MARKER ASSISTED SELECTION OF MAMMALIAN SUBJECTS WITH DESIRED

PHENOTYPE

FIELD OF THE INVENTION

[0001] This invention relates to an application of marker assisted selection of mammalian subjects, particularly milk-producing domestic animals, for quantitative trait loci (QTL) associated with β-lactoglobulin (BLG) production, regulation, or secretion, including for example milk BLG content, particularly by assaying for the presence of polymorphisms in a gene which is associated with the QTL.

BACKGROUND

[0002] The following includes information that may be useful in understanding the present inventions. It is not an admission that any of the information provided herein is relevant to, or prior art or part of the common general knowledge relating to, the presently described or claimed inventions, or that any publication or document that is specifically or implicitly referenced is prior art, or forms part of the common general knowledge as at the priority date of the application. All documents referred to herein are hereby incorporated by reference in their entirety.

[0003] The genetic basis of bovine milk production is of great significance to the dairy industry. Accordingly, genetic bases for variations in the composition of milk, for example, the relative amounts of major milk proteins, and the effect of these variations on milk production characteristics and milk processing properties, has been the subject of considerable research, debate, and review. For example, PCT International application PCT/NZOl/00245 (published as WO02/36824) reports that polymorphisms in the bovine Diacylglycerol-o-acyltransferase (DGAT1) gene are associated with increased milk yield and altered milk composition, and in particular that the presence of a K232A mutation in the DGAT1 gene results in a decrease in milk fat percentage, milk fat yield, solid fat content and milk protein percentage, while increasing milk volume and milk protein yield. In another example, PCT International application PCT/NZ02/00157 (published as WO03/104492) reports that polymorphisms in the bovine growth hormone receptor (GHR) gene are associated with an increased milk volume and altered milk composition, and, in particular, that the presence of the F279Y amino acid variant results in increased milk yield and decreased milk fat and milk protein percentage, as well as a decrease in live weight. For other characteristics of milk composition, the basis for variation is less clear.

[0004] An ability to modulate milk composition has the potential to alter farming practices, improve animal and human health, modify milk processing characteristics and to produce products which are tailored to meet a range of requirements. In particular, a method of genetically evaluating bovine to select those which express desirable phenotypes, such as a low milk BLG content, would be useful.

[0005] It has been reported that the concentration of BLG in milk from bovine of the AA genotype is >25% higher than in milk from bovine of the BB genotype (Hill, J.P. 1993. J Dairy Sci. 76: 281 -286). It has been suggested that bovine milk of the BB genotype has significant advantages over AA genotype milk in ultra-high temperature (UHT) milk manufacture by reducing plant-fouling and by increasing cheese yield from a given volume of milk because of the higher casein proportion of the milk protein (Hill, J.P. et al., 1997 ppl73-202 in Milk Composition, Production and Biotechnology. Eds Welch, R.A.S., Burns, D.J.W. et al. CAB International, UK). These benefits have been attributed to the lower concentration of BLG in the milk of BB genotype bovine. It will be appreciated that reduction in BLG concentration still further will be expected to enhance the benefits observed with the BB genotype.

[0006] It has also been reported that a reduction of BLG (by processing) to very low concentrations in whey powder changes the amino acid composition of the whey protein fraction to improve its nutritional qualities in infant formula (Lien, E. 2003. Am. J. Clin. Nutr. 77 Suppl. 1555S-8S).

[0007] Strategies to decrease milk BLG content could provide health benefits and milk processing benefits, and are expected to be economically valuable. BLG is normally present in cows' milk at significant concentrations and is the major protein in whey, accounting for over 50% of the whey protein content (Hill, J.P. 1993. J Dairy Sci. 76: 281 -286). Commercial scale purification/extraction of BLG from milk or whey typically requires chromatography (see, for example, US Patent No. 4,834,994) followed by salt elution regimes to remove the BLG- containing protein fraction(s). It will be appreciated, however, that these methods and, thus, the products prepared using these methods, are relatively costly.

[0008] Marker assisted selection, which provides the ability to follow and select subjects with a specific, favourable genetic allele, involves the identification of a DNA molecular marker or markers that segregate(s) with a gene or group of genes associated with, or which in part defines, a trait. DNA markers have several advantages. They are relatively easy to measure and are unambiguous, and as each allele is just as easy to identify as the other, heterozygous and homozygous animals can be distinctively identified. Once a marker system is established, selection decisions are able to be made very easily as DNA markers can be assayed at any time after a DNA containing sample has been collected from an individual subject, whether embryonic, infant or adult. [0009] It is an object of the present invention to provide a method for marker assisted selection of a mammalian subject with a low BLG production, regulation or secretion phenotype, including a low milk BLG content, or to provide subjects identified or selected using the method of the invention as well as milk produced by the selected subject, uses for such milk, or to provide the public with a useful choice.

SUMMARY OF THE INVENTION

[0010] This invention relates to the elucidation of the role of polymorphisms in the gene encoding β-lactoglobulin (BLG) in the concentration of BLG in milk or colostrum, and particularly milk or colostrum BLG content. In particular, the invention relates to the identification of the +78 A/G nucleotide polymorphism in the bovine BLG gene and to the association of the A allele at the +78 A/G polymorphism with production of milk and colostrum with decreased BLG content.

[0011] This gives rise to numerous, and separate, aspects of the invention.

[0012] In one aspect, the invention provides a method of determining the genetic status of a mammalian subject comprising determining the BLG allelic profile of the mammal, and determining the genetic status of the mammal with respect to milk or colostrum BLG content, or with respect to capability of producing progeny that will have decreased milk or colostrum BLG content, on the basis of the BLG allelic profile.

[0013] In one embodiment, the mammalian subject is bovine.

[0014] In one embodiment, the genetic status with respect to milk or colostrum BLG content is production of milk or colostrum with decreased milk or colostrum BLG content.

[0015] In one embodiment, the genetic status with respect to milk or colostrum BLG content is production of milk or colostrum with increased milk or colostrum casein content, including increased casein proportion (also known as casein number), increased casein yield, or increased casein concentration.

[0016] Accordingly, in one embodiment the invention provides a method for identifying or selecting a bovine, the method comprising determining the expression or activity of a BLG gene product, and identifying or selecting bovine that produces milk and colostrum with decreased BLG content, or identifying or selecting bovine capable of producing progeny that produce milk and colostrum with decreased BLG content, on the basis of the determination.

[0017] In various embodiments, decreased BLG content is decreased total BLG concentration, such as for example, decreased [total BLGJmolL ^'1 milk or decreased [total BLG]gL ^_1 milk, or decreased [total BLG]molL ^_1 colostrum or decreased [total BLG]gL ^_1 colostrum. [0018] In various embodiments, decreased BLG milk concentration is less than about

2.50gL ^_1 , less than about 2gL ^_1 , less than about 1.50gL ^_1 , or less than about IgL ^'1 .

[0019] In other embodiments, decreased BLG content is decreased BLG concentration relative to another component present in milk or colostrum, such as for example total milk protein, or relative to casein or another whey protein such as a -lactalbumin.

[0020] In various embodiments, decreased BLG content is decreased total BLG yield, such as for example, decreased BLG yield in milk, or decreased BLG yield in colostrum.

[0021] It will be appreciated that methods comprising determining the expression or activity of a BLG gene product encompass determining expression from or of a BLG gene.

[0022] In one embodiment, expression or activity of the BLG gene product is determined using BLG mRNA, for example by determining the presence or amount of BLG mRNA. In other embodiments, expression or activity of the BLG gene product is determined using BLG protein, in various examples by determining the amount of BLG protein, for example the amount of BLG protein, or by determining the activity of BLG protein, for example the activity of BLG protein present in a sample obtained from the subject, or by determining the amount of a BLG protein isoform, derivative or fragment. It will be apparent that the activity of BLG protein, such as that present in a sample obtained from the subj ect, may be determined by methods well known in the art, for example by determining BLG-mediated lipid-binding activity.

[0023] In still other embodiments, the expression or activity of the BLG gene product is determined using BLG DNA, in various examples by determining the presence or absence of one or more polymorphisms associated with decreased BLG expression or activity, for example one or more or the polymorphisms associated with decreased expression or activity as described herein.

[0024] In another embodiment, the BLG allelic profile of the subject is determined together with the allelic profile of the subject at one or more genetic loci associated with milk or colostrum content, including milk or colostrum protein content.

[0025] In one embodiment, the one or more genetic loci is one or more polymorphisms in one or more genes associated with milk or colostrum protein content.

[0026] The one or more polymorphisms can be detected directly or by detection of one or more polymorphisms which are in linkage disequilibrium with said one or more polymorphisms.

[0027] Linkage disequilibrium (LD) is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present implies the presence of the other. (Reich DE et al; Linkage disequilibrium in the human genome, Nature 2001 , 41 1 : 199- 204.)

[0028] It will be apparent that as used herein, the phrase "BLG allelic profile" contemplates data indicative of the presence or absence of one or more alleles at one or more polymorphisms in the BLG gene or which affect expression from the BLG gene or the expression or activity of a BLG gene product or which are associated with variation in the expression from the BLG gene or in the expression or activity of a BLG gene product. In preferred embodiments, the BLG allelic profile comprises data indicative of the presence or absence of one or more alleles at one or more polymorphisms associated with decreased milk or colostrum BLG content.

[0029] For example, in various preferred embodiments the BLG allelic profile of bovine comprises data indicative of

a) the presence or absence of the A allele at the +78 A/G polymorphism in the BLG gene; or b) the presence or absence of the G allele at the +78 A/G polymorphism in the BLG gene; or c) the presence or absence of a polymorphism in linkage disequilibrium with either of a) or b) above, and particularly the presence or absence of a polymorphism in 100% linkage disequilibrium (D'= 1.0) with either of a) or b) above, or

d) the presence or absence of the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5; or

e) any combination of any two or more of a) to d).

[0030] In one embodiment, the BLG allelic profile of bovine comprises data indicative of the presence or absence of the variant nucleotide or nucleotides at one or more of the polymorphisms identified by "*" (i.e., homozygous in animal 27) herein in Table 5.

[0031] In one embodiment, the BLG allelic profile of bovine comprises data indicative of the presence or absence of the variant nucleotide or nucleotides at one or more of the polymorphisms identified by "**" (i.e., homozygous in animal 27 and in animal 586) herein in Table 5.

[0032] In certain embodiments, the BLG allelic profile of a subject comprises data indicative of the presence or absence in one or more of the subject's progeny or ancestors of one or more alleles at one or more polymorphisms associated with decreased milk or colostrum BLG content. In one particularly contemplated embodiment, the BLG allelic profile of a subject comprises data indicative of the presence or absence in one or more of the subject's progeny or ancestors of one or more alleles specifically described herein, optionally together with data indicative of the expression or activity of a BLG gene or gene product in the subject. [0033] In other embodiments, the BLG allelic profile comprises data indicative of the presence or absence of one or more alleles at one or more polymorphisms in the promoter of the BLG gene, or in a regulatory region of the BLG gene, or in an intron of the BLG gene, and in one example comprises data indicative of the presence or absence of one or more alleles which affect expression from the BLG gene or the expression or activity of a BLG gene product or which are associated with variation in the expression from the BLG gene or in the expression or activity of a BLG gene product.

[0034] It will further be appreciated that the BLG allelic profile may comprise information correlating the presence or absence of one or more polymorphisms as described above with milk or colostrum BLG content.

[0035] For example, in one embodiment a subject's BLG allelic profile comprises data indicative of the presence or absence in one or more of the subject's progeny or ancestors of one or more alleles associated with a low BLG production, regulation or secretion phenotype, such as one or more alleles specifically described herein, together with data indicative of the expression or activity of a BLG gene or gene product in the subject, such as the amount or concentration of BLG present in the milk of the subject.

[0036] Accordingly, in one embodiment the invention provides a method for identifying or selecting a bovine having a desired BLG genotype, the method comprising determining the presence or absence in one or more of the subject's progeny or ancestors of one or more alleles associated with a low BLG production, regulation or secretion phenotype, such as one or more alleles specifically described herein, and determining the expression or activity of a BLG gene product in the subject, and identifying or selecting bovine that produces milk and colostrum with decreased BLG content or identifying or selecting bovine capable of producing progeny that produce milk and colostrum with decreased BLG content, on the basis of the determination.

[0037] In one embodiment, the allelic profile is determined using nucleic acid obtained from said subject, in one example DNA obtained from said subject, or alternatively, said allelic profile is determined using RNA obtained from said subject.

[0038] In another embodiment, the allelic profile is determined with reference to the amount or activity of BLG protein obtained from said subject.

[0039] Conveniently, in said method the presence or absence of DNA encoding wild type BLG in said subject is determined, directly or indirectly, for example using an expressed gene product.

[0040] Alternatively, in said method the presence or absence of at least one nucleotide difference from the nucleotide sequence encoding wild type BLG in said subject, or from the nucleotide sequence encoding BLG of the AA genotype, or from the nucleotide sequence encoding BLG of the BB genotype, is determined, directly or indirectly.

[0041] In various embodiments, the method comprises determining the +78 A/G BLG allelic profile of the bovine.

[0042] In another embodiment, the method comprises determining the BLG allelic profile of the bovine at one or more of the polymorphisms presented herein in Table 5, for example, by determining the presence or absence of the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5.

[0043] More specifically, in said method the presence or absence of one or more of the A allele or G allele at the +78 A/G polymorphism in the BLG gene is determined, directly or indirectly. For example, the presence of the A allele or G allele at the +78 A/G polymorphism in the BLG gene may be determined using a polymorphism in linkage disequilibrium with the A allele or with the G allele at the +78 A/G polymorphism.

[0044] In one embodiment, the method includes ascertaining, from a sample of material containing DNA obtained from the subject, whether a sequence of the DNA comprising a wild type BLG gene or encoding a protein "(X)" having biological activity or expression of wild type BLG is present, or whether a sequence of the DNA encoding an allelic protein "(Y)" at least partially lacking the activity or expression of (X) is present, or whether a sequence of the DNA encoding (X) and a sequence of the DNA encoding (Y) are both present. The absence of the DNA encoding (X) and the presence of the DNA encoding (Y) indicates an association with low relative milk or colostrum BLG content, particularly with the production of milk or colostrum with, inter alia, decreased BLG concentration. The reverse association holds true, where the presence of the DNA encoding (X) and the absence of the DNA encoding (Y) indicates an association with normal relative milk or colostrum BLG content, particularly with the production of milk or colostrum with, inter alia, normal BLG concentration. The presence of both the DNA encoding (X) and the DNA encoding (Y) indicates an association with intermediate relative BLG content, particularly with the production of milk or colostrum with, inter alia, intermediate BLG concentration.

[0045] As used herein, biological activity of wild type BLG protein refers to both expression levels and activity characteristic of BLG protein encoded by the wild type BLG gene such as that depicted herein as SEQ ID NO. 75. Similarly, as used herein, biological activity or expression of the BLG B variant, i.e., the gene variant encoding BLG protein isoform B, refers to both expression levels and activity characteristic of BLG protein encoded by the BLG B variant gene, while biological activity of BLG of the A genotype refers to both expression levels and activity characteristic of BLG protein encoded by the A genotype BLG gene.

[0046] In another embodiment, the method includes ascertaining, from a sample of material containing DNA obtained from the subject, whether the A genotype BLG gene is present, or whether the B genotype BLG gene is present, or whether another genotype BLG gene is present. In still another embodiment, the method includes ascertaining, from a sample of material containing DNA obtained from the subject, the expression of the BLG gene product, for example by determining the presence or absence of one or more polymorphisms associated with decreased or increased BLG expression, for example one or more promoter polymorphisms associated with increased or decreased expression, or the presence or absence of the B' variant as described herein.

[0047] In one embodiment, the method includes ascertaining, from a sample of material containing mRNA obtained from the subject, whether a sequence of the m NA comprising a wild type BLG gene or encoding a protein "(X)" having biological activity or expression of wild type BLG is present, or whether a sequence of the mRNA encoding an allelic protein "(Y)" at least partially lacking the activity or expression of (X) is present, or whether a sequence of the mRNA encoding (X) and a sequence of the mRNA encoding (Y) are both present. The absence of the mRNA encoding (X) and the presence of the DNA encoding (Y) indicates an association with low relative milk or colostrum BLG content, particularly with the production of milk or colostrum with, inter alia, decreased BLG concentration. The reverse association holds true, where the presence of the mRNA encoding (X) and the absence of the mRNA encoding (Y) indicates an association with normal relative milk or colostrum BLG content, particularly with the production of milk or colostrum with, inter alia, normal BLG concentration. The presence of both the mRNA encoding (X) and the DNA encoding (Y) indicates an association with intermediate relative BLG content, particularly with the production of milk or colostrum with, inter alia, intermediate BLG concentration. In another embodiment, the method includes ascertaining the amount of BLG mRNA present in a sample of material containing mRNA obtained from the subject. In another embodiment, the method includes ascertaining the BLG expression profile of the subject, in one example including ascertaining the BLG mRNA expression profile of the subject.

[0048] In another embodiment, the invention includes ascertaining whether a protein "(X)" having biological activity or amount of a wild type BLG is present, or whether a protein "(Y)" at least partially lacking the activity or amount of (X) is present, or whether (X) and (Y) are both present. The absence of (X) and the presence of (Y) again indicates an association with low relative milk or colostrum BLG content, particularly with the production of milk or colostrum with, inter alia, decreased BLG concentration. The reverse association again holds true, where the presence of (X) and the absence of (Y) again indicates an association with normal relative milk or colostrum BLG content, particularly with the production of milk or colostrum with, inter alia, normal BLG concentration. Again, the presence of both (X) and (Y) indicates an association with intermediate relative milk or colostrum BLG content, particularly with the production of milk with, inter alia, intermediate BLG concentration.

[0049] In another embodiment, the method includes ascertaining the amount or activity of BLG protein present in a sample of material containing protein obtained from the subject.

[0050] In one exemplary embodiment, the method includes ascertaining the amount or activity of a BLG protein isoform present in a sample of material containing protein obtained from the subject, such as the amount or activity of the BLG A protein isoform, or the amount or activity of the BLG B protein isoform.

[0051] In another aspect directed to veterinary or agricultural applications, the invention is a method for determining the BLG genotype of a mammalian subject, as may be desirable to know for breeding purposes.

[0052] In one embodiment, the method includes ascertaining, with reference to a sample of material containing nucleic acid obtained from the subject and uncontaminated by heterologous nucleic acid, whether the sample contains (i) nucleic acid molecule encoding a wild type BLG gene or gene product such as a protein having biological activity of wild type BLG and optionally ascertaining whether the sample contains an (ii) allelic nucleic acid molecule encoding a variant BLG gene or gene product such as a protein lacking biological activity of wild type BLG or a variant BLG gene associated with decreased expression of a BLG gene product.

[0053] In another embodiment, the method includes ascertaining, with reference to a sample of material containing protein obtained from the subject and uncontaminated by heterologous protein, whether the sample contains (i) a protein having biological activity of wild type BLG and optionally ascertaining whether the sample contains (iii) a protein lacking biological activity of wild type BLG.

