Marker-free genetically-engineered double mutants of Thermoanaerobacter TECHNICAL FIELD

The invention relates to a marker-free genetically engineered thermophilic bacterium of the Thermoanaerobacter genus comprising at least one inactivated gene in the lactic acid pathway and at least one inactivated gene in the acetic acid pathway, and the use of the bacterium in the production of fermentation products.

BACKGROUND OF THE INVENTION

Marker free deletion of genes

Antibiotic resistance or other selectable marker genes are routinely used to select for the chromosomal insertion of heterologous genes or the deletion of native genes by homologous recombination to create new strains of Bacteria. The presence of antibiotic resistance genes in the host chromosome reduces the variety of plasmids that can be propagated in a cell, since these often rely on the same genes for their selection and maintenance. Genetically modified Bacteria containing chromosomal antibiotic resistance genes are undesirable for biological production, because the chromosomal DNA will be present in the final product as a low-level contaminant, with the risk of antibiotic resistance gene transfer to pathogenic Bacteria in humans or the environment. The insertion of a constitutively expressed marker gene can also alter the expression of adjacent chromosomal genes. Therefore, a rapid method of inserting genes into or deleting genes from bacterial chromosomes, resulting in strains with no antibiotic resistance genes or other selectable markers genes is a significant advantage [1] .

One strategy for unlabeled (i.e., without a selectable marker gene) chromosomal gene integration relies on inserting a plasmid via a single homologous recombination event, followed by the removal of the plasmid by a second recombination event (resolution) to hopefully produce the desired genotype [1-3] . A major disadvantage of this approach is that if the insertion or deletion reduces the fitness of the cell, the resolution event will predominantly regenerate the wild-type rather than the mutant genotype and therefore can be inefficient.

An alternative method is to insert an antibiotic resistance gene flanked by regions of chromosomal homology, where recognition sites for a site-specific recombinase (SSR) immediately flank the antibiotic resistance gene. Chromosomal integration strategies include traditional RecA-mediated homologous recombination and recombineering using PCR products and phage-encoded recombination functions, including ET cloning that utilizes RecE/RecT from bacteriophage Rac or bacteriophage λ Red recombination [4] . Examples of SSRs/target sites used for antibiotic gene excision include Cre/loxP from bacteriophage PI [5], Xer(Rip)/cis from Escherichia coli and Bacillus subtilis [1,6], Xis/attP from bacteriophage λ [7], and FLP/FRT [8] and R/RS [9] from the yeasts Saccharomyces cerevisiae and Zygosaccharomyces rouxii, respectively. The

recombination functions of transposons such as Tn4430 from Bacillus thuringiensis [10] and thermostable rolling circle plasmids in Bacillus amyloliquefaciens [11] can also be employed.

The use of these systems is dependent on the functionality of these factors in the organism to be modified . For some organisms, no such system will work either due to high or low temperature optimum, requirements for high or low pH, and extreme concentrations of salts or other factors that will prevent the functionality of the recombinases. When using transposons or plasmids, such elements need to be functional in the organism of interest. Since in many organisms such elements have not been identified there remains a need for other methods for detecting gene insertion events. An alternative strategy is to use the sensitivity of microorganisms towards halogenated compounds such as haloacetate or 5-flouro-orotic acid. 5-flouro-orotic acid can be used to counter-select for the presence of the pyrF gene, since the product of pyrF converts 5- fluoro-orotic acid into the toxic compound 5-fluorouracil . Once the pyrF gene is deleted from the chromosome of the target microorganism, the pyrF gene can be used as a selection marker either on a plasmid or on a chromosomal integration in a different position . The method is widely used in yeast and has also been demonstrated in

Clostridium thermocellum [12] . For this method to be effective, the organism of choice needs to be sensitive to halogenated compounds. Some industrial microorganisms including Thermoanaerobacter mathranii BGl [13] are highly tolerant to toxic compounds such as halogenated compounds, and the use of these is therefore not possible. In general, microorganisms may become less sensitive to the toxic effects of halogenated compounds either by using novel pathways that circumvent the generation of reactive intermediates or by producing modified enzymes that decrease the toxicity of such compounds [14] . Also, once the pyrF gene has been used, it has to be removed before it can be used again as selection marker for a secondary mutation.

In plants, the removal of antibiotic resistance markers is also highly important. There are several ways to either avoid or get rid of selectable marker genes. Methods that will allow the removal of DNA in plants as efficiently as it is inserted have been developed, such as the use of site-specific recombination, transposition and homologous recombination . Researchers have also described several substitute marker genes that have no harmful biological activities. The presence of these non-bacterial genes allows the plants to metabolize non-toxic agents normally harmful to them [15] .

