATTCCA 15 24211 24226 743 826395 1257 1272 AGACCGTTGTTGATTC 30 N/A N/A 744

826396 1259 1274 ACAGACCGTTGTTGAT 33 N/A N/A 745

826409 1285 1300 ATTCTGCTCTGCGCGC 39 24582 24597 746

826410 1286 1301 CATTCTGCTCTGCGCG 36 24583 24598 747

826411 1287 1302 TCATTCTGCTCTGCGC 80 24584 24599 748

826412 1323 1338 CGGGCCCCAGTCACTG 118 24620 24635 749

826413 1325 1340 CCCGGGCCCCAGTCAC 82 24622 24637 750

826414 1327 1342 TACCCGGGCCCCAGTC 31 24624 24639 751

826415 1329 1344 ATTACCCGGGCCCCAG 56 24626 24641 752

826416 1331 1346 CCATTACCCGGGCCCC 37 24628 24643 753

826429 1366 1381 ATCATCCATAAAGGCA 75 24663 24678 754

826430 1379 1394 AGTTAAAGCCACCATC 57 24676 24691 755

826431 1383 1398 CGCAAGTTAAAGCCAC 70 24680 24695 756

826432 1385 1400 GCCGCAAGTTAAAGCC 33 24682 24697 757

826433 1387 1402 AGGCCGCAAGTTAAAG 32 24684 24699 758

826434 1388 1403 CAGGCCGCAAGTTAAA 47 24685 24700 759

826435 1389 1404 CCAGGCCGCAAGTTAA 40 24686 24701 760

826436 1390 1405 GCCAGGCCGCAAGTTA 40 24687 24702 761

826449 1446 1461 TAATCGCCCCCAAGTC 35 25166 25181 762

826450 1447 1462 ATAATCGCCCCCAAGT 56 25167 25182 763

826451 1448 1463 CATAATCGCCCCCAAG 53 25168 25183 764

826452 1450 1465 GCCATAATCGCCCCCA 23 25170 25185 765

826453 1451 1466 CGCCATAATCGCCCCC 22 25171 25186 766

826454 1453 1468 GTCGCCATAATCGCCC 43 25173 25188 767

826455 1457 1472 TGCAGTCGCCATAATC 36 25177 25192 768

826456 1458 1473 GTGCAGTCGCCATAAT 38 25178 25193 769

826469 1528 1543 GTGAATACACACCTGC 98 N/A N/A 770

826470 1530 1545 GAGTGAATACACACCT 47 25444 25459 771

826471 1531 1546 GGAGTGAATACACACC 128 25445 25460 772

826472 1534 1549 GCAGGAGTGAATACAC 106 25448 25463 773

826473 1553 1568 TGATCATGCTCTCCTG 25 25467 25482 774

826474 1554 1569 TTGATCATGCTCTCCT 31 25468 25483 775

826475 1556 1571 CCTTGATCATGCTCTC 28 25470 25485 776

826476 1557 1572 TCCTTGATCATGCTCT 23 25471 25486 777

826488 1583 1598 GATAGAAGATGTAGGC 38 25497 25512 778

826489 1584 1599 GGATAGAAGATGTAGG 36 25498 25513 779

826490 1585 1600 CGGATAGAAGATGTAG 101 25499 25514 780

826491 1587 1602 CGCGGATAGAAGATGT 33 25501 25516 781

826492 1588 1603 CCGCGGATAGAAGATG 69 25502 25517 782

826493 1589 1604 GCCGCGGATAGAAGAT 64 25503 25518 783

826494 1591 1606 GGGCCGCGGATAGAAG 48 25505 25520 784 826495 1612 1627 GTCACAGTACTCCACG 27 25526 25541 785

826508 1669 1684 GGAGAAGTCAACCTGG 21 30615 30630 786

826509 1675 1690 GTCTGAGGAGAAGTCA 43 30621 30636 787

826510 1696 1711 CTTGGTGAAACAGCCC 159 30642 30657 788

826511 1702 1717 CCGGCACTTGGTGAAA 123 30648 30663 789

826512 1708 1723 TGGCTTCCGGCACTTG 36 30654 30669 790

826513 1709 1724 ATGGCTTCCGGCACTT 26 30655 30670 791

826514 1711 1726 GCATGGCTTCCGGCAC 15 30657 30672 792

826515 1716 1731 ACGCTGCATGGCTTCC 44 N/A N/A 793

826555 1876 1891 TTTGTAGTTCAGCTCC 67 31232 31247 794

826568 2001 2016 AGGTCAAAGACGAGCT 76 31830 31845 795

826569 2002 2017 CAGGTCAAAGACGAGC 28 31831 31846 796

826570 2003 2018 GCAGGTCAAAGACGAG 103 31832 31847 797

826571 2009 2024 TGACCAGCAGGTCAAA 148 31838 31853 798

826572 2011 2026 GATGACCAGCAGGTCA 170 31840 31855 799

826573 2032 2047 TCGGAGCAGCATGAGG 61 31861 31876 800

826574 2034 2049 CTTCGGAGCAGCATGA 52 31863 31878 801

826575 2035 2050 CCTTCGGAGCAGCATG 44 31864 31879 802

826587 2049 2064 TATCGGCTTCGGAACC 28 31878 31893 803

826588 2050 2065 GTATCGGCTTCGGAAC 50 31879 31894 804

826589 2051 2066 AGTATCGGCTTCGGAA 28 31880 31895 805

826590 2053 2068 CCAGTATCGGCTTCGG 37 31882 31897 806

826591 2054 2069 ACCAGTATCGGCTTCG 23 31883 31898 807

826592 2055 2070 GACCAGTATCGGCTTC 32 31884 31899 808

826593 2056 2071 AGACCAGTATCGGCTT 20 31885 31900 809

826594 2058 2073 GGAGACCAGTATCGGC 25 31887 31902 810

826607 2282 2297 AGGGCCCCCCCAGAGG 90 32111 32126 811

826608 2284 2299 TCAGGGCCCCCCCAGA 55 32113 32128 812

826609 2308 2323 GTGTGAGAAACCTCTC 64 32137 32152 813

826610 2310 2325 TGGTGTGAGAAACCTC 81 32139 32154 814

826611 2313 2328 CCTTGGTGTGAGAAAC 93 32142 32157 815

826612 2314 2329 GCCTTGGTGTGAGAAA 52 32143 32158 816

826613 2315 2330 TGCCTTGGTGTGAGAA 31 32144 32159 817

826614 2316 2331 CTGCCTTGGTGTGAGA 30 32145 32160 818

826627 2399 2414 ACGGCAGTTTGGGCGG 34 32228 32243 819

826628 2400 2415 AACGGCAGTTTGGGCG 93 32229 32244 820

826629 2401 2416 CAACGGCAGTTTGGGC 87 32230 32245 821

826630 2403 2418 ATCAACGGCAGTTTGG 60 32232 32247 822

826631 2405 2420 ACATCAACGGCAGTTT 25 32234 32249 823

826632 2407 2422 ACACATCAACGGCAGT 19 32236 32251 824

826633 2408 2423 CACACATCAACGGCAG 38 32237 32252 825 826634 2410 2425 TCCACACATCAACGGC 49 32239 32254 826

826647 2491 2506 GGAGCCAAGGCACTTC 30 32320 32335 827

826648 2492 2507 TGGAGCCAAGGCACTT 31 32321 32336 828

826649 2502 2517 GGTACAGGGCTGGAGC 117 32331 32346 829

826650 2520 2535 TCAGAGGCAGTACCAA 48 32349 32364 830

826651 2523 2538 TGTTCAGAGGCAGTAC 38 32352 32367 831

826652 2533 2548 GAAACCAGAGTGTTCA 52 32362 32377 832

826653 2551 2566 TAGCCGCAGTTGGGTG 49 32380 32395 833

826654 2552 2567 TTAGCCGCAGTTGGGT 28 32381 32396 834

826665 2579 2594 CTTGGCTGATCCAAGG 33 32408 32423 835

826666 2580 2595 GCTTGGCTGATCCAAG 69 32409 32424 836

826667 2581 2596 CGCTTGGCTGATCCAA 66 32410 32425 837

826668 2582 2597 TCGCTTGGCTGATCCA 10 32411 32426 838

826669 2583 2598 TTCGCTTGGCTGATCC 33 32412 32427 839

826670 2584 2599 TTTCGCTTGGCTGATC 43 32413 32428 840

826671 2585 2600 GTTTCGCTTGGCTGAT 24 32414 32429 841

826672 2586 2601 AGTTTCGCTTGGCTGA 39 32415 32430 842

826685 2623 2638 CAGCGGTTTCTTAGGA 27 32452 32467 843

826686 2625 2640 ATCAGCGGTTTCTTAG 45 32454 32469 844

826687 2627 2642 TTATCAGCGGTTTCTT 18 32456 32471 845

826688 2629 2644 GGTTATCAGCGGTTTC 33 32458 32473 846

826689 2632 2647 CCTGGTTATCAGCGGT 29 32461 32476 847

826690 2634 2649 GTCCTGGTTATCAGCG 19 32463 32478 848

826691 2636 2651 TTGTCCTGGTTATCAG 36 32465 32480 849

826692 2652 2667 TACCCTTGGTTGTGTT 39 32481 32496 850

826705 2692 2707 TAAGCCGTCGCTGGGC 51 32521 32536 851

826706 2693 2708 TTAAGCCGTCGCTGGG 63 32522 32537 852

826707 2696 2711 GGCTTAAGCCGTCGCT 58 32525 32540 853

826708 2698 2713 CTGGCTTAAGCCGTCG 31 32527 32542 854

826709 2700 2715 GGCTGGCTTAAGCCGT 131 32529 32544 855

826710 2701 2716 GGGCTGGCTTAAGCCG 92 32530 32545 856

826711 2734 2749 GCTACTGGAGAGCAGT 20 32563 32578 857

826712 2735 2750 TGCTACTGGAGAGCAG 53 32564 32579 858

826725 2846 2861 TCTGCTCTAGCCCTAG 53 32675 32690 859

826726 2847 2862 GTCTGCTCTAGCCCTA 32 32676 32691 860

826727 2850 2865 CGGGTCTGCTCTAGCC 107 32679 32694 861

826728 2852 2867 CCCGGGTCTGCTCTAG 66 32681 32696 862

826729 2854 2869 TACCCGGGTCTGCTCT 92 32683 32698 863

826730 2855 2870 TTACCCGGGTCTGCTC 52 32684 32699 864

826731 2856 2871 CTTACCCGGGTCTGCT 51 32685 32700 865

826732 2858 2873 TACTTACCCGGGTCTG 38 32687 32702 866 826745 2954 2969 AGACATGTAGAGGTAT 16 32783 32798 867

826746 2955 2970 CAGACATGTAGAGGTA 8 32784 32799 868

826747 2959 2974 CAAGCAGACATGTAGA 32 32788 32803 869

826748 2960 2975 TCAAGCAGACATGTAG 25 32789 32804 870

826749 2961 2976 CTCAAGCAGACATGTA 22 32790 32805 871

826750 2963 2978 ATCTCAAGCAGACATG 50 32792 32807 872

826751 2964 2979 TATCTCAAGCAGACAT 26 32793 32808 873

826752 2965 2980 ATATCTCAAGCAGACA 27 32794 32809 874

826764 3016 3031 ATGCATAGGAGTTCTC 17 32845 32860 875

826765 3017 3032 GATGCATAGGAGTTCT 23 32846 32861 876

826766 3019 3034 GGGATGCATAGGAGTT 42 32848 32863 877

826767 3021 3036 AAGGGATGCATAGGAG 61 32850 32865 878

826768 3022 3037 TAAGGGATGCATAGGA 41 32851 32866 879

826769 3023 3038 CTAAGGGATGCATAGG 37 32852 32867 880

826770 3024 3039 TCTAAGGGATGCATAG 34 32853 32868 881

826771 3026 3041 GTTCTAAGGGATGCAT 25 32855 32870 882

826784 3121 3136 TGTGCTACGGGAGCCC 17 32950 32965 883

826785 3122 3137 GTGTGCTACGGGAGCC 10 32951 32966 884

826786 3123 3138 AGTGTGCTACGGGAGC 59 32952 32967 885

826787 3124 3139 TAGTGTGCTACGGGAG 12 32953 32968 886

826788 3125 3140 ATAGTGTGCTACGGGA 44 32954 32969 887

826789 3126 3141 TATAGTGTGCTACGGG 46 32955 32970 888

826790 3128 3143 GTTATAGTGTGCTACG 23 32957 32972 889

826803 3153 3168 GTGCAACAGCAACACT 67 32982 32997 890

826804 3154 3169 GGTGCAACAGCAACAC 37 32983 32998 891

826805 3155 3170 TGGTGCAACAGCAACA 64 32984 32999 892

826806 3156 3171 ATGGTGCAACAGCAAC 10 32985 33000 893

826807 3157 3172 TATGGTGCAACAGCAA 20 32986 33001 894

826808 3158 3173 GTATGGTGCAACAGCA 20 32987 33002 895

826809 3159 3174 AGTATGGTGCAACAGC 4 32988 33003 896

826821 3216 3231 CCCTGACCGCAAGGCA 16 33045 33060 897

826822 3217 3232 TCCCTGACCGCAAGGC 51 33046 33061 898

826823 3218 3233 GTCCCTGACCGCAAGG 35 33047 33062 899

826824 3219 3234 AGTCCCTGACCGCAAG 34 33048 33063 900

826825 3220 3235 CAGTCCCTGACCGCAA 33 33049 33064 901

826826 3222 3237 TTCAGTCCCTGACCGC 23 33051 33066 902

826827 3223 3238 ATTCAGTCCCTGACCG 69 33052 33067 903

826828 3225 3240 AGATTCAGTCCCTGAC 14 33054 33069 904

826840 3239 3254 TACATAAACGGGCAAG 50 33068 33083 905

826841 3242 3257 GCATACATAAACGGGC 61 33071 33086 906

826842 3244 3259 GAGCATACATAAACGG 59 33073 33088 907 826843 3249 3264 ACATGGAGCATACATA 94 33078 33093 908

826844 3250 3265 GACATGGAGCATACAT 42 33079 33094 909

826845 3251 3266 AGACATGGAGCATACA 81 33080 33095 910

826846 3253 3268 CTAGACATGGAGCATA 69 33082 33097 911

826847 3254 3269 GCTAGACATGGAGCAT 47 33083 33098 912

826860 N/A N/A TGATACCTCCCCTTGG 78 2720 2735 913

826861 N/A N/A ATGATACCTCCCCTTG 84 2721 2736 914

826862 N/A N/A GCTCATGATACCTCCC 176 2725 2740 915

826863 N/A N/A ACTGCTCATGATACCT 95 2728 2743 916

826864 N/A N/A ATACTGCTCATGATAC 59 2730 2745 917

826865 N/A N/A GATACTGCTCATGATA 87 2731 2746 918

826866 N/A N/A CTTGATACTGCTCATG 96 2734 2749 919

826867 N/A N/A CCTTGATACTGCTCAT 79 2735 2750 920

826880 N/A N/A CGAGTTTTGTCCTAGC 7 4876 4891 921

826881 N/A N/A TCGAGTTTTGTCCTAG 30 4877 4892 922

826882 N/A N/A CTTTCGAGTTTTGTCC 86 4880 4895 923

826883 N/A N/A CACCTTTCGAGTTTTG 30 4883 4898 924

826884 N/A N/A GCCACCTTTCGAGTTT 50 4885 4900 925

826885 N/A N/A GGGCCACCTTTCGAGT 21 4887 4902 926

826886 N/A N/A TAGGGCCACCTTTCGA 20 4889 4904 927

826887 N/A N/A ATAGGGCCACCTTTCG 27 4890 4905 928

826900 N/A N/A GCCGGAGCTGGGCTTC 55 4935 4950 929

826901 N/A N/A TGCCGGAGCTGGGCTT 82 4936 4951 930

826902 N/A N/A GTGCCGGAGCTGGGCT 179 4937 4952 931

826903 N/A N/A AAGTGCCGGAGCTGGG 31 4939 4954 932

826904 N/A N/A AAAAGTGCCGGAGCTG 44 4941 4956 933

826905 N/A N/A CCAAAAGTGCCGGAGC 34 4943 4958 934

826906 N/A N/A GCCAAAAGTGCCGGAG 19 4944 4959 935

826907 N/A N/A GGCCAAAAGTGCCGGA 38 4945 4960 936

826920 N/A N/A CCCCTGGAACCCGAGT 31 5065 5080 937

826921 N/A N/A CACCCCTGGAACCCGA 38 5067 5082 938

826922 N/A N/A CCCGGAGTGGATTGGG 185 5138 5153 939

826923 N/A N/A GCCCCGGAGTGGATTG 76 5140 5155 940

826924 N/A N/A GAGCCCCGGAGTGGAT 64 5142 5157 941

826925 N/A N/A ATGAGCCCCGGAGTGG 28 5144 5159 942

826926 N/A N/A TTCATGAGCCCCGGAG 42 5147 5162 943

826927 N/A N/A CCTTCATGAGCCCCGG 29 5149 5164 944

826940 N/A N/A TGCTTACCTTGATACT 152 2741 2756 945

826941 N/A N/A CCAAACCAGGTTCCCT 104 2757 2772 946

826942 N/A N/A AGCCGGTGTCAACCAG 187 2777 2792 947

826943 N/A N/A AAAGTGAAAGCCGGTG 138 2785 2800 948 826944 N/A N/A TGCGACTTCTTAAAGT 97 2796 2811 949

826945 N/A N/A GCTCAGGGTCCAACCT 79 2844 2859 950

826946 N/A N/A AGCAAGGAGTTTAGCA 95 2889 2904 951

826947 N/A N/A CATAAGAGCCAAGGGC 142 2983 2998 952

826960 N/A N/A CGTTGATGGGCTATAT 168 3408 3423 953

826961 N/A N/A CGCCTAGACAGGCCCT 61 3440 3455 954

826962 N/A N/A ACGCAGGACACTGTGG 90 3555 3570 955

826963 N/A N/A AGGCAGCGCGAGGGCC 109 3571 3586 956

826964 N/A N/A GTGTAATCGCCCCTGC 84 3622 3637 957

826965 N/A N/A GGCCCTAGGACATTCT 73 3674 3689 958

826966 N/A N/A GTCCAGACCCGGGAGG 66 3718 3733 959

826967 N/A N/A GGGAGCAGCGCACTCA 106 3804 3819 960

826980 N/A N/A GGGACTAACCGACCTG 146 5631 5646 961

826981 N/A N/A TTCCAGGCGCAGGCAC 76 5662 5677 962

826982 N/A N/A CAGTAAGCTGGAGGCT 181 5785 5800 963

826983 N/A N/A CGCCAGTCCAGTAAGC 137 5793 5808 964

826984 N/A N/A GCTAGGATGGCTCCAC 59 5819 5834 965

826985 N/A N/A CCACACTCTGGGTGAG 42 5843 5858 966

826986 N/A N/A GGGCAATGCTGCTCCA 76 5863 5878 967

826987 N/A N/A TCCCACTTGCAGGAGG 91 5919 5934 968

827000 N/A N/A TCCCAAGGTGTGGCAT 44 6462 6477 969

827001 N/A N/A TTGAAGCAGGTGTTCC 60 6475 6490 970

827002 N/A N/A TGCCAGGTGCCTAGCC 55 6502 6517 971

827003 N/A N/A CAATAAAGGGCTTATG 94 6538 6553 972

827004 N/A N/A AACTACCTGGCCTTCA 63 6552 6567 973

827005 N/A N/A GGCTTATATGCCTGTC 77 6605 6620 974