[0054] In a further embodiment, the invention provides a method of determining genetic status of a subject with respect to milk or colostrum BLG content which comprises providing the BLG allelic profile of the subject, together with the allelic profile of the subject at one or more genetic loci associated with milk or colostrum BLG content, and determining the genetic status on the basis of the allelic profiles. [0055] In one embodiment, the one or more genetic loci is one or more polymorphisms in one or more genes associated with milk or colostrum BLG content.

[0056] In one embodiment, the allelic profile comprises a haplotype, including for example a haplotype associated with a low BLG production, regulation or secretion phenotype.

[0057] In a further aspect, the invention includes a probe containing a nucleic acid molecule sufficiently complementary with a nucleic acid sequence present in nucleotides 70082740 to 107061559 of AC 000168.1 GI: 258513356, or with a nucleotide sequence present in NM 173929.3, or with a nucleotide sequence present in SEQ ID NO. 75, or with a nucleotide sequence encoding a wild type bovine BLG, or its complement, so as to bind thereto under stringent conditions, as well as a diagnostic kit containing such a probe. Particularly contemplated are probes that comprise one or other of the alleles at the +78 A/G polymorphism, for example a probe that includes an adenine at the site corresponding to the +78 A/G polymorphism, or a probe that includes a nucleotide able to hybridise to an adenine.

[0058] The invention also includes a primer composition useful for detection of the presence or absence of a wild-type BLG gene, including nucleic acid sequence encoding wild type BLG and/or the presence of the nucleic acid sequence encoding a variant protein at least partially lacking wild type activity. In one form, the composition can include a nucleic acid primer substantially complementary to a nucleic acid sequence encoding wild type BLG, or its complement. The nucleic acid sequence can in whole or in part be identified in Genbank reference NM 173929.3 GI:87196496, or in SEQ ID NO. 75 presented herein, or in nucleotides 70082740 to 107061559 of AC_000168.1 GI: 258513356. Diagnostic kits including such a composition are also included.

[0059] Particularly contemplated are primers comprising or substantially complementary to a nucleic acid sequence present in nucleotides 70082740 to 107061559 of AC_000168.1 GI: 258513356 or present in NMJ 73929.3 GL87196496 or present in SEQ ID NO. 75, for example to a nucleotide sequence within approximately 1 to about 2000 bp of the +78 A/G polymorphism in the bovine BLG gene, more preferably within approximately 1 to about 1000 bp, or within approximately 1 to about 500 bp, approximately 1 to about 400 bp, approximately 1 to about 300 bp, approximately 1 to about 200 bp, approximately 1 to about 100 bp, approximately 1 to about 50 bp, or within approximately 1 to about 20 bp of the +78 A/G polymorphism in the bovine BLG gene.

[0060] Examples of such primers may be derived from one or more of the sequences presented herein as SEQ ID NOs: 1 to 74 or 76 to 78, or may comprise, consist essentially of, or consist of one or more of the sequences presented herein as SEQ ID NOs: 1 to 74 or 76 to 78. [0061] Also contemplated are probes and primers as described herein that comprise one or other of the alleles at one or more of the polymorphisms presented herein in Table 5, or that can be used to discriminate the presence or absence of the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5.

[0062] It will be appreciated by those skilled in the art that a pair of such primers can be used to determine the identity of the nucleotide at a given polymorphism, by, for example the selective generation of an amplicon with one or more sequence-specific primers. Primer compositions comprising a pair of such primers are accordingly contemplated.

[0063] A number of nucleotide analogues capable of hybridising to naturally-occurring nucleotides are well known in the art, and thus probes and primers comprising one or more nucleotide analogues, including one or more nucleotide analogues at the site corresponding to the +78 A/G polymorphism such as a nucleotide analogue able to hybridise to a nucleotide to which adenine hybridises, or a nucleotide analogue that hybridises to an adenine, are also contemplated.

[0064] The invention also provides a diagnostic kit including a primer composition useful for determining the presence or absence of a reference BLG gene and/or the presence or absence of nucleic acid encoding reference BLG, the diagnostic kit comprising one or more primers or primer compositions as described herein.

[0065] The invention further includes an antibody composition useful for detection of the presence or absence or amount of wild type BLG and/or the presence or absence or amount of a variant protein at least partially lacking wild type activity, as well as a diagnostic kit containing such an antibody together with instructions for use, for example in a method of the invention.

[0066] The invention further provides a diagnostic kit useful in detecting DNA comprising a variant BLG gene, or DNA or mRNA encoding a variant BLG gene product at least partially lacking wild type activity in a subject which includes first and second primers for amplifying the DNA or mRNA, the primers being complementary to nucleotide sequences of the DNA or mRNA upstream and downstream, respectively, of a polymorphism in the BLG gene which results in decreased BLG levels (particularly decreased BLG content in milk or colostrum). The kit can also include a third or a fourth primer complementary to a naturally occurring mutation of the wild type BLG gene. Preferably the kit includes instructions for use, for example in accordance with a method of the invention.

[0067] In one embodiment at least one of the nucleotide sequences is selected to be from a non-coding region of the reference BLG gene. [0068] The kit can also include a primer complementary to a naturally occurring mutation of a coding or non-coding portion of the reference BLG gene, for example a mutation in the promoter of the BLG gene. Preferably the kit includes instructions for use, for example in accordance with a method of the invention.

[0069] Thus, in another embodiment the invention provides a method of assessing the genetic status of a bovine with respect to milk or colostrum BLG content which comprises the step of determining the presence or absence of the +78 A/G polymorphism in the BLG gene or one or more polymorphisms in linkage disequilibrium with the +78 A/G polymorphism in the BLG gene.

[0070] In another embodiment the invention provides a method of assessing the genetic status of a bovine with respect to milk or colostrum BLG content which comprises the step of determining the presence or absence of one or more polymorphisms selected from the group comprising:

the A allele at the +78 A/G polymorphism in the BLG gene, or

the G allele at the +78 A G polymorphism in the BLG gene, or

one or more polymorphisms which are in linkage disequilibrium with the A allele at the +78 A G polymorphism in the BLG gene, or

one or more polymorphisms which are in linkage disequilibrium with the G allele at the

+78 A/G polymorphism in the BLG gene.

[0071] In another embodiment the invention provides a method of assessing the genetic status of a bovine with respect to milk or colostrum BLG content which comprises the step of determining the presence or absence of the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5.

[0072] In another aspect, the present invention provides a method for identifying or selecting a mammalian subject with a genotype indicative of one or more desired BLG, production, regulation, or secretion phenotypes. The method comprises determining the BLG allelic profile of said subject, and identifying or selecting the subject on the basis of the determination.

[0073] In one embodiment, the BLG allelic profile is determined by providing the results of an analysis of a sample from said subject for the presence or absence of one or more polymorphisms in the BLG gene associated with one or more of:

(a) decreased expression or activity of a BLG gene product, or

(b) decreased BLG secretion, or

(c) production of milk or colostrum with decreased BLG content, or (d) one or more polymorphisms in linkage disequilibrium with one or more polymorphisms in the BLG gene associated with one or more of (a) to (c) above.

[0074] In one embodiment, the subject is bovine.

[0075] In one embodiment, the phenotype is desired milk or colostrum BLG content.

[0076] In a further embodiment the invention provides a method for selecting a bovine with a BLG allelic profile indicative of decreased milk or colostrum BLG content.

[0077] In a further embodiment the invention provides a method for selecting a bovine with a BLG allelic profile indicative of increased milk or colostrum casein content, increased milk or colostrum casein number, or increased milk or colostrum casein yield.

[0078] In one example the method comprises determining the presence of one or more of the A allele at the +78 A/G polymorphism in the BLG gene, and selecting the bovine on the basis of the determination. Alternatively or additionally, the method comprises determining the absence of the G allele at the +78 A/G polymorphism in the BLG gene, and selecting the bovine on the basis of the determination.

[0079] In one example, the method comprises determining the presence of the AA genotype at the +78 A/G polymorphism in the BLG gene, and selecting the bovine on the basis of the determination.

[0080] In a further embodiment the invention provides a method for selecting a bovine with a BLG allelic profile indicative of intermediate milk or colostrum BLG content, preferably of intermediate milk or colostrum BLG content.

[0081] In one example, the method comprises determining the presence of the AG genotype at the +78 A/G polymorphism in the BLG gene, and selecting the bovine on the basis of the determination.

[0082] In another example, the method comprises determining the presence or absence of the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5.

[0083] In one embodiment, the presence of an allele is determined with respect to a BLG polynucleotide (genomic DNA, mRNA or cDNA produced from mRNA) obtained from the bovine.

[0084] In one embodiment, the presence of an allele is determined by sequencing a BLG polynucleotide obtained from the bovine.

[0085] In a further embodiment the determination comprises the step of amplifying a BLG polynucleotide sequence from genomic DNA, mRNA or cDNA produced from mRNA derived from said bovine, for example by PCR. [0086] In one example, the determination is by use of primers which comprise a nucleotide sequence having at least about 12 contiguous bases of or complementary to the sequence of nucleotides 70082740 to 107061559 of AC_000168.1 GI: 258513356 or of NMJ73929.3 GI:87196496 or a naturally occurring flanking sequence thereof.

[0087] In one example, the determination is by use of primers which comprise a nucleotide sequence having at least about 12 contiguous bases of or complementary to the sequence of SEQ ID NO. 75.

[0088] In one embodiment at least one of the primers comprises sequence corresponding to at least one of the allele-specific nucleotides described herein. In one exemplary embodiment, at least one of the primers comprises at the position corresponding to the +78 A/G polymorphism an adenine or a nucleotide capable of hybridising to a nucleotide capable of hybridising to an adenine. In another exemplary embodiment, at least one of the primers comprises at the position corresponding to the +78 A/G polymorphism a nucleotide to which adenine hybridises or a nucleotide capable of hybridising to an adenine. Primers comprising a sequence corresponding to the variant nucleotide or nucleotides at the position corresponding to one or more of the polymorphisms presented herein in Table 5 are also specifically contemplated as if individually set forth.

[0089] In an alternative embodiment, the method comprises restriction enzyme digestion of a nucleotide derived from the bovine. Such digestion may also be performed on a product of the PCR amplification described above.

[0090] In a further embodiment, the presence of an allele is determined by mass spectrometric analysis of a BLG polynucleotide obtained from the bovine.

[0091] In an alternative embodiment, the presence of an allele is determined by hybridisation of a probe or probes comprising a nucleotide sequence of or complementary to the sequence of nucleotides 70082740 to 107061559 of AC_000168.1 GI: 258513356, or of a probe or probes comprising a nucleotide sequence of or complementary to NM_173929.3 GI:87196496, or of a probe or probes comprising a nucleotide sequence of or complementary to the sequence of SEQ ID NO. 75.

[0092] In one example, the probe or probes comprises 12 or more contiguous nucleotides of or complementary to the sequence of nucleotides 70082740 to 107061559 of AC_000168.1 GI: 258513356. In one example, the probe or probes comprises 12 or more contiguous nucleotides of or complementary to the sequence of NM_173929.3 GI:87196496. In another example, the probe or probes comprises 12 or more contiguous nucleotides of or complementary to the sequence of SEQ ID NO. 75. [0093] In one example, the probe or probes comprise sequence corresponding to at least one of the allele-specific nucleotides described herein or complements thereof.

[0094] In an alternative embodiment, the presence of an allele is determined by analysis of a BLG polypeptide obtained from the bovine.

[0095] In a further aspect the invention provides a bovine selected by a process of the invention; milk or colostrum produced by the selected bovine or the progeny thereof as well as compositions and dairy products produced from such milk; compositions produced from such colostrum, and ova or semen produced by or tissue from the selected bovine.

[0096] In still a further aspect the invention provides a method of selecting a herd of bovine, comprising selecting individuals by a method of the present invention, and segregating and collecting the selected individuals to form the herd. The invention further provides a herd of bovine so selected, as well as a herd comprising bovine produced by bovine selected by the methods described herein.

[0097] In one embodiment, the method of selecting a herd of bovine comprises

genotypically determining the presence of

the A allele at the +78 A/G polymorphism in the BLG gene or

one or more polymorphisms which are in linkage disequilibrium with the A allele at the +78 A/G polymorphism in the BLG gene, or

genotypically determining the absence of

the G allele at the +78 A/G polymorphism in the BLG or

one or more polymorphisms which are in linkage disequilibrium with the G allele at the +78 A/G polymorphism in the BLG gene,

within at least one individual member of a herd, and

determining the BLG allelic profile of one or more other individuals and selecting individuals on the basis of the BLG allelic profile, and segregating and collecting the selected individuals to form the herd.

[0098] In one embodiment, each member of the herd is homozygous for the A allele at the

+78G/A polymorphism in the BLG gene.

[0099] In various embodiments, the herd comprises two or more, three or more, four or more, five or more, 6, 7, 8, 9, 10, or more than 10 bovine. In certain embodiments, the herd comprises 20, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 bovine.

[00100] In a still further aspect, the invention provides a method of determining genetic status of a bovine with respect to one or more milk or colostrum BLG content phenotypes, or with respect to capability of producing progeny predisposed to or with one or more milk or colostrum

BLG content phenotypes, the method comprising

providing data about the BLG allelic profile of said bovine, and

determining the genetic status of the bovine on the basis of the data.

[00101] In one example, the data about the BLG allelic profile comprises data representative of the presence or absence of one or more of the A allele or the G allele at the +78 A/G polymorphism in the BLG gene.

[00102] In one example, the method additionally comprises providing data comprising the result of at least one analysis of one or more genetic loci associated with one or more milk or colostrum BLG content phenotypes, wherein the data is representative of the genetic status of the bovine.

[00103] In one example, the one or more genetic loci are one or more polymorphisms associated with a decrease in expression or activity of a BLG gene product.

[00104] In one example the genetic loci is the BLG gene (including all regulatory elements such as the promoter, introns and 3'UTR).

[00105] In one embodiment, the one or more milk or colostrum BLG content phenotypes is selected from the group comprising production of or capability of producing milk with decreased BLG content or production of or capability of producing colostrum with decreased BLG content.

[00106] Accordingly, in one embodiment the invention provides a method of determining genetic status of a bovine with respect to milk or colostrum BLG content, or with respect to capability of producing progeny that will have decreased milk or colostrum BLG content, the method comprising

providing data about the BLG allelic profile of the bovine, and

determining the genetic status of the bovine on the basis of the data.

[00107] In a further aspect the invention provides a method for identifying or selecting a mammalian subject with one or more desired BLG production, regulation, or secretion phenotypes or with the capability of producing progeny that will have one or more desired BLG production, regulation, or secretion phenotypes, the method comprising determining a BLG allelic profile of the subject, and identifying or selecting the subject on the basis of the determination.

[00108] In one embodiment, the method comprises

providing the result of one or more genetic tests of a sample from the subject, and analysing the result for the presence or absence of one or more polymorphisms selected from the group comprising: (a) one or more polymorphisms associated with decreased expression or activity of a BLG gene product, or

(b) one or more polymorphisms in the BLG gene associated with decreased BLG secretion, or

(c) one or more polymorphisms in the BLG gene associated with production of milk, colostrum, blood, serum, mucosal secretions, or having one or more mucosal surfaces with decreased BLG content, or

(d) one or more polymorphisms in linkage disequilibrium with one or more polymorphisms in the BLG gene associated with one or more of (a) to (c) above, wherein a result indicative of the presence or absence of one or more of said polymorphisms is indicative of a subject with one or more desired BLG production, regulation, or secretion phenotypes; and

identifying or selecting the subject on the basis of the result.

[00109] In one example, the one or more polymorphisms associated with decreased expression or activity of BLG gene product is one or more polymorphisms in the BLG gene.

[00110] In one embodiment, the one or more BLG production, regulation, or secretion phenotypes is one or more milk or colostrum BLG content phenotypes, including decreased milk or colostrum BLG content.

[00111] In a further aspect the invention provides a method for selecting a bovine with one or more desired milk or colostrum BLG content phenotypes, the method comprising

a) providing the result of one or more genetic tests of a sample from the bovine, and b) analysing the result for the presence or absence of one or more polymorphisms selected from the group comprising:

the A allele at the +78 A/G polymorphism in the BLG gene, or

the G allele at the +78 A/G polymorphism in the BLG gene, or

one or more polymorphisms which are in linkage disequilibrium with the A allele at the +78 A/G polymorphism in the BLG gene, or

one or more polymorphisms which are in linkage disequilibrium with the G allele at the +78 A/G polymorphism in the BLG gene; or

the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5;

wherein a result indicative of the presence or absence of one or more of said polymorphisms is indicative of a bovine with one or more desired milk or colostrum BLG content phenotypes, and selecting the bovine. [00112] In other aspects, the invention provides a system for performing one or more of the methods of the invention, said system comprising:

computer processor means for receiving, processing and communicating data;

storage means for storing data including a reference genetic database of the results of genetic analysis of a subject with respect to one or more milk or colostrum BLG content phenotypes and optionally a reference milk or colostrum BLG content trait database of non- genetic factors for one or more subject milk or colostrum BLG content phenotypes; and

a computer program embedded within the computer processor which, once data consisting of or including the result of a genetic analysis for which data is included in the reference genetic database is received, processes said data in the context of said reference databases to determine, as an outcome, the genetic status of the subject, said outcome being communicable once known, in one example to a user having input said data.

[00113] In one example, said system is accessible via the internet or by personal computer.

[00114] In one example, said reference genetic database comprises or includes the results of one or more analyses of one or more genetic loci associated with one or more milk or colostrum BLG content phenotypes, more preferably the one or more genetic loci are one or more polymorphisms in one or more genes associated with one or more milk or colostrum BLG content phenotypes.

[00115] In yet a further aspect, the invention provides a computer program suitable for use in a system as defined above comprising a computer usable medium having program code embodied in the medium for causing the computer program to process received data consisting of or including the result of at least one genetic analysis of one or more genetic loci associated with one or more milk or colostrum BLG content phenotypes in the context of both a reference genetic database of the results of said at least one genetic analysis and optionally a reference database of non-genetic factors associated with one or more subject milk or colostrum BLG content phenotypes.

[00116] In one example, the one or more genetic loci are one or more polymorphisms in one or more genes associated with one or more milk or colostrum BLG content phenotypes.

[00117] In one example the gene is the BLG gene (including all regulatory regulatory elements such as the promoter, introns and 3 'UTR).

[00118] In one example, the one or more polymorphisms are one or more polymorphisms associated with a decrease in expression or activity of a BLG gene product.

[00119] In still another aspect, the invention provides a method of determining genetic status of a bovine with respect to milk or colostrum BLG content, or with respect to capability of producing progeny that will have decreased milk or colostrum BLG content, the method comprising

determining milk or colostrum BLG content of the bovine,

determining the BLG allelic profile of the bovine,

comparing the BLG allelic profile of the bovine or the milk or colostrum BLG content of the bovine with that of a bovine having a known BLG allelic profile;

determining the genetic status of the bovine on the basis of the comparison.

[00120] It will be appreciated that for the purposes of the comparison, the milk or colostrum BLG content associated with the known BLG allelic profile is known. It will further be appreciated that the association of milk or colostrum BLG content with a particular BLG allelic profile may be established by the methods described herein.

