Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
MAC30 GENE
Document Type and Number:
WIPO Patent Application WO/2007/128545
Kind Code:
A2
Abstract:
The invention relates to the field of cholesterol-regulated genes, specifically, to the MAC 30 gene and its regulation by cholesterol and statins. The invention provides isolated nucleic acids encoding a MAC30, characterized in that the coding sequence of said gene is at least 70% homologous to SEQ ID No. 1 provided herein. The invention further provides isolated proteins having MAC30 activity encoded by the nucleic acid of the invention. The invention also provides antibodies directed against the said protein.

Inventors:
EBNER, Birgit (Stiftingtalstrasse 75, Graz, A-8010, AT)
KRATKY, Dagmar (Am Dominikanergrund 38, Graz, A-8043, AT)
KOSTNER, Gerhard, M. (Gustav-Hoferweg, Graz, A-8044, AT)
LEVAK-FRANK, Sanja (Körblergasse 64, Graz, A-8010, AT)
Application Number:
EP2007/004009
Publication Date:
November 15, 2007
Filing Date:
May 07, 2007
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
EBNER, Birgit (Stiftingtalstrasse 75, Graz, A-8010, AT)
KRATKY, Dagmar (Am Dominikanergrund 38, Graz, A-8043, AT)
KOSTNER, Gerhard, M. (Gustav-Hoferweg, Graz, A-8044, AT)
LEVAK-FRANK, Sanja (Körblergasse 64, Graz, A-8010, AT)
International Classes:
C07K14/43; C07K14/415
Attorney, Agent or Firm:
ENGELHARD, Markus et al. (Boehmert & Boehmert, Hollerallee 32, Bremen, 28209, DE)
Download PDF:
Claims:

Claims

1. An isolated nucleic acid encoding a MAC30, characterized in that the coding sequence of said gene is at least 70% homologous to SEQ ID No. 1 or SEQ ID No. 3.

2. The nucleic acid of claim 1 whereby the homology is at least 85%.

3. The nucleic acid of claim 2 whereby the homology is greater than 90%.

4. The nucleic acid of claim 3 whereby the homology is greater than 95%.

5. The nucleic acid of claim 1 characterized in that the nucleic acid is able to hybridize to a nucleic acid comprising SEQ ID No. 1 under moderately stringent conditions.

6. The nucleic acid of claim 5 characterized in that the nucleic acid is able to hybridize to a nucleic acid comprising SEQ ID No. 1 under highly stringent conditions.

7. The nucleic acid of claim 5 whereby the moderately stringent conditions are hybridization at Ix SSC at 55 degrees C, followed by at least one wash at 55 degrees C at Ix SSC.

8. The nucleic acid of claim 6 whereby the hybridization takes place at 0,IxSSC at 60 degrees C, followed by at least one wash at 0,1 x SSC at 60 degrees.

9. The nucleic acid of claim 6 whereby the hybridization takes place at 0,IxSSC at 65 degrees C, followed by at least one wash at 0,1 x SSC at 65 degrees.

10. An isolated protein recognizable by a specific antibody to the protein expressed by encoded by SEQ No. 2 or 4. encoded by a nucleic acid of any one of claims 1-9.

11. The protein of claim 10 being regulated by cholesterol.

12. The protein of claim 10 being regulated by LXR in a cell.

13. The protein of claim 12 whereby said cell is macrophage-derived or a macrophage precursor or a macrophage.

14. The protein of claim 13 whereby said cell line is RAW264.7.

15. An antibody directed against the protein of any one of claims 10-13, wherein the antibody is preferably a monoclonal, polyclonal or humanized antibody, an Fab fragment, or a single chain antibody.

16. An antibody or antigen-binding part thereof directed against the active site of the hydrolase activity of a protein of any one of claims 10-13.

17. A part of an antibody according to claim 16 which is the Fab fragment.

18. A single chain antibody according to claim 16.

19. An antibody according to claims 15-18 which specifically binds to the protein of claims 10-13, but fails to bind to and/or inhibit the activity of least one other cholesterol-rgulated gene expression product.

20. The antibody of claim 19 wherein the other gene expression product is Hmgcr.

21. The antibody of claim 15 which is directed to a protein encoded by SEQ ID no. 1 or by a nucleic acid sequence homologous thereto as defined in claims 1-9, whereby said antibody fails to bind and/or inhibit the activity of the protein encoded by SEQ ID No. 3.

22. The antibody of claim 15 which is directed to a protein encoded by SEQ ID no. 3 or by a nucleic acid sequence homologous thereto as defined in claims 1-9, whereby said antibody fails to bind and/ or inhibit the activity of the protein encoded by SEQ ID No. 1.

23. An antibody according to any one of claims 15-18 which inhibits the hydrolase activity of the protein.

24. A ribozyme, RNAi molecule, antisense nucleic acid molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or an anticalin directed against the nucleic acid of claim 1-9 or against the protein of claim 10-14.

25. Use of the ribozyme, RNAi molecule, antisense nucleic acid molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or an anticalin of claim 24 in the preparation of a pharmaceutical composition.

25. A method of treatment of a patient in need thereof comprising the administration of the ribozyme, RNAi molecule, antisense nucleic acid molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or anticalin of claim 24 to the patient, wherein said administration preferably comprises intravenous, oral, transdermal, sustained release, suppository, or sublingual administration.

26. The method of claim 25 wherein the patient suffers from a condition related to cholesterol metabolism and/or atherosclerosis or who carry an increased risk of developing said condition.

27. The method of claim 26 wherein the condition is selected from diabetes, diabetes type I, diabetes type II, coronary artery disease, atherosclerosis, myocardial infarction, coronary artery bypass graft, percutaneous transluminal angioplasties, coronary stenosis, cerebrovascular disease transient ischemic attack, ischemic stroke, carotid endarterectomies, and peripheral arterial disease.

28. An animal model wherein the expression of a gene corresponding to SEQ ID No. 1 or 3 is substantially reduced.

29. An animal model wherein the expression of a gene corresponding to SEQ ID No. 1 or 3 or a homologue thereof as defined in claim 1-9 is substantially enhanced.

30. An animal into which an isolated nucleic acid molecule carrying a gene corresponding to SEQ ID No. 1 or 3 or a homologue thereof as defined in claim 1-9 has been introduced.

31. The animal of claim 30 wherein the isolated gene is placed in proximity to a sequence that allows specific recombination.

32. The animal of claim 31 wherein the sequence that allows specific recombination is a lox of flox sequence.

33. A host cell carrying the nucleic acid sequence of claim 1-9.

34. The host cell of claim 33 which is a prokaryotic cell.

35. The host cell of claim 34 which is a bacterial cell.

36. The host cell of claim 33 which is a eukaryotic cell.

37. The host cell of claim 36 which is a fly, yeast, nematode, or mammalian cell.

38. The host cell of claim 37 which is a mouse or human cell.

39. The host cell of claim 38 which is a macrophage or derived from a macrophage cell.

40. The host cell of claim 39 which is RAW264.7 or the host cell of claim 37 which is a CHO or 3T3-Ll cell.

41. A vector comprising the nucleic acid of claim 1 and a promoter in operable sequence.

Description:

Mac30 gene

Field of the invention

The invention relates to the field of cholesterol-regulated genes. More specifically, the invention relates to the MAC 30 gene and its regulation by cholesterol and statins.

Background of the invention

Cholesterol is an essential component of mammalian cell membranes and is the biosynthetic precursor for steroid hormones, bile acids, and vitamin D. The correct intracellular distribution of cholesterol among membranes is essential for many biological functions. However, cholesterol is not only beneficial to the cells. An excess of cholesterol is toxic and therefore cells employ a number of safety devices to limit the concentration of free cholesterol. Monocyte-derived macrophages taking up modified cholesterol-rich low-density lipoprotein (LDL) particles are the central problem in the development of atherosclerosis (1- 3). To ensure an adequate supply of cholesterol, yet avoid excess, cellular cholesterol homeostasis is a tightly regulated process. Two transcription factor families, the sterol regulatory element-binding proteins (SREBPs) (4) and liver X receptors (LXRs) (5, 6), are implicated in gene regulation by cholesterol and its oxysterol derivatives. When cellular sterols are abundant, SREBPs are inactive in the endoplasmic reticulum membrane, whereas LXRs are activated by their oxysterol ligands and activate genes involved in reverse cholesterol transport and fatty acid synthesis (7). While LXRs are inactive upon sterol depletion, SREBPs are cleaved by regulated proteolysis to release the mature transcription factor domain, which translocates to the nucleus. SREBPs then bind to sterol regulatory elements (SREs) in the promoters of genes involved in the biosynthesis and uptake of

cholesterol and fatty acids to stimulate their transcription (4, 8). Recently, cholesterol was shown to activate a third transcriptional pathway, as free cholesterol-loaded macrophages trigger the endoplasmic reticulum (ER) stress response (9).

LXRs are nuclear hormone receptors that form heterodimers with the retinoic X receptor

(RXR). The LXR subfamily consists of two members, LXRα and LXRβ, which are both

activated by oxysterols. Whereas LXRβ is ubiquitously expressed, high expression of LXRα

is restricted to liver, adipose tissue, small intestine, and macrophages (10). LXRα has a dual

role in gene expression: the ligand-receptor complex upregulates a large number of target genes, whereas the unliganded receptor suppresses gene expression by recruiting corepressor proteins (1 1).

In the present study, we report on the identification and characterization of a gene which was found to be downregulated upon cholesterol loading in macrophages. This gene, which encodes for the transmembrane protein 97 (Tmem97), is a hypothetical protein with unknown function. Based on its homology to the human Mac30 protein, we also named it Mac30. We propose that Mac30 is sterol -regulated via SREBPs and LXR in a cell-type and tissue specific manner.

Summary of the invention

In one aspect, the invention provides an isolated nucleic acid encoding a MAC30, characterized in that the coding sequence of said gene is at least 70% homologous to SEQ ID No. 1 or SEQ ID No. 3. In another aspect, the invention provides an isolated protein having MAC30 activity encoded by the nucleic acid of the invention. In yet another aspect, the invention provides an antibody directed against the protein as mentioned hereinabove. In a further aspect, the invention provides a ribozyme, RNAi molecule, antisense nucleic acid

molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or an anticalin directed against the nucleic acid as defined hereinabove or against the protein as mentioned hereinabove. Also provided within the scope of the invention is the use of the ribozyme, RNAi molecule, antisense nucleic acid molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or an anticalin in the preparation of a pharmaceutical composition. Further provided by the invention is a method of treatment of a patient in need thereof comprising the administration of the ribozyme, RNAi molecule, antisense nucleic acid molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or anticalin to the patient. In a still further aspect, the invention provides an animal model wherein the expression of a gene corresponding to SEQ ID No. 1 or 3 is substantially reduced or the expression of said gene or or a homologous sequence as defined hereinabove and below is enhanced. The invention further provides an animal into which an isolated nucleic acid molecule carrying a gene corresponding to SEQ ID No. 1 or 3 or a homologue or orthologue thereof as defined above has been introduced. In another aspect, the invention provides a host cell carrying the nucleic acid sequence described hereinabove. In another aspect, the invention provides a vector comprising the nucleic acid as described hereinabove and a promoter in operable sequence. The vector preferably is an expression vector suitable for expression in a host cell as described above. The invention further provides methods of the treatment of a mammal wherein cells of the mammal, preferably blood cells, more preferably macrophage cells, are removed from the body and an isolated nucleic acid or expression vector as described hereinabove is introduced into said cells resulting in increased expression of the MAC30 activity according the invention, and said cells are reintroduced into the body.

Detailed description of the invention

Using cDNA microarray experiments we identified Mac30 as a gene whose expression was found to be more than 2-fold decreased upon cholesterol loading of mouse peritoneal macrophages. Mac30 lacks recognizable domains and its function is so far unknown. Murine Mac30 is ubiquitiously expressed with highest levels in testes and liver. Using quantitative real time PCR, we assessed Mac30 regulation under conditions known to regulate genes involved in cholesterol metabolism. We found that Mac30 mRNA expression was induced by cholesterol depletion upon statin incubation, which could not be reversed by mevalonate. When mice were fed a cholesterol-rich diet, Mac30 gene expression was found to be downregulated in mouse livers in vivo. Liver X receptor (LXR) activation in 3T3-L1 fibroblasts and RAW264.7 macrophages led to decreased Mac30 mRNA expression levels in vitro, while intraperitoneal injection of an LXR agonist resulted in an induction of Mac30 mRNA quantity in mouse livers in vivo. Mac30 gene expression increased 1.8-fold in free cholesterol-loaded macrophages, which activate the endoplasmic reticulum (ER) stress response. Because Mac30 is differently regulated in liver and macrophages we suggest cell- type specific functions in cholesterol metabolism with distinct regulatory mechanisms.

In one aspect, the invention provides an isolated nucleic acid encoding a MAC30, characterized in that the coding sequence of said gene is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 98% homologous to SEQ ID No. 1 or SEQ ID No. 3. Preferably, the invention provides an isolated nucleic acid encoding a MAC30, characterized in that the coding sequence of said gene is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 98% identical to SEQ ID No. 1 or SEQ ID No. 3. More preferably, the invention provides the isolated nucleic acid characterized in that the coding sequence thereof is at least 70% homologous or identical to SEQ ID No. 1 or SEQ ID No. 3. Further, the invention provides the nucleic acid whereby the

homology or identity is at least 85%, greater than 90%, or greater than 95%. Still further, the invention provides the said nucleic acid characterized in that the nucleic acid is able to hybridize to a nucleic acid comprising SEQ ID No. 1 or 2 under moderately stringent, stringent, or preferably under highly stringent conditions.

As used herein, the term "MAC30" is meant to comprise the above defined nucleic acid sequences, the proteins expressed thereby, and any orhtologues, variants, and/or alleles provided by the invention as described further below, as well as the regulatable characteristic of the said proteins which is the ability to be regulated by cholesterol and statins. In some cases, the term "mutant " or MAC30 mutant" is used to denote forms of MAC30 that have been prepared by the exchange, addition, and/or deletion of one or more nucleotides of the nucleic acid sequence or amino acids or the protein or peptide sequence and which do not exist in nature.

As used herein, the phrase "stringent hybridization conditions" refers to conditions under which a probe, primer or oligonucleotide or any other nucleic acid sequence referred to herein will hybridize to its target sequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures than shorter sequences. Generally, stringent conditions are selected to be about 5. degree. C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50% of the probes are occupied at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at

pH 7.0 to 8.3, and the temperature is at least about 30. degree. C. for short probes, primers or oligonucleotides (e.g., 10 nt to 50 nt) and at least about όO.degree. C. for longer probes, primers and oligonucleotides. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide. Stringent conditions are known to those skilled in the art and can be found in Ausubel et al. (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.

Moderately stringent conditions comprise hybridization at about 5x SSC at about 55 degrees C, followed by at least one wash at about 55 degrees C at about Ix SSC. Highly stringent conditions comprise hybridization in about 0,IxSSC at about 60 degrees C, followed by at least one wash at about 0,1 x SSC at about 60 degrees. The hybridization and/or washing temperatures may preferably independently be 65 degrees C. Preferred stringent hybridization conditions in accordance with the nucleic acids of the present invention, are hybridization in a high salt buffer comprising 6x SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 mg/ml denatured salmon sperm DNA at 65.degree. C, followed by one or more washes in 0.2. times. SSC, 0.01% BSA at 50.degree. C. More preferred stringent hybridization conditions in accordance with the nucleic acids of the present invention, are hybridization in a high salt buffer comprising 0,5x SSC, 50 mM Tris- HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 mg/ml denatured salmon sperm DNA at 65. degree. C, followed by one or more washes in 0.2.times.SSC, 0.01% BSA at όO.degree. C.

The nucleic acid sequences encoding mutant MAC30 of the invention may exist alone or in combination with other nucleic acids as, for example, vector molecules, such as plasmids, including expression or cloning vectors.

The term "nucleic acid sequence" as used herein refers to any contiguous sequence series of nucleotide bases, i.e., a polynucleotide, and is preferably a ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). Preferably the nucleic acid sequence is cDNA. It may, however, also be, for example, a peptide nucleic acid (PNA).

An "isolated" nucleic acid molecule, as referred to herein, is one, which is separated from other nucleic acid molecules ordinarily present in the natural source of the nucleic acid. Preferably, an "isolated" nucleic acid is free of sequences, which naturally flank the nucleic acid (i.e., sequences located at the 5'- and 3'-termini of the nucleic acid) in the genomic DNA of the organism that is the natural (wild type) source of the DNA.

MAC30 gene molecules can be isolated using standard techniques such as hybridization and cloning techniques or PCR amplification and cloning techniques such as described hereinbelow (see Materials and Methods, "cloning of genes" below) or the well known hybridization and cloning techniques, as described, for instance, in Sambrook et al. (eds.), MOLECULAR CLONING: A LABORATORY MANUAL (2.sup.nd Ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Ausubel et al. (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1993. A nucleic acid of the invention can be amplified using cDNA, mRNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to MAC30 nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.

A "homologous nucleic acid sequence" or "homologous amino acid sequence," or variations thereof, refers to sequences characterized by a homology at the nucleotide level or amino acid level, respectively. Homologous nucleotide sequences can include those sequences coding for isoforms of the MAC30 polypeptides. Isoforms can be expressed in different tissues of the same organism as a result of, for example, alternative splicing of RNA. Alternatively, isoforms can be encoded by different genes.

As used herein, the phrase "stringent hybridization conditions" refers to conditions under which a probe, primer or oligonucleotide or any other nucleic acid sequence referred to herein will hybridize to its target sequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures than shorter sequences. Generally, stringent conditions are selected to be about 5. degree. C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50% of the probes are occupied at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3, and the temperature is at least about 30.degree. C. for short probes, primers or oligonucleotides (e.g., 10 nt to 50 nt) and at least about όO.degree. C. for longer probes, primers and oligonucleotides. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide. Stringent conditions are known to those skilled in the

art and can be found in Ausubel et al. (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.

Preferred stringent hybridization conditions in accordance with the nucleic acids of the present invention, are hybridization in a high salt buffer comprising 6-times.SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 mg/ml denatured salmon sperm DNA at 65.degree. C, followed by one or more washes in 0.2.times.SSC, 0.01% BSA at 50.degree. C.

In another aspect, the invention provides an isolated protein having MAC30 activity encoded by a nucleic acid as mentioned hereinabove. The protein is preferably being characterized in being regulatable by cholesterol and/or statins upon expression in a macrophage cell line. The cell line is preferably murine, more preferably RAW264.7 and/or 3T3-L1.