827006 N/A N/A TGCCACAGTTACTGGC 80 6618 6633 975

827007 N/A N/A ACTTATCCCAGTGTGC 30 6631 6646 976

827020 N/A N/A AGGAAATGGTCCCTAC 70 6912 6927 977

827021 N/A N/A GTGCACACGGCAGCTT 77 6932 6947 978

827022 N/A N/A CCCAAGACACCTTCGC 55 6955 6970 979

827023 N/A N/A TAGCACCGGGCTTGTA 62 6994 7009 980

827024 N/A N/A AACAGGATGAGTCACA 26 7088 7103 981

827025 N/A N/A AGTTTTGGGATTAGGC 51 7107 7122 982

827026 N/A N/A GGCGGAAGCCACATCT 61 7178 7193 983

827027 N/A N/A TGAAATGAGGCGGAAG 117 7186 7201 984

827040 N/A N/A GGGAATAATACTGCCC 115 7751 7766 985

827041 N/A N/A AATGTATGTTCCCTTG 34 7816 7831 986

827042 N/A N/A GTAAAAAGTCTGGCCC 34 8222 8237 987

827043 N/A N/A TCCAAGGTGTGTTGTG 35 8283 8298 988

827044 N/A N/A CATGAGACCTACTTCC 30 8296 8311 989 827045 N/A N/A ATAAGAGTCATCATGA 54 8307 8322 990

827046 N/A N/A GGTGAGGGTGGACGGT 86 8444 8459 991

827047 N/A N/A GGCTTTCCATTGGAGC 64 8483 8498 992

827060 N/A N/A CCTCAGCAGGTAGGCA 45 8836 8851 993

827061 N/A N/A TCGGACTCAGCACTTC 75 8961 8976 994

827062 N/A N/A CTGCAGTGGCCAACCC 98 8983 8998 995

827063 N/A N/A CTGTAGGTATGACTGG 31 9047 9062 996

827064 N/A N/A TTCCATGACTGTAGGT 24 9055 9070 997

827065 N/A N/A GCCTAAACCGTTCCTG 53 9105 9120 998

827066 N/A N/A TTCAAGAACCCCAAGT 50 9132 9147 999

827067 N/A N/A AGAAGCTACCATGACC 66 9158 9173 1000

827080 N/A N/A GGCCTATCAACTAGGC 154 9783 9798 1001

827081 N/A N/A CACAATTCCATCGGGC 22 9837 9852 1002

827082 N/A N/A CCCTACATTGGAGGGT 188 9866 9881 1003

827083 N/A N/A AGGGATAAAGAATGCC 57 9978 9993 1004

827084 N/A N/A GACCAGCGGCTGGAGG 46 9996 10011 1005

827085 N/A N/A AGACATCCGATCTTGT 42 10020 10035 1006

827086 N/A N/A TGACACCTAGAGCTAA 60 10068 10083 1007

827087 N/A N/A GGCAGAGCCTTTGAGT 58 10084 10099 1008

10649 10664

827100 N/A N/A TACGCACCTCCCTCCT 41 1009

10672 10687

10650 10665

827101 N/A N/A CTACGCACCTCCCTCC 128 1010

10673 10688

10652 10667

827102 N/A N/A CCCTACGCACCTCCCT 88 1011

10675 10690

10653 10668

827103 N/A N/A ACCCTACGCACCTCCC 34 1012

10676 10691

10655 10670

827104 N/A N/A CCACCCTACGCACCTC 36 1013

10678 10693

10656 10671

827105 N/A N/A GCCACCCTACGCACCT 40 1014

10679 10694

10658 10673

827106 N/A N/A CTGCCACCCTACGCAC 47 1015

10681 10696

10659 10674

827107 N/A N/A CCTGCCACCCTACGCA 40 1016

10682 10697

827120 N/A N/A CCACATGGTGCCCCAG 61 11248 11263 1017

827121 N/A N/A TTTTAGGAGGGCCACA 126 11259 11274 1018

827122 N/A N/A GCCCTCTGGTCCGTCC 87 11291 11306 1019

827123 N/A N/A GGTCAGACAGCACTCC 33 11319 11334 1020

827124 N/A N/A AGCTAGCAAATGGGTC 82 11331 11346 1021

827125 N/A N/A TTCCAGTTGGCACAGC 42 11344 11359 1022 827126 N/A N/A CACAATTGTCATTCCC 22 11395 11410 1023

827127 N/A N/A TGTTAGCTAACACAAT 48 11405 11420 1024

827140 N/A N/A CCCACAGAAAACGGAA 40 11690 11705 1025

827141 N/A N/A GGCTGCTGCATGATTC 24 11738 11753 1026

827142 N/A N/A ACCAGAATAGATTCAC 108 11766 11781 1027

827143 N/A N/A TCGAATCGAGTGCCCC 35 11791 11806 1028

827144 N/A N/A AACAATGAACCTCGAA 98 11802 11817 1029

827145 N/A N/A TGGTATTAGAATGTAC 29 11881 11896 1030

827146 N/A N/A GTGGTATTAGAATGTA 41 11882 11897 1031

827147 N/A N/A TGTGGTATTAGAATGT 23 11883 11898 1032

827160 N/A N/A GTGCAGGGTCTTACTT 55 12230 12245 1033

827161 N/A N/A AAATACCAGTGCAGGG 73 12238 12253 1034

827162 N/A N/A GTACATCAATTATGCC 47 12268 12283 1035

827163 N/A N/A GGGCACTCAAGATTTG 52 12295 12310 1036

827164 N/A N/A CAAACCTGAGTGGGCA 43 12306 12321 1037

827165 N/A N/A CTCGACTGTCAAACCT 50 12315 12330 1038

827166 N/A N/A GTTCAACATCTCGACT 44 12324 12339 1039

827167 N/A N/A GTAATGGGAGTGTTCA 18 12335 12350 1040

827180 N/A N/A GTTGAAGGTGTGTGTT 35 13095 13110 1041

827181 N/A N/A AGCAACTCAAAGGTGT 38 13111 13126 1042

827182 N/A N/A AGATTTGTACATGAGG 78 13481 13496 1043

827183 N/A N/A ACCCGAAACACATTAG 66 13504 13519 1044

827184 N/A N/A GTTTAGGCCGCACCCG 27 13515 13530 1045

827185 N/A N/A ATTTACGGTGTTTAGG 61 13524 13539 1046

827186 N/A N/A GGGATTTACAGTGAGC 40 13548 13563 1047

827187 N/A N/A AAAGCATATGCCCCCA 26 13678 13693 1048

827200 N/A N/A AACCGTATGTAGTAGG 27 14153 14168 1049

827201 N/A N/A CAACCGTATGTAGTAG 53 14154 14169 1050

827202 N/A N/A ACAACCGTATGTAGTA 39 14155 14170 1051

827203 N/A N/A AACAACCGTATGTAGT 50 14156 14171 1052

827204 N/A N/A GAACAACCGTATGTAG 53 14157 14172 1053

827205 N/A N/A AGAACAACCGTATGTA 43 14158 14173 1054

827206 N/A N/A TAGAACAACCGTATGT 46 14159 14174 1055

827219 N/A N/A TGACATACTGCTTCTA 54 14642 14657 1056

827220 N/A N/A CCCCAGCAGGTATTTT 156 14667 14682 1057

827221 N/A N/A CCCAAGCAATCACCAG 120 14737 14752 1058

827222 N/A N/A GACCAAAAGTGTGCCA 45 14831 14846 1059

827223 N/A N/A GACACAATCGCCGCTC 114 14905 14920 1060

827224 N/A N/A GAATAAGTGGAGATAT 55 15017 15032 1061

827225 N/A N/A TGCATTTCCGTCTCAA 21 15204 15219 1062

827226 N/A N/A GGGTATCGAGACCACC 116 15441 15456 1063 827239 N/A N/A CCGGACCTAGAAGGGA 117 15987 16002 1064

827240 N/A N/A GGCCACGGCGAGCCCA 153 16080 16095 1065

827241 N/A N/A GTAAACAGGTGTGTCC 63 16110 16125 1066

827242 N/A N/A CTGGAGCGAGTGTCTG 165 16238 16253 1067

827243 N/A N/A GCGGAGCCCATGGGTG 73 16616 16631 1068

827244 N/A N/A TGTCACTGGGCTGCGC 60 16650 16665 1069

827245 N/A N/A CCGCGAGCCCACGAGG 54 16676 16691 1070

827246 N/A N/A CACCAAGAGGTGTTAT 54 16738 16753 1071

827259 N/A N/A ATTTATACCTCCCCTG 101 17495 17510 1072

827260 N/A N/A CACACACGGTTTTGGT 18 17513 17528 1073

827261 N/A N/A GACCAGTAGCTGCACA 72 17527 17542 1074

827262 N/A N/A ATTAAGGGAGTTGCAG 106 17555 17570 1075

827263 N/A N/A CCCTAGGAGCATGGAC 56 17585 17600 1076

827264 N/A N/A GCAGAAGTCCCTAGGA 92 17593 17608 1077

827265 N/A N/A ACAGGAGTCGGAAGCC 48 17640 17655 1078

827266 N/A N/A GGGATAAGCCCCTTGG 87 17705 17720 1079

827279 N/A N/A AGATCCATGCTTCCAG 17 18216 18231 1080

827280 N/A N/A AAGATCCATGCTTCCA 11 18217 18232 1081

827281 N/A N/A CCAAGATCCATGCTTC 22 18219 18234 1082

827282 N/A N/A ACCAAGATCCATGCTT 55 18220 18235 1083

827283 N/A N/A GACCAAGATCCATGCT 17 18221 18236 1084

827284 N/A N/A AGACCAAGATCCATGC 12 18222 18237 1085

827285 N/A N/A AAGACCAAGATCCATG 19 18223 18238 1086

827298 N/A N/A AGGATGATGTGATACA 30 18735 18750 1087

827299 N/A N/A AAGGATGATGTGATAC 74 18736 18751 1088

827300 N/A N/A ATCTAAGAAATAGGCT 35 18755 18770 1089

827301 N/A N/A CACATAGCCCAGATAG 31 18834 18849 1090

827302 N/A N/A TGCCAAAGGAGCATGG 61 18901 18916 1091

827303 N/A N/A CTTGAGTAAAAGTGCC 30 18913 18928 1092

827304 N/A N/A GTACAGCTCTTGAGAT 46 18955 18970 1093

827317 N/A N/A GGTAAGAAGTGACACC 57 19364 19379 1094

827318 N/A N/A GTGTACTGGGCAGAGT 20 19390 19405 1095

827319 N/A N/A TGCTACCATCTTACTT 52 19463 19478 1096

827320 N/A N/A GGCTTAGGTGTTGCTA 45 19474 19489 1097

827321 N/A N/A GCGGACTCAGGCTTAG 51 19483 19498 1098

827322 N/A N/A TGACAGGTGTGGGCGG 48 19495 19510 1099

827323 N/A N/A GTGACAGGTGTGGGCG 66 19496 19511 1100

827324 N/A N/A GTCCAGGTGACAGTTA 38 19522 19537 1101

827337 N/A N/A CCCAGGCGAGCAATGA 20 19746 19761 1102

827338 N/A N/A GGTATAACAACCCAGG 25 19756 19771 1103

827339 N/A N/A CAGTAGGGTGGAGTGG 74 19774 19789 1104 827340 N/A N/A GTACAAAGGTTCCTGT 74 19829 19844 1105

827341 N/A N/A CGTGAAGTAAGGTTGA 31 19846 19861 1106

827342 N/A N/A GTTACATGTGGTGACG 53 19860 19875 1107

827343 N/A N/A AGTTACATGTGGTGAC 45 19861 19876 1108

827344 N/A N/A TAGTTACATGTGGTGA 31 19862 19877 1109

827356 N/A N/A AGGACTAACTGGAATA 27 19876 19891 1110

827357 N/A N/A CAGGACTAACTGGAAT 31 19877 19892 1111

827358 N/A N/A GCCCGGTGAGATATTC 80 19923 19938 1112

827359 N/A N/A CCCGATAGCTGGTTGT 18 20415 20430 1113

827360 N/A N/A TTAATTAGTTCACCCG 12 20427 20442 1114

827361 N/A N/A AGTGAATCCTCACACT 161 20444 20459 1115

827362 N/A N/A CCTAGCTGGGAGGTGT 56 20516 20531 1116

827363 N/A N/A CATGTTGGAGGTGATC 58 20531 20546 1117

827376 N/A N/A TCATAGGTAAACACCC 31 21565 21580 1118

827377 N/A N/A GAAAAGTCTGGTAGCT 23 21628 21643 1119

827378 N/A N/A TGGTGTGACCATTTGG 13 21643 21658 1120

827379 N/A N/A ATGGTGTGACCATTTG 7 21644 21659 1121

827380 N/A N/A AAATGGTGTGACCATT 72 21646 21661 1122

827381 N/A N/A TAAATGGTGTGACCAT 41 21647 21662 1123

827382 N/A N/A GTTAAATGGTGTGACC 14 21649 21664 1124

827394 N/A N/A GTACGATTACAGGGAT 31 21753 21768 1125

827395 N/A N/A AGTACGATTACAGGGA 5 21754 21769 1126

827396 N/A N/A TAGTACGATTACAGGG 90 21755 21770 1127

827397 N/A N/A CTAGTACGATTACAGG 24 21756 21771 1128

827398 N/A N/A ACTAGTACGATTACAG 29 21757 21772 1129

827399 N/A N/A CACTAGTACGATTACA 50 21758 21773 1130

827400 N/A N/A TCACTAGTACGATTAC 78 21759 21774 1131

827401 N/A N/A CTCACTAGTACGATTA 34 21760 21775 1132

827413 N/A N/A CCTATGAGAATCAGTA 16 22313 22328 1133

827414 N/A N/A GCCTATGAGAATCAGT 19 22314 22329 1134

827415 N/A N/A CTATAGTGGCCTATGA 111 22322 22337 1135

827416 N/A N/A GATACACACTAAGCAC 23 22342 22357 1136

827417 N/A N/A AGATACACACTAAGCA 11 22343 22358 1137

827418 N/A N/A GCACACTACAGCGAGA 55 22455 22470 1138

827419 N/A N/A AAACATAGAGCTTCGA 7 22721 22736 1139

827432 N/A N/A GGTGAGCCCTTCGCAC 11 22828 22843 1140

827433 N/A N/A TGAAGGAGAGGCTACA 39 22866 22881 1141

827434 N/A N/A ATTCTAGGATGTACTG 53 22926 22941 1142

827435 N/A N/A GTGACATACTGGTGCA 17 22943 22958 1143

827436 N/A N/A GGGATATTCCACTGGC 37 22983 22998 1144

827437 N/A N/A AACTAGGTGATCCGGG 9 22996 23011 1145 827438 N/A N/A AATGTAGGATGATTCT 29 23030 23045 1146

827439 N/A N/A TTCTAAGCTTATTCTC 34 23057 23072 1147

827451 N/A N/A GGTGAGCACGGAGCTG 35 23471 23486 1148

827452 N/A N/A GGAGAAAGTGTGACCA 57 23489 23504 1149

827453 N/A N/A GAGCAGGGTTAAAGGA 110 23502 23517 1150

827454 N/A N/A TGTCATCTAGGAGATA 123 23597 23612 1151

827455 N/A N/A TTGCATAGATCCTGTC 47 23609 23624 1152

827456 N/A N/A CTTGATGACAGGAGCC 67 23660 23675 1153

827457 N/A N/A TTGAATCATGAGCTCC 35 23675 23690 1154

827458 N/A N/A GCCCATGCATCTAAGT 38 23703 23718 1155

827471 N/A N/A GGACTATGTGGCACCT 43 24342 24357 1156

827472 N/A N/A TGGCAACCCCTGAGCT 80 24412 24427 1157

827473 N/A N/A GTTCAGGAAGACCCGC 166 24437 24452 1158

827474 N/A N/A GCAGAGGCGGGAATCC 78 24524 24539 1159

827475 N/A N/A CATCAGGGACAGACCT 78 24564 24579 1160

827476 N/A N/A CTGCAATCTGAGGCGC 85 24761 24776 1161

827477 N/A N/A CCCTAAGCATGCCTTG 46 24939 24954 1162

827478 N/A N/A TTTCAAGGCCACTAGG 109 24974 24989 1163

827491 N/A N/A ACCTTAGGAGCCATTG 27 26493 26508 1164

827492 N/A N/A ACCCATGTATCTTCTA 46 26627 26642 1165

827493 N/A N/A AATGAGACAGACCCAT 62 26637 26652 1166

827494 N/A N/A GGATACAGTATGTCCA 78 26685 26700 1167

827495 N/A N/A CTCTACTATTGAATGG 46 26699 26714 1168

827496 N/A N/A ATTATATACCTCTACT 58 26708 26723 1169

827497 N/A N/A ATCTTAAACAGGTCCA 16 26745 26760 1170

827498 N/A N/A ACTGATTGTGCCCTTG 17 26777 26792 1171

827511 N/A N/A CCAGGAGGCCACGACT 30 27241 27256 1172

827512 N/A N/A TACAATCCTCTAAGGT 43 27271 27286 1173

827513 N/A N/A CTGTATACCCTGGGAC 59 27378 27393 1174

827514 N/A N/A TCTCAGCAATCAATAT 62 27490 27505 1175

827515 N/A N/A GGGAAGTAAGCCCTAG 47 27559 27574 1176

827516 N/A N/A GGCTGGAGATCTTTAG 34 27607 27622 1177

827517 N/A N/A CCCAAATCCCTACCAG 61 27623 27638 1178

827518 N/A N/A GTCATTATTGCTACTT 17 27675 27690 1179

827531 N/A N/A CAGAATAGCCGGGCGC 46 28650 28665 1180

827532 N/A N/A GGCAGACACGAGGGTC 40 28699 28714 1181

827533 N/A N/A CCATACGGATGAACCT 35 28741 28756 1182

827534 N/A N/A TACCATACGGATGAAC 20 28743 28758 1183

827535 N/A N/A CTACCATACGGATGAA 49 28744 28759 1184

827536 N/A N/A GCTACCATACGGATGA 23 28745 28760 1185

827537 N/A N/A TGCTACCATACGGATG 59 28746 28761 1186 827550 N/A N/A AGGGAATTAAGCCACA 13 29501 29516 1187

827551 N/A N/A GGATACACCAGTGTAA 32 29904 29919 1188

827552 N/A N/A AGCTAAGTCAGGCGAA 67 29930 29945 1189

827553 N/A N/A TATGAGTGTGCCTTTG 25 30329 30344 1190

827554 N/A N/A TTCAAGGTTGCAAGTG 41 30348 30363 1191

827555 N/A N/A AGCTAAGCCAGGGACA 67 30416 30431 1192

827556 N/A N/A GCCTTATGAGTGGCAG 54 30456 30471 1193

827557 N/A N/A CCACTTTACAAGAGCA 22 30492 30507 1194

827570 N/A N/A ATCAAGGTCACTCCCA 48 30959 30974 1195

827571 N/A N/A GAAGACCCATTCCTAG 78 30992 31007 1196

827572 N/A N/A CCATATCGATCCCTCT 132 31115 31130 1197

827573 N/A N/A GAATTTCCTGGACCTT 84 31142 31157 1198

827574 N/A N/A GAAATGGTAGAGGATG 46 31157 31172 1199

827575 N/A N/A AGGCACGACCTACCGT 139 31272 31287 1200

827576 N/A N/A CTCCATCCAGGCACGA 55 31280 31295 1201

827577 N/A N/A AAGTAAGACCCCCAGA 79 31306 31321 1202

Table 4: Percent level of human α-ENaC mRNA

SEQ SEQ SEQ SEQ

a-ENaC SEQ

Compound ID: 1 ID: 1 ID: 2 ID 2:

Sequence ID Number Start Stop (% Start Stop

control) NO Site Site Site Site

668182 535 550 CCAGAAGGCCGTCTTC 34 5463 5478 1203

668208 764 779 ATTTGTACAGGTCAAA 35 16349 16364 1204

668218 974 989 ATTTGTTCTGGTTGCA 19 17760 17775 1205

826072 7 22 GCTTTAGACGCAGACA 102 4268 4283 1206

826073 9 24 GGGCTTTAGACGCAGA 68 4270 4285 1207

826082 37 52 TGGACCTGAGAAGGCG 58 4298 4313 1208

826083 40 55 TACTGGACCTGAGAAG 66 4301 4316 1209

826084 42 57 AGTACTGGACCTGAGA 55 4303 4318 1210

826085 44 59 GGAGTACTGGACCTGA 55 4305 4320 1211

826086 45 60 GGGAGTACTGGACCTG 62 4306 4321 1212

826087 46 61 TGGGAGTACTGGACCT 81 4307 4322 1213

826088 47 62 CTGGGAGTACTGGACC 59 4308 4323 1214

826089 50 65 GAACTGGGAGTACTGG 81 4311 4326 1215

826092 62 77 CCGAGGGCAGGTGAAC 99 4323 4338 1216

826093 72 87 AGGAGGGCTCCCGAGG 81 4333 4348 1217

826102 94 109 GAGCCGGGAGTTTTCC 45 4355 4370 1218

826103 95 110 AGAGCCGGGAGTTTTC 71 4356 4371 1219

826104 98 113 GTCAGAGCCGGGAGTT 73 4359 4374 1220

826105 99 114 AGTCAGAGCCGGGAGT 73 4360 4375 1221 826106 100 115 GAGTCAGAGCCGGGAG 51 4361 4376 1222

826107 101 116 GGAGTCAGAGCCGGGA 53 4362 4377 1223

826108 138 153 AATTAAAGGTGAGCAG 67 4399 4414 1224

826109 143 158 ATCTCAATTAAAGGTG 91 4404 4419 1225

826112 164 179 AGCGACAGGAATCTCA 79 4425 4440 1226

826113 166 181 GAAGCGACAGGAATCT 68 4427 4442 1227

826122 181 196 GGCCGGCCAGGGATGG 41 4442 4457 1228

826123 182 197 TGGCCGGCCAGGGATG 55 4443 4458 1229

826124 183 198 CTGGCCGGCCAGGGAT 69 4444 4459 1230

826125 187 202 CCCGCTGGCCGGCCAG 32 4448 4463 1231

826126 188 203 GCCCGCTGGCCGGCCA 90 4449 4464 1232

826127 190 205 CCGCCCGCTGGCCGGC 58 4451 4466 1233

826128 192 207 GCCCGCCCGCTGGCCG 81 4453 4468 1234

826129 194 209 GAGCCCGCCCGCTGGC 57 4455 4470 1235

826132 217 232 ACAGGTGCAGCGGCCT 76 4478 4493 1236

826133 224 239 TCCCCTGACAGGTGCA 78 N/A N/A 1237

826142 256 271 CAGAGGTCTAGGGTCC 26 5184 5199 1238

826143 259 274 CTGCAGAGGTCTAGGG 36 5187 5202 1239

826144 267 282 GGTATGGGCTGCAGAG 24 5195 5210 1240

826145 269 284 CTGGTATGGGCTGCAG 31 5197 5212 1241

826146 272 287 GACCTGGTATGGGCTG 30 5200 5215 1242

826147 275 290 TGAGACCTGGTATGGG 38 5203 5218 1243

826148 278 293 CCATGAGACCTGGTAT 50 5206 5221 1244

826149 280 295 CTCCATGAGACCTGGT 42 5208 5223 1245

826152 284 299 TCCCCTCCATGAGACC 50 5212 5227 1246

826153 286 301 GTTCCCCTCCATGAGA 65 5214 5229 1247

826162 332 347 GCCCTGGAGTGGACTG 46 5260 5275 1248

826163 333 348 AGCCCTGGAGTGGACT 41 5261 5276 1249

826164 343 358 CCCCTTCATGAGCCCT 30 5271 5286 1250

5152 5167

826165 344 359 TCCCCTTCATGAGCCC 30 1251

5272 5287

5153 5168

826166 345 360 TTCCCCTTCATGAGCC 29 1252

5273 5288

5158 5173

826167 350 365 GCTTGTTCCCCTTCAT 12 1253

5278 5293

826168 351 366 CGCTTGTTCCCCTTCA 19 5279 5294 1254

826169 352 367 ACGCTTGTTCCCCTTC 20 5280 5295 1255

826172 356 371 CCTCACGCTTGTTCCC 41 5284 5299 1256

826173 359 374 GCTCCTCACGCTTGTT 48 5287 5302 1257

826182 425 440 ACTCGATCAGGGCCTC 34 5353 5368 1258

826183 427 442 GAACTCGATCAGGGCC 21 5355 5370 1259 826184 429 444 TGGAACTCGATCAGGG 45 5357 5372 1260

826185 431 446 GGTGGAACTCGATCAG 26 5359 5374 1261

826186 432 447 CGGTGGAACTCGATCA 36 5360 5375 1262

826187 433 448 GCGGTGGAACTCGATC 47 5361 5376 1263

826188 435 450 GAGCGGTGGAACTCGA 39 5363 5378 1264

826189 436 451 GGAGCGGTGGAACTCG 53 5364 5379 1265

826192 443 458 CTCGGTAGGAGCGGTG 50 5371 5386 1266

826193 445 460 CTCTCGGTAGGAGCGG 42 5373 5388 1267

826202 516 531 CGGTTGTGCTGGGAGC 19 5444 5459 1268

826203 517 532 GCGGTTGTGCTGGGAG 24 5445 5460 1269

826204 519 534 ATGCGGTTGTGCTGGG 23 5447 5462 1270

826205 524 539 TCTTCATGCGGTTGTG 31 5452 5467 1271

826206 529 544 GGCCGTCTTCATGCGG 39 5457 5472 1272

826207 532 547 GAAGGCCGTCTTCATG 27 5460 5475 1273

826208 564 579 ATGCCAAAGGTGCAGA 51 5492 5507 1274

826211 569 584 ACATCATGCCAAAGGT 33 5497 5512 1275

826212 573 588 CAGTACATCATGCCAA 42 5501 5516 1276

826221 590 605 AAAGCAGGCCGAATTG 38 5518 5533 1277

826222 594 609 CCGAAAAGCAGGCCGA 27 5522 5537 1278

826223 596 611 CTCCGAAAAGCAGGCC 31 5524 5539 1279

826224 598 613 CTCTCCGAAAAGCAGG 37 5526 5541 1280

826225 599 614 ACTCTCCGAAAAGCAG 27 5527 5542 1281

826226 601 616 GTACTCTCCGAAAAGC 20 5529 5544 1282

826227 602 617 AGTACTCTCCGAAAAG 43 5530 5545 1283

826228 605 620 TGAAGTACTCTCCGAA 44 5533 5548 1284

826231 610 625 GTAGCTGAAGTACTCT 35 5538 5553 1285

826232 611 626 GGTAGCTGAAGTACTC 23 5539 5554 1286

826241 650 665 CGAGCTTGTCCGAGTT 17 5578 5593 1287

826242 652 667 GACGAGCTTGTCCGAG 22 5580 5595 1288

826243 653 668 AGACGAGCTTGTCCGA 23 5581 5596 1289

826244 655 670 GAAGACGAGCTTGTCC 30 5583 5598 1290

826245 656 671 GGAAGACGAGCTTGTC 27 5584 5599 1291

826246 657 672 GGGAAGACGAGCTTGT 21 5585 5600 1292

826247 699 714 TCCGGGTACCTGTAGG 32 N/A N/A 1293

826248 700 715 TTCCGGGTACCTGTAG 38 N/A N/A 1294

826251 705 720 TTAATTTCCGGGTACC 27 16290 16305 1295

826252 709 724 CTCTTTAATTTCCGGG 31 16294 16309 1296

826261 763 778 TTTGTACAGGTCAAAG 43 16348 16363 1297

826262 766 781 GTATTTGTACAGGTCA 12 16351 16366 1298

826263 777 792 GTGAAGGAGCTGTATT 93 16362 16377 1299

826264 786 801 ACGAGAGTGGTGAAGG 43 16371 16386 1300 826265 788 803 CCACGAGAGTGGTGAA 56 16373 16388 1301

826266 789 804 GCCACGAGAGTGGTGA 77 16374 16389 1302

826269 794 809 AGCCGGCCACGAGAGT 43 16379 16394 1303

826270 795 810 GAGCCGGCCACGAGAG 42 16380 16395 1304

826279 812 827 GGTCGCGACGGCTGCG 31 16397 16412 1305

826280 815 830 GCAGGTCGCGACGGCT 48 16400 16415 1306

826281 816 831 CGCAGGTCGCGACGGC 35 16401 16416 1307

826282 819 834 CCCCGCAGGTCGCGAC 49 16404 16419 1308

826283 820 835 CCCCCGCAGGTCGCGA 43 16405 16420 1309

826284 821 836 TCCCCCGCAGGTCGCG 35 16406 16421 1310

826285 822 837 GTCCCCCGCAGGTCGC 49 16407 16422 1311

826286 824 839 GAGTCCCCCGCAGGTC 67 16409 16424 1312

826289 831 846 TGCGGCAGAGTCCCCC 37 16416 16431 1313

826290 833 848 GGTGCGGCAGAGTCCC 38 16418 16433 1314

826299 893 908 CCACGCTACGGGCTCG 33 16478 16493 1315

826300 895 910 GGCCACGCTACGGGCT 56 16480 16495 1316

826301 897 912 GAGGCCACGCTACGGG 36 16482 16497 1317

826302 898 913 GGAGGCCACGCTACGG 34 16483 16498 1318

826303 900 915 CTGGAGGCCACGCTAC 49 16485 16500 1319

826304 902 917 AGCTGGAGGCCACGCT 28 16487 16502 1320

826305 908 923 CCCGCAAGCTGGAGGC 41 16493 16508 1321

826306 913 928 GTTGTCCCGCAAGCTG 23 16498 16513 1322

826309 917 932 GGTTGTTGTCCCGCAA 33 16502 16517 1323

826310 918 933 GGGTTGTTGTCCCGCA 43 16503 16518 1324

826319 971 986 TGTTCTGGTTGCACAG 35 N/A N/A 1325

826320 972 987 TTGTTCTGGTTGCACA 38 N/A N/A 1326

826321 973 988 TTTGTTCTGGTTGCAC 23 17759 17774 1327

826322 975 990 GATTTGTTCTGGTTGC 36 17761 17776 1328

826323 976 991 CGATTTGTTCTGGTTG 22 17762 17777 1329

826324 978 993 TCCGATTTGTTCTGGT 38 17764 17779 1330

826327 981 996 CAGTCCGATTTGTTCT 36 17767 17782 1331

826328 982 997 GCAGTCCGATTTGTTC 34 17768 17783 1332

826337 1000 1015 TGAGTATGTCTGGTAG 19 17786 17801 1333

826338 1001 1016 ATGAGTATGTCTGGTA 15 17787 17802 1334

826339 1003 1018 TGATGAGTATGTCTGG 19 17789 17804 1335

826340 1007 1022 CCCCTGATGAGTATGT 41 17793 17808 1336

826341 1009 1024 CACCCCTGATGAGTAT 61 17795 17810 1337

826342 1011 1026 TCCACCCCTGATGAGT 36 17797 17812 1338

826343 1014 1029 GCATCCACCCCTGATG 56 17800 17815 1339

826344 1015 1030 CGCATCCACCCCTGAT 70 17801 17816 1340

826347 1019 1034 TCACCGCATCCACCCC 35 17805 17820 1341 826348 1021 1036 CCTCACCGCATCCACC 72 17807 17822 1342

826357 1047 1062 TTGATGTAGTGGAAGC 39 17833 17848 1343

826358 1058 1073 TCGACAGGATGTTGAT 56 17844 17859 1344

826359 1060 1075 CCTCGACAGGATGTTG 28 17846 17861 1345

826360 1061 1076 GCCTCGACAGGATGTT 37 17847 17862 1346

826361 1064 1079 GCAGCCTCGACAGGAT 45 17850 17865 1347

826362 1065 1080 GGCAGCCTCGACAGGA 22 17851 17866 1348

826363 1074 1089 AGAGTCTCTGGCAGCC 25 17860 17875 1349

826364 1110 1125 ATGAAGTTGCCCAGCG 64 17896 17911 1350

826367 1117 1132 GGCGAAGATGAAGTTG 47 17903 17918 1351

826368 1121 1136 GGCAGGCGAAGATGAA 46 17907 17922 1352

826377 1148 1163 CCTGGTTGCAGGAGAC 24 17934 17949 1353

826378 1150 1165 CGCCTGGTTGCAGGAG 38 17936 17951 1354

826379 1152 1167 TTCGCCTGGTTGCAGG 54 N/A N/A 1355

826380 1153 1168 ATTCGCCTGGTTGCAG 52 N/A N/A 1356

826381 1155 1170 TAATTCGCCTGGTTGC 86 N/A N/A 1357

826382 1157 1172 AGTAATTCGCCTGGTT 73 N/A N/A 1358

826383 1158 1173 GAGTAATTCGCCTGGT 49 N/A N/A 1359

826384 1160 1175 GAGAGTAATTCGCCTG 63 N/A N/A 1360

826387 1168 1183 GTGGAAGTGAGAGTAA 48 24124 24139 1361

826388 1230 1245 GACATCCAGAGGTTGG 47 24186 24201 1362

826397 1261 1276 GGACAGACCGTTGTTG 31 N/A N/A 1363

826398 1267 1282 CATCAGGGACAGACCG 40 N/A N/A 1364

826399 1268 1283 GCATCAGGGACAGACC 24 24565 24580 1365

826400 1273 1288 GCGCAGCATCAGGGAC 28 24570 24585 1366

826401 1275 1290 GCGCGCAGCATCAGGG 37 24572 24587 1367

826402 1277 1292 CTGCGCGCAGCATCAG 35 24574 24589 1368

826403 1279 1294 CTCTGCGCGCAGCATC 20 24576 24591 1369

826404 1280 1295 GCTCTGCGCGCAGCAT 49 24577 24592 1370

826407 1283 1298 TCTGCTCTGCGCGCAG 65 24580 24595 1371

826408 1284 1299 TTCTGCTCTGCGCGCA 49 24581 24596 1372

826417 1333 1348 CACCATTACCCGGGCC 34 24630 24645 1373

826418 1341 1356 TGCCCGTGCACCATTA 30 24638 24653 1374

826419 1343 1358 CCTGCCCGTGCACCAT 25 24640 24655 1375

826420 1344 1359 TCCTGCCCGTGCACCA 18 24641 24656 1376

826421 1345 1360 ATCCTGCCCGTGCACC 31 24642 24657 1377

826422 1348 1363 TTCATCCTGCCCGTGC 20 24645 24660 1378

826423 1350 1365 GGTTCATCCTGCCCGT 53 24647 24662 1379

826424 1351 1366 AGGTTCATCCTGCCCG 78 24648 24663 1380

826427 1358 1373 TAAAGGCAGGTTCATC 89 24655 24670 1381

826428 1361 1376 CCATAAAGGCAGGTTC 73 24658 24673 1382 826437 1393 1408 CACGCCAGGCCGCAAG 36 24690 24705 1383

826438 1394 1409 CCACGCCAGGCCGCAA 45 24691 24706 1384

826439 1395 1410 TCCACGCCAGGCCGCA 28 24692 24707 1385

826440 1396 1411 CTCCACGCCAGGCCGC 38 24693 24708 1386

826441 1399 1414 GGTCTCCACGCCAGGC 38 24696 24711 1387

826442 1401 1416 GAGGTCTCCACGCCAG 25 24698 24713 1388

826443 1402 1417 GGAGGTCTCCACGCCA 55 24699 24714 1389

826444 1404 1419 ATGGAGGTCTCCACGC 45 24701 24716 1390

826447 1442 1457 CGCCCCCAAGTCTGTC 38 25162 25177 1391

826448 1443 1458 TCGCCCCCAAGTCTGT 32 25163 25178 1392

826457 1461 1476 TTGGTGCAGTCGCCAT 25 25181 25196 1393

826458 1462 1477 CTTGGTGCAGTCGCCA 43 25182 25197 1394

826459 1463 1478 TCTTGGTGCAGTCGCC 24 25183 25198 1395

826460 1466 1481 CATTCTTGGTGCAGTC 40 25186 25201 1396

826461 1468 1483 GCCATTCTTGGTGCAG 45 25188 25203 1397

826462 1470 1485 CTGCCATTCTTGGTGC 30 25190 25205 1398

826463 1480 1495 AGGAACATCACTGCCA 29 25200 25215 1399

826464 1496 1511 GGTAAAGGTTCTCAAC 68 25216 25231 1400

826467 1509 1524 GTGTACTTTGAAGGGT 49 25229 25244 1401

826468 1526 1541 GAATACACACCTGCTG 54 N/A N/A 1402

826477 1558 1573 CTCCTTGATCATGCTC 31 25472 25487 1403

826478 1559 1574 ACTCCTTGATCATGCT 36 25473 25488 1404

826479 1560 1575 CACTCCTTGATCATGC 29 25474 25489 1405

826480 1561 1576 ACACTCCTTGATCATG 29 25475 25490 1406

826481 1562 1577 CACACTCCTTGATCAT 38 25476 25491 1407

826482 1564 1579 GCCACACTCCTTGATC 32 25478 25493 1408

826483 1576 1591 GATGTAGGCACAGCCA 25 25490 25505 1409

826484 1577 1592 AGATGTAGGCACAGCC 22 25491 25506 1410

826486 1581 1596 TAGAAGATGTAGGCAC 47 25495 25510 1411

826487 1582 1597 ATAGAAGATGTAGGCA 49 25496 25511 1412

826496 1638 1653 TACCCCCAGGAACTGT 27 N/A N/A 1413

826497 1639 1654 GTACCCCCAGGAACTG 49 N/A N/A 1414

826498 1640 1655 AGTACCCCCAGGAACT 65 N/A N/A 1415

826499 1641 1656 CAGTACCCCCAGGAAC 44 N/A N/A 1416

826500 1648 1663 ATAGTAGCAGTACCCC 36 N/A N/A 1417

826501 1650 1665 TTATAGTAGCAGTACC 38 30596 30611 1418

826502 1654 1669 GAGCTTATAGTAGCAG 59 30600 30615 1419

826503 1655 1670 GGAGCTTATAGTAGCA 55 30601 30616 1420

826506 1662 1677 TCAACCTGGAGCTTAT 39 30608 30623 1421

826507 1664 1679 AGTCAACCTGGAGCTT 41 30610 30625 1422

826516 1717 1732 CACGCTGCATGGCTTC 21 N/A N/A 1423 826517 1720 1735 GGTCACGCTGCATGGC 38 N/A N/A 1424

826518 1722 1737 CTGGTCACGCTGCATG 35 N/A N/A 1425

826519 1723 1738 GCTGGTCACGCTGCAT 30 N/A N/A 1426

826520 1724 1739 AGCTGGTCACGCTGCA 41 N/A N/A 1427

826521 1727 1742 GGTAGCTGGTCACGCT 26 30778 30793 1428

826522 1729 1744 CTGGTAGCTGGTCACG 46 30780 30795 1429

826523 1732 1747 GAGCTGGTAGCTGGTC 48 30783 30798 1430

826526 1737 1752 GCAGAGAGCTGGTAGC 67 30788 30803 1431

826527 1749 1764 CGTGAGTAACCAGCAG 48 30800 30815 1432

826556 1890 1905 GACTCAGAATTGGTTT 61 31246 31261 1433

826557 1961 1976 CCGAGGAGCCGAACCA 50 31790 31805 1434

826558 1965 1980 AACACCGAGGAGCCGA 14 31794 31809 1435

826559 1966 1981 CAACACCGAGGAGCCG 36 31795 31810 1436

826560 1968 1983 GACAACACCGAGGAGC 56 31797 31812 1437

826561 1970 1985 CAGACAACACCGAGGA 30 31799 31814 1438

826562 1972 1987 CACAGACAACACCGAG 42 31801 31816 1439

826563 1973 1988 CCACAGACAACACCGA 60 31802 31817 1440

826566 1998 2013 TCAAAGACGAGCTCAG 61 31827 31842 1441

826567 1999 2014 GTCAAAGACGAGCTCA 62 31828 31843 1442

826576 2036 2051 ACCTTCGGAGCAGCAT 17 31865 31880 1443

826577 2038 2053 GAACCTTCGGAGCAGC 28 31867 31882 1444

826578 2039 2054 GGAACCTTCGGAGCAG 17 31868 31883 1445

826579 2040 2055 CGGAACCTTCGGAGCA 20 31869 31884 1446

826580 2041 2056 TCGGAACCTTCGGAGC 32 31870 31885 1447

826581 2042 2057 TTCGGAACCTTCGGAG 30 31871 31886 1448

826582 2043 2058 CTTCGGAACCTTCGGA 47 31872 31887 1449

826583 2044 2059 GCTTCGGAACCTTCGG 30 31873 31888 1450

826585 2047 2062 TCGGCTTCGGAACCTT 32 31876 31891 1451

826586 2048 2063 ATCGGCTTCGGAACCT 33 31877 31892 1452

826595 2059 2074 TGGAGACCAGTATCGG 20 31888 31903 1453