[00121] In another aspect, the invention relates to an isolated, purified or recombinant nucleic acid molecule comprising nucleotide sequence selected from the group comprising:

a) at least 12 contiguous nucleotides of NM_173929.3 GL87196496 and comprising an adenine at the +78 A/G polymorphism; or

b) at least 12 contiguous nucleotides of SEQ ID NO. 75 and comprising an adenine at the +78 A/G polymorphism; or

c) at least 12 contiguous nucleotides of nucleotides 70082740 to 107061559 of AC 000168.1 GI: 258513356 and comprising an adenine at the +78 A/G polymorphism; or

d) at least 12 contiguous nucleotides of NM_173929.3 GI: 87196496 and comprising one or more of the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5;

e) at least 12 contiguous nucleotides of SEQ ID NO. 75 and comprising one or more of the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5;

f) at least 12 contiguous nucleotides of nucleotides 70082740 to 107061559 of AC 000168.1 GI: 258513356 and comprising one or more of the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5;

g) at least 12 contiguous nucleotides of a variant of any one or more of (a) to (f); or h) at least 12 contiguous nucleotides of any one or more of SEQ ID NOs: 1 to 74 or 76 to 78; or

i) at least 12 contiguous nucleotides of any one or more of SEQ ID NOs: 1 to 74 or 76 to 78 and comprising an adenine at the +78 A/G polymorphism or one or more of the variant nucleotide or nucleotides at one or more of the polymorphisms presented herein in Table 5; or

j) a complement of any one of (a) to (i); or

k) a sequence of at least 12 contiguous nucleotides and capable of hybridising to the nucleotide sequence of any one of (a) to (j) under stringent conditions.

[00122] In one embodiment, the BLG nucleic acid molecule is a BLG fragment as defined herein, wherein the BLG fragment comprises the +78 A/G polymorphism.

[00123] The invention also provides a genetic construct comprising a BLG nucleic acid molecule of the invention, a vector comprising the genetic construct or a nucleic acid sequence as described above, a host cell comprising the genetic construct or vector, a polypeptide encoded by a BLG nucleic acid molecule of the invention, an antibody which selectively binds a polypeptide of the invention, and a method for recombinantly producing a polypeptide of the invention.

[00124] The invention further provides a transgenic mammal comprising a BLG nucleic acid sequence of the invention, such as for example a transgenic bovine comprising an adenine at the position corresponding to the +78 A/G polymorphism in the BLG gene, including a transgenic bovine comprising an adenine at each allele of the +78 A/G polymorphism in the BLG gene.

[00125] The term "comprising" as used in this specification means "consisting at least in part of. When interpreting each statement in this specification that includes the term "comprising", features other than that or those prefaced by the term may also be present. Related terms such as "comprise" and "comprises" are to be interpreted in the same manner.

[00126] As described above, in this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows a diagram showing the gene map for the region on BTAl 1 that was sequenced around the BLG gene, as described herein in the examples.

Figure 2 shows a frequency distribution of B protein isoform concentration in 234 heterozygous AB daughters of bull "99" (also referred to herein as "sire 99"). Sire 99 was homozygous for the gene encoding the B protein isoform of BLG, and hence the genes encoding the B protein isoform present in milk from progeny heterozygous cows must have derived from sire 99. Units are arbitrary, and show two populations of BLG protein isoform B-producing progeny of sire 99 expressed as concentration in milk (Figure 2a), or as a ratio of the concentrations of the B protein isoform relative to the A protein isoform (Figure 2b).

Figure 3 shows the relative expression of BLG mRNA from qPCR of mammary tissue taken by biopsy of carriers of the B' variant and non-carriers in mid-lactation. Expression level is shown relative to expression of reference genes; GAPDH and EIF3K. Mean data are shown for A|A (n=l), A|B (n=2 ) A B' (n= 3) and B'|B' (n= 3).

Figure 4 shows a graph depicting relative expression levels of luciferase reporter constructs in MCF-7 cells carrying the B' plasmid (G+78A A allele) compared to the B plasmid (G+78A G allele), as described in Example 2.

Figure 5 shows a graph depicting relative expression levels of luciferase reporter constructs in CHO- 1 cells carrying the B' plasmid (G+78A A allele) compared to the B plasmid (G+78A G allele), as described in Example 2.

Figure 6 shows a graph depicting the ratio of B/B' expression in each cell line, as described herein in Example 2.

DETAILED DESCRIPTION OF THE INVENTION

[00127] The present invention recognises that one or more polymorphisms in the BLG gene in bovine are associated with a QTL for variations in BLG content, and particularly variations in milk or colostrum BLG content.

[00128] For the sake of clarity, the phrase "milk or colostrum BLG content" is to be read as referring to milk BLG content or colostrum BLG content. It will be apparent to those skilled in the art that milk or colostrum BLG content can readily be determined qualitatively or quantitatively. In some applications, a qualitative comparison of a sample of milk or colostrum relative to another sample (preferably from an individual of known BLG allelic profile) may be sufficient to correlate association with a particular genotype. Methods for quantitative determination of milk or colostrum BLG content are also known in the art, and examples are provided herein.

[00129] The invention provides methods of assessing the genetic status of a bovine with respect to BLG content, more particularly milk or colostrum BLG content. One such method comprises the step of determining the BLG allelic profile of said bovine, for example the step of genotypically determining the BLG allelic profile of said bovine, such as the BLG allelic profile of said bovine at the +78 AJG polymorphism. Another such method comprises the step of determining the level of a BLG gene product of said bovine. [00130] The invention also provides methods for identifying or selecting a mammalian subject with a genotype indicative of one or more desired BLG production, regulation, or secretion phenotypes, including desired milk or colostrum BLG content, particularly desired BLG content. One of the major applications of the present invention is in the identification or selection of bovine having the A allele at the +78 A/G polymorphism in the BLG gene, which is associated with decreased milk or colostrum BLG content. Accordingly, one method comprises determining the presence or absence of the A allele at the +78 A/G polymorphism, and selecting the bovine on the basis of the determination.

[00131] As used herein, the term "genotypically determining" refers to methods of the invention that rely on an analysis of one or more genotypes of a subject, and will typically involve an analysis of one or more nucleic acids or one or more nucleic acid samples from a subject.

[00132] As used herein, the term "phenotypically determining" refers to methods of the invention that rely on an analysis of one or more phenotypes of a subject, and will typically involve an analysis of one or more proteins or one or more protein samples from a subject.

[00133] Additionally, the invention is directed towards the selected non-human subjects, such as bovine and ova or semen from the selected non-human subjects which may be useful in further breeding programs. Bovine so selected will be useful for milk or colostrum production.

[00134] The invention is also directed to transgenic mammals comprising one or more BLG nucleotide sequences of the invention. As used herein, a "transgenic mammal" refers to a mammal which contains new genetic material as a result of genetic manipulation or transformation. The new genetic material is typically derived from a mammal of the same species as the resulting transgenic mammal, or in certain embodiments is from a different species.

[00135] The invention is also directed towards milk or colostrum produced by the selected bovine or the progeny thereof, as well as dairy products produced from such milk and compositions (including pharmaceutical, nutraceutical, veterinary, and the like) produced from such colostrum.

[00136] The production of a wide variety of dairy products and compositions is well known in the art, and dairy products and compositions contemplated herein include infant formula, ice creams, yoghurts and cheeses, dairy based drinks (such as milk drinks including milk shakes, and yogurt drinks), milk powders, dairy based sports supplements, food additives such as protein sprinkles and dietary supplement products including daily supplement tablets. [00137] Low beta-lactoglobulin milks are particularly suited to use in the manufacture of cheeses, where the increase in casein number leads to improved yield. Accordingly, use of low beta-lactoglobulin milks from bovine (or other ruminants typically used for milk production) selected by the methods of the invention in the preparation of cheeses is particularly contemplated.

[00138] In certain embodiments the composition is a maternal formula, infant formula, follow-on formula, growing-up formula or dietetic product. In other embodiments the composition is a nutraceutical. In still other embodiments, the composition is a pharmaceutical.

[00139] In one embodiment, compositions useful herein include maternal formulas, infant formulas, follow-on formulas and growing up formulas. Such products are formulated to target nutrients to the foetus, infant and child. It is appreciated that the first life-stages (foetus, infant and growing child) involve significant growth and development. Any support which enhances development can have significant effects on the development of the individual.

[00140] The term "maternal formula" as used in this specification means a composition for pregnant woman to take during pregnancy. The term "infant formula" as used in this specification means a composition for infants aged between 0 days and 6 months old. The term "follow-on formula" as used in this specification means a composition for infants aged 6 months to 1 year. The term "growing up formula" as used in this specification means a compositions directed to infants and children aged 1 year upwards. Growing-up formula includes growing-up milk powders as will be understood by those skilled in the art.

[00141] It will further be appreciated by those skilled in the art that the age ranges for the different compositions: "infant formula", "follow-on formula" and "growing-up formula" can vary from child to child depending on the individual's development.

[00142] Particularly contemplated are low beta-lactoglobulin formulas, such as low beta- lactoglobulin infant formulas.

[00143] Similarly, the production of a wide range of colostrum products, such as but not limited to nutraceutical supplements and the like, is well known in the art. Particularly contemplated herein are colostrum compositions having decreased BLG content or produced from colostrum having decreased BLG content. Methods to prepare compositions enriched in BLG are also known in the art, as exemplified by those discussed in for example US Patent No. 4,834,994, incorporated herein by reference in its entirety.

[00144] The present invention recognises that mutations in the gene encoding BLG, as well as BLG levels or activity, may be used as a selection tool to breed animals with lower milk concentrations of BLG. This in turn may allow the production of milk products more suitable to particular markets, such as the production of foods low in BLG.

Beta-lactoglobulin

[00145] BLG (also known as progestagen-associated endometrial protein (PAEP)) is a relatively small protein of 162 amino acid residues (plus a 16 amino acid signal peptide), with an 18.4 kDa molecular weight. BLG is the major whey protein of cow and sheep milk (-3-5 g/L), and is also present in the milks of many other mammalian species, with notable exceptions being that of rodents and humans. BLG (UniProtKB/Swiss-Prot P02754) is composed of a single polypeptide chain. BLG comprises 10% of the total bovine milk protein or about 58% of the whey protein. There are two main genetic variants, the first encoding protein isoform A, and the second encoding protein isoform B, that differ in the substitution of a glycine in protein isoform B for an aspartic acid in protein isoform A at amino acid position 64, and an alanine in protein isoform B for a valine in protein isoform A at position 1 18. Other variants are known, including variants encoding protein isoforms C through H, and a variant encoding protein isoform W.

[00146] The molecule contains two disulfide and 1 free sulfhydryl groups. A reference mRNA sequence for the bovine BLG gene (Gene ID: 280838) is available at Genbank accession number NM_173929.3 GL87196496, while a reference amino acid sequence for the bovine BLG protein is available at Genbank accession number NP_776354.2 GI:87196497. As described herein, the applicants have determined the genomic sequence of a number of individual bovine, and a reference sequence is provided in the accompanying Sequence ID listing as SEQ ID NO. 75.

[00147] As described herein, the present invention relates to the identification that a mutation in the BLG gene leads to a reduction in BLG content, production, or secretion, and particularly with variations in milk or colostrum BLG content. The BLG polymorphism described herein was closely associated with a milk and colostrum BLG concentration phenotype. Animals homozygous for the A allele at the +78 A/G polymorphism produced milk with approximately 25% of the BLG found in animals homozygous for the G allele at the +78 A/G polymorphism. Fixing the +78 A/G polymorphism to the AA genotype in a herd population would decrease the herd average BLG concentration by approximately 75%.

[00148] Accordingly, as used herein the term "wild type" recognizes the characteristics of the BLG nucleotide sequences presented in NMJ73929.3 GL87196496, or in SEQ ID NO. 75 presented herein, and of the BLG protein isoform B protein product encoded thereby. For example, when used with reference to activity, the term "wild type" denotes activity associated with the wild type BLG protein. Similarly, when used with reference to expression level, the term "wild type" denotes a level of expression associated with the wild type BLG promoter or of the wild type BLG gene.

[00149] It will be apparent that the term "activity" may refer both to the inherent activity of a single molecule of BLG, which may be wild type activity or may be less or greater than wild type activity as may depend, for example on the amino acid sequence, the presence of any amino acid substitutions, the availability of co-factors, and the like, as well as to the total activity of the population of BLG molecules present (for example, in a bovine or in a sample taken from a bovine), as may depend on both the activity of each molecule present and the level of expression (for example, how many such molecules are present). As used herein, activity in some embodiments refers to immunogenic activity.

[00150] As used herein, such as when used in reference to an allelic protein lacking the activity of wild type BLG, the phrase "lacking the activity of X" contemplates activity both greater than that of X and less than that of X. For example, an allelic protein lacking the activity of wild type BLG may be a variant BLG protein of greater or lesser enzymatic activity than that of wild type BLG.

[00151] It will similarly be apparent that the expression or amount of an allelic BLG protein may be referenced to the expression or amount of, for example, the BLG protein isoform B encoded by the BLG gene presented herein in SEQ ID NO. 75. For example, in certain embodiments the expression or amount of BLG protein produced from the B' variant gene described herein is referenced to the expression or amount of BLG protein produced by the BLG gene presented herein in SEQ ID NO. 75.

[00152] Methods to assay the expression or activity of BLG are well known in the art. For example, Northern analysis, RT-PCR, or immunostaining for BLG may be used. Anti-bovine BLG antibodies are widely available, such as those available from Abbiotec LLC, San Diego. Identification and analysis of polymorphisms

[00153] The polymorphisms described herein are numbered according to their position in the genomic nucleotide sequence relative to the +1 translation start site of the bovine BLG gene. Those skilled in the art will recognise that these positions can readily be expressed relative to the coding sequence, or relative to their position in the mature BLG polypeptide. It will be apparent to those skilled in the field that the convention of identifying polymorphisms effecting an amino acid substitution by their codon position in the gene in which they occur and the amino acid substitution effected thereby is also contemplated herein. Accordingly, the +78 A/G polymorphism described herein may be referred to by reference to the codon of the BLG gene within. The +78 A/G polymorphism can be detected directly or by detection of one or more polymorphisms which are in linkage disequilibrium with one or more of these polymorphisms. Linkage disequilibrium is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present implies the presence of the other. (Reich DE et al; Linkage disequilibrium in the human genome, Nature 2001 , 41 1 : 199-204.)

[00154] Various degrees of linkage disequilibrium are possible. In various examples, the one or more polymorphisms in linkage disequilibrium with one or more of the polymorphisms specified herein are in greater than about 60% linkage disequilibrium, are in about 70% linkage disequilibrium, about 75%, about 80%, about 85%, about 90%, about 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100% linkage disequilibrium with the +78 A/G polymorphism of the BLG gene. Those skilled in the art will appreciate that linkage disequilibrium may also, when expressed with reference to the deviation of the observed frequency of a pair of alleles from the expected, be denoted by a capital D. Accordingly, the phrase "two alleles are in LD" usually means that D does not equal 0. Contrariwise, "linkage equilibrium" denotes the case D = 0. When utilising this nomenclature, the one or more polymorphisms in LD with the one or more polymorphisms specified herein are in various examples in LD of greater than about D'=0.6, of about D'=0.7, of about D'=0.75, of about D'=0.8, of about D'=0.85, of about D'=0.9, of about D'=0.91 , of about D'=0.92, of about D'=0.93, of about D'=0.94, of about D'=0.95, of about D'=0.96, of about D'=0.97, of about D'=0.98, of about D'=0.99, or about D'=1.0. (Devlin and Risch 1995; A comparison of linkage disequilibrium measures for fine-scale mapping, Genomics 29: 31 1-322).

[00155] A "haplotype" as described herein refers to a combination of genetic markers, for example "alleles", such as those set forth in Table 5, and such haplotypes are useful in the methods of the present invention to identify subjects having a desired genetic characteristic. In a certain embodiment, the haplotype can comprise one or more alleles (e.g., a haplotype containing a single SNP), two or more alleles, three or more alleles, four or more alleles, or five or more alleles. The genetic markers are particular "alleles" at polymorphic sites associated with BLG, for example with BLG expression, such that the haplotypes useful herein, e.g., having markers such as those shown in Table 5, have predictive value for detecting subjects having or likely to have a particular BLG production, regulation, or secretion phenotype, or likely to produce progeny having a particular BLG production, regulation, or secretion phenotype. The haplotypes contemplated herein are in some cases a combination of various genetic markers, e.g., SNPs and microsatellites. Therefore, detecting haplotypes can be accomplished by methods known in the art for detecting sequences at polymorphic sites, such as the methods described herein. [00156] There are numerous standard methods known in the art for determining whether a particular DNA sequence is present in a sample, many of which include the step of sequencing a DNA sample. Thus in one embodiment of the invention, the step determining whether or not the specified nucleotides are present in a nucleic acid derived from a bovine, includes the step of sequencing the nucleic acid. Methods for nucleotide sequencing are well known to those skilled in the art.

[00157] In another aspect, the present invention provides a method for determining the genetic status of a bovine with respect to BLG content, and particularly with respect to milk or colostrum BLG content. The method includes ascertaining, from a sample of material containing DNA obtained from the bovine, whether a sequence of the DNA comprising the wild type BLG gene is present, or whether a gene encoding a protein having biological activity or expression of wild type BLG is present, or whether a sequence of the DNA encoding an allelic protein lacking the activity or expression of wild type BLG is present.

[00158] An example of another art standard method known for determining whether a particular DNA sequence is present in a sample is the Polymerase Chain Reaction (PCR). A preferred aspect of the invention thus includes a step in which ascertaining whether a sequence of the DNA comprising the wild type BLG gene is present, or whether a gene encoding a protein having biological activity or expression of wild type BLG is present, or whether a sequence of the DNA encoding an allelic protein lacking the activity or expression of wild type BLG is present, includes amplifying the DNA in the presence of primers based on a nucleotide sequence encoding a protein having biological activity or expression of wild type BLG, and/or in the presence of a primer containing at least a portion of a polymorphism known to naturally occur and which when present results in low relative BLG levels, and particularly in milk or colostrum having, inter alia, a lower BLG content.

[00159] A primer of the present invention, used in PCR for example, is a nucleic acid molecule sufficiently complementary to the sequence on which it is based and of sufficient length to selectively hybridise to the corresponding portion of a nucleic acid molecule intended to be amplified and to prime synthesis thereof under in vitro conditions commonly used in PCR. Likewise, a probe of the present invention, is a molecule, for example a nucleic acid molecule of sufficient length and sufficiently complementary to the nucleic acid molecule of interest, which selectively binds under high or low stringency conditions with the nucleic acid sequence of interest for detection in the presence of nucleic acid molecules having differing sequences.

[00160] Accordingly, a preferred embodiment of the invention thus includes the step of amplifying a BLG polynucleotide in the presence of at least one primer comprising a nucleotide sequence of or complementary to the BLG gene (as depicted in NM 173929.3 GL87196496 or in SEQ ID NO.75) or flanking sequence thereof, and/or in the presence of a such a primer comprising sequence corresponding to or flanking the allele-specific nucleotides described herein. PCR methods are well known by those skilled in the art (Mullis et al., 1994.) The template for amplification may be selected from genomic DNA, mRNA or first strand cDNA derived from a sample obtained from the bovine under test (Sambrook et al., 1989).