The term MAC30 activity as used herein denotes all enzymatic and regulatory activity of MAC30, especially regulatory activity in cholesterol metabolism and regulatory and/or enzymatic activity in fatty acid metabolism. Such activities include cholesterol ester hydrolase and triglyceride lipase and/or hydrolase activities. These activities may be measured by standard assays well known to the person of skill in the art. Regulatory activities include the modulation of other gene products such as lipases, hydrolases and esterases involved in cholesterol, preferably in fatty acid metabolism. Target genes may include HSL, ATGL, CESl, ACATl, TGH, or other enzymes involved in fatty acid metabolism and cholesterol metabolism well known top the skilled artisan. Preferably, MAC30 activity includes its characteristic of being regulated by cholesterol and/or statins. Preferably, this activity is measured by using a MAC30 primer or hybridization probe, or an antibody, anticalin,

aptamer, or similar agent as provided herein which specifically binds to MAC30, to determine the amount of MAC30 mRNA or protein in a cell or animal which has been subjected to cholesterol loading, addition of cholesterol in the culture medium or diet, or exposure (e.g., by addition to the culture medium or in the diet) to a statin, such as lovastatin and/or simvastatin.

The regulatable activity of MAC30 may advantageously be measured by employing the promoter sequence of MAC30 and introducing said sequence into a reporter construct. The MAC30 5 r upstream gene sequence may be obtained by standard methods well known to the skilled artisan. For instance, the upstream gene sequence may be derived from the sequence of the human genome. The part of that sequence active as a promoter may be determined by employing a variety of standard assays known to the skilled artisan, such a reporter gene assays (which determine the promoter and enhancer characteristics of isolated fragments of DNA) and RNA protection assays (which allow the precise determination of the transcriptional start point which defines the promoter location). Such techniques are described among others in Sambrook et al. (eds.), MOLECULAR CLONING: A LABORATORY MANUAL (2.sup.nd Ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Ausubel et al. (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1993.

All such proteins and peptides expressed by the isolated nucleic acid molecules of the invention and having MAC30 activity at least in one cell line are contemplated when using the expression "MAC30" or "MAC30 according (or "of) the invention" hereinbelow.

The present invention also provides homologues of the sequences of SEQ ID No. 1 and 3, for instance MAC30 genes of other species such as rat, money or human. These homologues may be obtained using the above mentioned hybridizytion and cloning techniques, preferably using

a low stringency approach, and determination of the MAC30 activity (for instance, as described hereinbelow for SEQ Nos 1 and 3) upon expression thereof (for instance as described hereinbelow for SEQ Nos 2 and 4) in a host cell or a cell free system. MAC30 homologues according to the invention are preferably those that express MAC30 activity in macrophage cells or cells derived therefrom, and more preferably those that lack triglyceride hydrolase activity. Also provided within the scope of the invention are mutated forms (mutants) of the MAC30 genes and proteins of the invention. Such mutated forms may be obtained by exchanging, deleting, or adding one or more nucleotides in the gene sequences or amino acids in the protein sequence. The resulting protein or protein expressed by the resulting nucleic acid preferably shows substantial MAC30 activity.

More generally, the present invention provides a protein having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid identity compared to the mouse MAC30 or the human MAC30 protein. Also encompassed by the present invention are fragments of such proteins comprising at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 1 10, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 555, or at least 558 contiguous amino acids having the above percentages of amino acid identity compared to the corresponding amino acids in SEQ ID NO:2 and SEQ ID NO4, or the orhtologues thereof derived from another species. For the purpose of clarity, the term "homologue" is meant to comprise all variants, homologues, and other forms of a gene or protein, including homologues of the gene derived from different species, otherwise referred to herein as "orthologue".

Again in a preferred embodiment, the mutation mentioned above results in a deletion or substitution by another amino acid of an amino acid of said mouse MAC30 protein according to SEQ ID NO:2 and SEQ ID NO:4, respectively or human orthologue MAC30 protein. Alternatively, the mutation may result in an insertion of additional amino acids not normally present in the amino acid sequence of the mouse MAC30 protein or the human MAC30 protein defined above.

The deletion, substitution, or insertion may furthermore occur in an evolutionary conserved region of said mouse MAC30 protein or said human MAC30 protein. In particular, it may be a substitution of an amino acid which is identical or similar between mouse, rat, and human MAC30, preferably between mouse, rat, human, and Xenopus laevis MAC30, more preferably between mouse, rat, human, Xenopus laevis, and Caenorhabditis elegans MAC30, by another amino acid. Such amino acid may be a non-naturally occurring or a naturally ocurring amino acid. The skilled artisan will be readily able to determine regions which are generally evolutionary conserved amongst different species on the basis of sequence comparisons.

Preferably, the wild type residue of the modified MAC30 protein is replaced by an amino acid with different size and/or polarity, i.e., a non-conservative amino acid substitution, as defined below.

An "isolated" or "purified" polypeptide or protein, or a biologically active fragment thereof as described and claimed herein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the polypeptide or protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.

The language "substantially free of cellular material" includes preparations of MAC30 protein

in which the protein is separated from cellular components of the cells from which the protein is isolated or in which it is recombinantly produced.

The invention furthermore encompasses mature mouse MAC30 or human MAC30 proteins, or their vertebrate orthologues, which comprise an amino acid or amino acid sequences corresponding to a mutation as defined above. As used herein, a "mature" form of a polypeptide or protein may arise from a post-translational modification. Such additional processes include, by way of non-limiting example, proteolytic cleavage, e.g., cleavage of a leader sequence, glycosylation, myristoylation or phosphorylation. In general, a mature polypeptide or protein according to the present invention may result from the operation of one of these processes, or a combination of any of them.

When a residue is replaced by an amino acid with different size and/or polarity, this is termed a non-conservative amino acid substitution. Non-conservative substitutions are defined as exchanges of an amino acid by another amino acid listed in a different group of the five standard amino acid groups shown below:

1. small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, (Pro), (GIy);

2. negatively charged residues and their amides: Asn, Asp, GIu, GIn;

3. positively charged residues: His, Arg, Lys;

4. large aliphatic, nonpolar residues: Met, Leu, He, VaI, (Cys);

5. large aromatic residues: Phe, Tyr, Trp.

Conservative substitutions are defined as exchanges of an amino acid by another amino acid listed within the same group of the five standard amino acid groups shown above. Three residues are parenthesized because of their special role in protein architecture. GIy is the only

residue without a side-chain and therefore imparts flexibility to the chain. Pro has an unusual geometry which tightly constrains the chain. Cys can participate in disulfide bonds.

The invention also provides novel chimeric or fusion proteins. As used herein, a novel "chimeric protein" or "fusion protein" comprises a novel MAC30 polypeptide linked to a non- MAC30 polypeptide (i.e., a polypeptide that does not comprise MAC30 or a fragment thereof).

In one embodiment, the fusion protein is a GST-MAC30 heavy chain fusion protein in which the MAC30 sequences are fused to the C-terminus of the GST (glutathione-S-transferase) sequences. Such fusion proteins can facilitate the purification of recombinant MAC30 polypeptides.

In yet another embodiment, the fusion protein is a MAC30-immunoglobulin fusion protein in which the MAC30 sequences are fused to sequences derived from a member of the immunoglobulin protein family, especially Fc region polypeptides. Also contemplated are fusions of MAC30 sequences (mutant proteins or fragments) fused to amino acid sequences that are commonly used to facilitate purification or labeling, e.g., polyhistidine tails (such as hexahistidine segments), FLAG tags, and streptavidin.

The amino acid sequences of the present invention may be made by using peptide synthesis techniques well known in the art, such as solid phase peptide synthesis (see, for example, Fields et al., "Principles and Practice of Solid Phase Synthesis" in SYNTHETIC PEPTIDES, A USERS GUIDE, Grant, G. A., Ed., W.H. Freeman Co. NY. 1992, Chap. 3 pp. 77-183; Barlos, K. and Gatos, D. "Convergent Peptide Synthesis" in FMOC SOLID PHASE

PEPTIDE SYNTHESIS, Chan, W. C. and White, P. D. Eds., Oxford University Press, New

York, 2000, Chap. 9: pp. 215-228) or by recombinant DNA manipulations and recombinant expression. Techniques for making substitution mutations at predetermined sites in DNA having known sequence are well known and include, for example, M 13 mutagenesis. Manipulation of DNA sequences to produce variant proteins which manifests as substitutional, insertional or deletional variants are conveniently described, for example, in Sambrook et al. (1989), mentioned herein.

In yet another aspect, the invention provides an antibody directed against the protein as mentioned hereinabove. The antibody is preferably a monoclonal, polyclonal or humanized antibody, an Fab fragment, or a single chain antibody. The invention also provides a part of an antibody as long as the part is capable of binding to the protein. In one embodiment, the part of the protein to which the antibody or part thereof binds is active site of the cholesterol ester hydrolase activity of the protein. The part of the antibody is preferably the Fab fragment or a functional part thereof having essentially the same binding characteristics, in another embodiment, the antibody is a single chain antibody. The antibody or part thereof preferably binds specifically to the protein. Further preferably, the antibody fails to bind to and/or inhibit the activity of least one other cholesterol-regulated gene. The other gene is preferably Hmgcr. Further preferably, the antibody is preferably directed to a protein encoded by SEQ ID no. 1 or by a nucleic acid sequence homologous thereto as defined hereinabove whereby said antibody fails to bind and/ or inhibit the activity of the protein encoded by SEQ ID No. 2. Also preferably, the antibody which is directed to a protein encoded by SEQ ID no. 2 or by a nucleic acid sequence homologous thereto as defined hereinabove fails to bind and/ or inhibit the activity of the protein encoded by SEQ ID No. 1. The antibody preferably inhibits the hydrolase activity of the protein.

An MAC30 polypeptide, i.e., wild type or mutant MAC30, as described herein, may be intended to serve as an antigen, or a portion or fragment thereof, and additionally can be used as an immunogen to generate antibodies that immunospecifϊcally bind the antigen, using standard techniques for polyclonal and monoclonal antibody preparation. Antigenic peptide fragments of the antigen for use as immunogens includes, e.g., at least 7 amino acid residues of the amino acid sequence of the mutated region such as an amino acid sequence shown in SEQ ID NO:2, and in SEQ ID NO:4, respectively, and encompasses an epitope thereof such that an antibody raised against the peptide forms a specific immune complex with the full length protein or with any fragment that contains the epitope. Preferably, the antigenic peptide comprises at least 10 amino acid residues, or at least 15 amino acid residues, or at least 20 amino acid residues, or at least 30 amino acid residues. Preferred epitopes encompassed by the antigenic peptide are regions of the protein that are located on its surface; commonly these are hydrophilic regions.

In certain embodiments of the invention, at least one epitope encompassed by the antigenic peptide is a region of mutant or wild type MAC30 polypeptide that is located on the surface of the protein, e.g., a hydrophilic region. A hydrophobicity analysis of a mutant or wild type MAC30 polypeptide will indicate which regions of a mutant or wild type MAC30 protein are particularly hydrophilic and, therefore, are likely to encode surface residues useful for targeting antibody production. As a means for targeting antibody production, hydropathy plots showing regions of hydrophilicity and hydrophobicity may be generated by any method well known in the art, including, for example, the Kyte Doolittle or the Hopp Woods methods, either with or without Fourier transformation. See, e.g., (Hopp and Woods, 1981 ; Kyte and Doolittle, 1982b; Kyte and Doolittle, 1982a). Antibodies that are specific for one or more domains within an antigenic protein, or derivatives, fragments, analogs or homologs thereof, are also provided herein.

A protein of the invention, or a derivative, fragment, analog, homolog or ortholog thereof, may be utilized as an immunogen in the generation of antibodies that immunospecifϊcally bind these protein components.

Various procedures known within the art may be used for the production of polyclonal or monoclonal antibodies directed against a protein of the invention, or against derivatives, fragments, analogs, homologies or orthologues thereof. See, for example, ANTIBODIES: A LABORATORY MANUAL, Harlow and Lane (1988) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Some of these antibodies are discussed below.

For the production of polyclonal antibodies, various suitable host animals (e.g., rabbit, goat, mouse or other mammal) may be immunized by one or more injections with the protein of the invention, a synthetic variant thereof, or a derivative of the foregoing. An appropriate immunogenic preparation can contain, for example, the naturally occurring immunogenic protein, a chemically synthesized polypeptide representing the immunogenic protein, or a recombinantly expressed immunogenic protein. Furthermore, the protein may be conjugated to a second protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. The preparation can further include an adjuvant. Various adjuvants used to increase the immunological response include, but are not limited to, Freund's (complete and incomplete), mineral gels (e.g., aluminum hydroxide), surface active substances (e.g., lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenol, etc.), adjuvants usable in humans such as Bacille Calmette-Guerin and Corynebacterium parvum, or similar immunostimulatory agents.

Additional examples of adjuvants which can be employed include MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).

The term "monoclonal antibody" (MAb) or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules that contain only one molecular species of antibody molecule consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity determining regions (CDRs) of the monoclonal antibody are identical in all the molecules of the population. MAbs thus contain an antigen binding site capable of immunoreacting with a particular epitope of the antigen characterized by a unique binding affinity for it.

Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein (Kohler and Milstein, 1975). Thus, the invention provides hybridoma cells expressing the monoclonal antibody of the invention.

The monoclonal antibodies can also be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA can be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also can be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences (U.S. Pat. No.

4,816,567; Morrison, 1994b) or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non- immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.

The antibodies directed against the protein antigens of the invention can further comprise humanized antibodies or human antibodies. These antibodies are suitable for administration to humans without engendering an immune response by the human against the administered immunoglobulin. Humanized forms of antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') 2 or other antigen- binding subsequences of antibodies) that are principally comprised of the sequence of a human immunoglobulin, and contain minimal sequence derived from a non-human immunoglobulin. Humanization can be performed following the method of Winter and co- workers (Jones et al., 1986; Riechmann et al., 1988b; Verhoeyen et al., 1988a; Riechmann et al., 1988a; Verhoeyen et al., 1988b), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. (See also U.S. Pat. No. 5,225,539.) In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies can also comprise residues, which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin

constant region (Fc), typically that of a human immunoglobulin (Jones et al., 1986; Riechmann et al., 1988b; Riechmann et al., 1988a).

Fully human antibodies relate to antibody molecules in which essentially the entire sequences of both the light chain and the heavy chain, including the CDRs, arise from human genes. Such antibodies are termed "human antibodies", or "fully human antibodies" herein. Human monoclonal antibodies can be prepared by the trioma technique; the human B-cell hybridoma technique and the EBV hybridoma technique to produce human monoclonal antibodies (see Cole, et al., 1985 In: MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96). Human monoclonal antibodies may be utilized in the practice of the present invention and may be produced by using human hybridomas (Cote et al., 1983) or by transforming human B-cells with Epstein Barr Virus in vitro (see Cole, et al. (1985) In: MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96).

In addition, human antibodies can also be produced using additional techniques, including phage display libraries (Hoogenboom and Winter, 1992; Marks et al., 1991a; Marks et al., 1991b). Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in here: Fishwild et al., 1996b; Lonberg et al., 1994b; Lonberg and Huszar, 1995b; Marks et al., 1992; Morrison, 1994b; Neuberger, 1996b; Fishwild et al., 1996a; Lonberg et al., 1994a; Lonberg and Huszar, 1995a; Morrison, 1994a; Neuberger, 1996a.

Human antibodies may additionally be produced using transgenic non-human animals which are modified so as to produce fully human antibodies rather than the animal's endogenous antibodies in response to challenge by an antigen. See PCT publication WO94/02602. The endogenous genes encoding the heavy and light immunoglobulin chains in the nonhuman host have been incapacitated, and active loci encoding human heavy and light chain immunoglobulins are inserted into the host's genome. The human genes are incorporated, for example, using yeast artificial chromosomes containing the requisite human DNA segments. An animal which provides all the desired modifications is then obtained as progeny by crossbreeding intermediate transgenic animals containing fewer than the full complement of the modifications. The preferred embodiment of such a nonhuman animal is a mouse, and is termed the Xenomouse.TM. as disclosed in PCT publications WO 96/33735 and WO 96/34096. This animal produces B cells which secrete fully human immunoglobulins. The antibodies can be obtained directly from the animal after immunization with an immunogen of interest, as, for example, a preparation of a polyclonal antibody, or alternatively from immortalized B cells derived from the animal, such as hybridomas producing monoclonal antibodies. Additionally, the genes encoding the immunoglobulins with human variable regions can be recovered and expressed to obtain the antibodies directly, or can be further modified to obtain analogs of antibodies such as, for example, single chain Fv molecules.

An example of a method of producing a nonhuman host, exemplified as a mouse, lacking expression of an endogenous immunoglobulin heavy chain is disclosed in U.S. Pat. No. 5,939,598. It can be obtained by a method including deleting the J segment genes from at least one endogenous heavy chain locus in an embryonic stem cell to prevent rearrangement of the locus and to prevent formation of a transcript of a rearranged immunoglobulin heavy chain locus, the deletion being effected by a targeting vector containing a gene encoding a

selectable marker; and producing from the embryonic stem cell a transgenic mouse whose somatic and germ cells contain the gene encoding the selectable marker.

A method for producing an antibody of interest, such as a human antibody, is disclosed in U.S. Pat. No. 5,916,771. It includes introducing an expression vector that contains a nucleotide sequence encoding a heavy chain into one mammalian host cell in culture, introducing an expression vector containing a nucleotide sequence encoding a light chain into another mammalian host cell, and fusing the two cells to form a hybrid cell. The hybrid cell expresses an antibody containing the heavy chain and the light chain.

In a further improvement on this procedure, a method for identifying a clinically relevant epitope on an immunogen, and a correlative method for selecting an antibody that binds immunospecifically to the relevant epitope with high affinity, are disclosed in PCT publication WO 99/53049.

According to the invention, techniques can be adapted for the production of single-chain antibodies specific to an antigenic protein of the invention (see e.g., U.S. Pat. No. 4,946,778). In addition, methods can be adapted for the construction of F ab expression libraries (Huse et al., 1989) to allow rapid and effective identification of monoclonal F ab fragments with the desired specificity for a protein or derivatives, fragments, analogs or homologs thereof. Antibody fragments that contain the idiotypes to a protein antigen may be produced by techniques known in the art including, but not limited to: (i) an F.sub.(ab')2 fragment produced by pepsin digestion of an antibody molecule; (ii) an F ab fragment generated by reducing the disulfide bridges of an F (ab)2 fragment; (iii) an F ab fragment generated by the treatment of the antibody molecule with papain and a reducing agent and (iv) Fyfragments.

Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for an antigenic protein of the invention. The second binding target is any other antigen, and advantageously is a cell-surface protein or receptor or receptor subunit.

Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities (Milstein and Cuello, 1983). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829 and in Traunecker et al. (Traunecker et al., 1991).

Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy-chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain constant region (CHl) containing the site necessary for light-chain binding present in at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host organism. For further details of generating bispecific antibodies see, for example, Suresh et al. (Suresh et al., 1986).

According to another approach described in WO 96/2701 1, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are

recovered from recombinant cell culture. The preferred interface comprises at least a part of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g. tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g. alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.

Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g. F(ab') 2 bispecific antibodies). Techniques for generating bispecific antibodies from antibody fragments have been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al. (Brennan et al., 1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab') 2 fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes.