826596 2061 2076 CCTGGAGACCAGTATC 30 31890 31905 1454

826597 2066 2081 CTCGGCCTGGAGACCA 35 31895 31910 1455

826598 2069 2084 CCCCTCGGCCTGGAGA 42 31898 31913 1456

826599 2071 2086 GCCCCCTCGGCCTGGA 64 31900 31915 1457

826600 2072 2087 TGCCCCCTCGGCCTGG 46 31901 31916 1458

826601 2093 2108 AGGCTACCTCCTGAGC 48 31922 31937 1459

826602 2098 2113 GGTGGAGGCTACCTCC 62 31927 31942 1460

826605 2279 2294 GCCCCCCCAGAGGACA 90 32108 32123 1461

826606 2280 2295 GGCCCCCCCAGAGGAC 75 32109 32124 1462

826615 2320 2335 GCATCTGCCTTGGTGT 24 32149 32164 1463

826616 2322 2337 GAGCATCTGCCTTGGT 24 32151 32166 1464 826617 2324 2339 AGGAGCATCTGCCTTG 32 32153 32168 1465

826618 2330 2345 CACCAGAGGAGCATCT 46 32159 32174 1466

826619 2331 2346 CCACCAGAGGAGCATC 34 32160 32175 1467

826620 2355 2370 AATCTTGCCAGGGCCA 21 32184 32199 1468

826621 2356 2371 CAATCTTGCCAGGGCC 37 32185 32200 1469

826622 2359 2374 CTTCAATCTTGCCAGG 41 32188 32203 1470

826625 2393 2408 GTTTGGGCGGCTCTGA 36 32222 32237 1471

826626 2395 2410 CAGTTTGGGCGGCTCT 22 32224 32239 1472

826635 2412 2427 CCTCCACACATCAACG 38 32241 32256 1473

826636 2435 2450 GAGCCCTTACCCATCT 50 32264 32279 1474

826637 2436 2451 TGAGCCCTTACCCATC 49 32265 32280 1475

826638 2439 2454 TCCTGAGCCCTTACCC 33 32268 32283 1476

826639 2447 2462 GAGCAACTTCCTGAGC 28 32276 32291 1477

826640 2449 2464 TGGAGCAACTTCCTGA 39 32278 32293 1478

826641 2459 2474 CTACTGTTCTTGGAGC 28 32288 32303 1479

826642 2462 2477 CAGCTACTGTTCTTGG 22 32291 32306 1480

826645 2477 2492 TCTGGGCAGCTTCATC 37 32306 32321 1481

826646 2490 2505 GAGCCAAGGCACTTCT 31 32319 32334 1482

826655 2553 2568 CTTAGCCGCAGTTGGG 13 32382 32397 1483

826656 2554 2569 ACTTAGCCGCAGTTGG 35 32383 32398 1484

826657 2555 2570 GACTTAGCCGCAGTTG 40 32384 32399 1485

826658 2556 2571 AGACTTAGCCGCAGTT 24 32385 32400 1486

826659 2557 2572 GAGACTTAGCCGCAGT 19 32386 32401 1487

826660 2559 2574 AAGAGACTTAGCCGCA 18 32388 32403 1488

826661 2561 2576 AAAAGAGACTTAGCCG 42 32390 32405 1489

826663 2577 2592 TGGCTGATCCAAGGGA 46 32406 32421 1490

826664 2578 2593 TTGGCTGATCCAAGGG 48 32407 32422 1491

826673 2587 2602 AAGTTTCGCTTGGCTG 18 32416 32431 1492

826674 2589 2604 CCAAGTTTCGCTTGGC 63 32418 32433 1493

826675 2591 2606 CTCCAAGTTTCGCTTG 33 32420 32435 1494

826676 2593 2608 AGCTCCAAGTTTCGCT 48 32422 32437 1495

826677 2600 2615 TTGTCAAAGCTCCAAG 19 32429 32444 1496

826678 2602 2617 CCTTGTCAAAGCTCCA 8 32431 32446 1497

826679 2604 2619 TTCCTTGTCAAAGCTC 24 32433 32448 1498

826680 2607 2622 AAGTTCCTTGTCAAAG 39 32436 32451 1499

826683 2621 2636 GCGGTTTCTTAGGAAA 22 32450 32465 1500

826684 2622 2637 AGCGGTTTCTTAGGAA 26 32451 32466 1501

826693 2653 2668 GTACCCTTGGTTGTGT 21 32482 32497 1502

826694 2655 2670 GTGTACCCTTGGTTGT 31 32484 32499 1503

826695 2656 2671 CGTGTACCCTTGGTTG 22 32485 32500 1504

826696 2670 2685 CCCGTGCATGCCTGCG 23 32499 32514 1505 826697 2674 2689 GAAACCCGTGCATGCC 28 32503 32518 1506

826698 2676 2691 AGGAAACCCGTGCATG 21 32505 32520 1507

826699 2677 2692 CAGGAAACCCGTGCAT 31 32506 32521 1508

826700 2678 2693 GCAGGAAACCCGTGCA 58 32507 32522 1509

826703 2685 2700 TCGCTGGGCAGGAAAC 31 32514 32529 1510

826704 2687 2702 CGTCGCTGGGCAGGAA 29 32516 32531 1511

826713 2736 2751 GTGCTACTGGAGAGCA 34 32565 32580 1512

826714 2737 2752 TGTGCTACTGGAGAGC 35 32566 32581 1513

826715 2738 2753 CTGTGCTACTGGAGAG 19 32567 32582 1514

826716 2739 2754 TCTGTGCTACTGGAGA 23 32568 32583 1515

826717 2740 2755 ATCTGTGCTACTGGAG 19 32569 32584 1516

826718 2750 2765 AGGAGCAGACATCTGT 17 32579 32594 1517

826719 2775 2790 GGGTTTCCCACCCAAG 91 32604 32619 1518

826720 2810 2825 GGAATTGCCTAAGTAA 29 32639 32654 1519

826723 2837 2852 GCCCTAGCCCTCGGGA 66 32666 32681 1520

826724 2839 2854 TAGCCCTAGCCCTCGG 60 32668 32683 1521

826733 2860 2875 TTTACTTACCCGGGTC 40 32689 32704 1522

826734 2862 2877 CCTTTACTTACCCGGG 47 32691 32706 1523

826735 2865 2880 CTGCCTTTACTTACCC 37 32694 32709 1524

826736 2884 2899 GGCTAGAGGAGCCCTG 48 32713 32728 1525

826737 2886 2901 GAGGCTAGAGGAGCCC 46 32715 32730 1526

826738 2891 2906 GGTATGAGGCTAGAGG 27 32720 32735 1527

826739 2893 2908 CGGGTATGAGGCTAGA 34 32722 32737 1528

826740 2895 2910 CACGGGTATGAGGCTA 55 32724 32739 1529

826743 2951 2966 CATGTAGAGGTATGAA 26 32780 32795 1530

826744 2953 2968 GACATGTAGAGGTATG 31 32782 32797 1531

826753 2966 2981 AATATCTCAAGCAGAC 18 32795 32810 1532

826754 2986 3001 GGAAACTTTCAGGCTG 22 32815 32830 1533

826755 2987 3002 GGGAAACTTTCAGGCT 25 32816 32831 1534

826756 3001 3016 CTGGCAGATGGTTGGG 31 32830 32845 1535

826757 3003 3018 CTCTGGCAGATGGTTG 30 32832 32847 1536

826758 3008 3023 GAGTTCTCTGGCAGAT 20 32837 32852 1537

826759 3010 3025 AGGAGTTCTCTGGCAG 22 32839 32854 1538

826760 3011 3026 TAGGAGTTCTCTGGCA 31 32840 32855 1539

826762 3014 3029 GCATAGGAGTTCTCTG 30 32843 32858 1540

826763 3015 3030 TGCATAGGAGTTCTCT 18 32844 32859 1541

826772 3035 3050 CTGAGCAGGGTTCTAA 20 32864 32879 1542

826773 3036 3051 TCTGAGCAGGGTTCTA 24 32865 32880 1543

826774 3039 3054 GTGTCTGAGCAGGGTT 13 32868 32883 1544

826775 3044 3059 TAATGGTGTCTGAGCA 19 32873 32888 1545

826776 3045 3060 GTAATGGTGTCTGAGC 11 32874 32889 1546 826777 3074 3089 GACAAGATGTGGCAGA 22 32903 32918 1547

826778 3097 3112 GCGGAGTGATCAATTT 50 32926 32941 1548

826779 3099 3114 AGGCGGAGTGATCAAT 55 32928 32943 1549

826782 3119 3134 TGCTACGGGAGCCCAG 46 32948 32963 1550

826783 3120 3135 GTGCTACGGGAGCCCA 24 32949 32964 1551

826791 3129 3144 TGTTATAGTGTGCTAC 27 32958 32973 1552

826792 3130 3145 ATGTTATAGTGTGCTA 34 32959 32974 1553

826793 3131 3146 GATGTTATAGTGTGCT 12 32960 32975 1554

826794 3132 3147 AGATGTTATAGTGTGC 13 32961 32976 1555

826795 3133 3148 CAGATGTTATAGTGTG 21 32962 32977 1556

826796 3135 3150 AGCAGATGTTATAGTG 14 32964 32979 1557

826797 3136 3151 CAGCAGATGTTATAGT 37 32965 32980 1558

826798 3137 3152 CCAGCAGATGTTATAG 50 32966 32981 1559

826801 3146 3161 AGCAACACTCCAGCAG 46 32975 32990 1560

826802 3147 3162 CAGCAACACTCCAGCA 35 32976 32991 1561

826810 3161 3176 AAAGTATGGTGCAACA 22 32990 33005 1562

826811 3162 3177 GAAAGTATGGTGCAAC 19 32991 33006 1563

826812 3163 3178 AGAAAGTATGGTGCAA 24 32992 33007 1564

826813 3204 3219 GGCACTTACAGTCTAG 16 33033 33048 1565

826814 3208 3223 GCAAGGCACTTACAGT 31 33037 33052 1566

826815 3210 3225 CCGCAAGGCACTTACA 37 33039 33054 1567

826816 3211 3226 ACCGCAAGGCACTTAC 21 33040 33055 1568

826819 3214 3229 CTGACCGCAAGGCACT 23 33043 33058 1569

826820 3215 3230 CCTGACCGCAAGGCAC 38 33044 33059 1570

826829 3226 3241 AAGATTCAGTCCCTGA 27 33055 33070 1571

826830 3228 3243 GCAAGATTCAGTCCCT 25 33057 33072 1572

826831 3229 3244 GGCAAGATTCAGTCCC 21 33058 33073 1573

826832 3230 3245 GGGCAAGATTCAGTCC 41 33059 33074 1574

826833 3231 3246 CGGGCAAGATTCAGTC 29 33060 33075 1575

826834 3232 3247 ACGGGCAAGATTCAGT 29 33061 33076 1576

826835 3233 3248 AACGGGCAAGATTCAG 23 33062 33077 1577

826838 3237 3252 CATAAACGGGCAAGAT 47 33066 33081 1578

826839 3238 3253 ACATAAACGGGCAAGA 42 33067 33082 1579

826848 3256 3271 GGGCTAGACATGGAGC 20 33085 33100 1580

826849 3259 3274 GATGGGCTAGACATGG 26 33088 33103 1581

826850 3261 3276 ATGATGGGCTAGACAT 34 33090 33105 1582

826851 3275 3290 TTGCTCCAAGCAGGAT 39 33104 33119 1583

826852 3276 3291 CTTGCTCCAAGCAGGA 75 33105 33120 1584

826853 3279 3294 CTACTTGCTCCAAGCA 66 33108 33123 1585

826854 3281 3296 GCCTACTTGCTCCAAG 53 33110 33125 1586

826855 3292 3307 ATTGAGCTCCTGCCTA 42 33121 33136 1587 826858 N/A N/A TACCTCCCCTTGGAAG 95 2717 2732 1588

826859 N/A N/A GATACCTCCCCTTGGA 43 2719 2734 1589

826868 N/A N/A CCCTTGATACTGCTCA 48 N/A N/A 1590

826869 N/A N/A CCCCTTGATACTGCTC 89 N/A N/A 1591

826870 N/A N/A TGTTCCCCTTGATACT 61 N/A N/A 1592

826871 N/A N/A TTGTTCCCCTTGATAC 70 N/A N/A 1593

826872 N/A N/A CTTGTTCCCCTTGATA 27 N/A N/A 1594

826873 N/A N/A AGCTTGTTCCCCTTGA 25 N/A N/A 1595

826874 N/A N/A CAGCTTGTTCCCCTTG 40 N/A N/A 1596

826875 N/A N/A CCAGCTTGTTCCCCTT 51 5161 5176 1597

826878 N/A N/A TTGTCCTAGCACCTCC 25 4870 4885 1598

826879 N/A N/A GTTTTGTCCTAGCACC 21 4873 4888 1599

826888 N/A N/A GATAGGGCCACCTTTC 31 4891 4906 1600

826889 N/A N/A CTGATAGGGCCACCTT 38 4893 4908 1601

826890 N/A N/A TCCCTGATAGGGCCAC 24 4896 4911 1602

826891 N/A N/A CTTCCCTGATAGGGCC 15 4898 4913 1603

826892 N/A N/A TGCTTCCCTGATAGGG 32 4900 4915 1604

826893 N/A N/A AACGGCCTCTCCTCTG 18 4914 4929 1605

826894 N/A N/A GAACGGCCTCTCCTCT 27 4915 4930 1606

826895 N/A N/A TAGAACGGCCTCTCCT 50 4917 4932 1607

826898 N/A N/A GGCTTCCCTAGAACGG 44 4925 4940 1608

826899 N/A N/A CTGGGCTTCCCTAGAA 47 4928 4943 1609

826908 N/A N/A GGGCCAAAAGTGCCGG 49 4946 4961 1610

826909 N/A N/A GACCTGCGGGAGTTGG 42 4961 4976 1611

826910 N/A N/A CAGACCTGCGGGAGTT 18 4963 4978 1612

826911 N/A N/A GCAGACCTGCGGGAGT 26 4964 4979 1613

826912 N/A N/A GCGCCCACATTCTCCC 48 5015 5030 1614

826913 N/A N/A CCTGCGCCCACATTCT 55 5018 5033 1615

826914 N/A N/A CCCTGCGCCCACATTC 68 5019 5034 1616

826915 N/A N/A CCACCCTGCGCCCACA 48 5022 5037 1617

826918 N/A N/A GGAACCCGAGTGAGGC 30 5060 5075 1618

826919 N/A N/A TGGAACCCGAGTGAGG 41 5061 5076 1619

826928 N/A N/A CCCTTCATGAGCCCCG 23 5150 5165 1620

826929 N/A N/A CCCCTTCATGAGCCCC 42 5151 5166 1621

826930 N/A N/A AGCTTGTTCCCCTTCA 23 5159 5174 1622

826931 N/A N/A CAGCTTGTTCCCCTTC 35 5160 5175 1623

826932 N/A N/A CTGCAATAAGGTGCTC 106 2302 2317 1624

826933 N/A N/A GGGCATGGTCCTCCCT 54 2316 2331 1625

826934 N/A N/A GTCCTTACATTGGGCA 71 2327 2342 1626

826935 N/A N/A CCTAGAAACTCCAGTC 75 2356 2371 1627

826938 N/A N/A GGCTATCTACTTAGCG 86 2568 2583 1628 826939 N/A N/A ATAGGAGCAGAGCTAT 101 2616 2631 1629

826948 N/A N/A GTGCAGATCTCAGATT 58 3013 3028 1630

826949 N/A N/A ACGGACTTCTAACAAA 73 3030 3045 1631

826950 N/A N/A AGGAGATAGGCCTGCA 73 3097 3112 1632

826951 N/A N/A ATTGATACACACCGGG 59 3115 3130 1633

826952 N/A N/A GTGCAGGAATGTGGTC 90 3185 3200 1634

826953 N/A N/A GGGAAGGCTGCCGCTT 41 3231 3246 1635

826954 N/A N/A CTGCACGCGGCAGGGA 62 3243 3258 1636

826955 N/A N/A AGGAGACTCGGGAGAG 90 3279 3294 1637

826958 N/A N/A AAGGAGTGGAGTGCCA 90 3350 3365 1638

826959 N/A N/A CCAAACTTAATGCAGC 54 3374 3389 1639

826968 N/A N/A CCAAAGGGAGTCTGTC 59 3981 3996 1640

826969 N/A N/A GCAAATAGAAGGAGCC 76 4001 4016 1641

826970 N/A N/A ACTGAGTGAGTAGAGG 67 4039 4054 1642

826971 N/A N/A GGGACAGCGAAGGACA 54 4079 4094 1643

826972 N/A N/A ACAATAGAGAGGGACA 99 4089 4104 1644

826973 N/A N/A GCCCACAGCTAGGAGG 66 4185 4200 1645

826974 N/A N/A AGTAGAAGGATCCTGA 50 4201 4216 1646

826975 N/A N/A TGGCAGCCAAACCTCT 69 4509 4524 1647

826978 N/A N/A TCCCAGGTTGCGGCTG 42 4555 4570 1648

826979 N/A N/A CCTGACCTCGAGCTGT 38 4639 4654 1649

826988 N/A N/A CTTATACTTTGCTGGC 25 5994 6009 1650

826989 N/A N/A GGTGGACGAGGTCTTA 27 6006 6021 1651

826990 N/A N/A CTGCACGGTCTCGCCT 43 6064 6079 1652

826991 N/A N/A CCCTAACCTCCACGAT 73 6150 6165 1653

826992 N/A N/A CTGTAAGGCCCCTGCC 43 6190 6205 1654

826993 N/A N/A GGGCAGGTCAACAGTG 30 6282 6297 1655

826994 N/A N/A GTAAAGGTCAGGCACC 42 6299 6314 1656

826995 N/A N/A CCGATGAAACCCAAAA 59 6336 6351 1657

826998 N/A N/A CGCTTACCACCTGCTC 38 6383 6398 1658

826999 N/A N/A AGGTATACAAAAGCAC 98 6425 6440 1659

827008 N/A N/A GTACACTAACTCACCA 53 6657 6672 1660

827009 N/A N/A AAAGATTTTGCACTCC 42 6679 6694 1661

827010 N/A N/A ACCCACACCCATAAAG 98 6691 6706 1662

827011 N/A N/A TACCAATATGTGCACA 44 6718 6733 1663

827012 N/A N/A TCGCACACATACCAAT 78 6727 6742 1664

827013 N/A N/A CAGCATCCAAAATCGC 44 6739 6754 1665

827014 N/A N/A ACCCACAGCATGACCA 68 6760 6775 1666

827015 N/A N/A ATGGAATATACGAAGG 35 6783 6798 1667

827018 N/A N/A ACGAAATGACCTGGCT 35 6870 6885 1668

827019 N/A N/A GGACATTATACAGACG 30 6893 6908 1669 827028 N/A N/A CACCAAGGCCTAAAGG 62 7268 7283 1670

827029 N/A N/A GGCCTCACCCGATTCA 47 7395 7410 1671

827030 N/A N/A TAAGAACTGTGCAGGC 5 7408 7423 1672

827031 N/A N/A GTCTAGGGCCCCGCAT 47 7435 7450 1673

827032 N/A N/A GGGCTTATGGCTTCCT 42 7473 7488 1674

827033 N/A N/A CTCCTAGGTGTTCTCT 38 7576 7591 1675

827034 N/A N/A TGCTTGGTGGGTGTTG 53 7638 7653 1676

827035 N/A N/A GTCAAGTGTGTAGTGC 14 7651 7666 1677

827038 N/A N/A GCTTTAGGGTGTAGCA 76 7684 7699 1678

827039 N/A N/A GTCTATAAAGCACCCA 36 7700 7715 1679

827048 N/A N/A GCTAACCTGAGATGCC 64 8501 8516 1680

827049 N/A N/A CACTAGGTTTGTGACT 82 8522 8537 1681

827050 N/A N/A AATCAAACACACTAGG 46 8531 8546 1682

827051 N/A N/A GGGTAAAAGAGCTTTG 25 8548 8563 1683

827052 N/A N/A CCCTACTTAAAGTGTA 83 8566 8581 1684

827053 N/A N/A CCTGACAAATTGTCCT 26 8651 8666 1685

827054 N/A N/A TTAACCTGTTTACCTC 38 8717 8732 1686

827055 N/A N/A TCCCGGTGATTCACTC 61 8744 8759 1687

827058 N/A N/A AACCGATCTCCTCGGT 110 8778 8793 1688

827059 N/A N/A CTCTAGCTCATCAACC 69 8790 8805 1689

827068 N/A N/A CCCTAGCTCAGGGCTT 48 9259 9274 1690

827069 N/A N/A ACAGGCAGGGACGGCC 32 9276 9291 1691

827070 N/A N/A ATGCAGGGTCTGCCCG 42 9307 9322 1692

827071 N/A N/A CTCAACAGTCCAGGCT 29 9376 9391 1693

827072 N/A N/A GGTTAGAGGGATGTCA 48 9395 9410 1694

827073 N/A N/A CACCATGGCAGGGTTA 45 9406 9421 1695

827074 N/A N/A AGCCGCCTAGGCCCCA 40 9449 9464 1696

827075 N/A N/A GCCCATGCTCATCCTA 62 9476 9491 1697

827078 N/A N/A CCAGGACGGAGCAGCA 60 9585 9600 1698

827079 N/A N/A AACTAGGCAAATTCCC 41 9775 9790 1699

827088 N/A N/A TAGAAATTCCTATAGC 46 10104 10119 1700

827089 N/A N/A CATGACCCCGTGATAC 50 10120 10135 1701

827090 N/A N/A TATGATAAATTAGCCG 57 10310 10325 1702

827091 N/A N/A GACGGAATGGCCGGGC 24 10443 10458 1703

827092 N/A N/A TGGCATAAGATAAGAC 34 10456 10471 1704

827093 N/A N/A CCAAAAGGTCTACTGC 30 10482 10497 1705