[00161] Primers suitable for use in PCR based methods of the invention should be sufficiently complementary to the BLG gene sequence, such as NM_173929.3 GL87196496 or flanking sequence thereof or such as the sequence of SEQ ID NO. 75, and of sufficient length to selectively hybridise to the corresponding portion of a nucleic acid molecule intended to be amplified and to prime synthesis thereof under in vitro conditions commonly used in PCR. In one example such primers comprise at least about 12 contiguous bases of or complementary to NM 173929.3 GI: 87196496, or naturally occurring flanking sequences thereof. In another example, such primers comprise at least about 12 contiguous bases of or complementary to the sequence of SEQ ID NO. 75. Examples of such PCR primers may be derived from the sequences presented herein as SEQ ID NOs: 1 to 74 or 76 to 78.

[00162] Suitable PCR primers may include a +78 A/G A allele-specific nucleotide, or a +78 A/G G allele-specific nucleotide, as described herein. Generation of a corresponding PCR product, or the lack of product, may constitute a test for the presence or absence of the specified nucleotides in the BLG gene of the test bovine. Analogous primers to test for the presence or absence of the variant nucleotide or nucleotides at one or more of the polymorphisms described herein in Table 5 are also specifically contemplated.

[00163] Other methods for determining whether a particular nucleotide sequence is present in a sample may include the step of restriction enzyme digestion of nucleotide sample. Separation and visualisation of the digested restriction fragments by methods well known in the art, may form a diagnostic test for the presence of a particular nucleotide sequence. The nucleotide sequence digested may be a PCR product amplified as described above.

[00164] Still other methods for determining whether a particular nucleotide sequence is present in a sample include a step of hybridisation of a probe to a sample nucleotide sequence. Thus, methods for detecting one or more of the allele-specific nucleotides described herein may comprise the additional steps of hybridisation of a probe derived from the BLG sequence of NM 173929.3 GL87196496, or the BLG sequence of SEQ ID NO. 75.

[00165] Such probes should comprise a nucleic acid molecule of sufficient length and sufficiently complementary to the BLG gene sequence, to selectively bind under high or low stringency conditions with the nucleic acid sequence of a sample to facilitate detection of the presence or absence of the allele-specific nucleotides described herein.

[00166] With respect to polynucleotide molecules greater than about 100 bases in length, typical stringent hybridization conditions are no more than 25 to 30° C (for example, 10° C) below the melting temperature (Tm) of the native duplex (see generally, Sambrook et al., 1989; Ausubel et al., 1987). Tm for polynucleotide molecules greater than about 100 bases can be calculated by the formula Tm = 81. 5 + 0. 41 % (G + C-log ( a+).

[00167] With respect to polynucleotide molecules having a length less than 100 bases, exemplary stringent hybridization conditions are 5 to 10° C below Tm. On average, the Tm of a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleotide length) ⁰ C.

[00168] Such a probe may be hybridised with genomic DNA, mRNA, or cDNA produced form mRNA, derived from a sample taken from a bovine under test.

[00169] In one example such probes comprise at least 12 contiguous nucleotides of or complementary to the sequences presented in NM_173929.3 GI:87196496, and may comprise sequence corresponding to the allele-specific nucleotides described herein.

[00170] In another example such probes comprise at least 12 contiguous nucleotides of or complementary to the sequences presented in SEQ ID NO. 75, and may comprise sequence corresponding to the allele-specific nucleotides described herein.

[00171] Such probes may additionally comprise means for detecting the presence of the probe when bound to sample nucleotide sequence. Methods for labelling probes such as radiolabelling are well known in the art (see for example, Sambrook et al., 1989).

[00172] In another aspect, the invention provides a method for determining the genetic status of bovine with respect to BLG content with reference to a sample of material containing mRNA obtained from the bovine. In one embodiment this method includes ascertaining whether a sequence of the mRNA encoding (X) a protein having biological activity or expression of a wild type BLG is present, and whether a sequence of the mRNA encoding (Y) a protein at least partially lacking the activity or expression of (X) is present, and may include determining the amount of mRNA. A reduction in or the absence of the mRNA encoding (X) and the presence of the mRNA encoding (Y) indicates an association with low relative BLG levels, particularly with the production of milk or colostrum with, inter alia, decreased BLG content.

[00173] Again, if an amplification method such as PCR is used in ascertaining whether a sequence of the mRNA encoding (X) is present, and whether a sequence of the mRNA encoding (Y) is present, the method includes amplifying the mRNA, for example in the presence of a pair of primers complementary to a nucleotide sequence encoding a protein having biological activity or expression of a wild type BLG, or in the presence of a pair of primers complementary to a nucleotide sequence encoding a variant BLG protein or comprising a variant BLG gene. It will be appreciated that in embodiments of the invention reliant on assessing the amount of BLG mRNA present in a sample, quantitative amplification methods well known in the art may be employed, for example quantitative RT-PCR, microarray analysis, and other methods described herein.

[00174] Other methods to quantitate or otherwise assess the amount of nucleic acid, particularly the amount of mRNA are well known in the art. These include Northern analysis using probes able to hybridise to the target BLG mRNA. Such probes should comprise a nucleic acid molecule of sufficient length and sufficiently complementary to the BLG coding sequence to selectively bind under high or low stringency conditions with the nucleic acid sequence of a sample to facilitate detection and assessment of the amount of BLG mRNA present. As is evident to the person skilled in the art, such quantitative methods generally utilise an internal control, for example in the case of Northern analysis quantitation may be done with reference to, for example, rRNA present in the sample.

[00175] In a further aspect, the invention provides a method of determining genetic status of a bovine with respect to milk or colostrum BLG content which comprises determining the BLG allelic profile of said bovine, together with determining the allelic profile of said bovine at one or more genetic loci associated with milk or colostrum BLG content.

[00176] In one embodiment, said genetic loci is a polymorphism in a gene associated with milk or colostrum BLG content, preferably a polymorphism in a gene involved in BLG production or secretion.

[00177] Exemplary methods of the invention are reliant on genetic information such as that derived from methods suitable to the detection and identification of polymorphisms, particularly single nucleotide polymorphisms (SNPs) associated with the qualitative trait for which an assessment is desired. For the sake of convenience the following discussion refers particularly to SNPs, yet the art-skilled worker will appreciate that the methods discussed are amenable to the detection and identification of other genetic polymorphisms, such as triplet repeats or microsatellites. A SNP is a single base change or point mutation resulting in genetic variation between individuals that can occur in both coding or non-coding regions.

[00178] A number of databases have been constructed of known SNPs, and for some such SNPs, the biological effect associated with a SNP. For example, the NCBI SNP database "dbSNP" is incorporated into NCBI's Entrez system and has records for over 17 million refSNPs mapped onto the human genome sequence. Similar databases exist for other mammalian genomes.

[00179] Genotyping approaches to detect SNPs well-known in the art include DNA sequencing, methods that require allele specific hybridization of primers or probes, allele specific incorporation of nucleotides to primers bound close to or adjacent to the polymorphisms (often referred to as "single base extension", or "minisequencing"), allele-specific ligation (joining) of oligonucleotides (ligation chain reaction or ligation padlock probes), allele-specific cleavage of oligonucleotides or PCR products by restriction enzymes (restriction fragment length polymorphisms analysis or RFLP) or chemical or other agents, resolution of allele-dependent differences in electrophoretic or chromatographic mobilities, by structure specific enzymes including invasive structure specific enzymes, or mass spectrometry. Analysis of amino acid variation is also possible where the SNP lies in a coding region and results in an amino acid change.

[00180] DNA sequencing allows the direct determination and identification of SNPs. Mini- sequencing involves allowing a primer to hybridize to the DNA sequence adjacent to the SNP site on the test sample under investigation.

[00181] A number of sequencing methods and platforms are particularly suited to large-scale implementation, and are amenable to use in the methods of the invention. These include pyrosequencing methods, such as that utilised in the GS FLX pyrosequencing platform available from 454 Life Sciences (Branford, CT) which can generate 100 million nucleotide data in a 7.5 hour run with a single machine, and solid-state sequencing methods, such as that utilised in the SOLiD sequencing platform (Applied Biosystems, Foster City, CA).

[00182] A number of methods currently used for SNP detection involve site-specific and/or allele-specific hybridisation. These methods are largely reliant on the discriminatory binding of oligonucleotides to target sequences containing the SNP of interest. The techniques of Illumina (San Diego, CA), Affymetrix (Santa Clara, CA.) and Nanogen Inc. (San Diego, Calif.) are particularly well-known, and utilize the fact that DNA duplexes containing single base mismatches are much less stable than duplexes that are perfectly base-paired. The presence of a matched duplex is usually detected by fluorescence. A number of whole-genome genotyping products and solutions amenable or adaptable for use in the present invention are now available, including those available from the above companies.

[00183] The majority of methods to detect or identify SNPs by site-specific hybridisation require target amplification by methods such as PCR to increase sensitivity and specificity (see, for example U.S. Pat. No. 5,679,524, PCT publication WO 98/59066, PCT publication WO 95/12607). US Patent Application Publication No. US 20050059030 (incorporated herein by reference in its entirety) describes a method for detecting a SNP in total human DNA without prior amplification or complexity reduction to selectively enrich for the target sequence, and without the aid of any enzymatic reaction. The method utilises a single-step hybridization involving a hybridization of a first portion of the target sequence to a capture probe, and hybridization of a second portion of said target sequence to a detection probe.

[00184] US Patent Application Publication No. US 20050042608 (incorporated herein by reference in its entirety) describes a modification of the method of electrochemical detection of nucleic acid hybridization of Thorp et al. (U.S. Pat. No. 5,871 ,918). Briefly, capture probes containing different SNP bases and a sequence of probe bases on each side of the SNP base are immobilized on a different electrode. The extent of hybridization between each capture probe and the nucleic acid target is detected by detecting the oxidation-reduction reaction at each electrode, utilizing a transition metal complex.

[00185] The technique of Lynx Therapeutics (Hayward, Calif.) using MEGATYPE™ technology can genotype very large numbers of SNPs simultaneously from small or large pools of genomic material. Two populations are compared using fluorescently labelled probes, enabling detection and recovery of SNPs that distinguish the two populations.

[00186] Other methods for detecting and identifying SNPs include mass spectrometry. A preferred example is the use of mass spectrometric determination of a nucleic acid sequence which comprises the polymorphisms of the invention (whether the coding sequence or a complementary sequence). Such mass spectrometric methods are known to those skilled in the art, and the genotyping methods of the invention are amenable to adaptation for the mass spectrometric detection of the polymorphisms of the invention.

[00187] SNPs can also be determined by ligation-bit analysis. A further discussion of these methods can be found in U.S. Pat. Nos. 5,919,626; 5,945,283; 5,242,794; and 5,952, 174.

[00188] A large number of methods reliant on the conformational variability of nucleic acids have been developed to detect SNPs. For example, Single Strand Conformational Polymorphism (SSCP, Orita et al., PNAS 1989 86:2766-2770), and various modifications of SSCP as are well known in the art. These include the use of differing gel running conditions, such as for example differing temperature, or the addition of additives, and different gel matrices, RNA-SSCP, restriction endonuclease fingerprinting-SSCP, dideoxy fingerprinting (a hybrid between dideoxy sequencing and SSCP), bi-directional dideoxy fingerprinting (in which the dideoxy termination reaction is performed simultaneously with two opposing primers), and Fluorescent PCR-SSCP (in which PCR products are internally labelled with multiple fluorescent dyes, may be digested with restriction enzymes, followed by SSCP, and analysed on an automated DNA sequencer able to detect the fluorescent dyes).

[00189] Other methods which utilise the varying mobility of different nucleic acid structures include Denaturing Gradient Gel Electrophoresis (DGGE), Temperature Gradient Gel Electrophoresis (TGGE), Heteroduplex Analysis (HET), and capillary electrophoresis. Denaturing High Pressure Liquid Chromatography (HPLC) is yet a further method utilised to detect SNPs, using HPLC methods to detect, for example, homoduplexes and heteroduplexes which elute from the HPLC column at different rates, thereby enabling detection of mismatch nucleotides and thus SNPs.

[00190] Yet further methods to detect SNPs rely on the differing susceptibility of single stranded and double stranded nucleic acids to cleavage by various agents, including chemical cleavage agents and nucleolytic enzymes. Further examples include the Protein Translation Test (PTT), used to resolve stop codons generated by variations which lead to a premature termination of translation and to protein products of reduced size, and the use of mismatch binding proteins. US Patent 6,821 ,733 (incorporated herein in its entirety) describes methods to detect differences in the sequence of two nucleic acid molecules.

[00191] Protein- and proteomics-based approaches are also suitable for polymorphism detection and analysis. These approaches typically require separation of the various proteins within a sample, by, for example, gel electrophoresis or HPLC, and identification of said proteins or peptides derived therefrom, for example by NMR or protein sequencing such as chemical sequencing or more prevalently mass spectrometry. Proteomic methodologies are well known in the art, and have great potential for automation. For example, integrated systems, such as the ProteomlQ™ system from Proteome Systems, provide high throughput platforms for proteome analysis combining sample preparation, protein separation, image acquisition and analysis, protein processing, mass spectrometry and bioinformatics technologies.

[00192] The majority of proteomic methods of protein identification utilise mass spectrometry, including ion trap mass spectrometry, liquid chromatography (LC) and LC/MSn mass spectrometry, gas chromatography (GC) mass spectroscopy, Fourier transform-ion cyclotron resonance-mass spectrometer (FT-MS), MALDI-TOF mass spectrometry, and ESI mass spectrometry, and their derivatives. Mass spectrometric methods are also useful in the determination of post-translational modification of proteins, such as phosphorylation or glycosylation, and thus have utility in determining polymorphisms that result in or are associated with variation in post-translational modifications of proteins. [00193] Associated technologies are also well known, and include, for example, protein processing devices such as the "Chemical Inkjet Printer" comprising piezoelectric printing technology that allows in situ enzymatic or chemical digestion of protein samples electroblotted from 2-D PAGE gels to membranes by jetting the enzyme or chemical directly onto the selected protein spots. After in-situ digestion and incubation of the proteins, the membrane can be placed directly into the mass spectrometer for peptide analysis.

[00194] Suitable polypeptide-based analyses include those able to discriminate between full- length and truncated protein products, and may include but are not limited to, the following: Native polyacrylamide gel electrophoresis (PAGE), isoelectric focussing, 2D PAGE, or Western blotting with specific antibodies. Mass spectroscopy, immunoprecipitation, and peptide fingerprinting are also suitable.

[00195] Those skilled in the art will know that a particular SNP, particularly when it occurs in a regulatory region of a gene such as a promoter, can be associated with altered expression of a gene. Altered expression of a gene can also result when the SNP is located in the coding region of a protein-encoding gene. Such altered expression can be determined by methods well known in the art, such as quantitative PCR, RT-PCR, quantative Northern analysis, and can thereby be employed to detect such SNPs. Similarly, where a SNP occurs in the coding region of a gene and results in a non-synonomous amino acid substitution, such substitution can result in a change in the function of the gene product. Similarly, in cases where the gene product is an RNA, such SNPs can result in a change of function in the RNA gene product. Any such change in function, for example as assessed in an activity or functionality assay, can be employed to detect such SNPs.

[00196] The above methods of detecting and identifying SNPs are amenable to use in the methods of the invention.

EXAMPLE ONE

[00197] This example describes the analysis of a polymorphism associated with the production of bovine milk with low BLG content.

Methods

1. Milk sampling

[00198] Milk samples were taken from commercial herds by the herd test procedure provided to dairy farmers by LIC Ltd., (Newstead, Hamilton, NZ). 1ml sub-samples of the herd test sample were removed from beneath the fat layer that formed after overnight storage at 4°C. Samples were accumulated in 96-well plates and frozen at -20°C until analysis. [00199] Samples were collected over the period October to December, corresponding to mid- lactation for spring-calving dairy herds in New Zealand. Repeat samples, where required, were taken in January to March.

[00200] 10800 samples were collected during the 2010-201 1 season from approximately 40 individual herds. A further set of about 570 milk samples were taken from the daughters of a single bull (bull 99) in mid-lactation.

1. Animal sampling

Blood sampling

[00201] Where required, cows of interest were blood sampled via the tail vein and blood stored at -20°C until DNA was extracted using a phenol-chloroform method.

Tissue sampling

[00202] Mammary gland samples were taken by needle biopsy, snap frozen in liquid nitrogen and stored at -86°C. RNA was extracted using RNeasy columns (Qiagen) and DNase treated (Ambion). For the daughters of sire 99, genomic DNA was extracted from an ear punch sample using Qiagen BioSprint 96 DNA extraction kits. For sire 99, genomic DNA was extracted from frozen semen.

2. Determination of milk BLG concentration

Sample preparation

[00203] Whey was prepared from skim milk by the addition of acetic acid to a final concentration of 1 %, followed by centrifugation for 5 min at 1,000 x g. Whey samples were diluted 800-fold with 30% methanol/0.1% acetic acid/69.9% H ₂ 0 prior to analysis by mass spectrometry.

Analysis of BLG in whey by mass spectrometry

[00204] Diluted whey samples were analysed by flow-injection analysis/mass spectrometry using an Agilent Technologies (Palo Alto, CA, USA) 1 100 series liquid chromatograph coupled to an Agilent Technologies 6310 ion trap mass spectrometer with an electrospray ionisation interface. Whey samples of 30 μΐ were injected into a stream of 30% methanol/0.1% acetic acid/69.9% H ₂ 0 and were delivered to the mass spectrometer at 100 μΐ/min. The mass spectrometer was operated in positive ion mode and mass spectra were collected between 1400 m z and 1 00 m/z. The level of BLG protein isoform A was calculated by summing the signals at 1413.4 m/z, 1531.1 m/z, 1670.2 m/z and 1837.1 m z corresponding to [M+13FTJ 13+, [M+12H] 12+, [M+1 1FTJ 1 1+ and [M+10FTJ 10+, respectively, and the level of BLG protein isoform B was calculated by summing the signals at 1406.8 m z, 1523.9 m/z, 1662.4 m/z and 1828.5 m/z corresponding to [M+13H] 13+, [M+12H] 12+, [M+1 1H] 1 1+ and [M+10H] 10+, respectively.

[00205] The data were calibrated by BLG standards for the protein isoform A and protein isoform B variants and results expressed as arbitrary units (arb. units per litre). For guidance, it was estimated that 140 arb. units (the average found for homozygous BB variant milk) was equivalent to 3.5 g/1 of BLG, this being the mean concentration of BLG protein isoform B determined quantitatively in NZ milks from homozygous BB variants.

3. 454 sequencing

[00206] Genomic DNA sequence of the region surrounding and including the BLG gene (see Fig 1) was obtained for 1 1 animals. Ten of these animals were cows, with two having normal BLG concentrations in milk, while four animals had intermediate BLG concentrations and four had low BLG concentrations in milk. The eleventh animal was a bull, sire 99, who had sired a disproportionately large number of the cows in the low BLG phenotype group. DNA sequencing was conducted using the Roche 454 sequencing platform, as described below.