Additionally, Fab' fragments can be directly recovered from E. coli and chemically coupled to form bispecific antibodies. Shalaby et al. (Shalaby et al., 1992) describe the production of a fully humanized bispecific antibody F(ab') 2 molecule. Each Fab' fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the

bispecific antibody. The bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.

Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers (Kostelny et al., 1992). The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion. The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers. The "diabody" technology (Holliger et al., 1993) has provided an alternative mechanism for making bispecific antibody fragments. The fragments comprise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (V L ) by a linker which is too short to allow pairing between the two domains on the same chain. Accordingly, the V H and V L domains of one fragment are forced to pair with the complementary V L and V H domains of another fragment, thereby forming two antigen- binding sites. Another strategy for making bispecific antibody fragments by the use of single- chain Fv (sFv) dimers has also been reported (Gruber et al., 1994).

Antibodies with more than two valencies are contemplated. For example, trispecific antibodies can be prepared (Tutt et al., 1991).

Exemplary bispecific antibodies can bind to two different epitopes, at least one of which originates in the protein antigen of the invention. Bispecific antibodies can also be used to direct various agents to cells, which express a particular antigen. These antibodies possess an

antigen-binding arm and an arm, which binds an agent such as a radionuclide chelator (e.g., EOTUBE, DPTA, DOTA, or TETA).

Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for treatment of HIV infection (WO 91/00360; WO 92/200373; EP 03089). It is contemplated that the antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including those involving cross-linking agents. For example, immunotoxins can be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. Pat. No. 4,676,980.

It can be desirable to modify the antibody of the invention with respect to effector function, so as to enhance, e.g., the effectiveness of the antibody. For example, cysteine residue(s) can be introduced into the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus generated can have improved internalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC) (Caron et al., 1992; Shopes, 1992a; Shopes, 1992b). Homodimeric antibodies with enhanced anti-tumor activity can also be prepared using heterobifunctional cross-linkers as described in Wolff et al. (Wolff et al., 1993). Alternatively, an antibody can be engineered that has dual Fc regions and can thereby have enhanced complement lysis and ADCC capabilities (Stevenson et al., 1989).

The invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of

bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioconjugate).

Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes. A variety of radionuclides are available for the production of radioconjugated antibodies. Examples include 212 Bi, . 131 I, 131 In, 90 Y, and 186 Re.

Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein-coupling agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1 ,5-difluoro-2,4- dinitrobenzene). For example, a ricin immunotoxin can be prepared as described (Vitetta et al., 1983). Carbon- 14-labeled l-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See WO94/11026.

In another embodiment, the antibody can be conjugated to a "receptor" (such streptavidin) for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administered to

the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand" (e.g.. avidin) that is in turn conjugated to a cytotoxic agent.

Immonoconjugates according to the present invention are furthermore those comprising an antibody as described above conjugated to an imaging agent. Imaging agents suitable in this regard are, for example, again certain radioactive isotopes. Suitable in this regard are .sup.l 8F, .sup.64Cu, .sup.67Ga, .sup.68Ga, .sup.99 mTc, .sup.l l l ln, .sup.1231, .sup.1251, .sup.1311, .sup.169Yb, .sup.186Re, and .sup.201Tl. Particularly preferred in this regard is .sup.99mTc. The radioactive isotopes will suitably be conjugated to the antibody via a chelating group that is covalently attached to the antibody and is capable of chelating the radioactive isotope.

In a further aspect, the invention provides a ribozyme, RNAi molecule, antisense nucleic acid molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or an anticalin directed against the nucleic acid as defined hereinabove or against the protein as mentioned hereinabove.

Also provided within the scope of the invention is the use of the ribozyme, RNAi molecule, antisense nucleic acid molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or an anticalin in the preparation of a pharmaceutical composition.

Further provided by the invention is a method of treatment of a patient in need thereof comprising the administration of the ribozyme, RNAi molecule, antisense nucleic acid molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or anticalin to the patient, wherein said administration preferably comprises intravenous, oral,

transdermal, sustained release, suppository, or sublingual administration. In a preferred embodiment, the patient suffers from a condition related to cholesterol metabolism or who carry an increased risk of developing said condition. The condition is preferably selscted selected from diabetes, diabetes type I, diabetes type II, coronary artery disease, atherosclerosis, myocardial infarction, coronary artery bypass graft, percutaneous transluminal angioplasties, coronary stenosis, cerebrovascular disease transient ischemic attack, ischemic stroke, carotid endarterectomies, and peripheral arterial disease.

The administration of an agent capable of upregulating the expression of Mac30 is preferably used for the treatment of prevention of a condition associated with fatty acid metabolism or cholesterol metabolism, such as diabetes, diabetes type I, diabetes type II, coronary artery disease, atherosclerosis, myocardial infarction, coronary artery bypass graft, percutaneous transluminal angioplasties, coronary stenosis, cerebrovascular disease transient ischemic attack, ischemic stroke, carotid endarterectomies, and peripheral arterial disease. Such agents preferably are siRNA molecules capable of upregulating Mac30, interacting partners capable of upregulating Mac30, and statin-like and other agents found in the screening assay as described herein.

Anticalins are engineered proteins with antibody-like binding functions derived from natural lipocalins as a scaffold. These small monomelic proteins of only about 150 to 190 amino acids may have certain competitive advantages over antibodies, e.g., an increased binding specificity and improved tissue penetration, for example in the case of solid tumors. The anticalins of the present invention preferably bind their ligands with high specificity and affinity in the nanomolar range, e.g., in the low nanomolar range with K(D) values ranging between 12 nM and 35 nM. The set of four loops of anticalins may be easily manipulated at the genetic level (Weiss and Lowmann, 2000; Skerra, 2001). A preferred anticalin according

to the present invention specifically binds to a mutant or ortholog MAC30 protein as described herein. Another preferred anticalin specifically binds to the wild type MAC30 protein, e.g., the MAC30 proteins according to SEQ ID NO:2 or SEQ ID NO:4.

Methods for producing aptamers specific for proteins and nucleic acids are known. See, e.g., U.S. Pat. No. 5,840,867, U.S. Pat. No. 5,756,291, and U.S. Pat. No. 5,582,981.

A preferred antisense nucleic acid according to the present invention is an antisense nucleic acid comprising a nucleotide sequence which is complementary to a part of an mRNA encoding a MAC30 according to the invention.

A further preferred antisense nucleic acid is one comprising a nucleotide sequence which is complementary to a part of an mRNA encoding the protein according to SEQ ID NO.2 and SEQ ID NO.4, respectively, or an orthologue thereof having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% amino acid identity compared to protein of SEQ ID NO.2 and SEQ ID NO.4, said part preferably being a non-coding part. In a preferred embodiment, the antisense nucleic acid is capable of hybridizing to the mRNA via the complementary nucleotide sequence under physiological conditions, in particular the preferred physiological conditions. Physiological conditions are conditions as they are inside eukaryotic cells either within a multicellular organism or under conditions of cell or tissue culture. Such conditions are preferably characterized by a temperature of about or exactly 37.degree. C, absence of formamide, and an ionic strength corresponding to physiological buffer, above, e.g., 6x SSC. In this case, the antisense RNA is inter alia suitable to be used in connection with the methods and uses of the present invention that relate to the prevention, treatment, or amelioration of a medical condition associated with an alteration in cholesterol metabolism or with the condition or risk thereof as defined above. In another preferred embodiment, the antisense

RNA according to the present invention is capable of hybridizing to said mRNA under high stringency conditions, in particular the preferred high stringency conditions defined above.

The antisense nucleic acid may be a ribozyme comprising a catalytic region; suitably, the catalytic regiion enables the antisense RNA to specifically cleave the mRNA to which the antisense RNA hybridizes. Also preferred are antisense nucleic acids which hybridize more effectively to their target mRNA than to the mRNA of other cholesterol regulated genes, such as Hmgcr. Prokaryotic and eukaryotic host cells transformed with the above antisense nucleic acids are likewise within the scope of the present invention.

In one aspect of the invention, MAC30 gene expression can be attenuated by RNA interference. One approach well-known in the art is short interfering RNA (siRNA) mediated gene silencing where expression products of a MAC30 gene are targeted by specific double stranded MAC30 derived siRNA nucleotide sequences that are complementary to at least a 19-25 nt long segment of the MAC30 gene transcript, including the 5' untranslated (UT) region, the open reading frame (ORF), or the 3' UT region. See, for example, PCT applications WO00/44895, WO99/32619, WO01/75164, WO/01/92513, WO01/29058, WO01/89304, WO02/16620, and WO02/29858, each incorporated by reference herein in their entirety. Targeted genes can be an MAC30 gene, or an upstream or downstream modulator of MAC30 gene expression or protein activity. For example, expression of a phosphatase or kinase of MAC30, or another protein binding to MAC30 and thereby modulating its activity, may be targeted by an siRNA.

According to the methods of the present invention, MAC30 gene expression is silenced using short interfering RNA. Such an MAC30 siRNA can be obtained using an MAC30 polynucleotide sequence, for example, by processing the MAC30 ribopolynucleotide

sequence in a cell-free system, such as but not limited to a Drosophila extract, or by transcription of recombinant double stranded MAC30 RNA or by chemical synthesis of nucleotide sequences homologous to a MAC30 sequence. See, e.g., Tuschl, Zamore, Lehrnann, Bartel and Sharp (1999), Genes & Dev. 13: 3191-3197, incorporated herein by reference in its entirety (Tuschl et al., 1999). When synthesized, a typical 0.2 micromolar- scale RNA synthesis provides about 1 milligram of siRNA, which is sufficient for 1000 transfection experiments using a 24-well tissue culture plate format.

The most efficient silencing is generally observed with siRNA duplexes composed of a 21 -nt sense strand and a 21-nt antisense strand, paired in a manner to have a 2-nt 3' overhang. The sequence of the 2-nt 3' overhang makes an additional small contribution to the specificity of siRNA target recognition. The contribution to specificity is localized to the unpaired nucleotide adjacent to the first paired bases. In one embodiment, the nucleotides in the 3' overhang are ribonucleotides. In an alternative embodiment, the nucleotides in the 3' overhang are deoxyribonucleotides. Using 2'-deoxynucleotides in the 3' overhangs is as efficient as using ribonucleotides, but deoxyribonucleotides are often cheaper to synthesize and are most likely more nuclease resistant.

A recombinant expression vector of the invention comprises a MAC30 DNA molecule cloned into an expression vector comprising operatively-linked regulatory sequences flanking the MAC30 sequence in a manner that allows for expression (by transcription of the DNA molecule) of both strands. An RNA molecule that is antisense to MAC30 mRNA is transcribed by a first promoter (e.g., a promoter sequence 3' of the cloned DNA) and an RNA molecule that is the sense strand for the MAC30 mRNA is transcribed by a second promoter (e.g., a promoter sequence 5' of the cloned DNA). The sense and antisense strands may hybridize in vivo to generate siRNA constructs for silencing of the MAC30 gene.

Alternatively, two constructs can be utilized to create the sense and anti-sense strands of an siRNA construct. Finally, cloned DNA can encode a construct having secondary structure, wherein a single transcript has both the sense and complementary antisense sequences from the target gene or genes. In an example of this embodiment, a hairpin RNAi product is homologous to all or a portion of the target gene. In another example, a hairpin RNAi product is an siRNA. The regulatory sequences flanking the MAC30 sequence may be identical or may be different, such that their expression may be modulated independently, or in a temporal or spatial manner.

In a specific embodiment, siRNAs are transcribed intracellularly by cloning the MAC30 gene templates into a vector containing, e.g., a RNA pol III transcription unit from the smaller nuclear RNA (snRNA) U6 or the human RNase P RNA Hl . One example of a vector system is the GeneSuppressor.TM. RNA Interference kit (commercially available from imgenex). The U6 and Hl promoters are members of the type III class of Pol III promoters. The +1 nucleotide of the U6-like promoters is always guanosine, whereas the +1 for Hl promoters is adenosine. The termination signal for these promoters is defined by five consecutive thymidines. The transcript is typically cleaved after the second uridine. Cleavage at this position generates a 3' UL overhang in the expressed siRNA, which is similar to the 3' overhangs of synthetic siRNAs. Any sequence less than 400 nucleotides in length can be transcribed by these promoter, therefore they are ideally suited for the expression of around 21 -nucleotide siRNAs in, e.g., an approximately 50-nucleotide RNA stem-loop transcript.

siRNA vectors appear to have an advantage over synthetic siRNAs where long term knockdown of expression is desired. Cells transfected with a siRNA expression vector would experience steady, long-term mRNA inhibition. In contrast, cells transfected with exogenous synthetic siRNAs typically recover from mRNA suppression within seven days or ten rounds

of cell division. The long-term gene silencing ability of siRNA expression vectors may provide for applications in gene therapy. Therefore, such vectors may be preferably used with the method of treatment of the invention whereby cells removed from the body of the mammal are manipulated outside of the body of the mammal to modulate the expression of the MAC30 gene.

In general, siRNAs are chopped from longer dsRNA by an ATP-dependent ribonuclease called DICER. DICER is a member of the RNase III family of double-stranded RNA-specific endonucleases. The siRNAs assemble with cellular proteins into an endonuclease complex. In vitro studies in Drosophila suggest that the siRNAs/protein complex (siRNP) is then transferred to a second enzyme complex, called an RNA-induced silencing complex (RISC), which contains an endoribonuclease that is distinct from DICER. RISC uses the sequence encoded by the antisense siRNA strand to find and destroy mRNAs of complementary sequence. The siRNA thus acts as a guide, restricting the ribonuclease to cleave only mRNAs complementary to one of the two siRNA strands.

A MAC30 mRNA region to be targeted by siRNA is generally selected from a MAC30 sequence beginning 50 to 100 nt downstream of the start codon. Alternatively, 5' or 3' UTRs and regions nearby the start codon can be used but are generally avoided, as these may be richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNP or RISC endonuclease complex. An initial BLAST homology search for the selected siRNA sequence is done against an available nucleotide sequence library to ensure that only one gene is targeted. Specificity of target recognition by siRNA duplexes indicate that a single point mutation located in the paired region of an siRNA duplex is sufficient to abolish target mRNA degradation. See Elbashir et al. 2001 EMBO J. 20(23):6877-88 (Elbashir et al., 2001b). Hence, consideration should be

taken to accommodate SNPs, polymorphisms, allelic variants or species-specific variations when targeting a desired gene.

A complete MAC30 siRNA experiment should include the proper negative control. Negative control siRNA should have the same nucleotide composition as the MAC30 siRNA but lack significant sequence homology to the genome. Typically, one would scramble the nucleotide sequence of the MAC30 siRNA and do a homology search to make sure it lacks homology to any other gene.

Two independent MAC30 siRNA duplexes can be used to knock-down a target MAC30 gene. This helps to control for specificity of the silencing effect. In addition, expression of two independent genes can be simultaneously knocked down by using equal concentrations of different MAC30 siRNA duplexes. Availability of siRNA-associating proteins is believed to be more limiting than target mRNA accessibility.

A targeted MAC30 region is typically a sequence of two adenines (AA) and two thymidines (TT) divided by a spacer region of nineteen (N 19) residues (e.g., AA(N19)TT). A desirable spacer region has a G/C-content of approximately 30% to 70%, and more preferably of about 50%. If the sequence AA(N19)TT is not present in the target sequence, an alternative target region would be AA(N21). The sequence of the MAC30 sense siRNA corresponds to (N19)TT or N21, respectively. In the latter case, conversion of the 3' end of the sense siRNA to TT can be performed if such a sequence does not naturally occur in the MAC30 polynucleotide. The rationale for this sequence conversion is to generate a symmetric duplex with respect to the sequence composition of the sense and antisense 3 1 overhangs. Symmetric 3' overhangs may help to ensure that the siRNPs are formed with approximately equal ratios of sense and antisense target RNA-cleaving siRNPs (see, Elbashir, Lendeckel and Tuschl

(2001), Genes & Dev. 15: 188-200, incorporated by reference herein in its entirely) (Elbashir et al., 2001 a). The modification of the overhang of the sense sequence of the siRNA duplex is not expected to affect targeted mRNA recognition, as the antisense siRNA strand guides target recognition.

Alternatively, if the MAC30 target mRNA does not contain a suitable AA(N21) sequence, one may search for the sequence NA(N21). Further, the sequence of the sense strand and antisense strand may still be synthesized as 5' (N19)TT, as it is believed that the sequence of the 3'-most nucleotide of the antisense siRNA does not contribute to specificity. Unlike antisense or ribozyme technology, the secondary structure of the target mRNA does not appear to have a strong effect on silencing. See Harborth et al. (2001) J. Cell Science 114: 4557-4565, incorporated herein by reference in its entirety (Harborth et al., 2001).

Transfection of MAC30 siRNA duplexes can be achieved using standard nucleic acid transfection methods, for example, OLIGOFECTAMINE Reagent (commercially available from Invitrogen). An assay for MAC30 gene silencing is generally performed approximately 2 days after transfection. No MAC30 gene silencing has been observed in the absence of transfection reagent, allowing for a comparative analysis of the wild type and silenced MAC30 phenotypes. In a specific embodiment, for one well of a 24-well plate, approximately 0.84 .micrograms of the siRNA duplex is generally sufficient. Cells are typically seeded the previous day, and are transfected at about 50% confluence. The choice of cell culture media and conditions are routine to those of skill in the art, and will vary with the choice of cell type. The efficiency of transfection may depend on the cell type, but also on the passage number and the confluency of the cells. The time and the manner of formation of siRNA-liposome complexes (e.g. inversion versus vortexing) are also critical. Low transfection efficiencies are the most frequent cause of unsuccessful MAC30 silencing. The efficiency of transfection

needs to be carefully examined for each new cell line to be used. Preferred cells are derived from a mammal, more preferably from a rodent such as a rat or mouse, and most preferably from a human. Where used for therapeutic treatment, the cells are preferentially autologous, although non-autologous cell sources are also contemplated as within the scope of the present invention.

For a control experiment, transfection of 0.84 .mu.g (micrograms) single-stranded sense MAC30 siRNA will have no effect on MAC30 silencing, and 0.84 .mu.g antisense siRNA has a weak silencing effect when compared to 0.84 .mu.g of duplex siRNAs. Control experiments again allow for a comparative analysis of the wild type and silenced MAC30 phenotypes. To control for transfection efficiency, targeting of common proteins is typically performed, for example targeting of lamin A/C or transfection of a CMV-driven EGFP-expression plasmid (e.g. commercially available from Clontech). In the above example, a determination of the fraction of lamin A/C knockdown in cells is determined the next day by such techniques as immunofluorescence, Western blot, Northern blot or other similar assays for protein expression or gene expression. Lamin A/C monoclonal antibodies may be obtained from Santa Cruz Biotechnology.