Isolation of strains containing a gene encoding a commercially important product such as an enzyme

Currently, microorganisms are the major source for industrial enzymes in the feed sector [16] . Isolation of cells producing commercially important enzymes is a tedious process involving the screening of a great number of microbial cells before the right one is found. The screening can be based on a known DNA sequence, for instance a conserved motif in the enzyme, or it can be based on the detection of the enzyme's activity in the culture supernatants. The source material can be plant or animal matter, or microbes - both prokaryotes (e.g . Bacteria and Archaea) and eukaryotes (e.g. Yeast and Fungi) [16] .

One problem often encountered early in the screening process is that natural microbial isolates usually produce commercially important enzymes in exceedingly low

concentrations. In some cases screening methods based on the activity of the enzyme is therefore not successful [16] .

Other commonly known screening methods includes colony hybridization, PCR or enzyme assays. In either case, the cells are isolated as colonies on plates or as pure liquid cultures before they are screened. The screening process involves the examination of thousands of samples of soil, plant material, etc., and the random isolation and screening of the resident microbial flora . Although capable of significant automation, the throughput capacity largely determines the speed of progress. [16] .

An alternative approach is to clone the gene of interest directly from the mixed cell population into a host cell. However, it may not be possible to express the product in the foreign host and the efforts may therefore be futile [16] .

Thermoanaerobacter species have unique advantages over other ethanol production strains. The primary advantages are their broad substrate specificities and high natural production of ethanol . Moreover, ethanol fermentation at high temperatures (55- 70°C) has many advantages over mesophilic fermentation . One advantage of using

Thermoanaerobacter species is the high stability in continuous cultures, since only a few microorganisms are able to grow at such high temperatures in undetoxified lignocellulose hydrolysate.

US20090221049 describes the knock-out of actetate kinase, phosphotransacetylase and lactate dehydrogenase genes in Thermoanaerobacterium using kanamycin and erythromycin antibiotic resistance markers. US20090221049 does not describe how removal of these antibiotic resistance markers could be achieved .

W2010075529A2 teaches a method for marker-free deletion of genes in

Thermoanaerobacterium saccharolyticum. However, the method of W2010075529A2 is not applicable to Thermoaanerobacter species and no methods for marker-free deletion of genes in Thermoanaerobacter are taught in the cited reference Reyrat et al ., 1998.

WO2010056805 describes screening schemes to detect homologous recombinant mutants based on antibiotics or toxic analogues (5-FOA, BAA, CAA, SFA), but does not show, state that toxic metabolite analogue screening can be implemented in Thermoanaerobacter. Providing thermophilic bacterium of the Thermoanaerobacter genus with the desired properties for fermentation valuable fermentation products often relies on genetic engineering, however there is a general need in the industry to provide tailor made bacteria that are devoid of antibiotic resistance marker genes.

SUMMARY OF THE INVENTION

The invention provides a genetically engineered thermophilic bacterium of the

Thermoanaerobacter genus comprising at least one inactivated gene in a first metabolic pathway and at least one inactivated gene in a 2 ^nd metabolic pathway, wherein the resulting strain does not contain genes conferring antibiotic resistance.

The invention provides a genetically engineered thermophilic bacterium of the

Thermoanaerobacter genus comprising at least one inactivated gene in a lactic acid pathway and at least one inactivated gene in an acetic acid pathway, wherein the resulting strain does not contain genes conferring antibiotic resistance. In one embodiment of the genetically engineered thermophilic bacterium of the

Thermoanaerobacter genus, a gene encoding lactate dehydrogenase (LDH) (EC 1.1.1.27) has been inactivated.

In a further embodiment of any one of the above embodiments of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus, a gene encoding an acetate kinase (EC 2.7.2.1) has been inactivated .

In a further embodiment of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus, a gene encoding a phosphate acetyltransferase (EC 2.3.1.8) has been inactivated. In a further embodiment of any one of the above embodiments of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus, the inactivated gene in the lactic acid pathway and/or the inactivated gene in the acetic acid pathway is inactivated by the mutation, deletion or insertion of one or more nucleotides in said gene.

In a further embodiment of any one of the above embodiments of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus, the bacterium comprises a native pyrF, tdk and hpt gene in its native position on the chromosome.