Primer design:

[00207] Primers were designed with the NCBI primer-blast design tool (Rozen & Skaletsky, 2000, Whitehead Institute for Biomedical Research). Primer length was set to a minimum of 24bp and an optimum of 27-28bp, with a maximum length of 32bp. A minimum 2-3bp GC- clamp at the 3 ' end of each primer was used where ever possible, to increase binding of primer to DNA template. The amplicon length was between 2783bp and 7482bp. Table 1 below presents the primer designations and predicted amplicon sizes. Specificity was checked against 'Bos Taurus (taxid: 9913)' and the database used was 'Genome (reference assembly from selected organisms)' .

Table 1. Primer design for 454 Sequencing.

OB-8 5701bp TGACCCAAGTTTTGA 15 AACATCCTGTTCGAGG 16

ATCCGTTGATGGC TTCAAGTGGTCC

OB-9 5200bp CAGTCACTTAGAGCC 17 CAAGACCCCCTACCCC 18

AGCCTGAGAGGG ATGTGTGTGCC

PA-A 7482bp AAACGGAGGTGTGTC 19 AAGGAGAGGGGAAGT 20

TACTGGAAACAGC TGTGCTAACAAGG

PA-B 6481 bp AGAAAGTTCTGGGAG 21 GTTTCCAGTAGACACA 22

ATGGATGTGGTGG CCTCCGTTTGCG

PA-1 5190bp TAAAGGTGTAAGCCT 23 AGAAATGTGGTTGTGA 24

GTGCTCTCCCTTC ATCAGCTCTGCG

PA-1A 3628bp AATGTCAGAGCTTCC 25 GTAGCCCACTCCTGTC 26

AAGCACAAGAAGC TTTGAAAAACCC

PA-2 6232bp TATTCTTAGCAGCAC 27 AGAGAGACGGAAATA 28

TCAAGACGTTCCG AAGCACCTCTGGC

PA-3 4604bp TGATTTCTTGCTTCTG 29 TAGGACAAACAAGTGA 30

CACTTACAGGCC ATGAGCGAGGGC

PA-4 6004bp GACACCCGAGCTCTC 31 CACTTGTCCCTCTGGTT 32

TTTGCTGAGG CTGATCTCTGG

PA-5 4871bp GGACTCAGAGCCTCT 33 AGTTGTCGTTCCTGTTT 34

TAACCGTTACAGG CAGCTTTGTCG

PA-6 5329bp GCTTCTCCTACATTGG 35 GGTGAGTTCATCTGTG 36

CAGGAAGACTCC GGGTAGATTCCC

PA-7 6003bp TCCAAAATAAAGTGT 37 TGGCTAGAGCCAAAGT 38

GGCACAGGCTTGG CTCCATGTTAGC

PA-8 5605bp CAGTCTGCCCCCAGA 39 GGGGAGGAGCC TAGT A 40

GTTAACCTTTTCC ACATTTTCTGGG

PA-9 4704bp TGCTTCGTGGGTTAA 41 TGTCAGTGGACATTTG 42

AAGTTGACTGTCC GGTTCCTTGTGG

PA- 10 5902bp TTAATAGAAGCACAT 43 GTGTGC TGGTTTTAC A 44

CTGCTCAGGGTCC CCCAGATAACCG

PA- 7292bp GAGTC AAAGGC C AC A 45 CCATCCCGTTAGAAGT 46 10A AGGAACCCAAATG GGTGGACGTAAG

PA- 4143bp GAGTTAC CGTAGGAC 47 CATTCATGTCAAGAGT 48 10B TCGCAATCTTCGA GCCCAACTTGCT

PA-1 1 2783bp GTCTCAACCACCAGG 49 CAGCACAATCTCCCAT 50

GCCTGTAAGAG CTCTCAAGGTGA

PA- 12 4135bp GCATCAACTGCACAA 51 CCCTGGACAAGGATGA 52

AAGCTACACAAGC GATTTGGGGTAG

PA- 4380bp AGAAGGGAACGAGA 53 CTGGACAAGGATGAGA 54 12A ACTCAGATGCAGAC TTTGGGGTAGGG

PA- 13 4982bp CTACGAGGGAAGCAA 55 TCCCAGACTTGACATC 56

GGAGTGGGTAAAG AGATCCACACAC

PA- 14 4053bp CTCTCCATGCTCCTGG 57 CAGTTCAGTCACGAGA 58

TTCATTCACTGA CCCTCTGAGAAG

PCR amplification:

[00208] PCR amplification was conducted using the Roche Expand LR dNTPack kit for PCRs, with the following cycling conditions: 94°C for 2 minutes, 94°C for 10 seconds then 68°C for 15 seconds (10 cycles), 94°C for 10 seconds then 68°C for 15 seconds with an additional 20 seconds per cycle (20 cycles), 7 minutes at 68°C. The amount of starting DNA, annealing temperature and quantity of DMSO was determined for each PCR reaction. The extension time for each PCR reaction was roughly set at 1 minute per Kb of amplicon.

PCR clean-up:

[00209] PCR products were purified using the QIAquick 96 PCR purification kit before quantification, as per manufacturer's instructions (Qiagen, 2003, QIAquick® Multiwell PCR Purification Handbook, pp 20-22).

DNA quantification:

[00210] A picogreen based assay called Quant-iT Picogreen dsDNA kit was used for accurate quantification of each amplicon. Picogreen was added to the DNA as a fluorescent stain. Lambda DNA standards of varying concentrations (0, 0.1, 0.2, 0.5, 0.75, 1 , 2, 5ng/uL) were made and a standard curve constructed. The reactions were then done in the light cycler following the protocol in the handbook that came with the kit (Invitrogen, 2008, Quant-iT™ Picogreen® dsDNA Reagent and Kits). Each sample was measured in triplicate.

DNA Pooling:

[00211] DNA from individual animals was pooled together for sequencing Equimolar amounts of each amplicon for each animal were added.

454 sequence mapping & SNP discovery

[00212] Sequence mapping was done using the Roche GS Reference Mapper software. Each reaction (.sff file) was mapped individually to the reference sequence 'BLG_regionl ' (made up from two different assemblies Btau_4.2 & UMD 3.1 on NCBI). Roche software gave a list of 'high-confidence differences' - which were SNPs represented by a frequency of at least 0.1, at least 3 non-duplicate reads with both forward and reverse reads showing the difference (unless there are at least 5 reads with q scores over 20), and if the difference is a single-base insertion or deletion at that location then the overall consensus must differ from the reference.

[00213] All SNPs in coding regions of BLG (BLG - ID: 280838), LCN9 (ID: 788658) and OBP2B (ID: 618559) were recorded, as well as non-coding SNPs in the 5' region of the BLG gene (5' region was defined as everything up to 2kb upstream from the start codon on exon 1). Sanger sequencing confirmation:

[00214] The same LR protocol and primers PA3 & PA4 (see Table 1) were used to amplify the region containing the first 5 exons of BLG in two PCR reactions. Sequencing primers, as shown in Table 2 below, were then used to sequence desired exons needed for confirmation. Sequencing was done with the same DNA samples that were used for the 454 sequencing. Further confirmation was also done from fresh extractions for 7 of the animals.

Table 2. Primer sequence design for Sanger sequencing Primer Forward SEQ Reverse SEQ pair ID ID

NO. NO. lgbLAl CTGCAGAGATCCCTTTACC 59 CTAGCTGACTGATGGGAAT 60 lgbLA2 GAGTGCAGCTCAAGGTCC 61 GGT AC C AGGAAAC TC C AAG 62 lgbLA3 CATCCTGATGAAAATGGTCC 63 AGTGTCTTCATCACCACCAG 64 lgbLA4 CTGGAACTCACTTTCCTCC 65 CCCTCTCCTGGCGGGACTCGGG 66 lgbLA5 AGGAAGGGGAGGGAACTG 67 CGTCAGGATGGGACTGGAC 68

4. BLG gene expression

[00215] 500ng of total RNA was transcribed to make cDNA with Superscript III First Strand Synthesis Supermix (Invitrogen).

[00216] BLG expression was measured by quantitative PCR on the cDNA transcripts. PCR reactions were set up using cDNA template, 2x Lightcycler 480 Probes Master Mastermix (Roche) with Primer 1 and Primer 2. The fluorescent probe used to detect amplification was Universal Probe Library (UPL) probe #10 (UPL probe #10, Catalogue #04685091001, Roche). Thermal cycling conditions were as follows: Pre-Incubation 95°C for 10 minutes followed by 45 cycles of 95°C 10 seconds, 60°C 30 seconds and 72°C 1 second. Thermal cycling and fluorescence detection was performed on a LightCycler 480 instrument (Roche).

[00217] BLG gene expression was normalized against reference genes GAPDH (NCBI Gene ID: 281 181, GAPDH - Primer 1 , GAPDH - Primer 2, UPL probe #9 (Catalogue #04685075001 , Roche)) and EiF3 (NCBI Gene ID: 515326 EiF3K - Primer 1, EiF3K - Primer 2, UPL probe #1 (Catalogue #04684974001 , Roche)).

BLG - Primer 1 : GCATGGAGAACAGTGCTGAG [SEQ ID NO. 69]

BLG - Primer 2: GAGGGCTTTGTCGAATTTCTC [SEQ ID NO. 70]

GAPDH - Primer 1 : GAAGCTCGTCATCAATGGAAA [SEQ ID NO. 71 ]

GAPDH - Primer 2: ATCCTGCCAACATCAAGTGG [SEQ ID NO. 72]

EiF3K - Primer 1 : AAGTTGCTCAAGGGGATCG [SEQ ID NO. 73]

EiF3K - Primer 2: TTGGCCTGTGTCTCCACATA [SEQ ID NO. 74]

5. Genotyping daughters of sire 99

[00218] 73 daughters of sire 99 were sampled by ear punch and the DNA extracted for genotyping using Qiagen BioSprint 96 DNA extraction kits. The BLG +78 SNP was genotyped by the Australian Genome Research Facility (AGRF) (Queensland, Australia). The AGRF custom SNP genotyping service utilized the single base extend method(SBE - Iplex GOLD chemistry), analysed on the Sequenom Compact Mass spectrometer. SNP assays were designed by AGRF, PCR oligos were obtained and then processed in multiplex format, following PCR, on a mass spectrometer.

RESULTS 1. Identification of a low BLG allele.

[00219] The BLG concentration in the milk samples collected in the 2010-201 1 season was analysed by mass spectrometry and allowed the identification of 3 groups of milks, the first containing exclusively BLG protein isoform A, the second containing exclusively BLG protein isoform B, and the third containing both BLG protein isoform A and BLG protein isoform B.

[00220] Among this third group there was observed milk containing BLG protein isoform B at a lower concentration, with the daughters of one bull, sire 99, being particularly well represented in this subset.

[00221] Sire 99 was determined by genotyping to be homozygous for the gene encoding the protein isoform B of BLG. Milk samples were collected from >500 daughters of sire 99 and analysed by mass spectrometry for allelic concentrations of BLG. Data for the AB heterozygote daughters (i.e., those daughters producing both protein isoform A of BLG and protein isoform B of BLG) of sire 99 (N=234) are shown in Fig 2a. The frequency distributions of protein isoform B concentration in this cohort shows two distinct ranges of concentrations, the first range with a mean arbitrary concentration of 56 units per litre, and the second range with a mean arbitrary concentration of 28 units per litre. The separation of these two ranges of concentrations was further improved when the results were expressed as a ratio of [protein isoform B]/[protein isoform A] (B/A; Fig 2b).

2. Identification of single nucleotide polymorphism associated with low milk BLG

[00222] To determine associations among single nucleotide polymorphisms with low milk BLG concentration, DNA sequence across the genomic region containing the BLG gene was obtained for sire 99. Sequencing was conducted using 454 sequencing chemistry, as described in the methods.

[00223] The genomic region that was first sequenced is shown in Figure 1. A region of 1 14 Kb was sequenced, which covered four genes, including BLG. Average coverage obtained for the entire region was 220.6.

[00224] Sequence analysis was focused on the identification of SNPs in sire 99 and thus in its lineage. This sequencing identified approximately 3000 polymorphism across this region. Identification of potential SNPs that could be associated with the low BLG production phenotype was focused within the BLG gene region. Surprisingly, a single polymorphism, +78 A/G in the BLG gene was identified that was present in the four animals with the low BLG phenotype and in the four animals with an intermediate BLG phenotype, and absent in the two animals with a normal BLG phenotype. Further, this SNP was heterozygous in the sire of interest, sire 99, consistent with the BLG production phenotypes of his daughters. This low BLG production variant is referred to herein as the B' variant.

[00225] The B' variant, that is, the A allele at the +78 A/G polymorphism, was associated with BLG expression in milk. The effect of BLG +78 genotypes on the concentration of BLG protein isoform B in heterozygote AB daughters of sire 99 is shown below in Table 3. The average concentration of protein isoform B in milks of cows homozygous for the G allele at the +78 A G polymorphism was 48 arbitrary units, while for cows heterozygous at the +78 A/G polymorphism, and thus carrying the B' variant, the concentration was 28 arbitrary units.

Table 3. Effect of +78 A/G genotype on mean concentration of BLG protein isoform B in milk of AB heterozygote daughters of sire 99

[00226] A small number of BB phenotype cows were genotyped at the +78 A G polymorphism in the BLG gene. Table 4 below shows the concentration of BLG in the 3 genotypic classes for the BLG +78 A/G polymorphism in BLG B|B homozygous milks. As can be seen, cows with the AA genotype at the +78 A/G polymorphism (i.e., homozygous B'|B' cows) had less than half the BLG concentration of those with the GG genotype at the +78 A/G polymorphism. Heterozygous cows (i.e., with the AG genotype at the +78 A/G polymorphism) were intermediate.

Table 4. Total BLG concentration in daughters of sire 99 relative to genotype at position +78. The +78 A allele identifies the low concentration B variant, B'

Expression analysis

[00227] Expression analysis for BLG mRNA was undertaken on mammary tissue from 8 cows, including 3 animals that were homozygous for the B' variant (i.e., the AA genotype at the BLG +78 A/G polymorphism). All of these animals showed considerably lower concentrations of BLG mRNA than heterozygous AB' and AB cows and a single AA protein isoform cow (Figure 3).

Additional sequencing [00228] Subsequent additional sequencing in putative relations of sire 99 across a larger region of bovine chromosome 11 was performed. This generated a list of polymorphisms identified in two bovine sharing a common ancestor with sire 99, a subset of which is shown below in Table 5, together with their position relative to a reference bovine sequence AC 000168.1 GI: 258513356 comprising the bovine BLG gene. Nucleotide position 1 in SEQ ID NO. 75 corresponds to position 103242649 in the reference bovine sequence AC 000168.1 GI: 258513356. The +78 G/A polymorphism described herein is depicted below at position 103301781, corresponding to position 54022 in SEQ ID NO. 75.