Depending on the abundance and the half life (or turnover) of the targeted MAC30 polynucleotide in a cell, a knock-down phenotype may become apparent after 1 to 3 days, or even later. In cases where no MAC30 knock-down phenotype is observed, depletion of the MAC30 polynucleotide may be observed by immunofluorescence or Western blotting. If the MAC30 polynucleotide is still abundant after 3 days, cells need to be split and transferred to a fresh 24-well plate for re-transfection. If no knock-down of the targeted protein (MAC30 or a MAC30 upstream or downstream gene) is observed, it may be desirable to analyze whether the target mRNA was effectively destroyed by the transfected siRNA duplex. Two days after

transfection, total RNA is prepared, reverse transcribed using a target-specific primer, and PCR-amplified with a primer pair covering at least one exon-exon junction in order to control for amplification of pre-mRNAs. RT/PCR of a non-targeted mRNA is also needed as control. Effective depletion of the mRNA yet undetectable reduction of target protein may indicate that a large reservoir of stable MAC30 protein may exist in the cell. Multiple transfection in sufficiently long intervals may be necessary until the target protein is finally depleted to a point where a phenotype may become apparent. If multiple transfection steps are required, cells are split 2 to 3 days after transfection. The cells may be transfected immediately after splitting.

An inventive therapeutic method of the invention contemplates administering an MAC30 siRNA construct as therapy to compensate for increased or aberrant MAC30 expression or activity. The MAC30 ribopolynucleotide is obtained and processed into siRNA fragments as described. The MAC30 siRNA is administered to cells or tissues using known nucleic acid transfection techniques, as described above. An MAC30 siRNA specific for an MAC30 gene will decrease or knockdown MAC30 transcription products, which will lead to reduced MAC30 polypeptide production, resulting in reduced MAC30 polypeptide activity in the cells or tissues.

Particularly preferred in connection with the present invention are siRNAs comprising a double stranded nucleotide sequence wherein one strand is complementary to an at least 19, 20, 21, 22, 23, 24, or 25 nucleotide long segment of an mRNA encoding a mutant of the invention as described herein, said segment encoding an amino acid sequence comprising the amino acid or amino acid sequence which corresponds to any of the mutations defined previously in connection with these mutants.

Also preferred are siRNAs wherein said strand is complementary to an at least 19, 20, 21 , 22, 23, 24, or 25 nucleotide long segment of an mRNA encoding the mouse MAC30 or the human homologue of MAC30 protein or an orthologue thereof having or at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% amino acid identity compared to the mouse MAC30 or the human MAC30 protein as defined above, said segment being a non-coding segment and comprising a sequence corresponding to a mutation in the gene coding for said protein or orthologue which affects expression of said protein or orthologue.

Furthermore preferred are siRNAs wherein said strand is complementary to an at least 19, 20, 21, 22, 23, 24, or 25 nucleotide long segment of an mRNA encoding a protein which affects expression or function of the mouse MAC30 or the human MAC30 protein, or an orthologue thereof having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% amino acid identity compared to the mouse MAC30 or the human MAC30 protein.

The above-mentioned segment may include sequences from the 5' untranslated (UT) region. Alternatively, or in addition, it may include sequences corresponding to the open reading frame (ORF). Again alternatively or in addition, it may include sequences from the 3' untranslated (UT) region.

Prokaryotic and eukaryotic host cells transformed with the above siRNAs are likewise within the scope of the present invention.

The present invention also encompasses a method of treating a disease or condition associated with the presence of an MAC30 protein in an individual comprising administering to the individual an RNAi construct that targets the mRNA of the protein (the mRNA that encodes the protein) for degradation. A specific RNAi construct includes a siRNA or a double

stranded gene transcript that is processed into siRNAs. Upon treatment, the target protein is not produced or is not produced to the extent it would be in the absence of the treatment.

Where the MAC30 gene function is not correlated with a known phenotype, a control sample of cells or tissues from healthy individuals provides a reference standard for determining MAC30 expression levels. Expression levels are detected using the assays described, e.g., RT- PCR, Northern blotting, Western blotting, ELISA, and the like. A subject sample of cells or tissues is taken from a mammal, preferably a mammal, suffering from a disease state. The MAC30 ribopolynucleotide is used to produce siRNA constructs, that are specific for the MAC30 gene product. These cells or tissues are treated by administering MAC30 siRNAs to the cells or tissues by methods described for the transfection of nucleic acids into a cell or tissue, and a change in MAC30 polypeptide or polynucleotide expression is observed in the subject sample relative to the control sample, using the assays described. This MAC30 gene knockdown approach provides a rapid method for determination of a MAC30 -phenotype in the treated subject sample. The MAC30 -phenotype observed in the treated subject sample thus serves as a marker for monitoring the course of a disease state during treatment.

In a still further aspect, the invention provides an animal model wherein the expression of a gene corresponding to SEQ ID No. 1 or 2 is substantially reduced. The invention also provides an animal model wherein the expression of a gene corresponding to SEQ ID No. 1 or 2 or a homologue thereof as defined above is substantially enhanced. The invention further provides an animal model wherein the expression of MAC30 is controlled such that expression is restricted to vertain tissues, or reduced in certain tissues, or controllable by addition of a modulator in the entire animal or in certain tissues or cell types. Such animals may be created, for instance, by placing the MAC30 gene within a cassette containing

recombinase recognition sequences and crossing the so obtained animal with one that expressed a recombinase capable fo recognizing said recombinase recognition sequences in certain tissues or cells. Such methods are well known in the art, see e.g., US patent application Nos. 20060064769 and 20030024001 , which are incorporated herein in their entirety by reference. The DNA sequence information provided by the present invention also makes possible the development (e.g., by homologous recombination or "knock-out" strategies; see Capecchi, Science 244:1288-1292 (1989), which is incorporated herein by reference) of animals that fail to express functional MAC30 or that express a variant of MAC30. Such animals (especially small laboratory animals such as rats, rabbits, and mice) are useful as models for studying the in vivo activities of MAC30 and modulators of MAC30.

The invention further provides an animal into which an isolated nucleic acid molecule carrying a gene corresponding to SEQ ID No. 1 or 2 or a homologue thereof as defined in above has been introduced. The isolated gene is preferably placed in proximity to a sequence that allows specific recombination. The sequence that allows specific recombination is preferably lox of flox sequence. The invention further preferably provides said animal also carrying a gene allowing the expression of a recombinase. The recombinase is preferably the ere or creER recombinase.

The host cells of the invention can also be used to produce non-human transgenic animals which may be useful as animal models. For example, in one embodiment, a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which MAC30 protein-coding sequences have been introduced. Such host cells can then be used to create non-human transgenic animals in which exogenous MAC30 sequences have been introduced into their genome or homologous recombinant animals in which endogenous MAC30 sequences have been altered. Such animals are useful for studying the function and/or activity of MAC30

protein and for identifying and/or evaluating modulators of MAC30 protein activity. As used herein, a "transgenic animal" is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, etc. Standard methods are known in the art that may be used in conjunction with the polynucleotides and of the invention and methods described herein to produce a transgenic animal expressing a wild-type or modified MAC30 of the invention.

In another aspect, the invention provides a host cell carrying the nucleic acid sequence described hereinabove. The host cell preferably is a prokaryotic cell, more preferably a bacterial cell, more preferably an E. coli, Streptococcus, preferably S. gordonii (Protein Expr Purif. 2005 Apr;40(2):319-26), or Lactobacillus, preferably Lactococcus lactis, (see e.g., Appl Environ Microbiol. 1994 February; 60(2): 587-593) host cell. More preferably, the host cell is an E. coli BL- 12 cell.

In another embodiment, the he host cell is a eukaryotic cell, preferably a fly, yeast, nematode, or mammalian cell. The mammalian cell is preferably a mouse or human cell. The mammalian cell is further preferably a macrophage cell or derived from a macrophage cell, more preferably RAW264.7. Further preferably, the mammalian cell is a CHO cell.

In another aspect, the invention provides a vector comprising the nucleic acid as described hereinabove and a promoter in operable sequence. The vector preferably is an expression vector suitable for expression in a host cell as described above.

The invention further provides methods of the treatment of a mammal wherein cells of the mammal, preferably blood cells, more preferably macrophage cells, are removed from the body and an isolated nucleic acid or expression vector as described hereinabove is introduced into said cells resulting in increased expression of the MAC30 activity according the invention, and said cells are reintroduced into the body. Preferably, that MAC30 activity is the activity exhibited by the protein of SEQ ID No. 2 or more preferably, by the protein of SEQ ID No. 4. Preferably, the nucleic acid introduced comprises SEQ ID No. 1 or a part thereof capable of expressing a protein having essentially the function of the protein of SEQ ID No. 2. More preferably, the nucleic acid introduced comprises SEQ ID No. 3 or a part thereof capable of expressing a protein having essentially the function of the protein of SEQ ID No. 4.

In another embodiment of the invention, the method comprises the step of removing cells of the mammal, preferably blood cells, more preferably macrophage cells, from the body and adding thereto a ribozyme, RNAi molecule, antisense nucleic acid molecule, a peptide, a small molecule, a peptide nucleic acid molecule, an aptamer, or an anticalin as described above, and reintroducing said cells into the body.

The mammal is preferably a mouse , monkey, or human. Most preferably, the mammal is a human.

Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding a MAC30 protein or derivatives, fragments, analogs or homologs thereof. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded circular DNA molecule into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of

autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors".

A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) MAC30 protein. Accordingly, the invention further provides methods for producing MAC30 protein using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding MAC30 protein has been introduced) in a suitable medium such that MAC30 protein is produced. In another embodiment, the method further comprises isolating MAC30 protein from the medium or the host cell.

In another aspect, the present invention relates to a method of identifying a protein or nucleic acid marker indicative of an increased risk of a mammal of developing a medical condition associated with an alteration in cholesterol metabolism function, said method comprising the step of analyzing a test sample derived from a mammal for the presence of a difference compared to a similar test sample if derived from a mammal unaffected by or known not to be at risk of developing said condition, wherein said difference is indicative of the presence of a mutation in an allele of the gene coding for the MAC30 protein according to SEQ ID NO:2 or 4 or an orthologue thereof, or in an allele of a gene coding for a protein which affects expression or function of said MAC30 protein. The mammal is preferably a human. In the following relating to the screening for altered cholesterol or preferably fatty acid metabolism, the mammal is preferably a human.

The present invention furthermore relates to a method of identifying a protein or nucleic acid marker indicative of an association of a medical condition in a mammal which is associated with an alteration in goblet cell function with altered MAC30 expression or function, said method comprising the step of analyzing a test sample derived from a mammal for the presence of a difference compared to a similar test sample if derived from a mammal unaffected by or known not to be at risk of developing said condition, wherein said difference is indicative of the presence of a mutation in an allele of the gene coding for the MAC30 protein according to SEQ ID NO:2 or 4 or an orthologue thereof, or in an allele of a gene coding for a protein which affects expression or function of said MAC30 protein.

In the above methods, the test sample derived from a mammal may be directly obtained from said mammal. It may, however, also be a sample that has been obtained previously. Also included test samples according to the invention are, for example, cDNA preparations that have been prepared from mRNA obtained from a tissue sample from a mammal at an earlier stage. It may also be cloned or PCR-amplified DNA that originates from DNA contained in such tissue sample obtained at an earlier stage.

According to the claimed method, the test sample will be analyzed for a difference to a similar test sample derived from a mammal unaffected by or known not to be at risk of developing a medical condition associated with an alteration in goblet cell function. While the method may include actually deriving or directly obtaining a test sample from such a mammal for comparative purposes, the necessary information regarding the relevant structural features and properties of such similar test sample to be used for comparison will often already be available. Thus, it will often be sufficient for the purposes of the above methods of the invention to perform an analysis for a difference to a similar test sample as it would be

observed if said similar test sample were in fact obtained from a mammal unaffected by or known not to be at risk of developing the above medical condition.

The test sample may be a nucleic acid sample, e.g., mRNA (or cDNA derived therefrom), or genomic DNA. It may also be a protein sample.

The difference analyzed may be one relating to the expression level of said nucleic acid or protein. Alternatively, it may be analyzed whether there is a difference in terms of the nucleotide or the amino acid sequence level.

Accordingly, the above methods of the invention include embodiments wherein the step of analysis for differences between the test samples comprises the partial or complete determination of the sequence of the nucleic acid, or a PCR-amplified portion of the nucleic acid, of the test sample, and optionally also of the nucleic acid or at PCR-amplified portion of the nucleic acid of the similar test sample (or the similar test samples).

Suitable methods for the determination of partial or complete nucleic acid sequences, and thus, detection of the above-mentioned differences, are well known to the skilled artisan. They include, for example, Southern blotting, TGGE (temperature gradient gel electrophoresis), DGGE (denaturing gradient gel electrophoresis), SCCP (single chain conformation polymorphism) detection, and the like. High throughput sequence analysis methods such as those described by Kristensen et al. (Kristensen et al., BioTechniques 30 (2001), 318-332), which is incorporated herein by reference in its entirety, are likewise suitable, and hence, contemplated in connection with the present invention.

Suitable methods for the determination of partial or complete amino acid sequences are likewise well known, and include, for example, detection of particular epitopes within a protein sample via specific antibodies in dot blot, slot blot, or Western blot assays, or via ELISAs or RIAs, or partial amino acid sequence determination on a sequencer via Edman degradation. Also, high-throughput methods may again be employed.

A further aspect of the present invention is represented by a method for identifying a predisposition of a mammal for developing a medical condition associated with an alteration in goblet cell function, said method comprising the step of determining whether a test sample derived from said mammal indicates the presence of a mutation in an allele of the gene coding for the MAC30 protein according to SEQ ID NO:2 or 4 or an orthologue thereof indicative of an increased risk of said mammal of developing said medical condition.

Also contemplated in connection with the present invention is a method for determining whether a medical condition in a mammal which is associated with an alteration in goblet cell function is associated with altered MAC30 expression or function, said method comprising the step of determining whether a test sample derived from said mammal indicates the presence of a mutation in an allele of the gene coding for the MAC30 protein indicative of an altered MAC30 expression or function.

As in the case of the methods described above, while the methods described in the two preceding paragraphs may involve that the test sample is derived from the mammal directly, it may also be a sample that has been obtained previously. Furthermore, suitable test samples according to the invention are, for example, cDNA preparations that have been prepared from mRNA obtained from a tissue sample from a mammal at an earlier stage. It may also again be

cloned or PCR-amplified DNA that originates from DNA contained in such tissue sample obtained at an earlier stage.

Again, the previously mentioned methods of determining partial or complete nucleic acid or amino acid sequences may be employed for the step of determining whether the test sample (which may be a nucleic acid or protein test sample as previously defined) indicates the presence of said mutation.

According to the above methods of identifying a predisposition in a mammal of developing a medical condition associated with an alteration in goblet cell function, or determining a potential association between such a medical condition with altered MAC30 expression or function, the test sample is analyzed for the presence of a mutation in an allele of the MAC30 gene which is either indicative of an increased risk of developing such a medical condition, or of an altered MAC30 expression or function. It will be appreciated that such mutations are inter alia those referred to herein in connection with the proteins and nucleic acids according to the invention, and that mutations of this kind may be readily identified, for example, by the in vitro assays or the animal model referred to in this regard. They may also be identified by any of the afore-mentioned methods of screening for disease-relevant MAC30 alleles.

The invention also includes pharmaceutical compositions containing agents that can modulate MAC30 activity, i.e., MAC30 mutein or wild type activity. These agents include biomolecules such as proteins, muteins, kinases, phosphatases, antibodies, antibody fragments, nucleic acids, ribozymes, anticalins, and aptamers as described herein, as well as pharmaceutical compositions containing antibodies to them (e.g., antibodies to muteins or wild-type proteins, anti-idotypic antibodies). In addition, the agent may also include chemical

compounds, e.g., small molecule agonists or antagonists, that may affect MAC30 directly. Furthermore, the agents may be biomolecules and chemical compounds, such as the ones listed above or below, that affect the interaction between MAC30, i.e., MAC30 mutein or wild type protein, and its physiologic substrates or binding partners.

The compositions are preferably suitable for internal use and include an effective amount of a pharmacologically active compound of the invention, alone or in combination, with one or more pharmaceutically acceptable carriers. The compounds are especially useful in that they have very low, if any toxicity.

The agents of this invention, and antibodies thereto, may be used in pharmaceutical compositions, when combined with a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifingal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of REMINGTON'S PHARMACEUTICAL SCIENCES (18th ed.), Alfonso R. Gennaro, ed. (Mack Publishing Co., Easton, Pa. 1990), a standard reference text in the field, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, finger's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J., U.S.A.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of

surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

For instance, for oral administration in the form of a tablet or capsule (e.g., a gelatin capsule), the active drug component can be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water and the like. Moreover, when desired or necessary, suitable binders, lubricants, disintegrating agents and coloring agents can also be incorporated into the mixture. Suitable binders include starch, magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium alginate, polyethylene glycol, waxes and the like. Lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silica, talcum, stearic acid, its magnesium or calcium salt and/or polyethyleneglycol and the like. Disintegrators include, without limitation, starch, methyl cellulose, agar, bentonite, xanthan gum starches, agar, alginic acid or its sodium salt, or effervescent mixtures, and the like. Diluents, include, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine.

Injectable compositions are preferably aqueous isotonic solutions or suspensions, and suppositories are advantageously prepared from fatty emulsions or suspensions. The compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing,

wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances. The compositions are prepared according to conventional mixing, granulating or coating methods, respectively, and contain about 0.1 to 75%, preferably about 1 to 50%, of the active ingredient.

The compounds of the invention can also be administered in such oral dosage forms as timed release and sustained release tablets or capsules, pills, powders, granules, elixers, tinctures, suspensions, syrups and emulsions.

Liquid, particularly injectable compositions can, for example, be prepared by dissolving, dispersing, etc. The active compound is dissolved in or mixed with a pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form the injectable solution or suspension. Additionally, solid forms suitable for dissolving in liquid prior to injection can be formulated. Injectable compositions are preferably aqueous isotonic solutions or suspensions. The compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances.

The compounds of the present invention can be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts. Iηjectables can be prepared in conventional forms, either as liquid solutions or suspensions.

Parental injectable administration is generally used for subcutaneous, intramuscular or intravenous injections and infusions. Additionally, one approach for parenteral administration employs the implantation of a slow-release or sustained-released system, which assures that a constant level of dosage is maintained, according to U.S. Pat. No. 3,710,795, incorporated herein by reference.

Furthermore, preferred compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in that art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. Other preferred topical preparations include creams, ointments, lotions, aerosol sprays and gels, wherein the concentration of active ingredient would range from 0.1% to 15%, w/w or w/v.

For solid compositions, excipients include pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like may be used. The active compound defined above, may be also formulated as suppositories using for example, polyalkylene glycols, for example, propylene glycol, as the carrier. In some embodiments, suppositories are advantageously prepared from fatty emulsions or suspensions.

The compounds of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines. In some embodiments, a film of lipid

components is hydrated with an aqueous solution of drug to a form lipid layer encapsulating the drug, as described in U.S. Pat. No. 5,262,564.

Compounds of the present invention may also be delivered by the use of monoclonal antibodies as individual carriers to which the compound molecules are coupled. The compounds of the present invention may also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyl-methacrylamide-phenol, polyhydroxyethylaspanamidephenol- , or polyethyleneoxidepolylysine substituted with palmitoyl residues. Furthermore, the compounds of the present invention may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels.