827094 N/A N/A TTCCATAGGGCCCCAC 50 10508 10523 1706

827095 N/A N/A CACTGATGAGCCCCCC 82 10601 10616 1707

827098 N/A N/A CCTGCCACCCTACGCG 44 10636 10651 1708

10637 10652

827099 N/A N/A TCCTGCCACCCTACGC 46 1709

10660 10675 10683 10698

827108 N/A N/A CCCTACACGCCTCCCT 56 10721 10736 1710

827109 N/A N/A TCAATCTGGTTGTCAC 55 10812 10827 1711

827110 N/A N/A TCTCATCACCAACTTC 42 10826 10841 1712

827111 N/A N/A AAGAATCCAGATCCCC 36 10943 10958 1713

827112 N/A N/A AGCGAATTTGCCTTTC 34 10974 10989 1714

827113 N/A N/A GCCCAGGAAAGCGAAT 55 10983 10998 1715

827114 N/A N/A TCGACTATCAGGAAGA 42 11015 11030 1716

827115 N/A N/A GTGAAGAGACCATCGA 41 11027 11042 1717

827118 N/A N/A GGGTAAGTGACCCAGC 48 11154 11169 1718

827119 N/A N/A GAAAGAGCACCCAAGC 51 11233 11248 1719

827128 N/A N/A TACCGTTAGCCACTGT 30 11418 11433 1720

827129 N/A N/A CTTCAGTGTAACACAG 41 11436 11451 1721

827130 N/A N/A CTTTAGGACAAACTTT 62 11503 11518 1722

827131 N/A N/A TCACTATGCATGAAGA 14 11522 11537 1723

827132 N/A N/A ATCTAGTTAGGTGGCA 32 11540 11555 1724

827133 N/A N/A AGGTAGGTTATAGTGT 22 11564 11579 1725

827134 N/A N/A TGCTATAAAGGTAGGT 18 11572 11587 1726

827135 N/A N/A TGACAAGTGGGCTGCC 44 11612 11627 1727

827138 N/A N/A GTACAGAAACACCCGG 63 11669 11684 1728

827139 N/A N/A AACGGAAGTAAGGTAC 47 11681 11696 1729

827148 N/A N/A CGTTTATCGAGCACTT 13 11915 11930 1730

827149 N/A N/A GGCAAGCATAGCTAGC 18 11930 11945 1731

11980 11995

827150 N/A N/A GTGTGTTTGGCATTCT 7 1732

13086 13101

827151 N/A N/A GGTGTGTTTGGCATTC 12 11981 11996 1733

827152 N/A N/A AGGTGTGTTTGGCATT 29 11982 11997 1734

827153 N/A N/A GCCTTAGGCATCAGCT 25 12045 12060 1735

827154 N/A N/A GTCTAGCTGGCTGGGC 42 12059 12074 1736

827155 N/A N/A AACCACCGTCTAGTCC 42 12126 12141 1737

827158 N/A N/A CCAGAACAAGGTTGTT 56 12181 12196 1738

827159 N/A N/A TCAGATTTAATGGGTC 43 12207 12222 1739

827168 N/A N/A AACCAGTTGATAGAGA 44 12409 12424 1740

827169 N/A N/A ATACGAATTCTATGAA 80 12432 12447 1741

827170 N/A N/A TCCCATTTATACGAAT 57 12440 12455 1742

827171 N/A N/A CCAGAATAGGCTCATC 33 12570 12585 1743

827172 N/A N/A GCTCAAATCAGGCAGC 89 12593 12608 1744

827173 N/A N/A GCAAAGAACGATGCTC 46 12605 12620 1745

827174 N/A N/A TAACAGAGTTGACTTG 100 12622 12637 1746

827175 N/A N/A TGGTATTAGAATGTGC 18 12681 12696 1747

827178 N/A N/A ACGACGAAACCTTGTA 48 12932 12947 1748 827179 N/A N/A GTGTTTGGCATTCTAG 19 13084 13099 1749

827188 N/A N/A ACCATATAACCCATCC 30 13715 13730 1750

827189 N/A N/A ATGATACGATCATTTT 34 13774 13789 1751

827190 N/A N/A CTGTACACAGCTAGTG 30 13800 13815 1752

827191 N/A N/A CGAACAGACCTACATT 41 13833 13848 1753

827192 N/A N/A CCGAACAGACCTACAT 32 13834 13849 1754

827193 N/A N/A AGCCGAACAGACCTAC 42 13836 13851 1755

827194 N/A N/A TGAACAGACCTACATT 52 14130 14145 1756

827195 N/A N/A ATGAACAGACCTACAT 60 14131 14146 1757

827198 N/A N/A AGTAGGCACTTTATGA 55 14143 14158 1758

827199 N/A N/A CCGTATGTAGTAGGCA 24 14151 14166 1759

827207 N/A N/A CTAGAACAACCGTATG 29 14160 14175 1760

827208 N/A N/A CCTAGAACAACCGTAT 34 14161 14176 1761

827209 N/A N/A CCCTAGAACAACCGTA 30 14162 14177 1762

827210 N/A N/A TCCCTAGAACAACCGT 21 14163 14178 1763

827211 N/A N/A TGGAAGATATCTTCCT 90 14229 14244 1764

827212 N/A N/A CCTTATGCTATACAGG 43 14311 14326 1765

827213 N/A N/A GAATACTGTATTGGAA 43 14349 14364 1766

827214 N/A N/A TGTTAGCAGGTTCTGC 48 14375 14390 1767

827217 N/A N/A ACAATGCGGTTCTTGG 38 14507 14522 1768

827218 N/A N/A CTAAGACTTATCTGGA 48 14629 14644 1769

827227 N/A N/A TGCATTTAGGCCGGGT 46 15520 15535 1770

827228 N/A N/A TTGCAGGGTACACAAC 51 15557 15572 1771

827229 N/A N/A CTGAACAAGGTTGCAG 46 15567 15582 1772

827230 N/A N/A TAGAACTAACAAACTG 53 15580 15595 1773

827231 N/A N/A GGCCTGAGGGATGTCA 52 15617 15632 1774

827232 N/A N/A CATCATGAAAGTCCAG 39 15641 15656 1775

827233 N/A N/A CACCGAAATCAAGAGT 58 15834 15849 1776

827234 N/A N/A TGCCGCTTGGCACCGA 96 15844 15859 1777

827237 N/A N/A ACCCAGGTCATCCCGC 106 15902 15917 1778

827238 N/A N/A ACCCGGAACTTGTCTG 45 15971 15986 1779

827247 N/A N/A CCCAAAAGCTTGGGCA 40 16752 16767 1780

827248 N/A N/A ACATAGGACCCCAGGG 37 16775 16790 1781

827249 N/A N/A TCCCACTAGTGGGCAC 53 16919 16934 1782

827250 N/A N/A TCCTAACTGAGTCCCA 32 16930 16945 1783

827251 N/A N/A TCACGCTGGAGGGTCC 31 16943 16958 1784

827252 N/A N/A TGTTAGCCCAGTTCTC 44 16961 16976 1785

827253 N/A N/A CTATCTTGGGCTGTTA 93 16972 16987 1786

827254 N/A N/A GGCAGACGAGCTCACT 11 17288 17303 1787

827257 N/A N/A GACTGAGGGATCAAGA 44 17431 17446 1788

827258 N/A N/A TGCCTAGGGTGGAAGG 42 17481 17496 1789 827267 N/A N/A GACTAGAGTCAGAGGG 43 17733 17748 1790

827268 N/A N/A TCTGGTTGCACTGGAC 28 17754 17769 1791

827269 N/A N/A TTCTGGTTGCACTGGA 38 17755 17770 1792

827270 N/A N/A GTTCTGGTTGCACTGG 15 17756 17771 1793

827271 N/A N/A TGTTCTGGTTGCACTG 37 17757 17772 1794

827272 N/A N/A TTGTTCTGGTTGCACT 32 17758 17773 1795

827273 N/A N/A GCGGACCCCGCGGAGA 39 17978 17993 1796

827274 N/A N/A ACCCAGGGAAGCGGAC 60 17988 18003 1797

827277 N/A N/A ATCCATGCTTCCAGCC 14 18214 18229 1798

827278 N/A N/A GATCCATGCTTCCAGC 19 18215 18230 1799

827286 N/A N/A AAAGACCAAGATCCAT 19 18224 18239 1800

827287 N/A N/A GGCCTTAGAAAGACCA 86 18551 18566 1801

827288 N/A N/A AGCTTTGATGCTAGGG 16 18574 18589 1802

827289 N/A N/A GACAGATGATCTCCTA 11 18600 18615 1803

827290 N/A N/A CCTCACTACTACTGCC 21 18643 18658 1804

827291 N/A N/A CCTCAACCCATGCCAC 51 18663 18678 1805

827292 N/A N/A ACTTAGGTTTAGTCCC 36 18677 18692 1806

827293 N/A N/A AGCTAGAGTGGGAACT 44 18690 18705 1807

827296 N/A N/A TGATACATCCAGAGTC 42 18726 18741 1808

827297 N/A N/A ATGATGTGATACATCC 58 18732 18747 1809

827305 N/A N/A ACACACTTGGTACAGC 23 18964 18979 1810

827306 N/A N/A GGTCTATAAAGTGCCC 23 18995 19010 1811

827307 N/A N/A AGAGTAATGAAACCCA 5 19022 19037 1812

827308 N/A N/A CTTCACCTGTTTGAGT 32 19041 19056 1813

827309 N/A N/A TCCTTAGCCAGGGCCG 15 19079 19094 1814

827310 N/A N/A AATGAATACCCGAGGG 25 19113 19128 1815

827311 N/A N/A GGACATTATAACAGGG 28 19139 19154 1816

827312 N/A N/A CTGCTATGAGCTGCTT 71 19159 19174 1817

827315 N/A N/A CTGTAGAGTGGAGCCA 44 19305 19320 1818

827316 N/A N/A AGGGAATGCCCCCTGT 95 19317 19332 1819

19542 19557

827325 N/A N/A GGCATAGGGAAAGCAC 30 1820

19624 19639

827326 N/A N/A GAGGCATCGGGTGAGG 47 19557 19572 1821

827327 N/A N/A GGACTTTCTGTTGATG 21 19598 19613 1822

827328 N/A N/A TGGACTTTCTGTTGAT 29 19599 19614 1823

19602 19617

827329 N/A N/A CCATGGACTTTCTGTT 32 1824

19685 19700

827330 N/A N/A TCCATGGACTTTCTGT 28 19603 19618 1825

827331 N/A N/A GTCCATGGACTTTCTG 41 19604 19619 1826

827332 N/A N/A GGACTTTCTGTTGAGG 30 19681 19696 1827

827335 N/A N/A CGCCTAAGTGCCAAGA 26 19711 19726 1828 827336 N/A N/A AGCAATGAGGCTCTGA 30 19738 19753 1829

827345 N/A N/A ATAGTTACATGTGGTG 25 19863 19878 1830

827346 N/A N/A AATAGTTACATGTGGT 30 19864 19879 1831

827347 N/A N/A GAATAGTTACATGTGG 13 19865 19880 1832

827348 N/A N/A TGGAATAGTTACATGT 18 19867 19882 1833

827349 N/A N/A CTGGAATAGTTACATG 25 19868 19883 1834

827350 N/A N/A ACTGGAATAGTTACAT 47 19869 19884 1835

827351 N/A N/A TAACTGGAATAGTTAC 93 19871 19886 1836

827354 N/A N/A GACTAACTGGAATAGT 73 19874 19889 1837

827355 N/A N/A GGACTAACTGGAATAG 33 19875 19890 1838

827364 N/A N/A GGAGGATACAGTTTGG 32 20588 20603 1839

827365 N/A N/A ACACTGAACGATTTTA 32 20608 20623 1840

827366 N/A N/A CTGGAGGCCGTGAGAG 45 20624 20639 1841

827367 N/A N/A ACCAACTTGATGCTGG 51 20636 20651 1842

827368 N/A N/A GGTGAGAAAGCCATGC 17 20660 20675 1843

827369 N/A N/A GAAAAGGGTGTAGTTA 35 20690 20705 1844

827370 N/A N/A AAACAGGTAGTGGTAA 27 20826 20841 1845

827371 N/A N/A GTGAAATGTCCACCAC 38 20962 20977 1846

827374 N/A N/A GCAAAAATGTGGGCCG 50 21420 21435 1847

827375 N/A N/A TCCATGTACAGGATCC 38 21529 21544 1848

827383 N/A N/A TAAGATGGCTAAAGTC 13 21733 21748 1849

827384 N/A N/A GGATTCATTAAGATGG 23 21741 21756 1850

827385 N/A N/A GGGATTCATTAAGATG 31 21742 21757 1851

827386 N/A N/A AGGGATTCATTAAGAT 14 21743 21758 1852

827387 N/A N/A CAGGGATTCATTAAGA 30 21744 21759 1853

827388 N/A N/A ACAGGGATTCATTAAG 38 21745 21760 1854

827389 N/A N/A TACAGGGATTCATTAA 42 21746 21761 1855

827390 N/A N/A TTACAGGGATTCATTA 55 21747 21762 1856

827393 N/A N/A TACGATTACAGGGATT 11 21752 21767 1857

827402 N/A N/A GCTCACTAGTACGATT 43 21761 21776 1858

827403 N/A N/A AGCTCACTAGTACGAT 46 21762 21777 1859

827404 N/A N/A GCCTTAGTAAGAGCTG 29 21782 21797 1860

827405 N/A N/A AGTTACTTACTTAATC 28 21896 21911 1861

827406 N/A N/A GACCAAACAAGTTACT 21 21905 21920 1862

827407 N/A N/A GGACCAAACAAGTTAC 27 21906 21921 1863

827408 N/A N/A ATTAGATGTGGGACCA 17 21916 21931 1864

827411 N/A N/A TATGAGAATCAGTATA 56 22311 22326 1865

827412 N/A N/A CTATGAGAATCAGTAT 44 22312 22327 1866

827420 N/A N/A GGAGAAACACGGATGG 10 22743 22758 1867

827421 N/A N/A TTCCATCAGCGGTGGA 52 22756 22771 1868

827422 N/A N/A GGCACAAGTTCCATCA 23 22764 22779 1869 827423 N/A N/A AGGCACAAGTTCCATC 34 22765 22780 1870

827424 N/A N/A CAGGCACAAGTTCCAT 32 22766 22781 1871

827425 N/A N/A GCAGGCACAAGTTCCA 19 22767 22782 1872

827426 N/A N/A AGCAGGCACAAGTTCC 14 22768 22783 1873

827427 N/A N/A AAGCAGGCACAAGTTC 44 22769 22784 1874

827430 N/A N/A GTGCTGCCCCCATGGA 37 22785 22800 1875

827431 N/A N/A GGGACAAGTATAATGG 58 22804 22819 1876

827440 N/A N/A AAGCAGGTCATTGTTT 28 23071 23086 1877

827441 N/A N/A TGGTTGTACGGTCTCA 19 23086 23101 1878

827442 N/A N/A GCAAAGACGGAAAGGG 34 23180 23195 1879

827443 N/A N/A GCGACGGGAGCCAGGC 36 23194 23209 1880

827444 N/A N/A CTTGGAGCTAGCGACG 20 23204 23219 1881

827445 N/A N/A TGCTACCCTGCCATCT 24 23218 23233 1882

827446 N/A N/A TGCCACACGGCACAGA 64 23248 23263 1883

827447 N/A N/A GCAAATCACAGGTTCC 19 23302 23317 1884

827449 N/A N/A CATCAGTATGTCTCAG 18 23412 23427 1885

827450 N/A N/A GAGGAAGATCAGTACC 39 23451 23466 1886

827459 N/A N/A CCCTAACTGCCCATGC 20 23711 23726 1887

827460 N/A N/A CGGCATTGACTTCCGT 48 23775 23790 1888

827461 N/A N/A TCACACATCTACCTTC 34 23828 23843 1889

827462 N/A N/A TTTACTCACACTCCCT 24 23936 23951 1890

827463 N/A N/A CCTACAGGACTTGTGC 26 24009 24024 1891

827464 N/A N/A AGAGAGAGTAGGGTCA 64 24094 24109 1892

827465 N/A N/A TGAGAGTAATTCCTTA 50 24117 24132 1893

827466 N/A N/A CACCGTTGTTGATTCC 39 24212 24227 1894

827469 N/A N/A GCTCAAGGTAAGTACA 55 24276 24291 1895

827470 N/A N/A GCTCTAGGAGGTGAGC 83 24290 24305 1896

827479 N/A N/A TCCTACTGGCCTCGCC 49 25036 25051 1897

827480 N/A N/A TTCCAGGTTGTATCTC 53 25067 25082 1898

827481 N/A N/A ACATACACCAAGAGAT 16 25127 25142 1899

827482 N/A N/A CCTATGAACCCACATA 107 25138 25153 1900

827483 N/A N/A GGCTGCCACGGAATCA 50 25265 25280 1901

827484 N/A N/A ATACACAACCCCTCCA 104 25316 25331 1902

827485 N/A N/A GTGAATACACACCTGG 48 25442 25457 1903

827486 N/A N/A CCTCAGTGAGTACTGG 52 25602 25617 1904

827489 N/A N/A GCCTGCAGGTTGTTTT 56 26100 26115 1905

827490 N/A N/A TGAGGAACCGCTGGAG 41 26479 26494 1906

827499 N/A N/A TCCAAACTTTACTGAT 41 26787 26802 1907

827500 N/A N/A TAAGGAGGAGATTCCA 38 26809 26824 1908

827501 N/A N/A GTCCTATACCAGGATA 47 26823 26838 1909

827502 N/A N/A AGAGATTTGTCTAGTC 12 26836 26851 1910 827503 N/A N/A ACTCAACTGTAGTCAA 36 26858 26873 1911

827504 N/A N/A TGGCACACGACTTCCC 28 26883 26898 1912

827505 N/A N/A TGCAAACCCTTGCAGC 80 26942 26957 1913

827506 N/A N/A CACTACCATGTCCCCT 60 27075 27090 1914

827509 N/A N/A TGCGGAGCCAGCCCAG 43 27202 27217 1915

827510 N/A N/A CACGACTGGAAAGTCC 42 27232 27247 1916

827519 N/A N/A TAATGGAACTGTAGAT 31 27734 27749 1917

827520 N/A N/A TATATGATGATTGCAC 35 27883 27898 1918

827521 N/A N/A TGCCTGGCTTGAGTGA 47 27944 27959 1919

827522 N/A N/A GAGTACAAGGTTTATT 22 28237 28252 1920

827523 N/A N/A TGAGTACAAGGTTTAT 26 28238 28253 1921

827524 N/A N/A ATGAGTACAAGGTTTA 7 28239 28254 1922

827525 N/A N/A GACTTGCTAATGAGTA 36 28248 28263 1923

827526 N/A N/A GGACTTGCTAATGAGT 58 28249 28264 1924

827529 N/A N/A TTGGGACTTGCTAATG 53 28252 28267 1925

827530 N/A N/A GCTTGGGACTTGCTAA 43 28254 28269 1926

827538 N/A N/A TTGCTACCATACGGAT 23 28747 28762 1927

827539 N/A N/A ATTGCTACCATACGGA 38 28748 28763 1928

827540 N/A N/A TATTGCTACCATACGG 31 28749 28764 1929

827541 N/A N/A CTATTGCTACCATACG 17 28750 28765 1930

827542 N/A N/A GCTATTGCTACCATAC 31 28751 28766 1931

827543 N/A N/A CTGCTATTGCTACCAT 25 28753 28768 1932

827544 N/A N/A AGGCACTGCTATTGCT 42 28758 28773 1933

827545 N/A N/A CCATACAAGGGAGTGT 66 28799 28814 1934

827548 N/A N/A TGCTGCTAGGGATGTA 45 29051 29066 1935

827549 N/A N/A ACCCATTAAGATGTGT 92 29468 29483 1936

827558 N/A N/A CCACACCCAAGAGGTC 42 30527 30542 1937

827559 N/A N/A TCCTAGGGCACCTCAG 100 30554 30569 1938

827560 N/A N/A TAGCAGTACCCTGTGG 56 30590 30605 1939

827561 N/A N/A GGACACTAACCTGCAT 47 30669 30684 1940

827562 N/A N/A ACCCAACCTGTACCCG 57 30692 30707 1941

827563 N/A N/A GGCTCGGTAACCTGTA 56 30712 30727 1942

827564 N/A N/A TCCCAAATGCTTGGCT 58 30724 30739 1943

827565 N/A N/A GGCCACAGCATTACAT 100 30879 30894 1944

827568 N/A N/A GGCTTACAGGGATAGG 61 30934 30949 1945

827569 N/A N/A CCCATATGCTTCAGGC 61 30947 30962 1946

827578 N/A N/A CCGACAGCCGCCCTGC 43 31323 31338 1947

827579 N/A N/A GGCCGAGCTCCTTCTT 71 31435 31450 1948

827580 N/A N/A ACCTTATGCCCCGGCC 56 31447 31462 1949

827581 N/A N/A CCCCAGAGACCTTATG 69 31455 31470 1950

827582 N/A N/A ACTGATAACTGGCCCA 58 31549 31564 1951 827583 N/A N/A CACCAAGCTGTCTCCC 50 31655 31670 1952

827584 N/A N/A GACGATGGGACAGAGG 76 31711 31726 1953

827585 N/A N/A GAGGAGAGGTACATTG 60 31726 31741 1954

Table 5: Percent level of human α-ENaC mRNA

SEQ SEQ SEQ SEQ

a-ENaC SEQ

Compound ID: 1 ID: 1 ID: 2 ID 2:

Sequence ID Number Start Stop (% Start Stop

control) NO Site Site Site Site

797469 N/A N/A GGATGATGTGATACAT 5 18734 18749 400

797524 N/A N/A ACCATACGGATGAACC 23 28742 28757 455

826071 5 20 TTTAGACGCAGACAGG 85 4266 4281 466

826074 25 40 GGCGGACTCTGGGCAG 74 4286 4301 611

826075 28 43 GAAGGCGGACTCTGGG 81 4289 4304 612

826076 29 44 AGAAGGCGGACTCTGG 82 4290 4305 613

826077 31 46 TGAGAAGGCGGACTCT 85 4292 4307 614

826078 32 47 CTGAGAAGGCGGACTC 70 4293 4308 615

826079 33 48 CCTGAGAAGGCGGACT 79 4294 4309 616

826091 53 68 GGTGAACTGGGAGTAC 111 4314 4329 468

826094 73 88 AAGGAGGGCTCCCGAG 66 4334 4349 618

826095 74 89 GAAGGAGGGCTCCCGA 90 4335 4350 619

826096 81 96 TCCGAAGGAAGGAGGG 81 4342 4357 620

826097 83 98 TTTCCGAAGGAAGGAG 95 4344 4359 621

826098 85 100 GTTTTCCGAAGGAAGG 69 4346 4361 622

826099 88 103 GGAGTTTTCCGAAGGA 105 4349 4364 623

826111 163 178 GCGACAGGAATCTCAT 90 4424 4439 470

826114 167 182 GGAAGCGACAGGAATC 60 4428 4443 626

826115 169 184 ATGGAAGCGACAGGAA 63 4430 4445 627

826116 170 185 GATGGAAGCGACAGGA 53 4431 4446 628

826117 171 186 GGATGGAAGCGACAGG 78 4432 4447 629

826118 172 187 GGGATGGAAGCGACAG 38 4433 4448 630

826119 175 190 CCAGGGATGGAAGCGA 56 4436 4451 631

826131 216 231 CAGGTGCAGCGGCCTG 116 4477 4492 472

826134 226 241 GTTCCCCTGACAGGTG 84 N/A N/A 634

826135 228 243 TTGTTCCCCTGACAGG 70 N/A N/A 635

826136 229 244 CTTGTTCCCCTGACAG 60 N/A N/A 636

826137 230 245 GCTTGTTCCCCTGACA 16 N/A N/A 637

826138 232 247 CAGCTTGTTCCCCTGA 52 N/A N/A 638

826139 233 248 CCAGCTTGTTCCCCTG 61 N/A N/A 639

826151 283 298 CCCCTCCATGAGACCT 26 5211 5226 474

826154 292 307 CAGCTTGTTCCCCTCC 14 5220 5235 642 826155 310 325 GCTAGAGTCCTGCTCC 43 5238 5253 643

826156 312 327 GGGCTAGAGTCCTGCT 78 5240 5255 644

826157 315 330 GGAGGGCTAGAGTCCT 94 5243 5258 645

826158 320 335 ACTGTGGAGGGCTAGA 67 5248 5263 646

826159 321 336 GACTGTGGAGGGCTAG 92 5249 5264 647

826171 355 370 CTCACGCTTGTTCCCC 34 5283 5298 476

826174 360 375 TGCTCCTCACGCTTGT 13 5288 5303 650

826175 362 377 CCTGCTCCTCACGCTT 40 5290 5305 651

826176 363 378 CCCTGCTCCTCACGCT 20 5291 5306 652

826177 386 401 GCGCCGCAGGTTCGGG 49 5314 5329 653

826178 405 420 TCCGCCGTGGGCTGCT 44 5333 5348 654

826179 407 422 CCTCCGCCGTGGGCTG 36 5335 5350 655

826191 441 456 CGGTAGGAGCGGTGGA 55 5369 5384 478

826194 446 461 GCTCTCGGTAGGAGCG 60 5374 5389 658

826195 448 463 GAGCTCTCGGTAGGAG 61 5376 5391 959

826196 451 466 GAAGAGCTCTCGGTAG 48 5379 5394 660

826197 453 468 TCGAAGAGCTCTCGGT 36 5381 5396 661

826198 456 471 AACTCGAAGAGCTCTC 36 5384 5399 662

826199 457 472 GAACTCGAAGAGCTCT 49 5385 5400 663

826210 566 581 TCATGCCAAAGGTGCA 27 5494 5509 480

826213 575 590 GCCAGTACATCATGCC 9 5503 5518 666

826214 577 592 TTGCCAGTACATCATG 40 5505 5520 667

826215 580 595 GAATTGCCAGTACATC 36 5508 5523 668

826216 581 596 CGAATTGCCAGTACAT 26 5509 5524 669

826217 582 597 CCGAATTGCCAGTACA 24 5510 5525 670

826218 585 600 AGGCCGAATTGCCAGT 54 5513 5528 671

826230 607 622 GCTGAAGTACTCTCCG 47 5535 5550 482

826233 626 641 TGTTGAGGCTGACGGG 5 5554 5569 674

826234 628 643 GATGTTGAGGCTGACG 31 5556 5571 675

826235 639 654 GAGTTGAGGTTGATGT 34 5567 5582 676

826236 641 656 CCGAGTTGAGGTTGAT 22 5569 5584 677

826237 643 658 GTCCGAGTTGAGGTTG 30 5571 5586 678

826238 644 659 TGTCCGAGTTGAGGTT 35 5572 5587 679

826250 703 718 AATTTCCGGGTACCTG 29 16288 16303 484

826253 731 746 TGCGGTCCAGCTCCTC 17 16316 16331 682

826254 734 749 TGATGCGGTCCAGCTC 41 16319 16334 683

826255 737 752 CTGTGATGCGGTCCAG 49 16322 16337 684

826256 739 754 CTCTGTGATGCGGTCC 21 16324 16339 685

826257 740 755 GCTCTGTGATGCGGTC 26 16325 16340 686

826258 759 774 TACAGGTCAAAGAGCG 24 16344 16359 687

826268 792 807 CCGGCCACGAGAGTGG 93 16377 16392 486 826271 798 813 CGGGAGCCGGCCACGA 36 16383 16398 690

826272 800 815 TGCGGGAGCCGGCCAC 39 16385 16400 691

826273 803 818 GGCTGCGGGAGCCGGC 61 16388 16403 692

826274 804 819 CGGCTGCGGGAGCCGG 71 16389 16404 693

826275 805 820 ACGGCTGCGGGAGCCG 90 16390 16405 694

826276 807 822 CGACGGCTGCGGGAGC 68 16392 16407 695

826288 830 845 GCGGCAGAGTCCCCCG 62 16415 16430 488

826291 834 849 GGGTGCGGCAGAGTCC 22 16419 16434 698

826292 858 873 GGCGGGACCCTCAGGC 38 16443 16458 699

826293 877 892 ACGGGCCCCGTGAGGC 46 16462 16477 700

826294 879 894 CGACGGGCCCCGTGAG 54 16464 16479 701

826295 882 897 GCTCGACGGGCCCCGT 37 16467 16482 702

826296 883 898 GGCTCGACGGGCCCCG 46 16468 16483 703

826308 916 931 GTTGTTGTCCCGCAAG 24 16501 16516 490

826311 952 967 GAAGCCGATCTTCCAG 22 16537 16552 706

826312 953 968 GGAAGCCGATCTTCCA 72 16538 16553 707

826313 954 969 TGGAAGCCGATCTTCC 71 16539 16554 708

826314 956 971 GCTGGAAGCCGATCTT 37 16541 16556 709

826315 958 973 CAGCTGGAAGCCGATC 59 16543 16558 710

826316 968 983 TCTGGTTGCACAGCTG 30 N/A N/A 711

826326 980 995 AGTCCGATTTGTTCTG 36 17766 17781 492

826329 983 998 AGCAGTCCGATTTGTT 29 17769 17784 714

826330 985 1000 GAAGCAGTCCGATTTG 51 17771 17786 715

826331 986 1001 AGAAGCAGTCCGATTT 33 17772 17787 716

826332 987 1002 TAGAAGCAGTCCGATT 61 17773 17788 717

826333 988 1003 GTAGAAGCAGTCCGAT 44 17774 17789 718

826334 989 1004 GGTAGAAGCAGTCCGA 18 17775 17790 719

826346 1018 1033 CACCGCATCCACCCCT 42 17804 17819 494

826349 1022 1037 CCCTCACCGCATCCAC 30 17808 17823 722

826350 1025 1040 ACTCCCTCACCGCATC 39 17811 17826 723

826351 1026 1041 CACTCCCTCACCGCAT 48 17812 17827 724

826352 1028 1043 ACCACTCCCTCACCGC 32 17814 17829 725

826353 1032 1047 CGGTACCACTCCCTCA 28 17818 17833 726

826354 1033 1048 GCGGTACCACTCCCTC 46 17819 17834 727

826366 1115 1130 CGAAGATGAAGTTGCC 67 17901 17916 496

826369 1123 1138 GCGGCAGGCGAAGATG 62 17909 17924 730

826370 1126 1141 GAAGCGGCAGGCGAAG 51 17912 17927 731

826371 1129 1144 GTTGAAGCGGCAGGCG 43 17915 17930 732

826372 1130 1145 GGTTGAAGCGGCAGGC 20 17916 17931 733

826373 1134 1149 ACCTGGTTGAAGCGGC 28 17920 17935 734

826374 1136 1151 AGACCTGGTTGAAGCG 31 17922 17937 735 826386 1164 1179 AAGTGAGAGTAATTCG 42 N/A N/A 498

826389 1232 1247 AAGACATCCAGAGGTT 79 24188 24203 738

826390 1250 1265 TGTTGATTCCAGGCAT 27 24206 24221 739

826391 1251 1266 TTGTTGATTCCAGGCA 29 24207 24222 740

826392 1252 1267 GTTGTTGATTCCAGGC 16 24208 24223 741

826393 1254 1269 CCGTTGTTGATTCCAG 11 24210 24225 742

826394 1255 1270 ACCGTTGTTGATTCCA 9 24211 24226 743

826406 1282 1297 CTGCTCTGCGCGCAGC 56 24579 24594 500

826409 1285 1300 ATTCTGCTCTGCGCGC 16 24582 24597 746

826410 1286 1301 CATTCTGCTCTGCGCG 30 24583 24598 747

826411 1287 1302 TCATTCTGCTCTGCGC 20 24584 24599 748

826412 1323 1338 CGGGCCCCAGTCACTG 55 24620 24635 749

826413 1325 1340 CCCGGGCCCCAGTCAC 51 24622 24637 750

826414 1327 1342 TACCCGGGCCCCAGTC 38 24624 24639 751

826426 1356 1371 AAGGCAGGTTCATCCT 122 24653 24668 502

826429 1366 1381 ATCATCCATAAAGGCA 32 24663 24678 754

826430 1379 1394 AGTTAAAGCCACCATC 37 24676 24691 755

826431 1383 1398 CGCAAGTTAAAGCCAC 33 24680 24695 756

826432 1385 1400 GCCGCAAGTTAAAGCC 43 24682 24697 757

826433 1387 1402 AGGCCGCAAGTTAAAG 56 24684 24699 758

826434 1388 1403 CAGGCCGCAAGTTAAA 42 24685 24700 759

826446 1416 1431 TTCCTCATGCTGATGG 33 24713 24728 504

826449 1446 1461 TAATCGCCCCCAAGTC 22 25166 25181 762

826450 1447 1462 ATAATCGCCCCCAAGT 61 25167 25182 763

826451 1448 1463 CATAATCGCCCCCAAG 17 25168 25183 764

826452 1450 1465 GCCATAATCGCCCCCA 24 25170 25185 765

826453 1451 1466 CGCCATAATCGCCCCC 25 25171 25186 766

826454 1453 1468 GTCGCCATAATCGCCC 47 25173 25188 767

826466 1500 1515 GAAGGGTAAAGGTTCT 60 25220 25235 506

826469 1528 1543 GTGAATACACACCTGC 45 N/A N/A 770

826470 1530 1545 GAGTGAATACACACCT 58 25444 25459 771

826471 1531 1546 GGAGTGAATACACACC 69 25445 25460 772

826472 1534 1549 GCAGGAGTGAATACAC 73 25448 25463 773

826473 1553 1568 TGATCATGCTCTCCTG 29 25467 25482 774

826474 1554 1569 TTGATCATGCTCTCCT 19 25468 25483 775

826485 1579 1594 GAAGATGTAGGCACAG 56 25493 25508 507

826488 1583 1598 GATAGAAGATGTAGGC 26 25497 25512 778

826489 1584 1599 GGATAGAAGATGTAGG 35 25498 25513 779

826490 1585 1600 CGGATAGAAGATGTAG 47 25499 25514 780

826491 1587 1602 CGCGGATAGAAGATGT 47 25501 25516 781

826492 1588 1603 CCGCGGATAGAAGATG 71 25502 25517 782 826493 1589 1604 GCCGCGGATAGAAGAT 62 25503 25518 783

826505 1661 1676 CAACCTGGAGCTTATA 54 30607 30622 509

826508 1669 1684 GGAGAAGTCAACCTGG 10 30615 30630 786

826509 1675 1690 GTCTGAGGAGAAGTCA 32 30621 30636 787

826510 1696 1711 CTTGGTGAAACAGCCC 53 30642 30657 788

826511 1702 1717 CCGGCACTTGGTGAAA 92 30648 30663 789

826512 1708 1723 TGGCTTCCGGCACTTG 25 30654 30669 790

826513 1709 1724 ATGGCTTCCGGCACTT 34 30655 30670 791

826525 1736 1751 CAGAGAGCTGGTAGCT 72 30787 30802 511

826565 1993 2008 GACGAGCTCAGCCATC 39 31822 31837 513

826568 2001 2016 AGGTCAAAGACGAGCT 29 31830 31845 795

826569 2002 2017 CAGGTCAAAGACGAGC 28 31831 31846 796

826570 2003 2018 GCAGGTCAAAGACGAG 42 31832 31847 797

826571 2009 2024 TGACCAGCAGGTCAAA 106 31838 31853 798

826572 2011 2026 GATGACCAGCAGGTCA 71 31840 31855 799

826573 2032 2047 TCGGAGCAGCATGAGG 37 31861 31876 800

826584 2046 2061 CGGCTTCGGAACCTTC 41 31875 31890 514

826587 2049 2064 TATCGGCTTCGGAACC 43 31878 31893 803

826588 2050 2065 GTATCGGCTTCGGAAC 30 31879 31894 804

826589 2051 2066 AGTATCGGCTTCGGAA 27 31880 31895 805

826590 2053 2068 CCAGTATCGGCTTCGG 23 31882 31897 806

826591 2054 2069 ACCAGTATCGGCTTCG 12 31883 31898 807

826592 2055 2070 GACCAGTATCGGCTTC 36 31884 31899 808

826604 2217 2232 CCCAGGGTGGCATAGG 46 32046 32061 516

826607 2282 2297 AGGGCCCCCCCAGAGG 97 32111 32126 811

826608 2284 2299 TCAGGGCCCCCCCAGA 70 32113 32128 812

826609 2308 2323 GTGTGAGAAACCTCTC 34 32137 32152 813

826610 2310 2325 TGGTGTGAGAAACCTC 58 32139 32154 814

826611 2313 2328 CCTTGGTGTGAGAAAC 46 32142 32157 815

826612 2314 2329 GCCTTGGTGTGAGAAA 37 32143 32158 816

826624 2390 2405 TGGGCGGCTCTGAGAG 52 32219 32234 518

826627 2399 2414 ACGGCAGTTTGGGCGG 30 32228 32243 819

826628 2400 2415 AACGGCAGTTTGGGCG 37 32229 32244 820

826629 2401 2416 CAACGGCAGTTTGGGC 36 32230 32245 821

826630 2403 2418 ATCAACGGCAGTTTGG 35 32232 32247 822

826631 2405 2420 ACATCAACGGCAGTTT 16 32234 32249 823

826632 2407 2422 ACACATCAACGGCAGT 15 32236 32251 824

826644 2476 2491 CTGGGCAGCTTCATCA 42 32305 32320 520

826647 2491 2506 GGAGCCAAGGCACTTC 13 32320 32335 827

826648 2492 2507 TGGAGCCAAGGCACTT 29 32321 32336 828

826649 2502 2517 GGTACAGGGCTGGAGC 52 32331 32346 829 826650 2520 2535 TCAGAGGCAGTACCAA 30 32349 32364 830

826651 2523 2538 TGTTCAGAGGCAGTAC 33 32352 32367 831

826652 2533 2548 GAAACCAGAGTGTTCA 48 32362 32377 832

826665 2579 2594 CTTGGCTGATCCAAGG 61 32408 32423 835

826666 2580 2595 GCTTGGCTGATCCAAG 45 32409 32424 836

826667 2581 2596 CGCTTGGCTGATCCAA 27 32410 32425 837

826668 2582 2597 TCGCTTGGCTGATCCA 6 32411 32426 838

826669 2583 2598 TTCGCTTGGCTGATCC 34 32412 32427 839

826670 2584 2599 TTTCGCTTGGCTGATC 30 32413 32428 840

826682 2612 2627 TAGGAAAGTTCCTTGT 83 32441 32456 523

826685 2623 2638 CAGCGGTTTCTTAGGA 16 32452 32467 843

826686 2625 2640 ATCAGCGGTTTCTTAG 42 32454 32469 844

826687 2627 2642 TTATCAGCGGTTTCTT 22 32456 32471 845

826688 2629 2644 GGTTATCAGCGGTTTC 9 32458 32473 846

826689 2632 2647 CCTGGTTATCAGCGGT 17 32461 32476 847

826690 2634 2649 GTCCTGGTTATCAGCG 25 32463 32478 848

826702 2681 2696 TGGGCAGGAAACCCGT 58 32510 32525 525

826705 2692 2707 TAAGCCGTCGCTGGGC 34 32521 32536 851

826706 2693 2708 TTAAGCCGTCGCTGGG 47 32522 32537 852

826707 2696 2711 GGCTTAAGCCGTCGCT 24 32525 32540 853

826708 2698 2713 CTGGCTTAAGCCGTCG 42 32527 32542 854

826709 2700 2715 GGCTGGCTTAAGCCGT 90 32529 32544 855

826710 2701 2716 GGGCTGGCTTAAGCCG 83 32530 32545 856

826722 2835 2850 CCTAGCCCTCGGGAGT 71 32664 32679 527

826725 2846 2861 TCTGCTCTAGCCCTAG 52 32675 32690 859

826726 2847 2862 GTCTGCTCTAGCCCTA 35 32676 32691 860

826727 2850 2865 CGGGTCTGCTCTAGCC 61 32679 32694 861

826728 2852 2867 CCCGGGTCTGCTCTAG 84 32681 32696 862

826729 2854 2869 TACCCGGGTCTGCTCT 63 32683 32698 863

826730 2855 2870 TTACCCGGGTCTGCTC 54 32684 32699 864

826742 2949 2964 TGTAGAGGTATGAAAG 55 32778 32793 529

826745 2954 2969 AGACATGTAGAGGTAT 17 32783 32798 867

826746 2955 2970 CAGACATGTAGAGGTA 7 32784 32799 868

826747 2959 2974 CAAGCAGACATGTAGA 31 32788 32803 869

826748 2960 2975 TCAAGCAGACATGTAG 30 32789 32804 870

826749 2961 2976 CTCAAGCAGACATGTA 24 32790 32805 871

826750 2963 2978 ATCTCAAGCAGACATG 39 32792 32807 872

826764 3016 3031 ATGCATAGGAGTTCTC 8 32845 32860 875

826765 3017 3032 GATGCATAGGAGTTCT 30 32846 32861 876

826766 3019 3034 GGGATGCATAGGAGTT 32 32848 32863 877

826767 3021 3036 AAGGGATGCATAGGAG 31 32850 32865 878 826768 3022 3037 TAAGGGATGCATAGGA 25 32851 32866 879

826769 3023 3038 CTAAGGGATGCATAGG 35 32852 32867 880

826781 3117 3132 CTACGGGAGCCCAGGA 32 32946 32961 532

826784 3121 3136 TGTGCTACGGGAGCCC 8 32950 32965 883

826785 3122 3137 GTGTGCTACGGGAGCC 20 32951 32966 884

826786 3123 3138 AGTGTGCTACGGGAGC 15 32952 32967 885

826787 3124 3139 TAGTGTGCTACGGGAG 21 32953 32968 886

826788 3125 3140 ATAGTGTGCTACGGGA 29 32954 32969 887

826789 3126 3141 TATAGTGTGCTACGGG 30 32955 32970 888

826800 3145 3160 GCAACACTCCAGCAGA 17 32974 32989 534

826803 3153 3168 GTGCAACAGCAACACT 36 32982 32997 890

826804 3154 3169 GGTGCAACAGCAACAC 33 32983 32998 891

826805 3155 3170 TGGTGCAACAGCAACA 30 32984 32999 892

826806 3156 3171 ATGGTGCAACAGCAAC 11 32985 33000 893

826807 3157 3172 TATGGTGCAACAGCAA 21 32986 33001 894

826808 3158 3173 GTATGGTGCAACAGCA 20 32987 33002 895

826818 3213 3228 TGACCGCAAGGCACTT 30 33042 33057 536

826821 3216 3231 CCCTGACCGCAAGGCA 7 33045 33060 897

826822 3217 3232 TCCCTGACCGCAAGGC 28 33046 33061 898

826823 3218 3233 GTCCCTGACCGCAAGG 25 33047 33062 899

826824 3219 3234 AGTCCCTGACCGCAAG 33 33048 33063 900

826825 3220 3235 CAGTCCCTGACCGCAA 17 33049 33064 901

826826 3222 3237 TTCAGTCCCTGACCGC 19 33051 33066 902

826837 3236 3251 ATAAACGGGCAAGATT 57 33065 33080 538

826840 3239 3254 TACATAAACGGGCAAG 40 33068 33083 905

826841 3242 3257 GCATACATAAACGGGC 35 33071 33086 906

826842 3244 3259 GAGCATACATAAACGG 27 33073 33088 907

826843 3249 3264 ACATGGAGCATACATA 69 33078 33093 908

826844 3250 3265 GACATGGAGCATACAT 42 33079 33094 909

826845 3251 3266 AGACATGGAGCATACA 48 33080 33095 910

826857 N/A N/A TCCCCTTGGAAGGGAC 109 2713 2728 540

826860 N/A N/A TGATACCTCCCCTTGG 90 2720 2735 913

826861 N/A N/A ATGATACCTCCCCTTG 84 2721 2736 914

826862 N/A N/A GCTCATGATACCTCCC 68 2725 2740 915

826863 N/A N/A ACTGCTCATGATACCT 89 2728 2743 916

826864 N/A N/A ATACTGCTCATGATAC 70 2730 2745 917

826865 N/A N/A GATACTGCTCATGATA 87 2731 2746 918

826877 N/A N/A GTCCTAGCACCTCCCT 15 4868 4883 542

826880 N/A N/A CGAGTTTTGTCCTAGC 7 4876 4891 921

826881 N/A N/A TCGAGTTTTGTCCTAG 25 4877 4892 922

826882 N/A N/A CTTTCGAGTTTTGTCC 36 4880 4895 923 826883 N/A N/A CACCTTTCGAGTTTTG 26 4883 4898 924

826884 N/A N/A GCCACCTTTCGAGTTT 30 4885 4900 925

826885 N/A N/A GGGCCACCTTTCGAGT 27 4887 4902 926

826897 N/A N/A CTTCCCTAGAACGGCC 37 4923 4938 544

826900 N/A N/A GCCGGAGCTGGGCTTC 36 4935 4950 929

826901 N/A N/A TGCCGGAGCTGGGCTT 80 4936 4951 930

826902 N/A N/A GTGCCGGAGCTGGGCT 67 4937 4952 931

826903 N/A N/A AAGTGCCGGAGCTGGG 30 4939 4954 932

826904 N/A N/A AAAAGTGCCGGAGCTG 45 4941 4956 933

826905 N/A N/A CCAAAAGTGCCGGAGC 28 4943 4958 934

826917 N/A N/A GAACCCGAGTGAGGCT 39 5059 5074 546

826920 N/A N/A CCCCTGGAACCCGAGT 25 5065 5080 937

826921 N/A N/A CACCCCTGGAACCCGA 50 5067 5082 938

826922 N/A N/A CCCGGAGTGGATTGGG 100 5138 5153 939

826923 N/A N/A GCCCCGGAGTGGATTG 50 5140 5155 940

826924 N/A N/A GAGCCCCGGAGTGGAT 46 5142 5157 941

826925 N/A N/A ATGAGCCCCGGAGTGG 38 5144 5159 942