Table 5. Identity and position of polymorphisms in bovine 27 and 586

Start Start

Reference Variation Reference Variation position in position in

Base Base Base Base ref ref

70082740 G GTG * 70090464 A G *

70225726 TG CA 70225729 C A

70259004 GT AC 70259007 A G

70259014 T A 70326971 G A *

70359593 G A * 70502765 G A *

70605188 C T * 70721560 A C *

70723339 G A * 70724491 A G *

70728946 T A * 70729535 A G *

70730887 c T * 70733586 C T *

70736326 c T * 70736890 T G *

70742545 G A * 70746522 A T *

70752596 T C * 70761425 A T *

70762096 G A * 70771433 C T *

70776192 T A * 70778164 G A *

70778584 A G * 70788853 T G *

70792617 C T * 70793486 c T *

70794733 G T * 70796581 G A *

70801006 C T * 70810824 C T *

70827734 G c * 70833808 G A *

70840444 G GG * 70855429 A G *

70860431 A G * 70861709 A T *

70864962 G A * 70865695 C T *

70867055 T C * 70876649 T c *

70897808 G A * 70899913 T c *

70910237 G A * 70919185 G T

70925930 C T * 70952418 T c *

70963902 C T * 70966351 T TGCT *

70971878 A G * 70975495 T C *

70975590 T A * 70980519 c T *

70980573 A C * 70981166 T c *

70986095 T C * 70994180 G A *

70997794 c T 71000375 C T *

71011450 c T * 71014438 A T *

71025105 A G * 71033107 G A *

71033764 G C * 71033925 G A * 71033938 T c * 71036792 C G *

71036860 c T * 71037615 G A

71038944 τ A * 71041906 A C *

71042911 τ C * 71048675 C T *

71050591 c A * 71051140 C T *

71051989 c T * 71056622 A G *

71061154 G A * 71062763 G C *

71063250 G A * 71064330 T TCA *

71068294 G A * 71075446 c T *

71075839 C G * 71076924 T C *

71079237 T A * 71079752 c T

71079813 G T 71079877 G A *

71080018 G c * 71080320 T C *

71080365 C T * 71080755 c T *

71082370 T c * 71083063 c T *

71083478 c T * 71083698 A G *

71083877 G A * 71084183 T G *

71084529 C T * 71085490 A C *

71085632 C cc * 71085846 T C

71085916 G A 71086152 G T *

71086600 T C * 71086966 A G *

71087074 A G * 71087682 G A *

71087806 G A * 71087903 C T *

71088975 C A * 71089053 T c *

71090543 T C * 71091003 G T *

71095038 G A * 71101189 TTTAGAGGA TCAACGG *

71101228 TGTAAATAGT TCTCTGTCAAC 71101330 G A *

71101563 A G * 71101595 T C *

71101638 T C * 71101664 G A *

71101818 A G * 71102131 T C *

71102203 G A * 71102782 T C *

71104333 G T * 71115599 TGT T *

71116844 TAGG T * 71118867 C A *

71119314 C T * 71121289 C T *

71122650 G A * 71129299 G A *

71130515 T C * 71130725 G A *

71132094 c T * 71132653 A G *

71133016 c G * 71133307 T G *

71133383 G C * 71133474 c G *

71133723 C T * 71133756 T C *

71133923 T C * 71134070 T C *

71134085 GG G * 71134121 G A *

71134310 C T * 71134422 C T *

71134466 T c * 71134566 T c *

71134577 c T * 71134687 A T *

71134806 TT T * 71134816 A G *

71134937 c T * 71134974 G A *

71135044 TC AT * 71135080 T A *

71135145 c T * 71135295 GG CT *

71135321 c A * 71135596 C T *

71135675 A G * 71135879 A G * 71135891 T C * 71136012 A G *

71136029 G A * 71136108 C A *

71136141 T C * 71136182 G C *

71136388 A G * 71136568 A G *

71136757 G T * 71136766 C T *

71137317 C G * 71137387 C T *

71137458 A G * 71137561 TG CA *

71137767 A C * 71139743 G GG *

71139908 T G * 71140027 A G *

71140120 A C * 71140374 T C *

71140404 C T * 71140425 T C *

71140428 G A * 71140443 A G *

71140526 G A * 71140616 C T *

71140716 C T * 71140950 c A *

71140967 C T * 71141093 A G *

71141096 A G * 71141178 C G *

71141205 C G * 71141349 C T *

71141364 C T * 71141383 G A *

71141486 C T * 71141494 G A *

71141514 C T * 71141803 C T *

71142285 C T * 71142402 T C *

71142680 T c * 71142820 A G *

71142826 c T * 71142897 G A *

71142946 c T * 71143048 C T *

71143272 G c * 71143364 T c *

71143523 A T * 71143560 A G *

71144639 A G * 71144731 G A *

71145681 G A * 71146017 A G *

71146254 G A * 71148018 T C *

71148608 A G * 71149291 G A *

71149615 C A * 71149806 C T *

71149971 C A * 71150281 G C *

71151110 T c * 71151703 G T *

71157862 G A * 71159490 C A *

71175950 A T * 71539749 C G *

71546920 A G 71559264 C G *

71593696 A T * 71599620 T C *

71680182 T c * 71743378 G A *

71749606 T G * 71842631 TGGT T *

71882923 c T * 72032316 T c *

72036997 G A * 72083913 T c *

72131669 C T * 72144384 G A *

72176246 G A * 72177081 C T *

72180573 C T * 72187615 C T *

72196346 T A * 72220544 G A *

72222126 G c * 72228617 A c *

72258166 AGCATAGCA AAGTGACT 72258179 ATA A

72258187 GCATA GTAACTC 72259023 T G *

72268533 T G * 72292175 A G *

72358594 T TT * 72409004 C T *

72444391 G A * 72456334 C A * 72574588 C T * 72591534 G C *

72735461 G c * 72761721 G A *

73233483 T c * 73347793 T A *

73490801 A G * 73501858 c T *

73560643 C T * 73647919 CAA c *

73660824 G A * 74016409 C cc *

74076727 GAAG G * 74253773 C G

74941077 C A * 74980461 C T *

74996570 C G * 75326703 G c *

75354646 T C * 75470568 T c *

75746867 A C 75746873 T c

CATCTCATCC CTGTCATCC

75869987 A G 75912323

TCTG CCTT

75970876 C T * 76023986 GCA TGC

76048741 T c * 76050607 C A *

76055730 c A * 76059453 C T *

76062138 c G * 76132768 C A *

76177568 c A * 76184889 G A *

76273796 c T * 76273808 T C *

76277738 c T 76279004 G A *

76283933 T c * 76286126 C T *

76289586 c T * 76289618 G A *

76289793 G T * 76290064 C T *

76290094 C T * 76290169 A G *

76290327 G T * 76290356 G A *

76290474 C A * 76290663 C T *

76290822 C T * 76290853 A G *

76290899 T TT * 76291178 T TAAATT *

76291221 G A * 76291229 A G *

76291282 C A * 76293856 A G *

76295315 A G * 76296433 T C *

76298276 C G * 76300875 c G *

76302619 G C * 76304220 G A *

76306278 C A * 76306878 G A *

76316931 C G * 76341124 A G *

76367261 G A * 76381985 G T *

76382909 C A * 76389573 A G *

76392187 AAA A * 76403105 C T *

76403140 G A * 76414500 TG T *

76417194 C G * 76417782 TT CA *

76418636 G A * 76419902 G T *

76427613 C T * 76429117 TTAT T *

76671397 G T 76671403 GC AT

76804690 A T * 76816071 C T *

76821427 C T * 76821574 C T *

76821640 G A * 76824973 T c *

76827051 G A * 76828461 c G *

76835913 AG A * 76839021 T A *

76876524 C G * 77057365 G C *

77207608 G T * 77212379 G A *

77213302 T A * 77214364 A C * 77235336 C A * 77264734 A G *

77355829 T A 77355833 T A

77396994 T C * 77450144 c T *

77468781 T C 77480447 c T *

77498120 c T * 77525099 A AA *

77528868 c T * 77533783 C T *

77535665 T C * 77626547 C T *

77630905 c G * 77633146 G A *

77634040 G T * 77637267 T C *

77653816 T c * 77671583 A G *

77676254 c T * 77676983 G C *

77706263 T G * 77706635 C T *

77706819 G A * 77707129 G A *

77707872 G A * 77708545 T G *

77711891 T G * 77712119 c T *

77717301 c T * 77719036 T c *

77726358 A C * 77734925 c T *

77740632 TTT T * 77743240 G A *

77745444 G A * 77746791 C T *

77747093 G T * 77747187 T c *

77748220 G A * 77748225 G c *

77749942 C T * 77752184 G A *

77752387 C G * 77755000 C T *

77755378 T G * 77755971 C G *

GTACATGGCTTTA

77766084 GGACCTGGGCTA 77766962 C T *

CC

77766964 C A * 77783123 T c

77788466 A C * 77790835 c T *

77799925 C T * 77810299 T c *

77812236 C T * 77824578 G T *

77826091 A G * 77833608 G A *

77836576 G T * 77843417 C T *

77844485 C T * 77860544 GTAAAG G *

77870345 C T * 77916165 T A

78012138 G A * 78019970 T TT *

78088753 GAAG G * 78120114 A T

78254815 TCTGTCTGG TTTGGTCGGC 78304643 C G *

78311654 G A * 78358401 C G *

78363456 G C * 78380105 T C *

ATGTGCCTGGTGA ACGTGCCTGGTG

78380568 * 78380622 c G *

CTTCG ACTTCCA

78380765 A G * 78380769 A G *

78380776 G A * 78380801 G A *

78380826 A G * 78381298 A G *

CTTCCTCCCT CCTCCTCCC

78381321 TG CA * 78381432 *

C T

78381479 T G * 78381710 A c *

78381716 A G * 78381718 C T *

78381733 G A * 78381775 A G *

78381808 G A * 78382059 C T *

78382078 G A * 78382239 G A * 78382318 TTCCAACAGGCG TACAGGCT * 78382407 C T *

78382486 T C * 78382652 T c *

78382677 T A * 78382849 c A *

78382887 G C * 78383390 CCCATG CTCC *

78383607 T C * 78383622 C T *

78383798 G A * 78383908 C T *

78384022 A G * 78384028 A G *

78384045 T C * 78384076 C T *

78384184 G A * 78384417 A G *

78384420 T G * 78384620 G A *

78384733 G A * 78384791 T C *

78385076 A G * 78385230 T A *

78385321 GG G * 78385526 c T *

78385775 G A * 78385910 c T *

78386118 G T * 78386218 A G *

78386430 C T * 78386689 G C *

78386717 A G * 78386995 CA TG *

78387085 T G * 78387429 A G *

78387653 G A * 78388078 G T *

78388083 A G * 78389233 C A *

78389804 A C * 78390743 G A *

78390763 CACCCCCC CCACCCCCT * 78392027 G T *

78392706 AT CC * 78393868 C T *

78394526 G A * 78396860 A G *

78402150 G T * 78403115 G A *

78403638 C T * 78405296 C T *

78407163 G A * 78407198 G A *

78408816 C G * 78410020 G A *

78412358 C T * 78414497 C A *

78416745 G A * 78416755 A G *

78421398 G A * 78433609 TT T *

78438489 T C * 78438494 C A *

78438724 C T * 78441278 G A *

78448094 c T * 78453577 G A *

78453721 T c * 78462388 G C *

78464028 G A * 78475326 C G *

78500876 T C * 78508820 G C *

78509357 A T * 78511232 G A *

78522068 C T * 78527598 G A *

78531447 T c * 78535299 G A *

78624187 A G * 78661020 T TT *

78804501 A T * 78841353 A G *

78841357 G c * 78970308 C T *

78976682 C T * 78981656 C T *

78982747 A G * 78985900 G T *

78985964 A G * 78988971 C A *

78993273 G A * 78994581 G A *

78995799 T G * 78996485 T C *

78998173 T A * 79000732 c T *

79001319 A C * 79002226 c T

79002626 G A * 79002991 c T * 79003644 T C * 79004578 C A *

79004746 G A * 79005721 A G *

79005723 A T * 79006179 G A *

79006807 T G * 79007021 C T *

79007736 A C * 79009054 G A *

79012002 C T * 79014267 C G *

79014620 C T * 79015694 C T *

79015905 C T * 79018697 G A *

79019586 T c * 79019959 G A *

79021167 A G * 79023310 C T *

79024007 A G * 79024705 G A *

AGGTACCTA ACCATACTG

79024907 G A * 79025150

TA TAT

79026765 G A * 79027144 C T *

79028458 T C * 79028594 G A *

79028631 A G * 79030101 C T *

79030194 C T * 79030275 G T *

79032509 G A * 79033904 G T *

79038387 T G * 79041290 T G *

79043479 T A * 79045390 c T *

79045937 A G * 79051871 c A *

79053869 G A * 79057967 A G *

79058079 C T * 79071776 C T *

79087906 A G * 79088370 C G *

79088509 A G * 79088882 T TT *

79089063 T G * 79089117 C T *

79090116 c A * 79090632 A G *

79095375 G A * 79097021 G A *

79102144 T A * 79105810 T C *

79106166 T C * 79112206 G A *

79121145 G A * 79123127 T A *

79123752 A C * 79126424 c T *

79127200 C T * 79133989 TT T *

79134769 G A * 79135160 G c *

79140912 A G * 79141162 C T *

79144419 C T * 79147166 C T *

79147209 C T * 79149029 A G *

79149464 C T * 79150430 C T *

79152967 G A * 79155950 T c *

79158432 T G * 79159440 T c *

79163377 c A * 79166189 c T *

79167328 c T * 79171299 G A *

79172085 G A * 79173316 G C *

79174760 C A * 79175439 T C *

79175685 T G * 79176515 G A *

79178482 A G * 79185178 G A *

79186259 G A * 79187211 C A *

79189327 A G * 79196079 C A *

79202834 G A 79204137 T C *

79204147 C T * 79206546 A C *

79207452 C A * 79209206 A G * 79212637 C G * 79212860 AA A *

79213562 T C * 79213664 A G *

79213783 A G * 79214062 T C *

79214241 TT T * 79215009 T A *

79217123 A G * 79217644 c T *

79217650 C T * 79218182 T c *

79218240 G A * 79220046 c A *

79221053 A G * 79222891 T G *

79223032 A G * 79225106 c T *

79225385 T C * 79225889 G A *

79226182 A G * 79226921 A G *

79228108 G C * 79228294 C A *

79233462 G A 79242156 A AA *

79245015 G A * 79249907 T G *

79251983 C T * 79254165 G A

79255548 G A * 79263831 ACAGA A *

79298134 G A * 79342349 C T *

79620118 T C * 79675941 A G *

79689635 G C * 79742636 G A *

79989668 A G * 79996923 T G *

80053643 G T * 80073236 c T *

80188101 C G * 80389854 A G

80413744 C T * 80506628 G C

80506634 G A 80599792 C G *

80819807 G A 80819896 TG CA

80819908 A G 80867081 C A *

80943546 A G 81155346 G A *

81158712 G A * 81158992 T C *

81159041 A T * 81164495 G A *

81165252 C T * 81166055 A G *

81169427 C G * 81170662 C A *

81172027 C T * 81185927 T C *

81199519 G A * 81218555 G A *

81223969 A G * 81232354 C G *

81236661 T TT * 81246881 TTATT T *

81253019 c T * 81254800 A G *

81255618 G A * 81259549 C T *

81263799 C T * 81265116 A c *

81269116 TTG AAT * 81269120 T c *

81269122 T G * 81269124 AGC GTT *

81269842 c T * 81273696 G A *

81274508 T c * 81279900 T C *

81291161 TCTTT T * 81294923 G A *

81295369 c T * 81306198 T C *

81313239 A c 81315834 G T *

81322617 G A * 81324167 C T *

81326936 T C * 81329083 C T *

81331076 A G * 81332431 T c *

81332826 G A * 81335153 c T *

81337767 T G * 81339579 A G *

81339721 T C * 81343448 AACA A * 81344341 C T * 81345946 T G *

81346087 A AA * 81346237 c A *

81347537 G A * 81351631 T TTCACTTT *

81352228 C T * 81357322 T A *

81361160 T c * 81363495 c T *

81365150 c T * 81367084 GTG G *

81372675 A T * 81375081 C T *

81381452 G c * 81381884 T c *

81382158 T c * 81388296 T G *

81390536 T c * 81392543 G T *

81394720 A G * 81398544 G T *

81401377 T C * 81401552 T c *

81402134 T A * 81411134 A G *

81414382 G T * 81416801 C T *

81417262 G A * 81418489 T G *

81418560 C A 81418663 c T

81419373 G A * 81419704 G T *

81421241 A T * 81422206 C T *

81423000 T G * 81423511 G A *

81423607 A G * 81427420 C T *

81428154 G T * 81428399 C T *

81428524 T A * 81428545 A G *

81428549 T C * 81428580 A G *

81428619 A G * 81429164 G A *

81429231 A C * 81429328 T C *

81429387 G A * 81429570 c A *

81429619 G A * 81429722 G A

81429724 T G 81429820 A G

81429840 T G 81429846 T C

81430280 G T * 81430506 c T *

81430935 T c * 81431295 A G *

81432632 T c * 81433358 C G *

81433796 T G * 81434792 A G *

81435102 T C * 81435119 G A *

81436873 G T * 81438498 A G *

81438878 A G * 81443096 G C *

81443136 T C * 81447043 C T *

81447969 A G * 81452005 C A *

81453756 C T * 81456313 G A *

81458751 G A * 81460304 C G *

81460326 G C * 81461033 C T *

81461316 C G * 81461703 C T *

81462749 C T * 81462873 T c *

81469526 C T * 81473280 c T *

81473703 G A 81474998 A G *

81475296 C T * 81476077 A G *

81477191 C T * 81479077 T G *

81482236 G A * 81482947 c T *

81485978 C A * 81489325 A G *

81489609 C T * 81489698 G A *

81489844 G A * 81490925 G C * 81490944 A G * 81490974 G A *

81491098 A G * 81491274 A A AG A *

81491610 A G * 81491990 A G *

81492211 C A * 81492311 A G *

81493075 C T * 81493635 TT T *

81498933 G A * 81499830 C T *

81501758 T C * 81502394 T G *

81503717 A T * 81504396 GG G *

81509082 T c * 81509117 C T *

81509371 G A * 81509379 A T *

81509734 T C * 81510104 A G *

81510480 A G * 81510482 A C *

81510565 C T * 81510714 T A *

81510890 G c * 81511071 G A *

81511278 C T * 81511280 T C *

81511683 G A * 81511701 G A *

81512568 G A * 81513072 A G *

81514141 T A * 81514945 G A *

81516669 c T * 81520599 C G *

81527771 A T * 81530776 TCTC T *

81532150 C A 81564707 C T *

81582723 C T * 81587570 AC A *

81608120 A G * 81609201 G T *

81613501 A C * 81625186 T c *

81633471 A G * 81639003 G T *

81647840 A T * 81647842 G T *

81653113 T A * 81659826 G A *

81660381 T C * 81666478 A C *

81683881 G A * 81691917 C T *

81693928 A T * 81702907 C T *

81705273 G A * 81810828 T c *

81813834 C T * 81819944 G A *

81820700 T c * 81821393 C T *

81836695 c T * 81904017 G T

81904174 c T 81932511 T c *

82006855 T c * 82017341 G A *

82021104 G GG * 82101193 A T *

82108220 C T * 82108419 GGC G *

82110680 C T * 82111883 G A *

82113873 C A * 82236946 C G *

82253200 GCTG AAGT 82253205 TGC GCT

82253209 A C 82331186 G A *

82335032 A G * 82357929 C T *

82415327 C G * 82422198 G A *

82456510 G A * 82528834 A AA *

82535191 G GTG * 82572580 C T *

82575256 C A * 82578310 G A

82591059 G A * 82596959 C T *

82599013 C T * 82600913 A G *

82602329 G A * 82617438 A G *

82620208 C T * 82624674 C T * 82628852 C T * 82633734 G A *

82639015 C T * 82642382 A G *

82651174 C T * 82654470 C T *

82659498 T G * 82691449 A c *

82699704 G T * 82705136 C T *

82710811 A G * 82713505 G A *

82715872 G A * 82718735 G A *

82723449 C T * 82725354 A G *

82731892 C T * 82737448 C T *

82751949 A G * 82753007 G A *

82754628 G GG * 82783158 TT T *

82785599 C A * 82788548 G A *

82788671 A AA * 82789385 G A *

82795775 TGAGT T * 82815434 C T *

82820909 C G * 82846957 T c *

82846962 A G * 82907730 c T

82973496 A C 83090507 A c

83173092 C T * 83228327 C T

83350311 T c * 83356258 G A *

83393738 c T * 83470043 T C *

83517352 c T * 83547614 A G

83606512 A G * 83617801 T G *

83627219 A C * 83638510 c T *

83639511 A C * 83659041 T c *

83659126 C T * 83659970 A G *

83662537 A G * 83662603 G C *

83662627 T C * 83662682 C T *

83662725 G A * 83662897 TTCTT T *

83663592 C T * 83664424 C T *

83664614 G A * 83665120 C T *

83667324 A AA * 83669660 A G *

83670796 C T * 83670905 AG GC *

83672141 C T * 83672427 G C *

83672516 C T * 83672823 C A *

83672984 C T * 83673015 T C *

83673579 G A * 83674545 c T *

83674548 G C * 83674743 A G *

83675158 T C * 83675368 A C *

83675449 c T * 83675515 T C *

83675627 G A * 83675802 A AAAGTA *

83675863 C T * 83676069 C T *

83676182 A c * 83676274 T c *

83676286 T c * 83676343 G T *

83676380 G A * 83676578 T c *

83676583 T C * 83676615 G A *

83676617 A G * 83676740 TT T *