If desired, the pharmaceutical composition to be administered may also contain minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and other substances such as for example, sodium acetate, triethanolamine oleate, etc.

The dosage regimen utilizing the compounds is selected in accordance with a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular compound or salt thereof employed. An ordinarily skilled physician or veterinarian can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the condition.

Oral dosages of the present invention, when used for the indicated effects, may be preferably provided in any form commonly used for oral dosage such as, for example, in scored tablets, time released capsules, liquid filled capsule, gels, powder or liquid forms. When provided in tablet or capsule form, the dosage per unit may be varied according to well known techniques. For example, individual dosages may contain 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100.0, 250.0, 500.0 and 1000.0 mg of active ingredient. It is well known that daily dosage of a medication, such as a medication of this invention, may involve between one to ten or even more individual tables per day.

The compounds comprised in the pharmaceutical compositions of the present invention may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three or four times daily.

Any of the above pharmaceutical compositions may contain 0.1-99%, preferably 1-70% (w/w or w/v) of the wild type MAC30 polypeptide, the proteins and fragments, or the antibodies and their various modified embodiments specifically described and claimed herein.

If desired, the pharmaceutical compositions can be provided with an adjuvant. Adjuvants are discussed above. In some embodiments, adjuvants can be used to increase the immunological response, depending on the host species, include Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Generally, animals are injected with antigen using several injections in a series, preferably including at least three booster injections.

A further aspect of the present invention is a method of gene therapy comprising delivering to cells in a mammal suffering from or known to be at risk of developing a condition associated with an alteration in goblet cell function a DNA construct comprising a sequence of an allele of the MAC30 gene encoding the human MAC30 protein, or encoding a protein having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% amino acid identity compared to the mouse MAC30 or the human MAC30 protein, respectively; or a sequence of an allele of the MAC30 gene of a mammal unaffected by or known not to be at risk of developing said condition.

Also encompassed by the present invention is a method of gene therapy of the above kind wherein the DNA construct delivered to the cells of the mammal comprises a DNA sequence encoding the human MAC30 protein, or a human MAC30 protein encoded by the MAC30 gene of an individual unaffected by or known not to be at risk of developing said condition, or a protein having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% amino acid identity compared to the mouse MAC30 or the human MAC30 protein.

Furthermore encompassed are methods wherein the DNA construct comprises a DNA sequence encoding an antisense nucleic acid according to the invention, or an antisense nucleic acid comprising a nucleotide sequence which is complementary to an mRNA encoded by the MAC30 gene of a mammal unaffected by or known not to be at risk of developing said condition.

Also encompassed are methods wherein the DNA construct comprises a DNA sequence encoding an siRNA as described and claimed herein.

Alternatively, the DNA construct may comprise a DNA encoding an aptamer specifically binding an MAC30 mutein or an MAC30 wild type protein as described herein.

In a further embodiment, the DNA construct may comprise a DNA sequence encoding an MAC30 mutant as described herein.

The use of a DNA construct as described above in a method of treating a mammal suffering from, or known to be at risk of developing a medical condition associated with an alteration in cholesterol metabolism, or a condition related to diabetes, diabetes type I, diabetes type II, coronary artery disease, atherosclerosis, myocardial infarction, coronary artery bypass graft, percutaneous transluminal angioplasties, coronary stenosis, cerebrovascular disease transient ischemic attack, ischemic stroke, carotid endarterectomies, and peripheral arterial disease, said method comprising delivering said DNA construct to at least some of the cells of said mammal, preferably the subject's goblet cells, is also encompassed within the present invention. Preferably, the construct comprises MAC30 gene that leads to enhanced MAC30 activity within the cell where the construct is introduced. Further preferably, the construct is introduced into macrophages, macrophage-like cells and/or macrophage precursors outside of the body, or else preferably, the construct is targeted to such cells, or otherwise preferably, the construct contains regulatory elements such as promoters that preferably function in the said cells.

A further aspect of the present invention is a method of preventing, treating, or ameliorating a medical condition in a mammal associated with an alteration in cholesterol metabolism or related to one of the above conditions, said method comprising administering to said mammal a pharmaceutical composition comprising an agent capable of modulating MAC30 activity, i.e., MAC30 mutant or wild type activity, in said mammal.

The agent capable of modulating MAC30 activity may be one of the agents described and specifically claimed herein, e.g., one of the muteins, nucleic acids, e.g., nucleic acids encoding the muteins, antisense nucleic acids, siRNAs, anticalins or aptamers directed against or specifically binding to the MAC30 muteins, antibodies, or small molecule agonists or antagonists of the MAC30 muteins or wild type MAC30 protein as described herein.

It will be appreciated that in situations where the above medical condition is caused by a mutation in one of the alleles of the MAC30 gene which leads to the expression of an MAC30 mutein with a reduced or abolished activity, antisense nucleic acids, siRNA molecules, aptamers, anticalins, or antibodies directed against said MAC30 mutein may be therapeutically useful. Alternatively, administration of an MAC30 mutein, or a nucleic acid coding therefore, which is characterized by an increased MAC30 activity, or administration of a nucleic acid capable of leading to an increased MAC30 expression (e.g., of the endogenous wild-type MAC30 or of a wild-type MAC30 encoded by said nucleic acid), may likewise be therapeutically useful in this regard.

In situations where an excess amount or activity of the endogenous MAC30 protein is the cause of the above medical condition, administration of an MAC30 mutein, or nucleic acid coding therefore, which is characterized by a decreased MAC30 activity, or administration of a nucleic acid capable of leading to a decreased MAC30 expression (e.g., of an endogenous mutated or a wild-type MAC30) may likewise be therapeutically useful in this regard.

It will be appreciated that agents relating to the wild type MAC30 protein will likewise be advantageously administered to a mammal suffering from a condition as mentioned above, e.g., in situations where a reduced amount or activity of the endogenous MAC30 is the cause of the above medical condition in the mammal. Such beneficial effect of enhanced MAC30

activity may be obtained e.g., in one or more of the conditions mentioned above, such as to diabetes, diabetes type I, diabetes type II, coronary artery disease, atherosclerosis, myocardial infarction, coronary artery bypass graft, percutaneous transluminal angioplasties, coronary stenosis, cerebrovascular disease transient ischemic attack, ischemic stroke, carotid endarterectomies, and peripheral arterial disease. Accordingly, it will be appreciated that a wild type MAC30 protein may advantageously be administered to a mammal suffering from such a condition, or a protein having a certain amino acid sequence identity and showing the same, or essentially the same, biological activity in any of the in vitro assays mentioned herein before (or a fragment or fusion of such protein). Proteins suitable in this regard may be readily determined, e.g., with the help of these in vitro assays.

It will also be appreciated that in situations where an excess of endogenous MAC30 protein or activity is the cause of the medical condition in the mammal, antisense nucleic acids, siRNAs molecules, aptamers, anticalins, or antibodies against said MAC30 wild type protein, may be therapeutically used.

It will be understood that the skilled person may use the in vitro assays as described herein in order to identify the activity of a given MAC30 mutein or the effect of an agent relating to such an MAC30 mutein or MAC30 wild type protein. Based on this information, the skilled person will be readily able to choose and identify the appropriate agent in connection with the disease situation to be treated.

The animals of the present invention present a phenotype whose characteristics are representative of many symptoms associated with disorders of altered cholesterol metabolism, therefore making the animal model of the present invention a particularly suitable model for the study of these diseases including diabetes, diabetes type I, diabetes type II, coronary artery

disease, atherosclerosis, myocardial infarction, coronary artery bypass graft, percutaneous transluminal angioplasties, coronary stenosis, cerebrovascular disease transient ischemic attack, ischemic stroke, carotid endarterectomies, and peripheral arterial disease.

The animals of the present invention can also be used to identify early diagnostic markers for diseases associated with MAC30 deficiency. The term deficiency refers to an alteration of protein function in both positive (=gain of function) and negative (=loss of function) ways. Surrogate markers, including but not limited to ribonucleic acids or proteins, can be identified by performing procedures of proteomics or gene expression analysis known in the art. For example procedures of proteomics analysis include, but are not restricted to, ELISA, 2D-gel, protein microarrays or mass spectrophotometric analysis of any organ or tissue samples, such as blood samples, or derivatives thereof, preferably plasma, at different age or stage of MAC30 activity deficiency or activity increase associated disease development, or symptom thereof. As a further example, gene expression analysis procedures include, but are not restricted to, differential display, cDNA microarrays, analysis of quality and quantity of ribonucleic acids species from any organ or tissue samples, such as blood samples, or derivatives thereof, at different age or stage of development of MAC30 activity deficiency associated disease, or symptom thereof.

The animal model of the present invention can be used to monitor the activity of agents useful in the prevention or treatment of the above-mentioned diseases and disorders. The agent to be tested can be administered to an animal of the present invention and various phenotypic parameters can be measured or monitored. In a further embodiment the animals of the invention may be used to test therapeutics against any disorders or symptoms that have been shown to be associated with MAC30 deficiency or over-expression.

The animals of the present invention can also be used as test model systems for materials, including but not restricted to chemicals and peptides, particularly medical drugs, suspected of promoting or aggravating the above-described diseases associated with MAC30 deficiency. For example, the material can be tested by exposing the animal of the present invention to different time, doses and/or combinations of such materials and by monitoring the effects on the phenotype of the animal of the present invention, including but not restricted to change of goblet cell function, namely proper mucin production. Furthermore, the animals of the present invention may be used for the dissection of the molecular mechanisms of the MAC30 pathway, that is for the identification of receptors or downstream genes or proteins thereof regulated by MAC30 activity and deregulated in MAC30 activity deficiency or activity increase associated disorders. For example, this can be done by performing differential proteomics analysis, using techniques including but not restricted to 2D gel analysis, protein chip microarrays or mass spectrophotometry, on tissues of the animal of the present invention which express MAC30 and which respond to MAC30 stimuli.

An exemplary method for detecting the presence or absence of MAC30 mutein in a biological sample involves obtaining a biological sample from a test subject and contacting the biological sample with a compound or an agent capable of detecting MAC30 protein or nucleic acid (e.g., mRNA, genomic DNA) that encodes MAC30 mutein such that the presence of MAC30 is detected in the biological sample. An agent for detecting MAC30 mutein mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to MAC30 mutein mRNA or genomic DNA.

The diagnostic methods described herein can furthermore be utilized to identify subjects having or at risk of developing a disease or disorder associated with aberrant MAC30 expression or activity. For example, the assays described herein, such as the preceding

diagnostic assays or the following assays, can be utilized to identify a subject having or at risk of developing a disorder associated with MAC30 protein, nucleic acid expression or activity. Alternatively, the prognostic assays can be utilized to identify a subject having or at risk for developing a disease or disorder. Thus, the invention provides a method for identifying a disease or disorder associated with aberrant MAC30 expression or activity in which a test sample is obtained from a subject and MAC30 protein or nucleic acid (e.g., mRNA, genomic DNA) is detected, wherein the presence of MAC30 protein or nucleic acid is diagnostic for a subject having or at risk of developing a disease or disorder associated with aberrant MAC30 expression or activity. As used herein thoughout the entire specification, a "test sample" refers to a biological sample obtained from a subject of interest. For example, a test sample can be a biological fluid (e.g., blood, plasma, serum), cell sample, or tissue sample.

Furthermore, the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate) to treat a disease or disorder associated with aberrant MAC30 expression or activity. For example, such methods can be used to determine whether a subject can be effectively treated with an agent for a disorder.

Agents, or modulators that have a stimulatory or inhibitory effect on MAC30 activity (e.g., MAC30 gene expression), as identified by a screening assay described herein can be administered to individuals to treat (prophylactically or therapeutically) MAC30-mediated disorders. Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug. Thus, the pharmacogenomics of the individual permits the selection of effective agents (e.g., drugs) for prophylactic or therapeutic treatments based on a consideration of the individual's genotype. Such pharmacogenomics can further be used to determine appropriate

dosages and therapeutic regimens. Accordingly, the activity of MAC30 protein, expression of MAC30 nucleic acid, or mutation content of MAC30 genes in an individual can be determined to thereby select appropriate agent(s) for therapeutic or prophylactic treatment of the individual.

The present invention also provides a diagnostic method for MAC30 activity deficiency or activity increase. Patients' peptide material, particularly that in or from blood, serum or plasma, is subjected to analysis for one or more of the amino acid sequences of the present invention. The peptide material may be analyzed directly or after extraction, isolation and/or purification by standard methods.

In one embodiment of the invention, the diagnostic method comprises the identification of the modified MAC30. The diagnostic methods of the invention also include those employing detection of the modified is MAC30 by its activity in competing with and blocking the action of native MAC30. Methods of identifying the modified MAC30 include any methods known in the art which are able to identify altered conformational properties of the amino acid sequence of the present invention compared to those of the wild type MAC30. These include, without limitation, the specific recognition of the modified protein by other proteins, particularly antibodies; individual or combined patterns of amino acid sequence digestion by known proteases or chemicals.

In a further embodiment of the present invention, the principle of the diagnostic method is the detection of a nucleic acid sequence encoding the modified MAC30 of the invention. This includes, but is not restricted to any methods known in the art using nucleic acid hybridizing properties, such as Polymerase Chain Reaction (PCR), Northern blot, Southern blot, nucleic

acid (genomic DNA, cDNA, mRNA, synthetic oligonucleotides) standard methods employing microarrays, and patterns of nucleic acid digestion by known restriction enzymes.

The inventinon further provides a screening method for inhibitors or activators of MAC30. For cellular proteins or peptides acting as activators or inhibitors of MAC30, the two-hybrid screen may advantageously be used.

In one embodiment, the invention provides an assay for regulation by cholesterol MAC30 reporter constructs comprising MAC30 promoter and/or enhancer sequences as described herein. Such constructs may be transfected into suitable cells and the assay performed essentially as described in example 1. Preferably, MPM-derived foam cells are used. MAC30 expression is preferably assayed by using quantitative real time PCR. In a preferred embodiment of the invention, a decrease by at least 10%, at least 20%, at least 30%, at least 40% or about 50% is observed in Mac30 mRNA abundance in foam cells compared to macrophages. Similarly, RAW264.7 differentiated to foam cells by incubation with aggLDL may be used. Also, sterol loading of RAW264.7 cells with cholesterol/25-hydroxycholesterol may be used. In another embodiment, 3T3-L1 cells may be incubated with aggLDL to observe decreased reporter gene expression of the MAC30 construct compared to unloaded cells.

In another embodiment, the invention provides a screening assay for compounds with statin- like activity. Preferably, a cell line, like 3T3-L1 or RAW264.7, is used. The expression of endogenous Mac30 may be assessed in the presence and absence of the compound to be screened. Such compounds may be derived by structural similarity to existing statins, by libraries of chemically synthesized or natural compounds, and/or by combinatorial libraries,

such as phage expression libraries or peptide libraries. The generation of such techniques is well known to the skilled artisan, and commercial service for the screening of such libraries is available (e.g., Peptor Inc., Nes Ziona, Israel). Further, the generation of chemical compounds according to a certain basic compound (e.g. the framework of lovastatin or simvastatin) can be carried out using a "genetic evolution" method (service available by Morphochem GmbH, Martinsried, Germany, see also e.g., US 6,355,726) and compounds with suitable characteristics, that is, up-regulation of mac30, preferably in 3T3-L1 and/or RAW 264.7 cells, or upregulation of a reporter gene in a MAC30 reporter gene construct comprising a MAC30 promoter and/or enhancer, can readily be identified. Such assays for screening may be adapted for high throughput screening as known in the art and as described herein.

The agents found in such screening assays may be advantageously employed in the treatment of one or more or the disorders mentioned hereinbelow. Preferably, such disorders are related to fatty acid and/or cholesterol metabolism or are related to or associated with atherosclerosis, obesity, and/or diabetes, preferably diabetes type I and/or diabetes type II. In addition to the agents identified by such screening assay, agent that modulate the activity or amount of MAC30, such as inhibitors, may be used advantageously for the treatment of such diseases. In particular, antibodies, RNAi molecules, aptamers, anticalins, ribozymes, siRNA molecules, and the like modulators as described herein my be used in the treatment of prevention of obesity, atherosclerosis, diabetes, preferably diabetes type I or diabetes typell, ischemia, stroke, transient ischemic attack, coronary heart disease, chronic obstructive pulmonary disease, and autoimmune disorders including autoimmune arthritis, rheumatoid arthritis, and lupus.

The present invention is also directed to kits, including diagnostic and pharmaceutical kits.

The kits can comprise any of the nucleic acid molecules described above, any of the

polypeptides described above, or any antibody which binds to a polypeptide of the invention as described above, as well as a negative control. The kit preferably comprises additional components, such as, for example, instructions, solid support, reagents helpful for quantification, and the like. The detection of Mac30 activity, protein amount or mRNA abundance above the value found for healthy volunteers preferably indicates a propensity, increased risk for or development of a condition related to cholesterol metabolism, such as diabetes, diabetes type I, diabetes type II, coronary artery disease, atherosclerosis, myocardial infarction, coronary artery bypass graft, percutaneous transluminal angioplasties, coronary stenosis, cerebrovascular disease transient ischemic attack, ischemic stroke, carotid endarterectomies, and peripheral arterial disease. The risk for such disease may, in addition, be evaluated by a method comprising the steps of (1) testing a sample derived from a subject for Mac30 mRNA or protein abundance or mac30 activity at a time when the subject has fed on a cholesterol-low diet and at a second time point when the subject has fed on a cholesterol- rich diet, and (2) comparing the values so obtained. A down-regulation of Mac30 in response to increased cholesterol uptake would be indicative of a correct functioning of the Mac30 metabolism pathway. Conversely, a failure of such down-regulation would be indicative of an aberration in such pathway, associated with a risk of developing a cholesterol-metabolism or fatty-acid related related condition such as diabetes, diabetes type I, diabetes type II, coronary artery disease, atherosclerosis, myocardial infarction, coronary artery bypass graft, percutaneous transluminal angioplasties, coronary stenosis, cerebrovascular disease transient ischemic attack, ischemic stroke, carotid endarterectomies, and peripheral arterial disease.

In another aspect, the invention features methods for detection of a polypeptide in a sample as a diagnostic tool for diseases or disorders, wherein the method comprises the steps of: (a) contacting the sample with a nucleic acid probe which hybridizes under hybridization assay conditions to a nucleic acid target region of a polypeptide having a sequence coming within

the sequence of SEQ ID No. 1 or 3 and being able to specifically hybridize with said sequence, said probe comprising the nucleic acid sequence encoding the polypeptide, fragments thereof, and the complements of the sequences and fragments; and (b) detecting the presence or amount of the probe:target region hybrid as an indication of the disease.