826937 N/A N/A AGCCGGGAAGGCCTCC 124 2486 2501 548

826940 N/A N/A TGCTTACCTTGATACT 113 2741 2756 945

826941 N/A N/A CCAAACCAGGTTCCCT 125 2757 2772 946

826942 N/A N/A AGCCGGTGTCAACCAG 103 2777 2792 947

826943 N/A N/A AAAGTGAAAGCCGGTG 112 2785 2800 948

826944 N/A N/A TGCGACTTCTTAAAGT 84 2796 2811 949

826945 N/A N/A GCTCAGGGTCCAACCT 109 2844 2859 950

826957 N/A N/A GCCAAGTGGTGAGCAA 42 3338 3353 550

826960 N/A N/A CGTTGATGGGCTATAT 99 3408 3423 953

826961 N/A N/A CGCCTAGACAGGCCCT 44 3440 3455 954

826962 N/A N/A ACGCAGGACACTGTGG 80 3555 3570 955

826963 N/A N/A AGGCAGCGCGAGGGCC 101 3571 3586 956

826964 N/A N/A GTGTAATCGCCCCTGC 90 3622 3637 957

826965 N/A N/A GGCCCTAGGACATTCT 79 3674 3689 958

826977 N/A N/A TGGGACTGGTTCCTTT 94 4536 4551 552

826980 N/A N/A GGGACTAACCGACCTG 98 5631 5646 961

826981 N/A N/A TTCCAGGCGCAGGCAC 39 5662 5677 862

826982 N/A N/A CAGTAAGCTGGAGGCT 92 5785 5800 963

826983 N/A N/A CGCCAGTCCAGTAAGC 85 5793 5808 964

826984 N/A N/A GCTAGGATGGCTCCAC 27 5819 5834 965

826985 N/A N/A CCACACTCTGGGTGAG 36 5843 5858 966

826997 N/A N/A CCAGACCCAACATTGG 84 6361 6376 554

827000 N/A N/A TCCCAAGGTGTGGCAT 15 6462 6477 969

827001 N/A N/A TTGAAGCAGGTGTTCC 57 6475 6490 970 827002 N/A N/A TGCCAGGTGCCTAGCC 44 6502 6517 971

827003 N/A N/A CAATAAAGGGCTTATG 64 6538 6553 972

827004 N/A N/A AACTACCTGGCCTTCA 69 6552 6567 973

827005 N/A N/A GGCTTATATGCCTGTC 68 6605 6620 974

827017 N/A N/A CTTTCTTAGTCCGTAA 48 6815 6830 556

827020 N/A N/A AGGAAATGGTCCCTAC 70 6912 6927 977

827021 N/A N/A GTGCACACGGCAGCTT 52 6932 6947 978

827022 N/A N/A CCCAAGACACCTTCGC 33 6955 6970 979

827023 N/A N/A TAGCACCGGGCTTGTA 51 6994 7009 980

827024 N/A N/A AACAGGATGAGTCACA 31 7088 7103 981

827025 N/A N/A AGTTTTGGGATTAGGC 30 7107 7122 982

827040 N/A N/A GGGAATAATACTGCCC 91 7751 7766 985

827041 N/A N/A AATGTATGTTCCCTTG 27 7816 7831 986

827042 N/A N/A GTAAAAAGTCTGGCCC 16 8222 8237 987

827043 N/A N/A TCCAAGGTGTGTTGTG 22 8283 8298 988

827044 N/A N/A CATGAGACCTACTTCC 26 8296 8311 989

827045 N/A N/A ATAAGAGTCATCATGA 46 8307 8322 990

827057 N/A N/A TCGGTAGGAGTCATTC 39 8767 8782 559

827060 N/A N/A CCTCAGCAGGTAGGCA 60 8836 8851 993

827061 N/A N/A TCGGACTCAGCACTTC 64 8961 8976 994

827062 N/A N/A CTGCAGTGGCCAACCC 51 8983 8998 995

827063 N/A N/A CTGTAGGTATGACTGG 18 9047 9062 996

827064 N/A N/A TTCCATGACTGTAGGT 32 9055 9070 997

827065 N/A N/A GCCTAAACCGTTCCTG 36 9105 9120 998

827077 N/A N/A TCTTACCCCGGTGGCC 69 9507 9522 561

827080 N/A N/A GGCCTATCAACTAGGC 103 9783 9798 1001

827081 N/A N/A CACAATTCCATCGGGC 17 9837 9852 1002

827082 N/A N/A CCCTACATTGGAGGGT 91 9866 9881 1003

827083 N/A N/A AGGGATAAAGAATGCC 38 9978 9993 1004

827084 N/A N/A GACCAGCGGCTGGAGG 54 9996 10011 1005

827085 N/A N/A AGACATCCGATCTTGT 41 10020 10035 1006

827097 N/A N/A CTGCCACCCTACGCGC 54 10635 10650 563

10649 10664

827100 N/A N/A TACGCACCTCCCTCCT 35 1009

10672 10687

10650 10665

827101 N/A N/A CTACGCACCTCCCTCC 64 1010

10673 10688

10652 10667

827102 N/A N/A CCCTACGCACCTCCCT 60 1011

10675 10690

10653 10668

827103 N/A N/A ACCCTACGCACCTCCC 34 1012

10676 10691

827104 N/A N/A CCACCCTACGCACCTC 36 10655 10670 1013 10678 10693

10656 10671

827105 N/A N/A GCCACCCTACGCACCT 49 1014

10679 10694

827117 N/A N/A GGGCATAACACTAGAT 53 11100 11115 565

827120 N/A N/A CCACATGGTGCCCCAG 40 11248 11263 1017

827121 N/A N/A TTTTAGGAGGGCCACA 60 11259 11274 1018

827122 N/A N/A GCCCTCTGGTCCGTCC 40 11291 11306 1019

827123 N/A N/A GGTCAGACAGCACTCC 36 11319 11334 1020

827124 N/A N/A AGCTAGCAAATGGGTC 56 11331 11346 1021

827125 N/A N/A TTCCAGTTGGCACAGC 26 11344 11359 1022

827137 N/A N/A GGTTACACCCCCGGCG 44 11650 11665 567

827140 N/A N/A CCCACAGAAAACGGAA 74 11690 11705 1025

827141 N/A N/A GGCTGCTGCATGATTC 33 11738 11753 1026

827142 N/A N/A ACCAGAATAGATTCAC 63 11766 11781 1027

827143 N/A N/A TCGAATCGAGTGCCCC 40 11791 11806 1028

827144 N/A N/A AACAATGAACCTCGAA 51 11802 11817 1029

827145 N/A N/A TGGTATTAGAATGTAC 19 11881 11896 1030

827157 N/A N/A TTGAAAGAGCCCCCAC 65 12166 12181 569

827160 N/A N/A GTGCAGGGTCTTACTT 19 12230 12245 1033

827161 N/A N/A AAATACCAGTGCAGGG 41 12238 12253 1034

827162 N/A N/A GTACATCAATTATGCC 36 12268 12283 1035

827163 N/A N/A GGGCACTCAAGATTTG 62 12295 12310 1036

827164 N/A N/A CAAACCTGAGTGGGCA 36 12306 12321 1037

827165 N/A N/A CTCGACTGTCAAACCT 30 12315 12330 1038

827177 N/A N/A GCAATCATAGCTAGCA 57 12729 12744 571

827180 N/A N/A GTTGAAGGTGTGTGTT 35 13095 13110 1041

827181 N/A N/A AGCAACTCAAAGGTGT 22 13111 13126 1042

827182 N/A N/A AGATTTGTACATGAGG 30 13481 13496 1043

827183 N/A N/A ACCCGAAACACATTAG 61 13504 13519 1044

827184 N/A N/A GTTTAGGCCGCACCCG 36 13515 13530 1045

827185 N/A N/A ATTTACGGTGTTTAGG 42 13524 13539 1046

827197 N/A N/A GTAGGCACTTTATGAA 68 14142 14157 573

827200 N/A N/A AACCGTATGTAGTAGG 18 14153 14168 1049

827201 N/A N/A CAACCGTATGTAGTAG 25 14154 14169 1050

827202 N/A N/A ACAACCGTATGTAGTA 40 14155 14170 1051

827203 N/A N/A AACAACCGTATGTAGT 36 14156 14171 1052

827204 N/A N/A GAACAACCGTATGTAG 39 14157 14172 1053

827216 N/A N/A GGAGAGACAATAGATC 50 14488 14503 575

827219 N/A N/A TGACATACTGCTTCTA 33 14642 14657 1056

827220 N/A N/A CCCCAGCAGGTATTTT 98 14667 14682 1057

827221 N/A N/A CCCAAGCAATCACCAG 61 14737 14752 1058 827222 N/A N/A GACCAAAAGTGTGCCA 54 14831 14846 1059

827223 N/A N/A GACACAATCGCCGCTC 64 14905 14920 1060

827224 N/A N/A GAATAAGTGGAGATAT 84 15017 15032 1061

827236 N/A N/A CCGCAGGCGAGTGTCG 61 15878 15893 577

827239 N/A N/A CCGGACCTAGAAGGGA 89 15987 16002 1064

827240 N/A N/A GGCCACGGCGAGCCCA 82 16080 16095 1065

827241 N/A N/A GTAAACAGGTGTGTCC 48 16110 16125 1066

827242 N/A N/A CTGGAGCGAGTGTCTG 93 16238 16253 1067

827243 N/A N/A GCGGAGCCCATGGGTG 52 16616 16631 1068

827244 N/A N/A TGTCACTGGGCTGCGC 41 16650 16665 1069

827256 N/A N/A CAAGAGATTTGTCCCA 67 17420 17435 579

827259 N/A N/A ATTTATACCTCCCCTG 60 17495 17510 1072

827260 N/A N/A CACACACGGTTTTGGT 26 17513 17528 1073

827261 N/A N/A GACCAGTAGCTGCACA 34 17527 17542 1074

827262 N/A N/A ATTAAGGGAGTTGCAG 61 17555 17570 1075

827263 N/A N/A CCCTAGGAGCATGGAC 47 17585 17600 1076

827264 N/A N/A GCAGAAGTCCCTAGGA 61 17593 17608 1077

827276 N/A N/A CCTCAGATCCAGCAGT 49 18147 18162 581

827279 N/A N/A AGATCCATGCTTCCAG 11 18216 18231 1080

827280 N/A N/A AAGATCCATGCTTCCA 17 18217 18232 1081

827281 N/A N/A CCAAGATCCATGCTTC 20 18219 18234 1082

827282 N/A N/A ACCAAGATCCATGCTT 35 18220 18235 1083

827283 N/A N/A GACCAAGATCCATGCT 13 18221 18236 1084

827295 N/A N/A GATACATCCAGAGTCA 36 18725 18740 583

827298 N/A N/A AGGATGATGTGATACA 24 18735 18750 1087

827299 N/A N/A AAGGATGATGTGATAC 36 18736 18751 1088

827300 N/A N/A ATCTAAGAAATAGGCT 29 18755 18770 1089

827301 N/A N/A CACATAGCCCAGATAG 21 18834 18849 1090

827302 N/A N/A TGCCAAAGGAGCATGG 52 18901 18916 1091

827314 N/A N/A GGAGATGGCTCCGGAA 63 19278 19293 585

827317 N/A N/A GGTAAGAAGTGACACC 62 19364 19379 1094

827318 N/A N/A GTGTACTGGGCAGAGT 16 19390 19405 1095

827319 N/A N/A TGCTACCATCTTACTT 26 19463 19478 1096

827320 N/A N/A GGCTTAGGTGTTGCTA 28 19474 19489 1097

827321 N/A N/A GCGGACTCAGGCTTAG 50 19483 19498 1098

827322 N/A N/A TGACAGGTGTGGGCGG 46 19495 19510 1099

827334 N/A N/A AACCATGGACTTTCTG 46 19687 19702 587

827337 N/A N/A CCCAGGCGAGCAATGA 49 19746 19761 1102

827338 N/A N/A GGTATAACAACCCAGG 34 19756 19771 1103

827339 N/A N/A CAGTAGGGTGGAGTGG 41 19774 19789 1104

827340 N/A N/A GTACAAAGGTTCCTGT 48 19829 19844 1105 827341 N/A N/A CGTGAAGTAAGGTTGA 25 19846 19861 1106

827342 N/A N/A GTTACATGTGGTGACG 43 19860 19875 1107

827353 N/A N/A ACTAACTGGAATAGTT 99 19873 19888 589

827356 N/A N/A AGGACTAACTGGAATA 15 19876 19891 1110

827357 N/A N/A CAGGACTAACTGGAAT 31 19877 19892 1111

827358 N/A N/A GCCCGGTGAGATATTC 55 19923 19938 1112

827359 N/A N/A CCCGATAGCTGGTTGT 11 20415 20430 1113

827360 N/A N/A TTAATTAGTTCACCCG 4 20427 20442 1114

827361 N/A N/A AGTGAATCCTCACACT 88 20444 20459 1115

827373 N/A N/A AAAAAGGTGGTGTATC 80 21111 21126 591

827376 N/A N/A TCATAGGTAAACACCC 14 21565 21580 1118

827377 N/A N/A GAAAAGTCTGGTAGCT 23 21628 21643 1119

827378 N/A N/A TGGTGTGACCATTTGG 9 21643 21658 1120

827379 N/A N/A ATGGTGTGACCATTTG 15 21644 21659 1121

827380 N/A N/A AAATGGTGTGACCATT 46 21646 21661 1122

827381 N/A N/A TAAATGGTGTGACCAT 25 21647 21662 1123

827392 N/A N/A CGATTACAGGGATTCA 15 21750 21765 593

827394 N/A N/A GTACGATTACAGGGAT 11 21753 21768 1125

827395 N/A N/A AGTACGATTACAGGGA 8 21754 21769 1126

827396 N/A N/A TAGTACGATTACAGGG 29 21755 21770 1127

827397 N/A N/A CTAGTACGATTACAGG 23 21756 21771 1128

827398 N/A N/A ACTAGTACGATTACAG 15 21757 21772 1129

827399 N/A N/A CACTAGTACGATTACA 39 21758 21773 1130

827410 N/A N/A GAATCAGTATAATGTG 16 22306 22321 595

827413 N/A N/A CCTATGAGAATCAGTA 14 22313 22328 1133

827414 N/A N/A GCCTATGAGAATCAGT 13 22314 22329 1134

827415 N/A N/A CTATAGTGGCCTATGA 33 22322 22337 1135

827416 N/A N/A GATACACACTAAGCAC 22 22342 22357 1136

827417 N/A N/A AGATACACACTAAGCA 29 22343 22358 1137

827429 N/A N/A CTGCCCCCATGGAAAG 70 22782 22797 597

827432 N/A N/A GGTGAGCCCTTCGCAC 3 22828 22843 1140

827433 N/A N/A TGAAGGAGAGGCTACA 45 22866 22881 1141

827434 N/A N/A ATTCTAGGATGTACTG 36 22926 22941 1142

827435 N/A N/A GTGACATACTGGTGCA 3 22943 22958 1143

827436 N/A N/A GGGATATTCCACTGGC 29 22983 22998 1144

827437 N/A N/A AACTAGGTGATCCGGG 11 22996 23011 1145

827448 N/A N/A CTGCAGTAGGACTGCA 111 23326 23341 598

827451 N/A N/A GGTGAGCACGGAGCTG 14 23471 23486 1148

827452 N/A N/A GGAGAAAGTGTGACCA 56 23489 23504 1149

827453 N/A N/A GAGCAGGGTTAAAGGA 49 23502 23517 1150

827454 N/A N/A TGTCATCTAGGAGATA 70 23597 23612 1151 827455 N/A N/A TTGCATAGATCCTGTC 35 23609 23624 1152

827456 N/A N/A CTTGATGACAGGAGCC 38 23660 23675 1153

827468 N/A N/A CGCCATGGAGCAAGCA 67 24238 24253 600

827471 N/A N/A GGACTATGTGGCACCT 47 24342 24357 1156

827472 N/A N/A TGGCAACCCCTGAGCT 59 24412 24427 1157

827473 N/A N/A GTTCAGGAAGACCCGC 65 24437 24452 1158

827474 N/A N/A GCAGAGGCGGGAATCC 49 24524 24539 1159

827475 N/A N/A CATCAGGGACAGACCT 43 24564 24579 1160

827476 N/A N/A CTGCAATCTGAGGCGC 58 24761 24776 1161

827488 N/A N/A GGACAATTCCTTGACA 36 26078 26093 602

827491 N/A N/A ACCTTAGGAGCCATTG 18 26493 26508 1164

827492 N/A N/A ACCCATGTATCTTCTA 44 26627 26642 1165

827493 N/A N/A AATGAGACAGACCCAT 42 26637 26652 1166

827494 N/A N/A GGATACAGTATGTCCA 52 26685 26700 1167

827495 N/A N/A CTCTACTATTGAATGG 45 26699 26714 1168

827496 N/A N/A ATTATATACCTCTACT 58 26708 26723 1169

827508 N/A N/A AGGTAGGGATGGACGC 38 27147 27162 604

827511 N/A N/A CCAGGAGGCCACGACT 32 27241 27256 1172

827512 N/A N/A TACAATCCTCTAAGGT 47 27271 27286 1173

827513 N/A N/A CTGTATACCCTGGGAC 41 27378 27393 1174

827514 N/A N/A TCTCAGCAATCAATAT 75 27490 27505 1175

827515 N/A N/A GGGAAGTAAGCCCTAG 22 27559 27574 1176

827516 N/A N/A GGCTGGAGATCTTTAG 36 27607 27622 1177

827528 N/A N/A TGGGACTTGCTAATGA 42 28251 28266 606

827531 N/A N/A CAGAATAGCCGGGCGC 36 28650 28665 1180

827532 N/A N/A GGCAGACACGAGGGTC 31 28699 28714 1181

827533 N/A N/A CCATACGGATGAACCT 24 28741 28756 1182

827534 N/A N/A TACCATACGGATGAAC 31 28743 28758 1183

827535 N/A N/A CTACCATACGGATGAA 38 28744 28759 1184

827547 N/A N/A GGTGATGTCACTTCGG 8 29031 29046 608

827550 N/A N/A AGGGAATTAAGCCACA 8 29501 29516 1187

827551 N/A N/A GGATACACCAGTGTAA 43 29904 29919 1188

827552 N/A N/A AGCTAAGTCAGGCGAA 38 29930 29945 1189

827553 N/A N/A TATGAGTGTGCCTTTG 42 30329 30344 1190

827554 N/A N/A TTCAAGGTTGCAAGTG 24 30348 30363 1191

827555 N/A N/A AGCTAAGCCAGGGACA 59 30416 30431 1192

827567 N/A N/A GGATAGGGTTGTGTCA 96 30925 30940 610

827570 N/A N/A ATCAAGGTCACTCCCA 65 30959 30974 1195

827571 N/A N/A GAAGACCCATTCCTAG 69 30992 31007 1196

827572 N/A N/A CCATATCGATCCCTCT 67 31115 31130 1197

827573 N/A N/A GAATTTCCTGGACCTT 64 31142 31157 1198 827574 N/A N/A GAAATGGTAGAGGATG 82 31157 31172 1199

827575 N/A N/A AGGCACGACCTACCGT 124 31272 31287 1200

Example 2: Effect of modified oligonucleotides complementary to α-ENaC in Hep3B cells at various doses

Selected oligonucleotides listed in Example 1 were tested at various doses in Hep3B cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 148, 444, 1,333, or 4,000 nM of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated and analyzed as described in Example 1. As illustrated in the tables below, α-ENaC mRNA levels were reduced in a dose-dependent manner in cells treated with a modified oligonucleotide complementary to an α-ENaC nucleic acid.

Table 6: Percent level of human α-ENaC mRNA

Table 7: Percent level of human α-ENaC mRNA

Table 8: Percent level of human α-ENaC mRNA 827280 19 15 7 4

827318 51 21 11 11

827378 44 29 8 12

827395 44 22 19 4

827414 54 27 15 14

827435 28 19 7 3

Table 9: Percent level of human α-ENaC mRNA

α-ENaC expression (% control)

Compound Number

148 nM 444 nM 1,333 nM 4,000 nM

797309 53 15 12 8

797501 24 20 16 11

826334 65 43 26 23

826392 46 26 25 5

826393 57 12 12 7

826394 51 32 16 17

826591 44 14 13 6

826631 22 10 9 2

826632 38 22 13 14

826689 54 33 17 10

826809 21 12 10 2

826825 41 23 18 3

827283 46 28 20 14

827301 65 49 24 13

827359 18 15 6 3

827360 33 10 15 2

827379 28 22 13 8

827398 34 25 16 4

827437 37 24 8 11

Table 10: Percent level of human α-ENaC mRNA

826655 65 46 32 18

826711 51 28 30 12

826828 57 35 18 4

826906 72 20 22 24

827148 74 47 34 23

827284 34 22 13 5

827382 53 31 27 18

827383 69 60 37 23

827419 33 18 13 5

827420 71 34 20 12

827497 46 14 11 9

827498 56 34 24 13

827518 65 33 15 14

Table 11: Percent level of human α-ENaC mRNA

α-ENaC expression (% control)

Compound Number

148 nM 444 nM 1,333 nM 4,000 nM

797501 44 33 16 6

826183 57 38 13 10

826202 77 35 25 5

826241 43 36 25 18

826262 81 50 21 12

826338 79 35 13 5

826558 80 53 24 16

826576 70 45 27 12

826673 88 40 29 12

826753 64 39 21 23

826754 67 47 22 11

826793 62 35 13 6

826811 85 42 18 3

827030 43 23 9 4

827149 42 38 23 11

827150 54 41 20 10

827307 46 23 20 6

827347 66 41 26 16

827441 30 13 11 1 Table 12: Percent level of human a-ENaC

Table 13: Percent level of human a-ENaC 827134 112 57 31 33

827175 43 39 13 7

827254 53 36 24 6

827408 53 28 21 15

827426 79 34 23 9

827447 35 18 13 10

Table 14: Percent level of human a-ENaC α-ENaC expression (% control)

Compound Number

148 nM 444 nM 1,333 nM 4,000 nM

797469 81 55 24 17

797501 26 25 41 21

826232 39 32 14 5

826233 88 58 23 29

826626 59 53 39 8

826743 83 47 23 10

826763 77 24 20 9

826764 33 45 37 26

826784 44 47 16 15

826819 40 24 10 2

826821 81 52 31 11

826878 39 31 19 2

826880 41 28 13 17

827179 62 24 7 5

827199 44 14 20 10

827278 31 23 10 9

827393 55 22 9 6

827432 66 52 24 7

827550 62 43 36 16

Table 15: Percent level of human a-ENaC

826776 76 36 26 10

826794 57 28 19 10

826891 54 34 19 10

827131 109 69 48 10

827151 34 32 13 1 1

827270 57 35 25 1 1

827288 45 37 21 6

827289 71 36 23 8

827309 84 48 32 8

827348 73 58 35 1 1

827368 67 38 23 7

827386 92 50 21 7

827502 60 24 13 12

827524 83 41 28 15

Example 3: Effect of various doses of modified oligonucleotides complementary to human α-ENaC in vitro via free uptake

Selected oligonucleotides were tested at various doses in A431 cells by free uptake. Cells were plated at a density of 10,000 cells per well with 16, 49, 148, 1,333, or 4,000 nM of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated and analyzed as in Example 1. As illustrated in the tables below, α-ENaC mRNA levels were reduced in a dose- dependent manner in cells treated with a modified oligonucleotide complementary to an α-ENaC nucleic acid.