83676895 T C * 83676954 G A *

83676964 A G * 83676992 C T *

83677000 A G * 83677198 T c *

83677641 A G * 83677796 A G *

83680658 G T * 83684472 AA A * 83688601 T c * 83694005 G A *

83694415 A AAAGT * 83694584 G A *

83694745 T G * 83694778 T A *

83694794 c T * 83694962 G C *

83695139 c G * 83695172 C T *

83695220 T C * 83695267 C T *

83695269 G A * 83695284 G A *

83695295 A AGA * 83695343 G A *

83695356 G A * 83695370 G A *

83695480 A G * 83695485 A G *

83695504 A G * 83695723 A C *

83695743 C T * 83696293 G C *

83696442 C T * 83697050 T C *

83697835 G A * 83698010 T C *

83699133 C T * 83699263 A C *

83699296 G A * 83699431 C T *

83699574 G A * 83699581 C T *

83699609 C T * 83699708 G A *

83699836 A G * 83699903 T A *

83699949 A G * 83699964 T G *

83700001 T C * 83700040 GG G *

83700083 T C * 83700231 T C *

83700237 G A * 83700246 T C *

83700268 C T * 83700455 c G *

83700615 CC c * 83700699 T C *

GATCACCTG

83700786 A ATG 83700794 GGAA *

GAG

83701149 T C * 83701151 C G *

83701241 c T * 83701252 T G

83701256 GGAG AAGA 83701261 AG GT

83701276 GGCTTGT GCTGGC 83701381 G A *

83701400 A G * 83701526 T C *

83701581 A G * 83701605 A T *

83701623 G A * 83701789 G A *

83701807 G A * 83702099 G T *

83702228 GAAAC G * 83702251 ACAAA A *

83702309 T C * 83702491 T C *

83702581 A G * 83702826 c T *

83702913 A C * 83703152 A G *

83703330 A G * 83703388 A G *

83703418 T G * 83703433 AATA AT *

83703475 GAAGCA GGAAGCC * 83703521 C T *

83703662 C T * 83703710 G A *

83703871 C T * 83704190 A T *

83704386 CAA TGC * 83704489 A G *

83704551 T c * 83704584 C T *

83704623 G A * 83704760 A G *

1 1 1 1 CAGAAACCC I C I 1 1 1 CAGAAAC

83704863 * 83704897 A G *

TACA CCTACG

83704987 G A * 83705017 A G *

83705193 T C * 83705227 C T * 83705363 C T * 83705499 G A *

83706022 C T * 83706084 G C *

83706105 C G * 83706170 C T *

83706558 C T * 83706593 G A *

83706736 T c * 83706808 C T *

83706964 G A * 83707082 A G *

83707163 C T * 83707165 G C *

83707206 C T * 83707300 GG G *

83707426 C T * 83707500 G T *

83708350 A T * 83708538 T A *

83708583 A G * 83708660 G A *

83708671 A C * 83708689 C T *

83708722 TG CA * 83708771 C T *

83708795 G A * 83708840 C T *

83708847 A G * 83708940 C T *

83708969 C T * 83709043 T c *

83709077 G A * 83709080 G A *

83709093 G A * 83709196 T C *

83709218 A G * 83709258 c T *

83709272 C T * 83709332 T G *

83709555 G T * 83709580 T TTTT *

83709675 C G * 83709707 A AAAA *

83709807 ATACA A * 83709833 T C *

83709840 A T * 83709906 G C *

83710048 A G * 83710159 G A *

83710204 C T * 83710255 G A *

83710259 A c * 83710308 G C *

83710361 C T * 83710441 G A *

83710458 T G * 83710515 G T *

83710550 c T * 83710659 G A *

83710708 A G * 83710725 TACTTGT TGG *

83710849 C T * 83711160 G T *

83711374 G A * 83711544 A G *

83711558 G A * 83711595 T C *

83711601 C G * 83711636 c T *

83711730 G A * 83711785 A c *

83711787 G T * 83711933 C T *

83711982 A G * 83712056 G A *

83712058 A G * 83712184 A T *

83712216 A T * 83712305 A G *

83716458 C T * 83716471 C G *

83717384 T c * 83717467 T TT *

83737120 CGACTG c * 83737380 A T *

83738988 G A * 83740841 C T *

83753548 G T * 83776494 A G *

83784549 TTT T * 83800743 T C *

83842417 G A * 83842584 T C

83984129 C G 83987067 A C *

83987269 A G * 83990983 G A *

83996789 A C * 83999349 C T *

84002902 C T * 84013235 G A * 84016995 G A * 84019070 G A *

84020375 T C * 84023459 G A *

84023725 c A * 84025749 T C *

84026234 c A * 84028191 G A *

84031405 G A * 84035083 C T *

84035145 G A * 84036748 G T *

84051840 G A * 84056274 AA A *

84064091 G T * 84066064 A T *

84071646 A G * 84080568 A G *

84097119 C T * 84099489 T C *

84187898 G T * 84187901 T C *

84227157 G c * 84376306 c T *

84380960 T c * 84390867 c T

84468681 AA A * 84491324 A T *

84519727 T TTTC 84527641 A G *

84539077 G A * 84586784 A T *

84763003 T A * 84907621 C T

84921839 A G * 84943609 A G

85029850 G A * 85202125 C T *

85272747 T G 85312141 T G *

85479215 G T * 85488004 A G

85512057 G T 85512068 C G

85512073 T c 85538854 G A *

85573450 G A * 85601513 C T *

85601692 A C * 85601848 T c *

85608536 C T * 85621486 c A *

85624785 C T * 85628581 G A *

85628610 C T * 85632952 C A *

85633407 C A * 85661981 T C *

85674718 T c * 85695923 c T *

TGGACTGGTTGAT TTGACTGGGTTG

85732672 85748689 cc c *

CTCCT ATCTCCA

85793352 TACA TCC * 85944927 G A *

86004755 C T * 86069071 G A *

86130822 C T 86130828 G A

86130835 T c 86559249 G A *

86640847 c T * 86667458 G A *

86681316 A T * 86687047 G GG *

86742114 C T * 86744968 C T *

86745961 T c * 86746239 G A *

86747716 A G * 86753966 TCGT T *

86777765 C G * 86819055 T c *

87027899 C T 87045141 T c *

87216699 C G * 87292266 c T *

87293249 TT T * 87293341 c A *

87293429 C A * 87336771 G A *

87366009 G C * 87413027 G A *

87422276 C T * 87431751 G A *

87443620 C T * 87512858 GAG G *

87523239 G A * 87572508 G C *

87710411 A G * 87727820 C T * 87728685 C T * 87737104 G T *

87739423 G A * 87746740 C T *

87752004 G A * 87752851 G T *

87753456 G A * 87754117 T c *

87754142 C T * 87754238 T c *

87755140 G A * 87755224 G T *

87755276 T C * 87755331 G A *

87755524 c T * 87755608 C T *

87755767 G T * 87756012 TG cc *

87756105 G A * 87756180 C T *

87756420 A AA * 87756936 G T *

87757218 C T * 87757655 A G *

87757753 A T * 87758012 G A *

87758245 T c * 87761387 C T *

87766365 G A * 87768467 AA A *

87771137 A G * 87772920 T C *

87916252 T C * 87941630 G C *

87978266 c A * 88110550 C T *

88112480 G C * 88116610 G T *

88116757 G A * 88129120 G T *

88129527 T A * 88131840 C T *

88145056 G A * 88146461 C T *

88150453 C T * 88151555 C G *

88154692 C T * 88155022 C T *

88155905 G A * 88158468 G A *

88164242 G A * 88164953 G A *

88190010 C T * 88209524 C T *

89178416 A T 89312752 A c

89665823 G A * 89728185 G c *

89928830 ACA A * 89943706 G A *

89946281 C T * 90063417 C T *

90068151 A G * 90097295 A G

90133973 A T * 90139752 C T *

90268427 T c * 90288901 C T *

90393560 T A 90458334 A T *

90459674 G A * 90460069 T c *

90460436 T C * 90461301 G A *

90489159 c T * 90491541 C G *

90495548 c T * 90512491 A G *

90514389 c G * 90519687 G A *

90524399 G A * 90525198 G C *

90533530 C T * 90559953 T C *

90596684 T c * 90608128 c A *

90635576 c T * 90637790 A G *

90641376 G A * 90648854 G T *

90650852 C A * 90655520 C T *

90679447 A G * 90685138 A c *

90730378 T G 90761967 C A *

90782765 G A * 90790620 A G *

90792585 C T * 90795373 C T *

90799217 A G * 90799641 C T * 90804900 T G * 90822974 G A *

90864384 G A * 90866271 G A *

90895263 TT T * 90898875 A G *

90900687 G A * 90904299 G A *

90908355 G A * 90908411 G A *

90909295 A C * 90910648 C T *

90945750 A G * 90965115 T c *

90990563 T G * 90991002 G A *

90991018 c A * 90991109 T C *

91002578 T G * 91012070 G A *

91185504 G A * 91201746 G A *

91212664 C T * 91213846 C A *

91216157 G A * 91219027 C T *

91221056 G A * 91221793 G A *

91224278 G A * 91233843 G C *

91242616 G A * 91254044 T C *

91257085 G A * 91663170 c G * *

92003674 C A * 92010994 G A * *

92069105 T G ** 92175943 A G * *

92185398 A G 92194023 A T * *

92221028 AGA A ** 92334317 A G

92334487 T C 92357222 G T * *

92371712 T G 92371714 CTG AAC

92371719 G T 92400996 T C * *

92415292 C A ** 92419101 T G *

92437311 T A ** 92441956 c G * *

92444928 G A ** 92445374 G T * *

92446819 G A ** 92447398 G c * *

92448865 G A ** 92449452 T A * *

92458648 T C ** 92463209 T A * *

92465200 G A ** 92466684 A G * *

92473557 C T ** 92475974 C T * *

92479068 T c ** 92480749 G A * *

92485675 G A ** 92486097 T G

92486170 G A ** 92486453 c A * *

92488306 A G ** 92488365 G A * *

92489468 C T ** 92489910 T A * *

92490708 C T ** 92492916 T C * *

92494093 A G ** 92494799 G A * *

92517981 G A ** 92518540 G A * *

92518755 A C ** 92530386 T C * *

92534171 C T ** 92536779 G A * *

92547791 C T ** 92549731 G T * *

92552174 C T ** 92560074 A G * *

92560222 C T ** 92569727 C A * *

92571111 C T ** 92573458 G A * *

92575509 C A ** 92642371 C A * *

92649523 C T ** 92656081 C T * *

92785101 C T ** 93409703 A T * *

93438221 G A 93438614 G A

93512821 T c 93534284 T G 93556015 C T 93556183 A G *

93574784 G A 93575742 C A

93575896 A G 93576047 C T

93579338 A G ** 93579366 C T **

93588998 G A 93622516 A T *

93622519 T G * 93734667 C A *

93734670 c T * 93734677 G A *

93735014 A G 93735928 C G **

93802598 G A ** 93805281 G T **

93809713 C A ** 93816005 C A **

93818096 G C ** 93819305 T G **

93820741 G A ** 93836209 G T

93852574 C A 94538569 G A **

94542564 C T ** 94548803 A C **

94551440 C T ** 94555793 C T **

94558585 A G ** 94560169 A G **

94560700 A G ** 94561431 G C **

94562325 A G ** 94565597 G A **

94570809 GGAG G ** 94571824 C T **

94578109 A C ** 94579074 G A **

94584115 G A ** 94584359 A AAA **

94596003 T C ** 94603026 C T **

GGGAGCTCCGGG

94604600 GCACAGCGGGGG 94610483 C T **

A

94620697 C T ** 94622712 T TT **

94625758 A c ** 94625869 G c **

94626003 T c ** 94629576 A G **

94629791 G A ** 94631106 T C **

94634793 C G ** 94635354 G T **

94636863 T A ** 94638085 A AA **

94643412 c T ** 94645444 C T **

94652114 G A ** 94656047 G c **

94656206 G A ** 94656325 T c **

94657100 G A ** 94658314 c A **

94659088 C T ** 94661680 G c **

94663412 A AA ** 94664416 G A **

94665560 G A ** 94666939 T C **

94676336 T C ** 94684657 T C **

94687254 G A ** 94692099 c T **

94693422 G A ** 94695606 G A **

94707184 G A ** 94712462 G A **

94720462 G T ** 94725530 C T **

94731834 T c ** 94735686 T G **

94751322 c T ** 94755760 A G **

94756433 c T ** 94756530 G A **

94756874 G T ** 94757278 G A **

94757327 c T ** 94757916 T C **

94758199 T c * 94758718 A AGAGA **

94759269 T c ** 94759322 A G **

94759390 G A ** 94759396 A C **

94759417 C T ** 94759559 T C ** 94759650 T TTA ** 94759810 T c **

94759992 c G ** 94760119 A G **

94760192 τ G ** 94760243 C T **

94760288 G A ** 94760531 T c

94760581 AATAATACAC ACTACACCACT * 94760652 G A **

94760671 C A ** 94760770 G c **

94761049 G A ** 94762795 G A **

94764505 G A ** 94764573 A G **

94765076 T C ** 94766443 G A **

94766608 c A ** 94766826 T C **

94766867 T C ** 94766963 c T **

94766991 c A ** 94768022 c T **

94768206 c T ** 94769429 c T **

94769583 G A ** 94772830 A C

94772832 T C ** 94773045 G T **

94801051 c A ** 94803439 A C **

94803946 T C ** 94807228 T C **

94807356 A G ** 94810523 G A **

94810647 C G ** 94812549 c G **

94814930 T C ** 94816003 c G **

94820572 A C ** 94820663 CACCAAGGC CTGCA **

94827689 A T ** 94835423 T C **

94838062 A G ** 94841106 T G **

94844030 A C ** 94849692 AA A **

94850460 T C ** 94851762 C G **

94856135 T C ** 94857194 C T **

94864522 cc C ** 94864646 C A **

94875984 A G ** 94880129 C T **

94887957 T A ** 94888214 A AA **

94891185 A T ** 94903867 A G **

94927614 C T ** 94951835 C T **

94965349 C T ** 94966363 C A **

94977041 C G ** 95000839 T C

95000931 G A 95000933 T A

95001041 G C 95008762 A G **

95035311 C G ** 95052255 G T **

95107499 C G ** 95109388 A G **

95109956 C T ** 95110705 T A **

95174703 G c ** 95179660 T A **

AACTGAACTGAAC AACTGAACTCCA

95181626 95191325 A T **

TG GGGTTGA

95205755 G A ** 95235458 G C **

95248679 C A 95304577 G A **

95348590 G A ** 95350362 G A **

95356975 C T ** 95369944 T A **

95375711 C G ** 95384251 c G **

95388241 CC C 95418721 T C **

95421182 A G ** 95422991 A G **

95427492 C T ** 95427708 G C **

95428048 C T ** 95428167 A T **

95429356 C G ** 95429412 T G ** 95430537 C A ** 95432337 C T **

95433544 C T ** 95433626 A c **

95433763 A ACA 95434535 G A **

95434573 T C ** 95434715 CT C **

95435143 G C ** 95435201 G C **

95435843 C T ** 95435866 T C **

95436330 A AA ** 95436443 A G **

95437123 A G ** 95437455 C T **

95437858 T G ** 95438437 T c **

95438597 c T ** 95439442 A G **

95440624 G A ** 95442090 C T **

95442237 G T ** 95442288 C T **

95443190 A c ** 95443210 C A **

95443929 T c ** 95443953 A G **

95444425 T c ** 95445815 C T **

95446080 AA A ** 95446253 C T **

95447366 T C ** 95448488 G A **

95448524 A G ** 95449796 C T **

95450658 C G ** 95450786 A c **

95451677 G A ** 95451862 A T **

95452183 TA T ** 95452218 C T **

95454969 G A ** 95455193 G c **

95456488 C T ** 95457162 G A **

95458546 CCCA CACCCCC ** 95464439 G A **

95470454 TT T ** 95475758 T C

95475763 T c 95475774 AC TT

95490717 c T ** 95490889 G A **

95492066 T G 95492068 A G

95499370 G A ** 95511214 AG ACA **

95514093 G C ** 95515837 G A **

95625195 G T ** 95625202 T C **

95625205 A T ** 95625207 G C **

95625210 A c ** 95668898 C A **

95669068 T c ** 95749511 A C **

95816713 A G ** 95857009 T C **

95996288 T C ** 96008990 G A **

96021733 c T ** 96038930 G A **

96040372 G c ** 96042409 G C **

96046832 C G ** 96047557 C T **

96048821 T C ** 96048987 C T **

96050383 c T ** 96051176 G T **

96051395 T c ** 96051716 A G **

96051756 A c ** 96053466 C T **

96054956 C T ** 96055486 A T **

96055989 C T ** 96056030 T c **

96059122 G A ** 96059924 A G **

96060727 C T ** 96062347 G A **

96066160 C G ** 96067535 A G **

96069237 G A ** 96070232 T C **

96070922 C T ** 96071622 T G **

96075472 C T ** 96076497 G T ** 96076499 AT GC ** 96077511 C T **

96078096 G A 96080730 G c **

96082118 G A ** 96082992 G A **

96083920 A T ** 96084125 AAA A **

96084327 A c ** 96084570 T C **

96087370 C T ** 96087441 T G **

96089743 A c ** 96090846 G A **

96091015 G c ** 96091170 A G **

96091201 C G ** 96091373 T C **

96091711 T C ** 96092945 G A **

96093187 T C ** 96095711 G T **

96096217 c T ** 96128624 A G **

96258097 A G ** 96299594 T A **

96301681 C CAC ** 96311108 G A **

96375873 T C ** 96378042 G A **

96385548 T c ** 96402404 A G **

96407631 G T ** 96414456 A AA **

96437223 T G ** 96444828 T C *

96463045 T G ** 96465824 T A **

96471477 A C ** 96491105 T C **

96509230 T C ** 96543254 c T **

96627240 A C ** 96635736 c A **

96652553 T C ** 96693999 A G **

96724032 A G ** 96811640 T G **

96836507 G A ** 96865834 TT T **

96878367 G A ** 96881159 T G **

96890385 G A ** 96892623 c T **

TCAGAAAATTAAA TCAGAAAATTAA

96896881 96910626 G T **

TGTAG ATGTGTATAA

96913702 TT T ** 96913976 C G **

96914390 C T ** 96915840 A G **

96923446 T c ** 96923577 G A *

96924180 TT T ** 96932098 T G

96932104 c T 96935960 c T **

96936982 c T ** 96945962 G A **

96946854 c T ** 96955289 G T **

96958192 T G ** 96959372 G A **

96959515 G A ** 96969804 T G **

96971708 G C ** 96976996 c T **

96978336 C T ** 96981906 A G **

96982947 G T ** 96984621 T A **

96986735 C T ** 96986748 c A **

96991303 T c ** 96996882 c G **

97002380 G A ** 97002416 G T **

97005992 C T ** 97007210 C T **

97012651 G A ** 97013746 T c **

97014197 A T ** 97028094 T A **

97028205 A c ** 97028262 G A **

97448518 A G 97455185 C T **

97456250 G A ** 97456383 A G **

97456428 G A ** 97459207 T A ** 9 ₇ 464646 C T ** 97467780 C T **

97467835 G A ** 97472224 C G **

97472994 C G ** 97480087 C T **

97483489 G A ** 97492342 G A **

97492473 G A ** 97495925 G C **

97502394 C T ** 97520679 T C **

97547382 T c ** 97548696 c A **

97552661 A T ** 97553790 A G **

97555616 T A ** 97556294 C G **

97556325 T c ** 97565513 G T **

97568410 G A ** 97582391 C T **

97586195 C T ** 97588801 AG AAAAAA *

97590435 C T ** 97592047 G A **

97592196 C T ** 97592695 G A **

97599616 C G ** 97601769 A T **

97602659 G T ** 97603964 T c **

97608412 A T ** 97609102 T c **

97610019 T c ** 97610625 G A **

97611287 c T ** 97612024 C T **

97614233 G T ** 97615936 G A **

97617263 G A ** 97617497 G A **

97618332 T C ** 97627471 G T **

97629366 A G ** 97632703 T c **

97633906 A G ** 97637511 c T **

97640419 A G ** 97642205 G T **

97642858 T C ** 97644857 C T **

97645466 c T ** 97646529 C T **

97647380 c T ** 97647835 T c **

97648768 CCG CT ** 97648819 c T **

97649383 TA T ** 97649540 G A **

97654593 A AA ** 97655380 T A **

97655382 G c ** 97655969 c T **

97656161 T G ** 97657881 T TT **

97657903 c G ** 97658116 T TACT **

97658374 T C ** 97659191 c G **

97659360 c T ** 97659484 c G **

97659509 G T ** 97659703 G A **

97659964 A T ** 97660265 C T **

97660623 A G ** 97660732 A c **

97661493 G T ** 97661625 A G **

97661742 A c ** 97683781 G A **

97688571 C T ** 97688751 T C **

97689395 C T ** 97705943 c T **

97706341 T A ** 97716810 G c **

97721918 A G ** 97722560 G A **

97725154 AAGAA A ** 97736741 G A **

97740323 C A ** 97741501 G C

97760051 G C ** 97760409 G A **

97770643 C T ** 97781477 G A **

97879286 G A 97915035 G A **

97977671 C A ** 98086386 G A ** 98184415 C T ** 98215916 G C *

98232218 T c 98309378 GAAG G **

98363470 A G ** 98390430 GAAG G **

98416433 C T ** 98418511 C T **

98438700 C A ** 98550835 A c

98581296 TCA T ** 98738586 C T **

98878198 G A ** 98880006 C T **

98939319 T C 98939329 T c

99003867 G C ** 99056614 G c **

99326916 G C 99338143 G c

99367654 C A 99367688 G A

99373630 T A 99388514 A G

99388517 A G 99388524 GG AA

99393081 C T 99397119 C A