In preferred embodiments of the invention, the disease is selected from the group consisting of thyroid disorders (e.g. thyreotoxicosis, myxoedema); renal failure; inflammatory conditions (e.g., Crohn's disease); diseases related to cell differentiation and homeostasis; rheumatoid arthritis; autoimmune disorders; movement disorders; CNS disorders (e.g., pain including migraine; stroke; psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, anxiety, generalized anxiety disorder, post-traumatic-stress disorder, depression, bipolar disorder, delirium, dementia, severe mental retardation; dyskinesias, such as Huntington's disease or Tourette's Syndrome; attention disorders including ADD and ADHD, and degenerative disorders such as Parkinson's, Alzheimer's; movement disorders, including ataxias, supranuclear palsy, etc.); infections, such as viral infections caused by HIV- 1 or HIV-2; metabolic and cardiovascular diseases and disorders (e.g., type 2 diabetes, obesity, anorexia, hypotension, hypertension, thrombosis, myocardial infarction, cardiomyopathies, atherosclerosis, etc.); proliferative diseases and cancers (e.g., different cancers such as breast, colon, lung, etc., and hyperproliferative disorders such as psoriasis, prostate hyperplasia, etc.); hormonal disorders (e.g., male/female hormonal replacement, polycystic ovarian syndrome, alopecia, etc.); and sexual dysfunction, among others.

The invention further provides a method for identifying a compound which binds MAC30 comprising the steps of: a) contacting MAC30 with a compound; and b) determining whether said compound binds MAC30. The MAC30 preferably comprises the amino acid sequence of

SEQ ID NO: 2 or 4. The binding is preferably determined by a protein binding assay.The

protein binding assay is preferably selected from the group consisting of a Western blot, radiolabeled competition assay, phage-based expression cloning, co-fractionation by chromatography, co-precipitation, cross linking, interaction trap/two-hybrid analysis, southwestern analysis, and ELISA. The invention further provides a compound identified by the said method, the invention also provides a method for identifying a compound which binds a nucleic acid molecule encoding MAC30 comprising the steps of: a) contacting said nucleic acid molecule encoding MAC30 with a compound; and b) determining whether said compound binds said nucleic acid molecule. Binding is preferably determined by a gel-shift assay. The invention also provides a compound identified by the said method. The invention further provides a method for identifying a compound which modulates the activity of MAC30 comprising the steps of: a) contacting MAC30 with a compound; and b) determining whether MAC30 activity has been modulated. The MAC30 preferably comprises an amino acid sequence of SEQ ID NO: 2 or 4. The MAC30 activity preferably is neutral cholesterol ester hydrolysis, the invention also provides a compound identified by the said method.

The invention also provides methods for identifying a modulator of binding between a MAC30 and a MAC30 binding partner, comprising the steps of: (a) contacting a MAC30 binding partner and a composition comprising a MAC30 in the presence and in the absence of a putative modulator compound; (b) detecting binding between the binding partner and the MAC30; and (c) identifying a putative modulator compound or a modulator compound in view of decreased or increased binding between the binding partner and the MAC30 in the presence of the putative modulator, as compared to binding in the absence of the putative modulator. MAC30 binding partners that stimulate MAC30 activity are useful as agonists in disease states or conditions characterized by insufficient MAC30 signaling (e.g., as a result of insufficient activity of a MAC30 ligand). MAC30 binding partners that block ligand-mediated

MAC30 signaling are useful as MAC30 antagonists to treat disease states or conditions

characterized by excessive MAC30 signaling. In addition MAC30 modulators in general, as well as MAC30 polynucleotides and polypeptides, are useful in diagnostic assays for such diseases or conditions.

Agents that modulate (i.e., increase, decrease, or block) MAC30 activity or expression may be identified by incubating a putative modulator with a cell containing a MAC30 polypeptide or polynucleotide and determining the effect of the putative modulator on MAC30 activity or expression. The selectivity of a compound that modulates the activity of MAC30 can be evaluated by comparing its effects on MAC30 to its effect on other cholesterol ester hydrolases or triglyceride hydrolases. Selective modulators may include, for example, antibodies and other proteins, peptides, or organic molecules that specifically bind to a MAC30 polypeptide or a MAC30-encoding nucleic acid. Modulators of MAC30 activity will be therapeutically useful in treatment of diseases and physiological conditions in which normal or aberrant MAC30 activity is involved. MAC30 polynucleotides, polypeptides, and modulators may be used in the treatment of such diseases and conditions as are related to aberrant cholesterol metabolism and/or to diabetes, diabetes type I, diabetes type II, coronary artery disease, atherosclerosis, myocardial infarction, coronary artery bypass graft, percutaneous transluminal angioplasties, coronary stenosis, cerebrovascular disease transient ischemic attack, ischemic stroke, carotid endarterectomies, and peripheral arterial disease.

Methods of the invention to identify modulators include variations on any of the methods described above to identify binding partner compounds, the variations including techniques wherein a binding partner compound has been identified and the binding assay is carried out in the presence and absence of a candidate modulator. A modulator is identified in those instances where binding between the MAC30 polypeptide and the binding partner compound changes in the presence of the candidate modulator compared to binding in the absence of the candidate modulator compound. A modulator that increases binding between the MAC30

polypeptide and the binding partner compound is described as an enhancer or activator, and a modulator that decreases binding between the MAC30 polypeptide and the binding partner compound is described as an inhibitor.

The invention also provides high-throughput screening (HTS) assays to identify compounds that interact with or inhibit biological activity (i.e., affect enzymatic activity, binding activity, etc.) of a MAC30 polypeptide. HTS assays permit screening of large numbers of compounds in an efficient manner. Cell-based HTS systems are contemplated to investigate MAC30 receptor-ligand interaction. HTS assays are designed to identify "hits" or "lead compounds" having the desired property, from which modifications can be designed to improve the desired property. Chemical modification of the "hit" or "lead compound" is often based on an identifiable structure/activity relationship between the "hit" and the MAC30 polypeptide.

Another aspect of the present invention is directed to methods of identifying compounds which modulate (i.e., increase or decrease) activity of MAC30 comprising contacting MAC30 with a compound, and determining whether the compound modifies activity of MAC30. The activity in the presence of the test compared is measured to the activity in the absence of the test compound. Where the activity of the sample containing the test compound is higher than the activity in the sample lacking the test compound, the compound will have increased activity. Similarly, where the activity of the sample containing the test compound is lower than the activity in the sample lacking the test compound, the compound will have inhibited activity.

The present invention is particularly useful for screening compounds by using MAC30 in any of a variety of drug screening techniques. The compounds to be screened include (which may include compounds which are suspected to modulate MAC30 activity), but are not limited to,

extracellular, intracellular, biologic or chemical origin. The MAC30 polypeptide employed in such a test may be in any form, preferably, free in solution, attached to a solid support, borne on a cell surface or located intracellularly. One skilled in the art can, for example, measure the formation of complexes between MAC30 and the compound being tested. Alternatively, one skilled in the art can examine the diminution in complex formation between MAC30 and its substrate caused by the compound being tested.

The activity of MAC30 polypeptides of the invention can be determined by, for example, examining the ability to bind or be activated by chemically synthesized cholesterol ester substrate. Binding or function-based assays of MAC30 activity are describer hereinbelow in the examples.

The modulators of the invention exhibit a variety of chemical structures, which can be generally grouped into non-peptide mimetics of natural MAC30 substrates, peptide and non- peptide allosteric effectors of MAC30, and peptides that may function as activators or inhibitors (competitive, uncompetitive and non-competitive) (e.g., antibody products) of MAC30. In addition, the modulators comprise those that act by influencing transcription or translation of mac30, directly or indirectly. Those modulators include e.g., statins, cholesterol, and LXR receptors. The invention does not restrict the sources for suitable modulators, which may be obtained from natural sources such as plant, animal or mineral extracts, or non-natural sources such as small molecule libraries, including the products of combinatorial chemical approaches to library construction, and peptide libraries.

Other assays can be used to examine enzymatic activity including, but not limited to, photometric, radiometric, HPLC, electrochemical, and the like, which are described in, for

example, Enzyme Assays: A Practical Approach, eds. R. Eisenthal and M. J. Danson, 1992, Oxford University Press, which is incorporated herein by reference in its entirety.

The use of cDNAs encoding MAC30 is described herein, such use may be adapted in drug discovery programs; assays capable of testing thousands of unknown compounds per day in high-throughput screens (HTSs) are thoroughly documented. The literature is replete with examples of the use of radiolabeled ligands in HTS binding assays for drug discovery (see Williams, Medicinal Research Reviews, 1991, 1 1 , 147-184.; Sweetnam, et al., J. Natural Products, 1993, 56, 441-455 for review). Such assays may be adapted for use with the MAC30 proteins described herein. Recombinant MAC30 are preferred for binding assay HTS because they allow for better specificity (higher relative purity), provide the ability to generate large amounts of protein material, and can be used in a broad variety of formats (see Hodgson, Bio/Technology, 1992, 10, 973-980; each of which is incorporated herein by reference in its entirety).

A variety of heterologous systems is available for functional expression of recombinant proteins that are well known to those skilled in the art. Such systems include bacteria (Strosberg, et al., Trends in Pharmacological Sciences, 1992, 13, 95-98), yeast (Pausch, Trends in Biotechnology, 1997, 15, 487-494), several kinds of insect cells (Vanden Broeck, Int. Rev. Cytology, 1996, 164, 189-268), amphibian cells (Jayawickreme et al., Current Opinion in Biotechnology, 1997, 8, 629-634) and several mammalian cell lines (CHO, see herein, HEK293, COS, etc.; see Gerhardt, et al., Eur. J. Pharmacology, 1997, 334, 1-23). These examples do not preclude the use of other possible cell expression systems, including cell lines obtained from nematodes (PCT application WO 98/37177).

In preferred embodiments of the invention, methods of screening for compounds that modulate MAC30 activity comprise contacting test compounds with MAC30 and assaying for the presence of a complex between the compound and MAC30. In such assays, the substrate is typically labeled. After suitable incubation, free substrate is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of the particular compound to bind to MAC30.

As described hereinbelow, enhancing the activity of MAC30 (e.g. by overexpression of heterologous expression) may be detected by using functional assays or assays directed at determining the amount of substrate metabolized.

Preferred methods of HTS employing these receptors include permanently transfected CHO or RAW 264.7 cells, in which agonists and antagonists can be identified by the ability to specifically alter the metabolism of cholesterol esters these cells. Alternatively, a functional assay, such as one using fluorescent compounds as described further below, would be preferred for HTS. Equally preferred would be an alternative type of mammalian cell, such as HEK293 or COS cells, in similar formats. More preferred would be permanently transfected insect cell lines, such as Drosophila S2 cells. Even more preferred would be recombinant yeast cells in HTS formats well known to those skilled in the art (e.g., Pausch, Trends in Biotechnology, 1997, 15, 487-494).

The invention contemplates a multitude of assays to screen and identify inhibitors of substrate binding to MAC30 receptors. In one example, the MAC30 protein is immobilized and interaction with a binding partner is assessed in the presence and absence of a candidate modulator such as an inhibitor compound. In another example, interaction between the MAC30 protein and its substrate is assessed in a solution assay, both in the presence and absence of a candidate inhibitor compound. In either assay, an inhibitor is identified as a

compound that decreases binding between the MAC30 receptor and its substrate. Another contemplated assay involves the well known yeast two-hybrid screening assay.

Candidate modulators contemplated by the invention include compounds selected from libraries of either potential activators or potential inhibitors. There are a number of different libraries used for the identification of small molecule modulators, including: (1) chemical libraries, (2) natural product libraries, and (3) combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules. Chemical libraries consist of random chemical structures, some of which are analogs of known compounds or analogs of compounds that have been identified as "hits" or "leads" in other drug discovery screens, some of which are derived from natural products, and some of which arise from non-directed synthetic organic chemistry. Natural product libraries are collections of microorganisms, animals, plants, or marine organisms which are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms. Natural product libraries include polyketides, non- ribosomal peptides, and variants (non-narurally occurring) thereof. For a review, see Science 282:63-68 (1998). Combinatorial libraries are composed of large numbers of peptides, oligonucleotides, or organic compounds as a mixture. These libraries are relatively easy to prepare by traditional automated synthesis methods, PCR, cloning, or proprietary synthetic methods. Of particular interest are non-peptide combinatorial libraries. Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, and polypeptide libraries. For a review of combinatorial chemistry and libraries created therefrom, see Myers, Curr. Opin. Biotechnol. 8:701-707 (1997). Identification of modulators through use of the various libraries described herein permits modification of the candidate "hit" (or "lead") to optimize the capacity of the "hit" to modulate activity.

Still other candidate inhibitors contemplated by the invention can be designed and include soluble forms of binding partners, as well as such binding partners as chimeric, or fusion, proteins. A "binding partner" as used herein broadly encompasses non-peptide modulators, as well as such peptide modulators as neuropeptides other than natural ligands, antibodies, antibody fragments, and modified compounds comprising antibody domains that are immunospecific for the expression product of the identified MAC30 gene.

The polypeptides of the invention are employed as a research tool for identification, characterization and purification of interacting, regulatory proteins. Appropriate labels are incorporated into the polypeptides of the invention by various methods known in the art and the polypeptides are used to capture interacting molecules. For example, molecules are incubated with the labeled polypeptides, washed to remove unbound polypeptides, and the polypeptide complex is quantified. Data obtained using different concentrations of polypeptide are used to calculate values for the number, affinity, and association of polypeptide with the protein complex.

Labeled polypeptides are also useful as reagents for the purification of molecules with which the polypeptide interacts including, but not limited to, inhibitors. In one embodiment of affinity purification, a polypeptide is covalently coupled to a chromatography column. Cells and their membranes are extracted, and various cellular subcomponents are passed over the column. Molecules bind to the column by virtue of their affinity to the polypeptide. The polypeptide-complex is recovered from the column, dissociated and the recovered molecule is subjected to protein sequencing. This amino acid sequence is then used to identify the captured molecule or to design degenerate oligonucleotides for cloning the corresponding gene from an appropriate cDNA library.

Alternatively, compounds may be identified which exhibit similar properties to the ligand for the MAC30 of the invention, but which are smaller and exhibit a longer half time than the endogenous ligand in a human or animal body. When an organic compound is designed, a molecule according to the invention is used as a "lead" compound. The design of mimetics to known pharmaceutically active compounds is a well-known approach in the development of pharmaceuticals based on such "lead" compounds. Mimetic design, synthesis and testing are generally used to avoid randomly screening a large number of molecules for a target property. Furthermore, structural data deriving from the analysis of the deduced amino acid sequences encoded by the DNAs of the present invention are useful to design new drugs, more specific and therefore with a higher pharmacological potency.

Comparison of the protein sequence of the present invention with the sequences present in all the available databases showed a significant homology with the transmembrane portion of G protein coupled receptors. Accordingly, computer modeling can be used to develop a putative tertiary structure of the proteins of the invention based on the available information of the transmembrane domain of other proteins. Thus, novel ligands based on the predicted structure of MAC30 can be designed.

In a particular embodiment, the novel molecules identified by the screening methods according to the invention are low molecular weight organic molecules, in which case a composition or pharmaceutical composition can be prepared thereof for oral intake, such as in tablets. The compositions, or pharmaceutical compositions, comprising the nucleic acid molecules, vectors, polypeptides, antibodies and compounds identified by the screening methods described herein, can be prepared for any route of administration including, but not limited to, oral, intravenous, cutaneous, subcutaneous, nasal, intramuscular or intraperitoneal.

The nature of the carrier or other ingredients will depend on the specific route of administration and particular embodiment of the invention to be administered. Examples of techniques and protocols that are useful in this context are, inter alia, found in Remington's Pharmaceutical Sciences, 16.sup.th edition, Osol, A (ed.), 1980, which is incorporated herein by reference in its entirety.

The dosage of these low molecular weight compounds will depend on the disease state or condition to be treated and other clinical factors such as weight and condition of the human or animal and the route of administration of the compound. For treating human or animals, between approximately 0.5 mg/kg of body weight to 500 mg/kg of body weight of the compound can be administered. Therapy is typically administered at lower dosages and is continued until the desired therapeutic outcome is observed.

The present compounds and methods, including nucleic acid molecules, polypeptides, antibodies, compounds identified by the screening methods described herein, have a variety of pharmaceutical applications and may be used, for example, to treat or prevent unregulated cellular growth, such as cancer cell and tumor growth, hi a particular embodiment, the present molecules are used in gene therapy. For a review of gene therapy procedures, see e.g. Anderson, Science, 1992, 256, 808-813, which is incorporated herein by reference in its entirety.

The present invention also encompasses a method of agonizing (stimulating) or antagonizing a MAC30 natural binding partner associated activity in a mammal comprising administering to said mammal an agonist or antagonist to one of the above disclosed polypeptides in an amount sufficient to effect said agonism or antagonism. One embodiment of the present invention, then, is a method of treating diseases in a mammal with an agonist or antagonist of

the protein of the present invention comprises administering the agonist or antagonist to a mammal in an amount sufficient to agonize or antagonize MAC30-associated functions.

In an effort to discover novel treatments for diseases, biomedical researchers and chemists have designed, synthesized, and tested molecules that inhibit the function of protein polypeptides. Some small organic molecules form a class of compounds that modulate the function of protein polypeptides. Examples of molecules that have been found by the inventors to decrease the function of Mac30 include the statin compounds described hereinbelow. Such compounds may be modified to specifically decrease the Mac30 of the invention only, by chemically synthesizing variants thereof and screening these variants for modulation of Mac30 activity and for the absence of modulation of the activity of different cholesterol-regulated gene products.

Methods of determining the dosages of compounds to be administered to a patient and modes of administering compounds to an organism are disclosed in U.S. application Ser. No. 08/702,282, filed Aug. 23, 1996 and International patent publication number WO 96/22976, published Aug. 1 1996, both of which are incorporated herein by reference in their entirety, including any drawings, figures or tables. Those skilled in the art will appreciate that such descriptions are applicable to the present invention and can be easily adapted to it.

The proper dosage depends on various factors such as the type of disease being treated, the particular composition being used and the size and physiological condition of the patient. Therapeutically effective doses for the compounds described herein can be estimated initially from cell culture and animal models. For example, a dose can be formulated in animal models to achieve a circulating concentration range that initially takes into account the IC.sub.50 as

determined in cell culture assays. The animal model data can be used to more accurately determine useful doses in humans.

Plasma half-life and biodistribution of the drug and metabolites in the plasma, tumors and major organs can also be determined to facilitate the selection of drugs most appropriate to inhibit a disorder. Such measurements can be carried out. For example, HPLC analysis can be performed on the plasma of animals treated with the drug and the location of radiolabeled compounds can be determined using detection methods such as X-ray, CAT scan and MRI. Compounds that show potent inhibitory activity in the screening assays, but have poor pharmacokinetic characteristics, can be optimized by altering the chemical structure and retesting. In this regard, compounds displaying good pharmacokinetic characteristics can be used as a model.

Toxicity studies can also be carried out by measuring the blood cell composition. For example, toxicity studies can be carried out in a suitable animal model as follows: 1) the compound is administered to mice (an untreated control mouse should also be used); 2) blood samples are periodically obtained via the tail vein from one mouse in each treatment group; and 3) the samples are analyzed for red and white blood cell counts, blood cell composition and the percent of lymphocytes versus polymorphonuclear cells. A comparison of results for each dosing regime with the controls indicates if toxicity is present.