In a further embodiment of any one of the above embodiments of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus, the bacterium is a species of Thermoanaerobacter selected from among T. acetoethylicus, T. brockii, T. ethanolicus, T. indiensis, T. inferii, T. italicus, T. keratinophilus, T. kivui, T. mathranii, T. pseudethanolicus, T. siderophilus, T. sulfurigignens, T. sulfurophilus, T. thermocopriae, T. thermohydrosulfuricus, T. uzonensis, and T. wiegelii.

In one embodiment of the genetically engineered thermophilic bacterium is BG463 (DSMZ Accession number DSM 26411).

In a further embodiment of any one of the above embodiments of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus, the bacterium was isolated from a mixed culture of microorganisms comprising the steps: a) providing a mixed culture of microorganisms containing said selected

microorganism, wherein said selected microorganism comprises one or more nucleic acid molecule, wherein said nucleic acid molecule comprises a known unique consecutive sequence of at least 15 nucleic acid base pairs, and wherein the frequency of the selected microorganism is less than 10 ^"3 , b) serially diluting said mixed culture in a growth medium to provide diluted cultures;

c) incubating said diluted cultures to allow growth of said microorganisms; d) detecting the presence or absence of said nucleic acid molecule in said diluted cultures obtained from step (c) to allow the frequency of said selected microorganism in said mixed culture to be determined, and identifying the most dilute culture in which said nucleic acid molecule is detected (P) , and identifying the least diluted culture in which said nucleic acid molecule is not detected (N), wherein the dilution factor between P and N is D and the total dilution factor of culture N relative to the undiluted mixed culture is Dt;

e) preparing and incubating replicate diluted cultures having the dilution Dt; f) detecting the presence or absence of said nucleic acid molecule in replicate dilution cultures obtained from step (e), wherein the frequency of said selected microorganism in said replicate dilution cultures is increased compared to culture P;

g) selecting a replicate dilution culture containing said nucleic acid molecule and using said selected culture to repeat steps (e) to (g), wherein the total dilution factor (Dt) of the replicate diluted cultures is increased by the factor D, and wherein steps (e) to (g) are repeated until the frequency of said selected microorganism comprising said nucleic acid molecule is greater than 10 ^"3 , preferably greater than 10 ^"1 ;

screening single colonies of a replicate dilution culture obtained from step (g) and isolating said selected microorganism comprising said nucleic acid molecule.

In a further embodiment of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus isolated by the above method, the frequency of the selected microorganism in step a) is between 10 ^"4 and 10 ^"7 .

In a further embodiment of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus isolated by the above method, said nucleic acid molecule is detected by PCR or by hybridization to said nucleic acid molecule.

In a further embodiment of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus isolated by the above method, said one or more nucleic acid molecule, comprises at least two nucleic acid molecules, wherein each of said two molecules comprises a known unique consecutive sequence of at least 15 nucleic acid base pairs, and wherein the at least two molecules are comprised within a larger nucleic acid molecule comprising 50 to 10,000 nucleic acid basepairs, preferably 150 to 3,000 nucleic acid basepairs, more preferably 150 to 1500 nucleic acid basepairs.

In a further embodiment of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus isolated by the above method, D is 2-20.

In a further embodiment of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus isolated by the above method, the number of replicate cultures prepared in step (e) is 2 to 500.

In a further embodiment of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus isolated by the above method, said bacterium is obtained by the steps of: a inserting one or more nucleotides into at least one gene in the lactic acid pathway and subsequent deletion of one or more of said inserted nucleotides, and

b inserting one or more nucleotides into at least one gene in the acetic acid

pathway and subsequent deletion of one or more of said inserted nucleotides, wherein the inserted nucleotides may optionally confer antibiotic resistance.

The invention provides a method of producing a fermentation product comprising culturing the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus according to any the above embodiments, under suitable conditions.

In a further embodiment of the method, the fermentation process is performed under strict anaerobic conditions.

In a further embodiment of the method, the fermentation process is operated at temperature in the range of about 40-95°C, such as the range of about 50-90°C, such as the range of about 60-85°C, such as the range of about 65-75°C.

In a further embodiment of the method, the fermentation process is a batch fermentation process.

In a further embodiment of the method, the fermentation process is a continuous fermentation process.

In a further embodiment of the method, the fermentation product is selected from the group consisting of an acid, an alcohol, a ketone and hydrogen .

In a further embodiment of the method, the alcohol is selected from the group consisting of ethanol, butanol, propanol, methanol, propanediol and butanediol.

In a further embodiment of the method, the acid is selected from the group consisting of lactic acid, propionic acid, acetic acid, succinic acid, butyric acid and formic acid.

In a further embodiment of the method, the ketone is acetone.