99501242 C T ** 99502518 G A

99529272 T A ** 99702173 A G **

99706541 T C ** 99749940 C G **

99750895 c A ** 99770166 G C **

99775941 GG G ** 99781244 G A **

99844820 A C ** 99879733 TT T **

99933357 A T ** 99941147 G T **

100013195 G T ** 100067946 G A **

100088768 G A ** 100100438 C T **

100100476 C T ** 100104580 C A **

100154415 G A ** 100156615 G A **

100179586 G A ** 100193129 C T **

100231111 C G 100231113 C A

100231115 C A 100289272 C T **

100289435 G T ** 100322980 G T **

100323128 T c ** 100352413 C G **

100352468 c G ** 100525705 T G

100525713 T G 100703337 c T **

100750654 GG G ** 100760073 G A **

100901334 C T ** 100951886 A G **

100959680 C T ** 100975099 C G **

101010137 C A ** 101010233 A C **

101029183 C T ** 101056783 GTGG CGAA

101056824 CCG GGA 101056829 A T

101106417 T TGTTT ** 101160228 C T **

101217101 G A ** 101242300 G A **

101251699 G A ** 101254927 C T *

101261094 G A ** 101283285 C T *

101283302 C T 101286320 C T **

101289492 A c 101292099 G c **

101306315 T c ** 101319517 C A **

101323981 c G ** 101340022 T G

101341837 G T ** 101351949 A G **

101355736 A T ** 101358828 A G **

101359869 C T ** 101362658 A G **

101366773 C T ** 101369873 A G **

101372872 G A ** 101380076 C G ** 101380079 T G 101380082 A G

101382808 c T ** 101387645 A G **

101389426 c T ** 101392585 G A **

101396199 c T ** 101399470 C G **

101400865 c G ** 101404438 G A **

101404722 c T ** 101406780 G C **

101407677 G A ** 101407734 C T **

101418204 A G ** 101434035 C T **

101436832 C T ** 101448787 C T

101452101 C T ** 101467411 G A **

101489640 GG G 101579999 TAAATG T **

101583135 CTT C ** 101587117 A G **

101619535 G A ** 101624821 G T **

101666890 G T ** 101730959 T c

101752475 G A ** 101812194 c T **

101818736 G A 102181273 A G

102181275 G C 102313668 C A **

102368910 TAGTTT T ** 102419884 C T **

102432122 C T ** 102680581 A T **

102680766 G T ** 102684529 G T **

102684713 GC G ** 102704262 A c **

102715439 G A ** 102717544 A G **

102724955 C T ** 102727430 C G **

102729069 C T ** 102734599 C A

102734704 G A ** 102735007 G A **

102736940 G C ** 102753778 C T **

102754750 C T ** 102764886 C T **

102770892 G C ** 102833936 G A **

102883999 C T 102927468 G A **

102936401 A G 103054260 C T **

103101376 C T ** 103137360 C T **

103277690 A G 103277693 G T

103277697 C G 103285716 G T

103287544 G A ** 103301781 G A **

103304414 G A ** 103305129 C G **

103307730 G A ** 103328269 G T **

103332263 C A ** 103345446 G c **

103345901 C T ** 103347126 A G **

103349820 C T ** 103353237 G A **

103372675 C T ** 103468450 C T **

AGGAGGGG ACGCAGGA

103473570 G A ** 103488002

GACGC GGATGCG

ACGCGAGGAGGG ATGCGAGGAGGA

103488043 103496775 C T **

GGACGCGGGA CGCGAGGAGGG

103540987 C T ** 103576082 A G

103587175 C T ** 103610084 C T **

103614879 T A ** 103634369 C T **

103639331 c T ** 103648579 C A **

103657471 A G ** 103662316 C T **

103692202 G A ** 103704012 G T **

103706376 C T ** 103710505 G A ** 103714827 G A ** 103716398 C T * *

103719405 C T ** 103721271 G T * *

103724948 G A ** 103729108 G A * *

103809705 C A ** 103922484 T G

103949436 G C ** 103987223 A C

104097637 G A ** 104098500 GT GGGGG *

104105126 C T ** 104129930 C T * *

104130289 G A ** 104137000 G c * *

104206721 C T ** 104227569 T A

104233993 T c ** 104239830 G A * *

104252189 T c 104281352 C T

104281484 GG GA 104297533 T G

104321851 C T 104322752 c T

104326298 A AGCA 104326357 T A

104326399 G C 104328349 TGACT T

104331065 A c 104332380 A c

104332395 A c 104332398 C G

104332775 GAG G 104333439 A T

104334665 C G 104334669 G A

104334674 GTT ACC 104336847 G T

104339077 C A 104339813 T c

104344430 G A 104345083 c T

104347667 C T 104349837 G A

104350340 G A 104352513 C A

104353033 G A 104353300 T C

104353571 A G 104354052 c A

104355462 C T 104358980 c G

104359629 T c 104361198 G A

104361358 G A 104362238 C T

104363603 G A 104364589 C T

104367283 C T 104405753 G A

104422392 G A 104424848 A G

104860758 G T * 104911164 C T

104931863 G A 104943099 G A

104960835 G T 104976315 T G

105027271 G A 105037326 c T

105039502 A C 105051326 TCCT T

105090226 C A 105103945 A G

105106549 A G 105106557 A G

105131074 G A 105147692 C T

105177811 G A 105211495 C T

105212593 G C 105231461 A G

105239658 T C 105240807 T TT

105240893 c T 105276094 G A

105288839 G A 105302916 G A

105320566 C A 105353877 G A

105578641 G A 105627459 A C

105979951 T C 105983727 C T

105983826 c T 105997270 C T

105997493 G A 106003207 G A

106015647 G C 106015992 C T

106016767 G A 106021578 C A 106021945 G C 106041966 C G

106157763 C T 106234400 G C

106252452 C T 106254569 C T

106255217 C T 106255890 T c

106256013 G A 106256358 T c

106256552 C T 106257087 G A

106257421 C T 106257819 C T

106258658 G T 106258831 C T

106258843 G A 106259198 AC GT

106260513 G A 106260584 C A

106262180 G A 106345339 GG G

106419885 A G 106461006 C G

106461269 A G 106469465 C G

106469477 A C 106471900 G A

106478838 C T 106479826 G T

106479875 G A 106480009 C T

106480247 T C 106480951 A AT

106481118 c T 106487598 G A

106493570 A T 106535251 A G

106536004 C T 106572530 C T

106692214 T G 106692820 A G

106696640 c T 106699376 G A

106699679 G A 106709561 G A

106721214 C T 106732047 G A

106756152 A G 106756212 A C

106760318 G A 106760897 G A

106761229 C T 106770957 C T

106773339 C A 106779008 T c

106779279 A G 106779627 A G

106800797 G A 106801836 C T

106802247 G A 106802691 G T

106803063 C T 106803145 C T

106803403 C T 106803459 G A

106803515 A G 106803517 T A

106803946 A G 106804173 c T

106804291 G C 106804295 c T

106804379 G T 106804393 c T

106804915 A G 106805111 c G

106805200 C T 106805405 T C

106805408 G A 106805432 A G

106805448 G A 106805458 A G

106805468 T G 106805510 A G

106805636 A C 106805728 A G

106806057 C A 106806980 C T

106807004 A G 106807109 T c

106807125 A C 106807289 T c

106807310 A G 106807350 c T

106807429 C G 106807731 T c

106807764 C T 106807899 T c

106807974 G A 106808181 T G

106808458 C T 106808576 T C

106808649 G A 106808946 c T 106809068 C A 106809072 A G

106809310 C T 106809314 G A

106809335 T c 106809398 G A

106809454 G c 106809548 T C

106809615 C A 106809695 AG GC

106809732 T c 106809739 A G

106809752 G T 106809774 C G

106809788 GG G 106810018 T C

106810173 AA A 106810425 T C

106810444 G C 106810764 G T

106810828 A G 106811052 G c

106811141 C T 106811289 T c

106813733 G A 106815020 A G

106816076 T C 106816253 C T

106816744 c T 106820013 A G

106821107 c A 106821514 T C

106821880 c T 106822129 T TT

106822327 G A 106822384 A G

106822689 T C 106822954 G A

106823375 T C 106823537 A G

106823716 G A 106824207 A G

106825245 C T 106825274 C T

106825860 C T 106826664 G T

106826815 G A 106826965 G A

106827970 C T 106828043 C T

106828249 A G 106830565 T A

106832060 C G 106832082 G A

106832107 T G 106832159 C T

106832220 A G 106832231 C T

106834755 G A 106835605 T c

106837185 T A 106839155 T G

106839234 G A 106839542 G T

106839801 G A 106839830 C T

106840370 T G 106840486 T G

106841031 c T 106841181 G A

106846596 T c 106852098 G A

106858407 c G 106866568 G A

106870318 GTG G 106877164 G A

106881894 G C 106883173 C T

106893322 G A 106897186 C T

106897189 T C 106897238 G A

106905486 c T 106906154 A G

106906157 A G 106906239 C T

106906242 G A 106906340 T A

106906354 A G 106906358 TG CC

106906682 A G 106906754 G A

106907146 C T 106907588 C T

106907631 G A 106907658 C A

106907758 C T 106907857 T G

106907920 A G 106908083 c G

106908810 G A 106909448 G A

106909963 C T 106910013 G A 106910919 C T 106926300 C T

106932396 G A 106937633 A AA

106939321 AA A 106981340 C T

106991145 C T 106998720 G A

106999250 C A 107000683 C T

107004967 T C 107017701 A G

107033857 G A 107036380 C T

107044523 G A 107049036 G A

107049414 A G 107050167 A G

107050339 T G 107050365 CTT CC

107050435 G A 107050467 G A

107050677 A G 107051557 A G

107051647 A G 107051659 A G

107052030 C T 107052277 G A

107052823 C G 107052857 G A

107061559 G A 107263901 G A

* homozygous in animal 27

** homozygous in both animal 27 and animal 586

[00229] The two bovine genotyped as shown in Table 5 above were homozygous at each polymorphism identified by while those polymorphisms indicated by "*" were homozygous in animal 27, such that the listed variants are all in LD with the A allele at the +78G/A polymorphism and all co-segregate with the A allele at the +78G/A polymorphism. Discussion

[00230] As those skilled in the art will appreciate, those polymorphisms more proximal to the +78G/A polymorphism are expected to be in greater LD across a population than those more distally located. Indeed, applicants have identified a number of SNPs more distant to the +78G/A polymorphism than those depicted in Table 5 above, and as these polymorphisms have been discovered in a homozygous animal they are expected to be of use in selecting for the B' variation.

[00231] It will be appreciated that certain embodiments of the methods of the present invention which utilize a polymorphism in, for example, 95% LD with an allele at the +78G/A polymorphism will correctly identify in 95% of cases the identity of the allele at the +78G/A polymorphism. Given the quantitative nature of the commercially valuable phenotypic consequences of selection of the A allele at the +78G/A polymorphism, employment of such an embodiment, for example at commercial scale across a herd or population of bovine, would reduce BLG by 95% of the size of the effect achievable by directly identifying and selecting the A allele at the +78G/A polymorphism. Put another way, such an embodiment would increase cheese yield by 95% relative to the effects achievable by directly identifying and selecting for the A allele at the +78G/A polymorphism. Thus, commercially useful outcomes are achievable, particularly across a herd or population via such an embodiment. [00232] Moreover, commercially useful outcomes, particularly across a herd or population, are achievable using polymorphism at lower degrees of LD. For example, embodiments of the methods of the present invention which utilize a polymorphism in, for example, 90% LD with an allele at the +78G/A polymorphism will correctly identify in 90% of cases the identity of the allele at the +78G/A polymorphism. Employment of such an embodiment, for example at commercial scale across a herd or population of bovine, would reduce BLG by 90% of the size of the effect achievable by directly identifying and selecting the A allele at the +78G/A polymorphism, and increase cheese yield by 90% relative to the effects achievable by directly identifying and selecting for the A allele at the +78G/A polymorphism. Corresponding quantitative reductions in BLG and increases in cheese yield, for example across a herd or population, are achievable using polymorphisms in, for example, 85% LD, 80% LD, 75% LD, 70% LD, or 65% LD or lower, and such embodiments represent commercially useful embodiments of the present invention.

[00233] Thus, it will be appreciated that a greater degree of selective accuracy (and thus potential for commercial value) is achievable in embodiments where the degree of LD between the directly identified variant and the indirectly identified allele at the +78G/A polymorphism is increased, and conversely, a lower potential for commercial value will be achievable in embodiments where a lower degree of LD exists.

[00234] The present invention recognises that the BLG polymorphism described above, together with polymorphisms in linkage disequilibrium, such as those depicted in Table 5, are useful in the identification of subjects with particular BLG production, regulation, or secretion phenotypes, for example as a selection tool to breed agricultural animals with lower production of BLG, such as lower colostrum or milk concentrations of BLG, or animals with higher casein production, such as higher casein number.

EXAMPLE TWO

This example describes the in vitro assessment of the effect of the presence of the A allele at the

+78G/A polymorphism on expression of the BLG gene.

Methods

Cloning

[00235] An 1819 bp fragment covering the PAEP promoter, exon 1, intron 1 and part of ex on 2 was amplified by PCR using Expand Long Range dNTPack (Roche) with forward primer 01 and either reverse primer 02 or reverse primer 03 binding to position -921 upstream and +898 downstream from the start site of the reference sequence SEQ ID NO: 75. This generated two fragments that differed only at position 78 and in the restriction site in the reverse primer. These fragments were cloned into pCR2.1 -TOPO vector (Life Technologies). The fragments were then excised from pCR2.1 using the Xhol and Hindlll sites designed into primers 01, 02 and 03 and ligated into promoter-less luciferase pGL4.16 vector (Promega) using Rapid DNA Ligation kit (Roche). The resulting plasmids were labelled B and B' .

Primer sequences

01 : CTCGAGAGATCTCCACAGCCCGCTGGGTACTGATGCCC (SEQ ID NO:76)

02: AAGCTTCAGCTGATTTCTGCAGCAGGATCTCCAGGTCGCC (SEQ ID NO:77) 03 : AAGCTTGTCGACATTTCTGCAGCAGGATCTCCAGGTCGCC (SEQ ID NO:78)

Cell culture

[00236] CHO-K1 cells were grown in MEM-alpha medium (Life Technologies), supplemented with 10% FBS (Life Technologies), 1 mM Sodium Pyruvate (Life Technologies) and lx Penicillin Streptomycin (Life Technologies).

[00237] MCF-7 cells were grown in MEM-alpha medium (Life Technologies), supplemented with 10%) FBS (Life Technologies), 1 mM Sodium Pyruvate (Life Technologies), lx Penicillin Streptomycin (Life Technologies) and 10 μg/mL Insulin (Sigma).

[00238] Cells were grown to 80%> confluence before transfection with Fugene (Roche). 6 μg plasmid DNA was used per 2 xL Fugene reagent for transfection. Transfection efficiency was normalised between wells by inclusion of Renilla luciferase pGL4.73 vector (Promega) at a 9: 1 ratio.

[00239] Prior to harvest, cells were grown for 48 hours in MEM-alpha medium (Life Technologies), supplemented with 10% FBS (Life Technologies), 1 mM Sodium Pyruvate (Life Technologies), lx Penicillin Streptomycin (Life Technologies), 10 μg/mL Insulin (Sigma), 5 μg/mL Prolactin (Sigma) and 1 μg/mL Hydrocortisone (Sigma). Cells were harvested by removing media, rinsing with PBS then lysing with Passive Lysis Buffer (Promega).

Luciferase assay

[00240] Luciferase assay was performed using Dual Luciferase Reporter Assay (Promega). Luminesence was measured using EnVision Multilabel Plate Reader (PerkinElmer) 20 \L of cellular lysate was dispensed into a 96 well plate. 100 μL· of LAR II (Promega) was added to each well and luminescence was measured five times. 100 μΐ _^ of "Stop & Glo Reagent" (Promega) was added to each well and luminescence was again measured five times.

Results

[00241] Measurements of cellular luciferase activity were averaged per well and normalised by the corresponding Renilla luciferase measurement giving a ratio of Luciferase :Renilla Luciferase. Results were averaged from 12 independent transfections for each plasmid in two cell lines, MCF-7 (Figure 4) and CHO-K1 (Figure 5).

[00242] Reporter activity was 40% less for cells containing the B' plasmid relative to the B plasmid in both MCF-7 and CHO- 1 cell lines, suggesting lower expression of the PAEP- Luciferase fusion protein from the promoter harbouring the A allele at the +78G/A polymorphism (see Figure 6 for the ratio of B/B' expression in each cell line).

[00243] The casein number in control and high casein herds (Hawera, New Zealand) was determined on four separate occasions. Controls were picked from outlier herds matching for fpl composition as far as possible.

[00244] As shown below in Table 6, there was a 4.1 % difference between overall mean casein number in the high casein herd compared to the control herd.

Table 6. Casein number in control and high casein herds

_ Mean , ,

Group ,„ . - _T , . Std Err N

(Casein Number)

CON 0.77 0.003 43

HC 0.82 0.004 39

CON 0.79 0.003 43

HC 0.83 0.003 40

CON 0.79 0.003 33

HC 0.83 0.003 39

CON 0.80 0.003 35

HC 0.84 0.003 35

Overall

CON 0.79

HC 0.83

[00245] This data clearly identifies the potential impact on milk production and quality (as exemplified by casein number) enabled by the methods of genetic selection provided by the present invention.

INDUSTRIAL APPLICATION

[00246] The present invention is directed to methods of geno typing mammalian subjects to facilitate the identification or selection of subjects with desired BLG production, regulation, or secretion phenotypes, including desired milk or colostrum BLG content phenotypes. In particular, these phenotypes include decreased milk or colostrum BLG content. It is anticipated that in agricultural applications, herds of bovine selected for such phenotypes will produce milk or colostrum of more desirable BLG content, will allow the production of products with, for example, decreased BLG content, or increased casein, and therefore will be of significant socioeconomic benefit.