At the termination of each toxicity study, further studies can be carried out by sacrificing the animals (preferably, in accordance with the American Veterinary Medical Association guidelines Report of the American Veterinary Medical Assoc. Panel on Euthanasia, Journal of American Veterinary Medical Assoc, 202:229-249, 1993). Representative animals from each treatment group can then be examined by gross necropsy for immediate evidence of

metastasis, unusual illness or toxicity. Gross abnormalities in tissue are noted and tissues are examined histologically. Compounds causing a reduction in body weight or blood components are less preferred, as are compounds having an adverse effect on major organs. In general, the greater the adverse effect the less preferred the compound.

The invention further provides a method for identifying and obtaining proteins interacting with MAC30 comprising a two-hybrid screening assay wherein a MAC30 polypeptide as described hereinabove as a bait and a cDNA library as prey are used. The invention also provides a method for modulating the interaction between and/or for modulating the activity of complexes comprising MAC30 and MAC30- interacting protein partners obtainable by a two-hybrid screening assay as described herein comprising the use of an MAC30 polypeptide as describer hereinabove. The invention further provides a method for identifying and obtaining compounds interacting with MAC30 comprising the steps of: a) providing a yeast two-hybrid system wherein a MAC30 polypeptide as described above MAC30-interacting protein partners obtainable by two-hybrid screening assay as described herein are expressed, b) interacting said compound with the complex formed by the expressed polypeptides as defined in a).

With "two-hybrid assay" is meant an assay that is based on the observation that many eukaryotic transcription factors comprise two domains, a DNA-binding domain (DB) and an activation domain (AD) which, when physically separated (i.e. disruption of the covalent linkage) do not effectuate target gene expression. Two proteins able to interact physically with one of said proteins fused to DB and the other of said proteins fused to AD will re-unite the DB and AD domains of the transcription factor resulting in target gene expression. The target gene in the yeast two-hybrid assay is usually a reporter gene such as the .beta.-

galactosidase gene. Interaction between protein partners in the yeast two-hybrid assay can thus be quantified by measuring the activity of the reporter gene product (Bartel and Fields 1997). Alternitavely, a mammalian two-hybrid system can be used which includes e.g. a chimeric green fluorescent protein encoding reporter gene (Shioda et al., 2000).

The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims. The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

Other features and advantages of the invention will be apparent from the following examples.

Brief description of the Figures

Figure 1: Murine Mac30 mRNA expression in control and sterol-loaded cells. Relative abundance of Mac30 in (A) MPM, (B) RAW264.7, and (C) 3T3-L1 cells. Total RNA was isolated from cells and Mac30 mRNA concentrations were quantitated with fluorescent real time PCR. Mac30 mRNA quantities were normalized to those of cyclophilin. Data are expressed as the mean values of two experiments performed in triplicate. Bars represent mean

± SD in relation to the levels in unloaded control cells (arbitrarily set to 1). *P < 0.05.

Figure 2: Murine Mac30 mRNA expression in mouse tissues. Total RNA was isolated from mouse tissues. mRNA concentrations were determined by fluorescent real time PCR on a LightCycler instrument (Roche) using a SybrGreen cDNA kit and by Northern blotting analysis. The obtained mRNA concentrations were normalized to those of cyclophilin. mRNA

levels are presented in relation to the expression in liver (arbitrarily set to 1). Bars represent

mean ± SD of two experiments performed in triplicate.

Figure 3: Regulation of Mac30 mRNA expression by dietary cholesterol. Fifteen male mice were fed a 0.01% cholesterol diet for 1 week. Three mice were sacrifized at that time point, and the remaining mice were switched to a 0.5% cholesterol diet. Four mice were sacrifized at days 0, 1, 4, and 7 of feeding, respectively. Total RNA was isolated from livers and subjected to fluorescent real time PCR. As a control, the expression of Hmgcr was determined. The obtained mRNA concentrations were normalized to those of cyclophilin. mRNA levels are

presented in relation to the expression on day 0 (arbitrarily set to 1). Bars represent mean ±

SD of four animals performed in triplicate.

Figure 4: Regulation of Mac30 mRNA expression by cholesterol depletion. Relative abundance of Mac30 in the absence or presence of simvastatin and lovastatin was determined in (A) 3T3-L1 and (B) RAW264.7 cells. Total RNA was isolated from loaded and control cells and Mac30 mRNA concentrations were quantitated by fluorescent real time PCR. As a control, the mRNA expression of Hmgcr was determined. mRNA quantities were normalized to those of cyclophilin. Data are expressed as the mean values of two experiments performed

in triplicate. Bars represent mean ± SD in relation to the levels in unloaded control cells

(arbitrarily set to 1). *P < 0.05.

Figure 5: Statin-induced upregulation of Mac30 is not reversed by mevalonate. Relative abundance of Mac30 incubated with lovastatin in the absence or presence of mevalonate was determined in RAW264.7 cells. Total RNA was isolated from loaded and control cells and Mac30 mRNA concentrations were quantitated with fluorescent real time PCR. mRNA

quantities were normalized to those of cyclophilin. Data are expressed as the mean values ±

SD of two independent experiments performed in triplicate. The levels in unloaded control

cells were arbitrarily set to 1. *P < 0.05, ***P ≤ 0.001.

Figure 6: Mac30 is not involved in cholesterol biosynthesis. RAW264.7 (A) and HepG2 (B) cells transiently transfected with Mac30 and lacZ (mock) were labeled with l4 C-acetate (2μCi/well) for 24 h. Thereafter, cells were washed twice and saponified in NaOH. Total lipids were extracted from cells with hexane/isopropanol (3/2) and dried under nitrogen. The lipid pellets were dissolved in chloroform and separated by TLC using petrol etheπetheπacetic acid (50:50:1) as mobile phase. The lipids were visualized with iodine vapor and the bands corresponding to free cholesterol and triacylglyceride were cut out. The comigrating radioactivity was determined by liquid scintillation counting. Data are presented as mean ± S.D. and represent two independent experiments.

Figure 7: Regulation of Mac30 mRNA expression by LXR activation. (A) Relative abundance of Mac30 was determined in the absence or presence of the LXR agonists TO901317 or 22-R-hydroxycholesterol was determined in RAW264.7 cells. Total RNA was isolated from loaded (24h and 48h) and control cells and Mac30 mRNA concentrations were quantitated with fluorescent real time PCR. As a control, the mRNA expression of Abcal was determined. Data are expressed as the mean values of four experiments performed in

triplicate. Bars represent mean ± SD in relation to the levels in unloaded control cells

(arbitrarily set to 1). **P ≤ 0.01.

Figure 8: Regulation of Mac30 mRNA expression by LXR activation in murine livers in vivo. Relative abundance of Mac30 was measured after peritoneal injection of the LXR agonists TO901317 or vehicle into mice. Total RNA was isolated from murine livers and Mac30 mRNA concentrations were quantitated with fluorescent real time PCR. As a control, the

mRNA expression of Abcal was determined. mRNA quantities were normalized to those of cyclophilin. Data represent the mean values of 4 mice performed twice in triplicate,

respectively. Bars represent mean ± SD in relation to the levels in control mice (arbitrarily set

to \).***P≤ 0.001.

Days on 0.5% chol. diet n TC (mg/dl) FC (mg/dl) CE (mg/dl)

0 3 82.5 ± 18.1 21.213.0 61.3 ±15.3

1 3 86.2112.8 22.911.3 63.4112.0

Tables

2 3 108.6 + 3.4 27.113.0 81.613.3

4 2 89.713.0 20.210.2 69.612.8

Table 1. Total

7 3 83.316.6 19.611.2 63.715.4 cholesterol (TC) plasma levels of mice on 0.5% cholesterol diet.

All values represent means ± SD. Age of the male animals at the time of analysis was 12-16

weeks.

Table 2. Hepatic total cholesterol (TC), free cholesterol (FC), and cholesteryl ester (CE) levels of mice on 0.5% cholesterol diet.

Days on 0.5% chol. diet n TC (mg/g) FC (mg/g) CE (mg/g)

0 3 5.8 + 0.6 3.610.5 2.2 ± 0.2

1 3 9.3 ±0.8** 3.8±0.4 5.5 ± 0.4**

2 3 10.6 ±1.4** 4.5 ±0.2 6.1 ±0.2*

4 2 15.7 ±6.5 5.3 ±2.6 10.4 ±3.9

7 3 13.2 ±2.3* 5.3 ±0.6* 8.0 ±1.8*

All values represent means ± SD. Age of the male animals at the time of analysis was 12-16

weeks. *P < 0.05, **P ≤ 0.01.

Table 3. Triglyceride (TG) and total cholesterol (TC) concentrations in plasma and livers after peritoneal injection of TO901317 for 6 days.

Plasma Liver

n TG (mg/dl) TC (mg/dl) TG (mg/g) TC (mg/g)

controls 34 ± 2.2 91 ± 6.3 2.69 ± 0.40 5.05 ± 0.48

TO901317 37 1 10.0 123 ± 30 4.05 ± 0.91 * 4.50 ± 0.42

All values represent means ± SD. Age of the male animals at the time of analysis was 10

weeks. *P < 0.05

Materials and methods

Animals: C57B1/6 mice were bred and housed in clean environments. All animals were maintained on a regular light-dark cycle (14 h light, 10 h dark) and kept on a standard laboratory chow diet. Healthy male animals at the age of 12 - 16 weeks were used for the experiments. For cholesterol feeding studies, 10 week old male mice were fed chow diet supplemented with 0.5% (wt/wt) cholesterol (cholesterol was added as a powder before pelleting) (SSNIFF, Soest, Germany). At days 0, 1, 2, 4, and 7 of feeding, three mice were fasted for 5h and sacrificed, respectively. For LXR agonist in vivo studies, 10-12 week old male mice were intraperitoneally injected with vehicle alone (95% sesame oil, 5% ethanol) or

with vehicle plus 50 mg TO901317 (Cayman Chemical, Ann Arbor, MI, USA) / kg body weight for 6 days. At the day of the experiment, mice were fasted for 4h and then sacrifized.

Lipid analysis. Blood was collected from animals by retroorbital bleeding and EDTA-plasma was prepared within 20 min. Plasma triglyceride (TG), total cholesterol (TC), and free cholesterol (FC) concentrations were measured enzymatically using commercially available kits (DiaSys, Holzheim, Germany; Greiner Diagnostics AG, Langenthal, Switzerland; Wako Chemicals, Neuss, Germany). The tissue lipid content was determined from blood free livers. After perfusion with 0.9% NaCl, livers were excised, weighed, and frozen. Total lipids were extracted from livers (12) and lipid parameters were determined using above mentioned kits.

Cell culture: Mice were peritoneally injected with 3 ml 3% thioglycollate medium. 3 days later, mouse peritoneal macrophages (MPM) were isolated by flushing the peritoneum with 10 ml phosphate-buffered saline. MPM were centrifuged, washed with PBS and cultured in 75 cm 3 flasks in Dulbecco's minimal essential medium (DMEM) (Gibco, Invitrogen, Lofer, Austria) supplemented with 10% fetal calf serum (FCS) (Sigma- Aldrich, Vienna, Austria) for 2h. Afterwards, non-adherent cells were removed and MPM were cultured in DMEM containing 10% lipoprotein-deficient serum (LPDS), 1% L-glutamine, and 1% streptomycin/penicillin under standard conditions (37°C, 5% CO2). Human LDL was isolated by density gradient ultracentrifugation in a vertical rotor (13). Aggregated LDL was made from native LDL by vortexing for 2 min. Foam cell formation was achieved by incubation of MPM with 50 μg/ml aggLDL for 48h. The mouse macrophage RAW264.7 cells (ATCC TIB- 71), the mouse fibroblast 3T3-L1 cells (ATCC CL-173) and the human hepatoma HepG2 cells (ATCC HB-8065) were cultured under the same conditions in the above mentioned medium. 3T3-L1 cells were grown as fibroblast-like cells and were not differentiated to adipocytes. LPDS was prepared from newborn bovine serum by ultracentrifugation.

Treatment with various agents were performed in 6-well plates for 24h or 48h. Cells were cultured in DMEM / 10% LPDS in the absence or presence of 1 or 10 μg/ml lovastatin (mevinolin, Sigma-Aldrich), 1 μg/ml simvastatin (extracted from Simvastatin, Genericon, Lannach, Austria), 10 μM TO901317 (Cayman Chemical, Ann Arbor, MI, USA), 10 μM 22- (R)-hydroxy-cholesterol, 10 μM retinoic acid, sterols (10 μg/ml cholesterol and 1 μg/ml 25- hydroxycholesterol), and 2.5 mM mevalonolactone (all purchased from Sigma-Aldrich, Vienna, Austria). Vehicle control experiments were performed with equal amounts of DMSO or ethanol in which drugs had been diluted.

RNA isolation, quantitative real-time PCR and Northern blotting analysis: Tissues from 4 months old male mice were removed surgically, weighed, and subsequently frozen in liquid nitrogen. Total RNA was isolated using the Trizol procedure according to the manufacturer ' s protocol (Invitrogen, Lofer, Austria). Total RNA from cells was isolated using the RNeasy kit (Qiagen, Hilden, Germany). RNA quality was checked on a 2100 Bioanalyzer (Agilent Technologies, Vienna, Austria). cDNA was synthesized by reverse transcription of 3 μg total RNA using M-MLV reverse transcriptase (Promega GmbH, Mannheim, Germany). For quantitative real-time PCR, diluted cDNA samples (1 :10, 1 :100, 1 :1000 in water) were used as templates. Each sample was amplified in triplicates for the genes of interest on a Light cycler instrument (Roche Applied Biosscience, Vienna, Austria) using SybrGreen cDNA kit according to the manufacturer's instructions (Roche Applied Biosscience, Vienna, Austria). Initially, amplifications of peptidylprolyl isomerase A (cyclophilin A) and porphobilinogen deaminase were performed on all samples as internal controls for variations in RNA amounts. As both "housekeeping" genes gave the same normalized quantities, levels of the different mRNAs were finally presented after normalization to murine cyclophilin A mRNA levels. A dissociation curve was

generated at the end of all PCR amplifications to verify that the distinct PCR products had been amplified, respectively.

Mac30-fwd 5'- CTACTTCGTCTCGCACATCC -3',

Mac30-rev 5'- ACACAAGCTCACAGAGCAGG -3';

Hmgcr-fwd 5'- CTATTGC ACCG AC AAGAAGCCT-3',

Hmgcr-rev 5'- GCCATCACAGTGCCACATACAA-3';

Srebpl-fwd 5'- CTCAGCAGCCACCATCTAGCCT-S 1 ,

Srebpl-rev 5'- GCTGATGCCTGCAGTCTTCACG-3';

Cyclophilin-fwd 5'- TTCCAGGATTCATGTGCCAG-3',

Cyclophilin-rev 5'- CCATCCAGCCATTCAGTCTT-3'.

For Northern blotting analysis, 10 μg of total RNA were separated by 1% formaldehyde/agarose gel electrophoresis and blotted overnight onto nylon membranes

(Hybond N + , Amersham Biosciences, Vienna, Austria). RNA was immobilized to membranes by ultraviolet irradiation. The blots were prehybridized for 4h at 65°C in a buffer containing

0.15 M sodium phosphate (pH 7.2), 1 mM EDTA, 7% (w/v) SDS and 1% (w/v) BSA.

Membranes were hybridized in the same buffer at 65°C overnight with an appropriate 32 P- labeled murine Mac30 probe. After hybridization, the blots were washed in 2x SSC (SSC:

0.15 M NaCl, 0.015 M sodium citrate) containing 0.1% SDS for 20 min at room temperature, followed by two additional washing steps in Ix SSC / 0.1% SDS for 10 min at 65°C each.

Specific hybridization signals were visualized after exposure to Phosphorlmager Screens on a

Storm Phosphorlmager and analyzed using ImageQuant Software (Amersham Biosciences,

Vienna, Austria).

A full-length murine Mac30 cDNA clone was generated from total mouse macrophage RNA by RT-PCR. After reverse transcription using oligo dT primers, the resulting cDNA was PCR amplified with two Mac30- specific primers using the Advantage RT-for-PCR Kit (Clontech,

Takara Bio Inc, Mountain View, CA, USA). The reaction resulted in a Mac30 cDNA fragment which was subcloned into pstBlue-1. After confirming the correct amplification product by DNA sequencing, the fragment was radioactively labeled with [ 32 P]-dCTP (Amersham Biosciences, Vienna, Austria; Prime-a-Gene Kit, Promega, GmbH, Mannheim, Germany) and used to detect murine Mac30 mRNA in Northern blotting experiments.

cDNA cloning of Mac30 for the expression of a recombinant His-tagged protein. The coding sequence of mouse Mac30 was PCR amplified from mouse macrophage cDNA using Advantage cDNA Polymerase Mix (Clontech, Takara Bio Inc, Mountain View, CA, USA). The primers (Invitrogen, Lofer, Austria) were created to produce suitable restriction sites.

The product, containing the whole open reading frame, was ligated to complement restriction sites of the eukaryotic expression vector pcDNA4/HisMax (Invitrogen, Lofer, Austria). This product was sequence verified on a CEQ™ 8000 Genetic Analysis System (Beckman Coulter GmbH, Krefeld, Germany) using a DTCS-Quick Start Kit and the CEQ™ 8000 Genetic

Analysis 9.0 software. pcDNA4/HisMax vector expressing β-galactosidase (LacZ) was used

as a control for mock transfection.

Expression of recombinant Mac30 in cultured cells. Mouse macrophage RAW264.7 cells were used for Mac30 expression experiments. The cells were cultured in DMEM containing 10% FCS (Sigma- Aldrich, Vienna, Austria) under standard conditions (37°C, 5% CO2). Before transfection, RAW264.7 cells were plated in 6-well dishes. After reaching 80-90% confluency, cells were washed once in PBS. Subsequently, transient transfection of RAW264.7 cells with pcDNA4/HisMax coding for His-tagged Mac30 or β-galactosidase (LacZ) was performed with DEAE-Dextran hydrochloride (Sigma-Aldrich, Vienna, Austria).

For that purpose, cells of each well were incubated with 1 ml DEAE-dextran/DNA cocktail

containing 200 μg/ml DEAE-Dextran hydrochloride, 50 mM Tris-HCl pH 7.3, 10% FCS and 2 μg of purified DNA (Qiagen MaxiPrep, Qiagen, Vienna, Austria) for 2h at 37 0 C. After washing the cells with PBS, 1 ml 10% DMSO was added to the cells for 1 min. Thereafter, cells were washed with PBS and then the medium was replaced by DMEM containing 10% FCS.