Table 16: Level of α-ENaC mRNA in A431 cells

Table 17: Level of α-ENaC mRNA in A431 cells

Example 4: Tolerability of modified oligonucleotides complementary to human α-ENaC in CDl mice following systemic delivery

CDl® mice (Charles River, MA) are a multipurpose mice model, frequently utilized for safety and efficacy testing. The mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of 6-8 week old male CDl mice were injected subcutaneously once a week for 6 weeks with 50 mg/kg of a modified oligonucleotide listed in the tables below (50 mg/kg/week dose). Each group contained 4 mice. One group of male CDl mice was injected subcutaneously once a week for 6 weeks with PBS. Mice were sacrificed 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Plasma chemistry markers

To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, BUN, and billirubin were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results in the tables below show that most of the tested modified oligonucleotides were well tolerated when delivered systemically, with ALT and AST levels under approximately 200 IU/L and albumin, BUN, creatine, and total bilirubin within acceptable ranges. Table 18: Levels of plasma chemistry markers

Table 19: Levels of plasma chemistry markers 826394 466.0 196.3 2.81 23.1 .068 .218

826558 126.8 117.3 2.97 21.6 .080 .155

826631 1073.5 1267.0 2.61 19.0 .040 .275

826632 113.3 129.5 2.94 22.4 .085 .173

826655 1349.8 754.5 3.13 21.1 .123 6.315

826687 1174.0 647.0 2.85 20.0 .075 .178

826688 430.0 362.0 3.38 22.5 .100 .215

826743 115.0 111.8 2.94 21.6 .085 .160

826753 58.0 70.0 2.68 24.5 .070 .138

826763 77.0 89.3 2.97 22.9 .083 .203

826776 1685.8 1027.0 2.55 20.7 .058 .248

826793 1306.3 563.5 2.85 18.8 .065 .250

826796 1552.5 740.8 3.29 19.5 .088 .453

826811 439.3 347.5 3.00 19.5 .085 .438

826819 297.0 146.8 2.88 26.6 .125 .163

826828 559.0 314.0 2.71 17.4 .060 .170

826906 41.0 56.5 2.98 22.5 .093 .163

827030 44.0 55.8 3.04 20.0 .093 .180

827035 n.d. n.d. n.d. n.d. n.d. n.d.

Table 20: Levels of plasma chemistry markers

827414 145.8 123.0 2.59 23.2 .055 .148

827419 62.0 73.3 2.68 27.5 .065 .178

827437 63.8 103.8 2.56 19.5 .050 .243

827449 300.0 211.3 2.49 22.0 .040 .168

827497 100.5 112.8 2.19 22.0 .043 .170

827502 126.3 106.3 2.36 22.9 .043 .108

Organ weights

Organ weights were measured at the end of the study, and kidney, liver, and spleen weig presented in the table below. The results provide additional evidence that most of the modified oligonucleotides were well tolerated when delievered systemically.

Table 21: Organ weights

797508 0.469 1.322 0.148

797523 0.560 2.614 0.172

Table 22: Organ weights

Compound No. Kidney (g) Liver (g) Spleen (g)

PBS 0.610 2.212 0.138

797192 0.530 4.632 0.157

797309 0.586 2.160 0.115

797469 0.633 4.636 0.238

826183 n.d. n.d. n.d.

826262 0.609 2.197 0.227

826393 0.508 3.084 0.210

826394 0.530 2.914 0.206

826558 0.567 2.048 0.149

826631 0.587 2.361 0.169

826632 0.595 2.442 0.136

826655 0.588 3.511 0.113

826687 0.619 2.750 0.261

826688 0.546 2.418 0.214

826743 0.608 2.162 0.110

826753 0.538 2.364 0.140

826763 0.542 2.478 0.144

826776 0.574 4.112 0.386

826793 0.555 2.295 0.173

826796 0.605 2.566 0.151

826811 0.557 2.085 0.133

826819 0.517 2.559 0.144

826828 0.590 2.046 0.191

826906 0.561 2.121 0.123

827030 0.564 1.974 0.114

827035 n.d. n.d. n.d.

Table 23: Organ weights

827254 0.631 2.589 0.139

827288 0.579 2.341 0.138

827307 0.614 2.391 0.133

827347 0.596 2.235 0.152

827348 0.678 2.832 0.251

827359 0.647 2.316 0.146

827360 0.517 2.098 0.147

827372 0.657 2.120 0.140

827382 0.574 2.089 0.142

827392 0.595 2.208 0.124

827393 0.603 2.307 0.137

827398 0.590 2.249 0.141

827408 0.751 2.399 0.290

827410 0.653 3.247 0.174

827414 0.663 2.787 0.185

827419 0.682 2.327 0.150

827437 0.674 2.523 0.544

827449 0.619 2.798 0.155

827497 0.630 2.368 0.189

827502 0.674 3.082 0.183

Example 5: Establishment of a transgenic mouse line expressing human a-ENaC

A transgenic mouse was developed to analyze knockdown of human α-ENaC in a mouse model. A 41,279 bp portion of the gene for human α-ENaC ABC14-50929300K14 (digested with Notl) was microinjected into embryos of C57BL/6 WT mice. Five transgene positive F0 mouse pups were obtained, and one founder was used to generate a C57BL/6 ha-ENaC mouse line. The line was evaluated for expression of ha-ENaC in tongue, brain, heart, colon, trachea, pancreas, kidney, liver, spleen, skeletal muscle, fat, uterus, and both total lung and lung fractions. The mouse model exhibits ha-ENaC expression in a variety of tissues, and, importantly, high levels of expression in all fractions of the lung.

Example 6: Effect of modified oligonucleotides on human α-ENaC expression in a transgenic mouse

Treatment

Transgenic mice were maintained on a 12-hour light/dark cycle and were fed ad libitum normal diet. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Modified oligonucleotides were prepared in buffered saline (PBS) and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

The C57Bl/6-TG(ha-ENaC) mice weighing ~20g were divided into groups of 2-4 mice. Groups of mice were administered 2.5 mg/kg of modified oligonucleotide twice a week for two weeks (5mg/kg/week) via oropharyngeal aspiration. A control group of 6 mice was given PBS twice per week for two weeks. The PBS group served as the control group to which animals dosed with modified oligonucleotide were compared. Mice were sacrificed 48 hrs after the last dose and organs were harvested for further analysis. Human a-ENaC Expression Levels

Total RNA was isolated from the whole lung and human α-ENaC mRNA levels were measured as described in Example 1. Results are presented in the table below as percent reduction of the amount of α-ENaC mRNA relative to untreated control. As illustrated in the table below, α-ENaC mRNA levels were reduced in lung of modified oligonucleotide-treated animals.

Table 24: Percent level of human α-ENaC mRNA

* Group contained 3 mice

** Group contained 2 mice

All other groups contained 4 Example 7: Dose-response of Compound 827359 on human α-ENaC expression in a transgenic mouse

Treatment

Transgenic mice were maintained on a 12-hour light/dark cycle and were fed ad libitum normal diet. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Modified oligonucleotides were prepared in buffered saline (PBS) and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS.

The C57Bl/6-TG(ha-ENaC) mice weighing ~20g were divided into groups of 12 mice. Groups of 12 mice were administered 0.033, 0.1, 0.33 or 1.0 mg/kg of modified oligonucleotide twice a week for three weeks (5mg/kg/week) via aerosol dosing. A control group of 12 mice was given aerosol saline twice per week for 3 weeks. The PBS group served as the control group to which animals dosed with modified oligonucleotide were compared. Mice were sacrificed 3 days after the last dose and organs were harvested for further analysis.

Human a-ENaC Expression Levels

Total R A was isolated from the whole lung and human α-ENaC mR A levels were measured by quantitative real-time PCR as described in Example 1. Results are presented in the table below as percent reduction of the amount of α-ENaC mRNA relative to untreated control. As illustrated in the table below, a- ENaC mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated animals.

Table 25: Dose Response of 827359 in transgenic mouse

Example 8: Human Peripheral Blood Mononuclear Cells (hPBMC) Assay

The hPBMC assay was performed using BD Vautainer CPT tube method. A sample of whole blood from volunteered donors with informed consent at US HealthWorks clinic (Faraday & El Camino Real, Carlsbad) was obtained and collected in 4-15 BD Vacutainer CPT 8 ml tubes (VWR CatJ BD362753). The approximate starting total whole blood volume in the CPT tubes for each donor was recorded using the PBMC assay data sheet.

The blood sample was remixed immediately prior to centrifugation by gently inverting tubes 8-10 times. CPT tubes were centrifuged at rt (18-25 °C) in a horizontal (swing-out) rotor for 30 min. at 1500-1800 RCF with brake off (2700 RPM Beckman Allegra 6R). The cells were retrieved from the buffy coat interface (between Ficoll and polymer gel layers); transferred to a sterile 50 ml conical tube and pooled up to 5 CPT tubes/50 ml conical tube/donor. The cells were then washed twice with PBS (Ca ⁺⁺ , Mg ⁺⁺ free; GIBCO). The tubes were topped up to 50 ml and mixed by inverting several times. The sample was then centrifuged at 330 x g for 15 minutes at rt (1215 RPM in Beckman Allegra 6R) and aspirated as much supernatant as possible without disturbing pellet. The cell pellet was dislodged by gently swirling tube and resuspended cells in RPMI+10% FBS+pen strep (~1 ml / 10 ml starting whole blood volume). A 60 μΐ sample was pipette into a sample vial (Beckman Coulter) with 600 μΐ VersaLyse reagent (Beckman Coulter Cat# A09777) and was gently vortexed for 10-15 sec. The sample was allowed to incubate for 10 min. at rt and being mixed again before counting. The cell suspension was counted on Vicell XR cell viability analyzer (Beckman Coulter) using PBMC cell type (dilution factor of 1 : 11 was stored with other parameters). The live cell/ml and viability were recorded. The cell suspension was diluted to 1 x 10 ⁷ live PBMC/ml in RPMI+ 10%

FBS+pen/strep. The cells were plated at 5 x 10 ⁵ in 50 μΐ/well of 96-well tissue culture plate (Falcon Microtest). 50 μΐ/well of 2x concentration oligos/controls diluted in RPMI+10% FBS+pen strep. was added according to experiment template (100 μΐ/well total). Plates were placed on the shaker and allowed to mix for approx. 1 min. After being incubated for 24 hrs at 37 °C; 5% CO2, the plates were centrifuged at 400 x g for 10 minutes before removing the supernatant for MSD cytokine assay (i.e. human IL-6, IL-10, and TNF-a). Compound 353512 is an internal standard known to be a high responder for IL-6 release in the assay, while compound 104838 is a negative control. The hPBMCs were isolated from fresh, volunteered donors and were treated with modified oligonucleotide at 0.064, 0.32, and 1.6 200 μΜ concentrations. After a 24 hr treatment, the cytokine levels were measured and averaged across two donors. The results presented in the table below show that selected modified oligonucleotides targeting human α-ENaC have low

proinflammatory responses in human peripheral mononuclear blood cells.

Table 26: Modified oligonucleotides tested as controls in hPBMC assay

Table 27: Results of hPBMC Assay for Selected Modified Oligonucleotides

1.6 7.3 62.8 11.3

826906 0.064 4.4 48.3 7.6

0.32 4.8 68.9 9.2

1.6 6.3 60.4 13.9

827030 0.064 3.7 40.8 7.9

0.32 5.4 42.4 7.5

1.6 4.5 54.1 8.4

827200 0.064 4.2 49.4 8.9

0.32 5.3 67.6 9.5

1.6 5.4 55.2 9.5

827288 0.064 4.5 44.1 7.7

0.32 6.0 50.2 8.7

1.6 7.6 76.3 14.9

827307 0.064 4.6 62.2 9.9

0.32 5.3 52.3 9.0

1.6 5.0 54.1 10.6

827347 0.064 8.3 53.6 10.9

0.32 20.7 115.2 12.8

1.6 33.9 163.3 21.1

827359 0.064 5.8 61.8 9.4

0.32 6.2 52.7 10.3

1.6 11.0 75.2 11.8

827372 0.064 4.7 56.5 8.8

0.32 7.3 65.4 9.6

1.6 13.1 81.3 13.1

827392 0.064 4.5 45.5 7.7

0.32 5.1 48.0 8.8

1.6 5.4 50.9 9.9

827414 0.064 5.5 51.6 8.7

0.32 7.6 58.1 10.3

1.6 16.6 102.4 16.3

827419 0.064 4.2 52.5 7.9

0.32 7.5 62.0 11.2

1.6 8.0 93.8 16.5

827497 0.064 4.5 50.5 8.3

0.32 5.1 56.9 9.5

1.6 5.8 73.7 13.0 Example 9: Effects of a modified oligonucleotide complementary to α-ENaC in a mouse model of cystic fibrosis

A modified oligonucleotide complementary to mouse α-ENaC was tested for its effects on preventing and treating airway restriction in a mouse model of cystic fibrosis. Treatment of wild type mice with a modified oligonucleotide complementary to Nedd4L induced a cystic fibrosis-like phenotype (See Crosby et al. J. of Cystic Fibrosis, 2017). Compound 668395 has a 3-10-3 phosphothiorate cEt gapmer motif. It is 16 nucleobases in length, wherein the central gap segment contains ten 2'-deoxynucleosides and is flanked by wing segments on the 3' and 5' ends, each containing three cEt nucleosides. All cytosine residues throughout the modified oligonucletoide are 5-methyl cytosines. The internucleoside linkages are all phosphorothioate internucleoside linkages. The sequence is GAGCATCTAATACAGC (SEQ ID NO: 1958), which is 100% complementary to mouse a-ENaC.

Adult mice were treated twice a week for 2 weeks with compound 668395 or vehicle (control) at 0.33 mg/kg/dose via aerosol dosing. Then, mice were treated with an antisense oligonucleotide that reduces Nedd4L (Nedd 4L ASO) via oropharyngeal dosing at 10 mg/kg/dose once a week for 6 weeks. After 8 weeks, airway restriction was tested with a methacholine challenge. Lung function was measured using the Penh score obtained through unrestrained plethysmography. A higher Penh score indicates more lung constriction. Each group contained 8 mice. The results, shown in the table below, indicate that pre-treatment with a modified oligonucleotide complementary to α-ENaC prevented the decrease in lung function observed in the cycstic fibrosis mouse model.

Table 28: Penh scores

In order to test the effect of a modified oligonucleotide complementary to mouse α-ENaC on reversal of airway restriction in a mouse model of cystic fibrosis, adult mice were treated with Nedd4L ASO via oropharyngeal dosing at 10 mg/kg/dose once a week for a total of 9 weeks; and compound 668395 was not administered until week 6. Starting at 6 weeks, mice were administered compound 668395, vehicle, or a control 3-10-3 cEt modified oligonucleotide (control compound) via aerosol dosing three times per week for three weeks. Lung function was tested with a methacholine challenge prior to the first treatment at 6 weeks and at 9 weeks, and Penh scores were obtained through unrestrained plethysmography. Each group contained 12 mice. The results, shown in the tables below, indicate that treatment with a modified oligonucleotide complementary to α-ENaC restored lung function in a mouse model of cystic fibrosis. Table 29: Penh scores at 6 weeks

Table 30: Penh scores at 9 weeks

Example 10: Effect of modified oligonucleotides complementary to human α-ENaC on cystic fibrosis patient derived primary human bronchial epithelial cells

Primary human bronchial epithelial cells from cystic fibrosis patients were obtained from Epithelix. Cells were cultured at an Air-Liquid Interface (ALI) on transwell membrane inserts (Corning®) with PneumaCult™-ALI Medium (StemCell Technologies) on the basolateral side of the membrane. At 6 weeks post seeding, cells were treated either with ION No. 827359, or with ION No. 549148 (3-10-3 cET gapmer, GGCTACTACGCCGTCA, designated herein as SEQ ID NO: 1959), that served as a negative control that does not target α-ENaC. Both modified oligonucleotides were treated using free uptake at a concentration of ΙμΜ on the basolateral side. Cells were lysed 72 hours post treatment.

Human a-ENaC Expression Levels

Total RNA was isolated from the cells 72 hours post treatment. α-ENaC mRNA levels were measured using human primer probe set hSCNNlA_LTS01170. α-ENaC mRNA levels were normalized to cyclophilin A. Cyclophilin A was amplified using primer-probe set HTS3936 (forward sequence,

GCCATGGAGCGCTTTGG, designated herein as SEQ ID NO: 1960; reverse sequence,

TCCACAGTCAGCAATGGTGATC, designated herein as SEQ ID NO: 1961; probe sequence,

TCCAGGAATGGCAAGACCAGCAAGA, designated herein as SEQ ID NO: 1962). Results are presented in the tables below as percent control of the amount of α-ENaC mRNA relative to control cells (% control). Table 31

Inhibition of α-ENaC mRNA by in cystic fibrosis patient derived primary human bronchial epithelial cells

Measurement of amiloride sensitive current

72 hours post treatment with modified oligonucleotide, the transwell inserts were mounted in Ussing chambers (Physiologic Instruments, San Diego, CA). Short-circuit current (I _sc ) was measured. Data were analyzed using ACQUIRE & ANALYZE 2.3 (Physiologic Instruments). The basolateral solution contained (in mM) 145 NaCl, 3.3 K2HP04, 0.8 KH2P04, 1.2 MgC12, 1.2 CaC12, 10 glucose, 10 Hepes (adjusted to pH 7.35 with NaOH) and the apical solution contained (in mM) 145 sodium gluconate, 3.3 K2HP04, 0.8 KH2P04, 1.2 MgC12, 1.2 CaC12, 10 glucose, 10 Hepes (adjusted to pH 7.35 with NaOH)._Amiloride was added to apical side at ΙΟΟμΜ. Amiloride -sensitive currents were measured in order to assess ENaC functional activity.

Table 32

Amiloride response in cystic fibrosis patient derived primary human bronchial epithelial cells

Measurement of Airway Surface Liquid (ASL)

72 hours post start of treatment, the effect of modified oligonucleotide on Airway Surface Liquid (ASL) was measured. Immediately before measuring the ASL, cultures were washed three times with PBS to remove excess mucus. 150μί of KBR buffer (89 mM NaCl, 4 mM KC1, 1.2 mM MgC12, 1.2 mM CaC12, 1 mM Hepes, 16 mM Na-gluconate, 10 mM glucose) was added to the apical surface of the cells as the absorption volume. ASL volume was then measured 24hours, 48hours and 72hours post additional of KBR buffer.

Table 33

ASL volume in cystic fibrosis patient derived primary human bronchial epithelial cells

48hr 20 67

72hr 18 38

Example 11: Effect of combination treatment of modified oligonucleotides with VX-661 (Tezacaftor) and VX-770 (Ivacaftor)

Primary human bronchial epithelial cells from cystic fibrosis patients were obtained from Epithelix. Cells were cultured at an Air-Liquid Interface (ALI) on transwell membrane inserts (Corning®) with PneumaCult™-ALI Medium (Stemcell Technologies) on the basolateral side of the membrane for 6 weeks before treatment. At Day 0, Day 4 and Day 8 of treatment, cells were treated either with ION Nos. 827359, or 549148 at ΙΟμΜ on the basolateral side of the membrane (a total of 3 doses of each ASO). One set of cells was left untreated with modified oligonucleotide. At Day 11, VX-661 (Tezacaftor) (Medchem Express) was added at 18μΜ to both the previously untreated well and to one of the wells treated with ION No. 827359. On Day 14, VX-770 (Ivacaftor) (Medchem Express) was added at ΙΟμΜ to the cells previously treated with VX-661. On the same day (Day 14), cultures were washed three times on the apical side with PBS to remove excess mucus. 150μί of PBS (absorption volume) was added to the apical surface of the cells. ASL volume was measured the next day (Day 15). Combination treatment was found to further increase ASL volume compared to control.

Table 34

ASL volume in cystic fibrosis patient derived primary human bronchial epithelial cells