Western blotting analysis. Protein quantitation was performed after the method of Lowry et al. (14). Proteins were separated on a 10% SDS-PAGE and transferred to a nitrocellulose membrane. For detection of His-tagged Mac30, blots were incubated with an anti-Express monoclonal antibody (BD Biosciences Clontech, Palo Alto, CA). Gels were calibrated with prestained molecular weight standard. Specifically bound immunoglobulin was detected in a second reaction with a horseradish peroxidase-labeled IgG conjugate and visualized by enhanced chemoluminescence detection (ECL plus, Amersham Biosciences, Vienna, Austria). Membranes were exposed to ECL Hyperfilm and signals were quantitated on a Herolab system using ImageQuant Software.

Measurement of cholesterol biosynthesis. After transfection, 2 μCi l4 C-acetate per well were added, and the RAW264.7 cells were incubated for 24h. After washing the cells once with ice-cold buffer A (50 mM Tris-HCl pH 7.4, 137 mM NaCl, 2g/l BSA) and twice with buffer B (buffer A without BSA), lipids were extracted by hexane/isopropanol (3:2, v:v). After evaporation of the solvent under a stream of nitrogen, lipids were redissolved in 100 μl hexane/isopropanol (3:2, v:v) and separated by thin-layer chromatography (hexane/ether/acetic acid, 70:29:1). The free cholesterol and TG-specific spots were excised, and the radioactivity was quantitated by scintillation counting. Protein quantitation was performed after the method of Lowry et al. (14).

Statistics: Results are expressed as mean ± standard deviation (SD). Two-tailed student's /

test was used to calculate statistical significance among groups. Significance levels were set at

P < 0.05 (*), P ≤ 0.01 (**) or P ≤ 0.001 (***).

Examples

Example 1

Mac30 is downregulated in macrophages and 3T3-L1 cells by cholesterol loading.

Utilizing cDNA microarray experiments with mouse peritoneal macrophages (MPM) and MPM differentiated to foam cells, we identified a large number of genes that are differentially regulated by a variation in cholesterol content. Most of them have already been known to be up- or downregulated in foam cells, but additionally we identified a so far unknown target gene whose expression was downregulated in foam cells compared to macrophages. We named this gene Mac30. The downregulation of mac30 in MPM-derived foam cells was confirmed by quantitative real time PCR and revealed a 54% decrease of Mac30 mRNA abundance in foam cells compared to macrophages (Fig IA). A similar downregulation by 35% was observed in RAW264.7 differentiated to foam cells by incubation with aggLDL (Fig. IB). Sterol loading of RAW264.7 cells with cholesterol/25-hydroxycholesterol also resulted in a significant reduced Mac30 gene expression of -39%. In addition, upon incubation of 3T3-L1 cells with aggLDL Mac30 mRNA abundance decreased by 35% compared to unloaded cells (Fig. 1C).

To elucidate the gene expression pattern, we performed real time PCR on various mouse tissues (Fig. 2). Mac30 showed ubiquitious expression with highest levels in testes and liver. Mac30 mRNA abundance in macrophages was similar to that in skeletal muscle and brown

adipose tissue and less expression could be detected in white adipose tissue, kidney, cardiac muscle, and brain.

Example 2

Mac30 is downregulated in liver by cholesterol feeding. Mice were fed a cholesterol-rich diet for 0, 1 , 2, 4, or 7 days. Table 1 shows that feeding 0.5% cholesterol did not significantly raise total cholesterol (TC), free cholesterol (FC) nor cholesteryl ester (CE) concentrations. Only a slight increase could be observed at day 2, however, the elevation was not significant. Though cholesterol feeding did raise hepatic cholesterol levels with significant increases in TC, FC, and CE (Table 2). The effect of dietary cholesterol on hepatic Mac30 mRNA concentrations were determined by real time PCR. As a control, we measured the mRNA abundance of Hmgcr, which is known to be regulated by cholesterol. Hmgcr was downregulated by 49% after 1 day of cholesterol feeding, by 63% after 2 days and remained down through day 7 (Fig. 3). Unlikely to Hmgcr, Mac30 gene expression was decreased by 29% after 1 day of cholesterol diet, by 34% after 2 days, and by 46% after 4 days. On day 7, Mac30 showed a similar reduction in its expression such as Hmgcr since it was downregulated by 58%.

Example 3

Mac30 is upregulated in 3T3-L1 fibroblasts and RA W264.7 macrophages by statins. To investigate the effect of statins on Mac30 gene expression, 3T3-L1 cells and RAW264.7 were incubated with 1 μg/ml lovastatin or simvastatin for 24h. Expression of Hmgcr, which is known to be upregulated by statins, was used as a positive control. In 3T3-L1 cells, Hmgcr gene expression levels were 3.2-fold increased by simvastatin and 1.7-fold by lovastatin (Fig.

4A). In RAW264.7 cells, the abundance of Hmgcr mRNA was 3.1 -fold increased by simvastatin and 2.9-fold by lovastatin (Fig 4B), respectively. Sterol depletion by simvastatin treatment significantly increased Mac30 expression by 2.2-fold in 3T3-L1 cells, while lovastatin was shown to increase Mac30 mRNA levels only by 1.3-fold (Fig. 4A). The increase of Mac30 mRNA levels in RAW264.7 was less pronounced than in 3T3-L1 cells (Fig. 4B).

Example 4

Mac30 is not involved in cholesterol biosynthesis. Since mevalonate, the Hmgcr reaction product, was expected to prevent cholesterol depletion induced by statin treatment, RAW264.7 macrophages and 3T3-L1 fibroblasts were incubated with lovastatin in the absence or presence of mevalonate. As shown in figure 5, co-incubation of mevalonate and lovastatin did not reverse the statin-induced increase of Mac30 gene expression in RAW264.7 macrophages suggesting that Mac30 is not directly involved in cholesterol biosynthesis. Therefore, we measured the conversion of I4 C-acetate into free cholesterol and triglycerides in RAW264.7 cells transiently transfected with a Mac30-expressing vector. Overexpression of Mac30 had no significant effect on cholesterol or triglyceride biosynthesis in macrophages (Fig. 6A) and HepG2 cells (Fig. 6B).

Mac30 is downregulated in macrophages by LXR activation. In addition to affecting SREBPs, cholesterol can regulate gene expression via LXRs. Thus, Mac30 regulation was assessed in the absence or presence of two different LXR agonists: the oxysterol 22-(R)- hydroxycholesterol (22R-HC) and the non-steroidal TO901317. As shown in figure 7, expression of Mac30 was decreased by 53% when cells were activated using TO901317 and by 83% using 22R-HC. Since it is known that Abcal is a direct target of LXR, its expression

was analyzed in the same set of experiment (Fig. 7). As expected, Abcal mRNA levels were highly upregulated by LXR activation (1 1-fold).

Example 5

Mac30 is upregulated in liver by LXR feeding. To determine whether LXR activation also represses Mac30 gene expression in vivo, mice were peritoneally injected with TO901317 for 6 days. Plasma total cholesterol and triglyceride concentrations were not significantly affected by TO901317 treatment compared to controls (Table 3). However, hepatic triglyceride levels were increased by 1.5-fold, while total cholesterol levels were similar to controls. Therefore, despite no effect on plasma concentrations, TO901317 raised hepatic triglyceride levels. We studied the effect of LXR activation on hepatic Mac30 gene expression and on Abcal as a positive control. As expected, Abcal mRNA levels were found to be 3.1 -fold upregulated by LXR activation in vivo. Unlike to cell culture experiments, LXR activation was shown to induce Mac30 mRNA abundance in liver in vivo by 1.4-fold compared to vehicle treated mice (Fig. 8). These data demonstrate that Mac30 mRNA quantity is repressed by LXR activation in macrophages in vitro and induced in liver in vivo.

Discussion

Utilizing high-density cDNA microarrays, we identified a so far unknown gene in cholesterol metabolism which was found to be significantly downregulated after cholesterol loading of MPM. This study describes the regulation of this gene, which we named Mac30.

The murine gene for Mac30 (NCBI nucleotide entry NM l 33706) encodes a 176 amino acid protein (NP 598467) with a calculated molecular mass of 20.8 kDa. The human Tmem97 gene, also designated as Mac30, encodes a 189-amino acid protein (Q07823) with 77% identity to the mouse protein. Originally, human Mac30 (meningioma-associated protein) was

assigned a protein with unknown function and unknown cellular localization (15). Recent publications showed a human Mac30 overexpression in different malignancies which suggested a role of Mac30 in human breast cancer (16), in pancreatic cancer and rumors of the gastrointestinal tract (17). Additionally it was proposed to fulfill a role in fetal liver during embryonic development (18).

For murine Mac30, mRNA is expressed at high levels in testes and to a lesser degree in macrophages, liver, brown adipose tissue and skeletal muscle. Cholesterol loading decreased its gene expression not only in MPM, but also in RAW264.7 macrophages and 3T3-L1 fibroblasts. Consistently, statin-induced cholesterol depletion resulted in an upregulation of Mac30 indicating that Mac30 might be involved in cholesterol biosynthesis. However, the addition of mevalonate, which is known to prevent cholesterol depletion caused by statins, did not reverse the statin-induced upregulation of Mac30 suggesting that Mac30 is not involved in the synthesis of mevalonate or other subsequent downstream reactions. This fact was additionally confirmed by transient overexpression of Mac30 in RAW264.6 macrophages and HepG2 liver cells which did not result in an increase in cholesterol biosynthesis. Moreover, incorporation of 14 C-acetate into triglycerides was also not affected, indicating that it is neither implicated in cholesterol nor triglyceride de novo synthesis. Our cholesterol feeding studies corroborated these data in mouse livers in vivo. Hmgcr, which is involved in cholesterol biosynthesis, was immediately decreased after dietary cholesterol for one day and remained downregulated through day 7. Mac30 mRNA concentrations were also found to be decreased by cholesterol feeding, however, its downregulation was not so much pronounced at the beginning of the time course, but rather at day 7, when it was shown to reach similar expression levels as Hmgcr. Two SREBP genes encode the three distinct proteins SREBP-Ia, SREBP-Ic, and SREBP-2.

While SREBP-Ia and SREBP-Ic predominantly activate genes involved in fatty acid

metabolism, SREBP-2 targets are involved in cholesterol metabolism (4). Hmgcr is known to be transcriptionally regulated by SREBP-2. Recently, Maxwell et al. have proposed that genes regulated by SREBP-2 are early responders to dietary cholesterol, while genes regulated by SREBP-Ic are late responders (19). Because Mac30 followed this pattern, we predict that it might be involved in fatty acid metabolism. Therefore Mac30 resembles more a lipogenic than a cholesterogenic gene.

It is well known that the SREBP-Ic isoform is regulated by insulin (20) and is a target for the

LXRα, which itself is activated by cholesterol-derived oxysterol ligands (21). Excess

cholesterol should therefore result in LXRα activation in livers, which induces SREBP-Ic

transcription which results in the upregulation of fatty acid synthase, respectively (22). This linkage provided an explanation for the effect of dietary cholesterol on the concentration of SREBP-Ic mRNA. Moreover, LXR induces reverse cholesterol transport from peripheral tissue to liver via HDL by stimulating the production of apolipoproteins and ABC transporters and conversion to bile acids, a positive effect of LXR in terms of counteracting atherosclerosis (23). Since lipogenic SREBP-Ic target genes were proposed to be downregulated by cholesterol and upregulated by LXR agonists (19), we investigated the effect of LXR activation on Mac30 gene expression. Actually, we found an LXR-dependent repression of Mac30 gene expression in macrophages in vitro. Since Mac30 is similarly downregulated by LXR activation as shown for Apoa5, it seems to be regulated by TO901317 in a negative manner through SREBP-Ic (24). To determine if Mac30 is also in vivo a target of LXR, we studied the effect of TO901317 on the hepatic Mac30 mRNA expression. In contrast to the repression of Mac30 observed in macrophages upon LXR activation, hepatic Mac30 mRNA quantity was induced. Very recently, another study postulated this novel mode of cross-talk between LXR and SREBP-Ic in gene regulation (25). Like Mac30, Abcd2 was induced upon cholesterol depletion in cultured cells via a mechanism requiring the activation

and binding of SREBPs (26). However, Abcd2 gene expression was actively repressed by

LXRα activation in human monocytic cells, whereas hepatic Abcd2 mRNA quantity was

stimulated by RXRα activation and not regulated by LXR (25). The authors speculated that

an overlap between sterol regulatory elements and direct repeat-4, which are LXR activating elements, might provide a mechanism by which some SREBP- lc-inducible genes are

downregulated under conditions of sustained LXRα activation. Such a mechanism seems also

plausible for Mac30 gene regulation with LXR being a negative modulator of Mac30 gene expression in macrophages in vitro and a positiv stimulator in liver in vivo. Promoter studies will be necessary to verify this hypothesis. More studies in various cells and organs will have to be performed to elucidate if Mac30 gene expression is regulated tissue or cell type specifically by SREBP-Ic activation and/or LXR repression.

Taken together, we identified Mac30 to be downregulated by an excess of cholesterol in macrophages and fibroblasts in vitro as well as in liver in vivo, but was induced by ER stress in free cholesterol-loaded macrophages. Cholesterol depletion was shown to induce Mac30 mRNA abundance, which, however, could not be reversed by the addition of mevalonate. LXR activation resulted in Mac30 repression in macrophages, while hepatic Mac30 mRNA quantity was induced suggesting that Mac30 is stimulated by SREBP-Ic in some tissues, whereas LXR-mediated repression is obtained in others. These findings will help in the design of future mechanistic and in vivo studies to elucidate further the physiological function of Mac30.

References

1. Chait, A. 1987. Progression of atherosclerosis: the cell biology. Eur Heart J 8 Suppl E:15-22.

2. Gerrity, R. G. 1981. The role of the monocyte in atherogenesis: I. Transition of blood- borne monocytes into foam cells in fatty lesions. Am J Pathol 103:181-190.

3. Tabas, I. 2000. Cholesterol and phospholipid metabolism in macrophages. Biochim Biophys Acta 1529:164-174.

4. Horton, J.D., Goldstein, J. L., and Brown, M.S. 2002. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J CHn Invest 109:1125-1 131.

5. Edwards, P.A., Kennedy, M.A., and Mak, P. A. 2002. LXRs; oxysterol-activated nuclear receptors that regulate genes controlling lipid homeostasis. Vascul Pharmacol 38:249-256.

6. Schoonjans, K., Brendel, C, Mangelsdorf, D., and Auwerx, J. 2000. Sterols and gene expression: control of affluence. Biochim Biophys Acta 1529:114-125.

7. Repa, J.J., Liang, G., Ou, J., Bashmakov, Y., Lobaccaro, J. M., Shimomura, I., Shan, B., Brown, M.S., Goldstein, J. L., and Mangelsdorf, D.J. 2000. Regulation of mouse sterol regulatory element-binding protein- Ic gene (SREBP-Ic) by oxysterol receptors, LXRalpha and LXRbeta. Genes Dev 14:2819-2830.

8. Edwards, P.A., Tabor, D., Kast, H.R., and Venkateswaran, A. 2000. Regulation of gene expression by SREBP and SCAP. Biochim Biophys Acta 1529:103-1 13.

9. Feng, B., Yao, P.M., Li, Y., Devlin, CM., Zhang, D., Harding, H.P., Sweeney, M., Rong, J.X., Kuriakose, G., Fisher, E.A., et al. 2003. The endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages. Nat Cell Biol 5:781-792.

10. Steffensen, K.R., and Gustafsson, J.A. 2004. Putative metabolic effects of the liver X receptor (LXR). Diabetes 53 Suppl l :S36-42.

11. Hu, X., Li, S., Wu, J., Xia, C, and LaIa, D.S. 2003. Liver X receptors interact with corepressors to regulate gene expression. MoI Endocrinol 17:1019-1026.

12. Folch, J., Lees, M., and Sloane Stanley, G. H. 1957. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226:497-509.

13. Puhl, H., Waeg, G., and Esterbauer, H. 1994. Methods to determine oxidation of low- density lipoproteins. Methods Enzymol 233:425-441.

14. Lowry, O.H., Rosebrough, N.J., Fair, A.L., and Randall, R.J. 1951. Protein measurement with the Folin phenol reagent. J Biol Chem 193:265-275.

15. Murphy, M., Pykett, M.J., Harnish, P., Zang, K.D., and George, D.L. 1993. Identification and characterization of genes differentially expressed in meningiomas. Cell Growth Differ 4:715-722.

16. Atalay, A., Crook, T., Ozturk, M., and Yulug, LG. 2002. Identification of genes induced by BRCAl in breast cancer cells. Biochem Biophys Res Commun 299:839- 846.

17. Kayed, H., Kleeff, J., Ding, J., Hammer, J., Giese, T., Zentgraf, H., Buchler, M.W., and Friess, H. 2004. Expression analysis of MAC30 in human pancreatic cancer and tumors of the gastrointestinal tract. Histol Histopathol 19:1021-1031.

18. Malhotra, K., Luehrsen, K.R., Costello, L.L., Raich, T. J., Sim, K., Foltz, L., Davidson, S., Xu, H., Chen, A., Yamanishi, D.T., et al. 1999. Identification of differentially expressed mRNAs in human fetal liver across gestation. Nucleic Acids Res 27:839- 847.

19. Maxwell, K.N., Soccio, R.E., Duncan, E.M., Sehayek, E., and Breslow, J. L. 2003. Novel putative SREBP and LXR target genes identified by microarray analysis in liver of cholesterol-fed mice. J Lipid Res 44:2109-21 19.

20. Shimomura, I., Bashmakov, Y., Ikemoto, S., Horton, J. D., Brown, M.S., and Goldstein, J. L. 1999. Insulin selectively increases SREBP-Ic mRN A in the livers of rats with streptozotocin-induced diabetes. Proc Natl Acad Sci USA 96:13656-13661.

21. Janowski, B.A., Willy, P.J., Devi, T.R., Falck, J.R., and Mangelsdorf, D.J. 1996. An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 383:728-731.

22. Joseph, S.B., Laffitte, B.A., Patel, P.H., Watson, M.A., Matsukuma, K.E., Walczak, R., Collins, J.L., Osborne, T.F., and Tontonoz, P. 2002. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. JBiol Chem 277:11019-1 1025.

23. Tontonoz, P., and Mangelsdorf, D.J. 2003. Liver X receptor signaling pathways in cardiovascular disease. MoI Endocrinol 17:985-993.

24. Jakel, H., Nowak, M., Moitrot, E., Dehondt, H., Hum, D.W., Pennacchio, L.A., Fruchart-Najib, J., and Fruchart, J.C. 2004. The liver X receptor ligand T0901317 down-regulates APOA5 gene expression through activation of SREBP-Ic. J Biol Chem 279:45462-45469.

25. Weinhofer, I., Kunze, M., Rampler, H., Bookout, A. L., Forss-Petter, S., and Berger, J. 2005. Liver X receptor alpha interferes with SREBPl c-mediated Abcd2 expression. Novel cross-talk in gene regulation. J Biol Chem 280:41243-41251.

26. Weinhofer, I., Forss-Petter, S., Zigman, M., and Berger, J. 2002. Cholesterol regulates ABCD2 expression: implications for the therapy of X-linked adrenoleukodystrophy. Hum MoI Genet 11 :2701-2708.