The invention provides for the use of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus for the production of a fermentation product selected from the group consisting of an acid, an alcohol, a ketone and hydrogen . LEGENDS TO FIGURES

Figure 1. A graphical representation of the delivery vector used to introduce the genetic fragment (e.g. PAR) into the genome of the organism. The PAR fragment (parM-ext) is placed between the up flank (LDH-Up) and the down flank (LDH-Down) in the clockwise orientation. Ndel shows the site where the vector is linearized prior to transformation. parM-ext-Re (100%) and parM-ext-fw3 (100%) are priming sites used for screening.

Features illustrated between LDH-Down and LDH-Up clockwise orientation originate from cloning vector pUC19.

Figure 2. An agarose gel showing parM-ext screening result of the 10 ^s mixtures (samples 5Am - 5Dm) and associated negative and positive controls. Square box shows selected sample 5Cm, chosen for individual sample differentiation).

Figure 3. An agarose gel showing the PCR products from the individual samples of mixture 5Cm (Figure 2). 5C1 was found to be the one sample with parM-ext inserted in the genome.

Figure 4. An agarose gel showing PCR products from the individual samples from mixture 6Dm (10 ^s ). 6D4 was found to be one of four samples with parM-ext inserted in the genome.

Figure 5. An agarose gel showing PCR products from individual samples of mixture 7Dm (10 ^{" 7} ). 7D5 was found to be the sample with parM-ext inserted in the genome.

Figure 6. An agarose gel showing PCR results from individual samples of mixture 8Am (10 ^s ). 8A5 was found to be the sample with parM-ext inserted in the genome.

Figure 7. An agarose gel showing PCR results from individual samples of mixture 9Am (10 ⁹ ). 9A2 was found to be one of two samples with parM-ext inserted in the genome.

Figure 8. A graphical representation of the delivery vector used to introduce the HKT kanamycin resistance gene into the genome of the Thermoanaerobacter mathranii strain BG411, P3PKA-large.

Figure 9 - PCR results from isolates. Figure 10. A graphical representation of the delivery vector used to delete HKT gene from the genome of Thermoanaerobacter mathranii strain BG463, p3d PKA-14K-BG10dn.

Figure 11. Primary detection: weak PC products were seen in dilution 1E-4 (and lower dilutions) from a dilution series growing to lE-10. Figure 12. The matrix: The upper row symbolizes the primary dilution series (example: 1E-4 is the 10-4 dilution in the primary dilution series). Each of the ID-tags in the rest of the table includes the dilution, the position and, the number in the matrix (example: 4B2 is from the 10-4 dilution. It is in the column of B samples, and it is the second sample - counted from the top). Mixed samples are created by pooling multiple samples from a column (example: 3Cm is created by pooling: 3C1, 3C2, 3C3, 3C4, and 3C5).

Figure 13. PCR screening of mixed samples from the matrix.

Figure 14. Individual samples from 6Cm analysed by gel electrophoresis.

Figure 15. Individual samples from 7Am analysed by gel electrophoresis.

Figure 16. Dilution samples from 7 analysed by gel electrophoresis. Figure 17: Dilution samples from 7A1 analysed by gel electrophoresis

Figure 18. Continuous fermentation of pretreated wheat straw using Pentocrobe 463. All values are shown in g/L. Open squares: ethanol produced in fermentation, open triangles: acetic acid produced in fermentation, open circles: lactic acid produced in fermentation, filled squares: remaining glucose, filled triangles: remaining xylose, filled circles: remaining arabinose. The hydraulic retention time varied between 11 and 206 hours.

Figure 19. Concentration of sugars in the feed to the continuous fermentation of figure 18. All values are shown in g/L. Open squares: glucose concentration in feed, open triangles: xylose concentration in feed, open circles: arabinose concentration in feed.

DETAILED DESCRIPTION OF THE INVENTION

The invention provides a genetically engineered thermophilic bacterium of the

Thermoanaerobacter genus comprising at least one inactivated gene in a first metabolic pathway, such as the lactic acid pathway and at least one inactivated gene in a second metabolic pathway such as the acetic acid pathway, wherein the resulting strain does not contain genes conferring antibiotic resistance.

Marker free mutants of the Thermoanaerobacter genus are difficult to obtain since common techniques for making this type of deletion cannot be used. For instance,

Thermoanaerobacter is able to adapt to a wide range of toxins such as 5-flouro orotic acid (5-FOA) and counter selectable markers based on toxins are therefore not applicable. Furthermore, a wide range of other methods are dependent on detecting the activity of proteins (used as selection markers), which due to their denaturation at the high growth temperature of Thermoanaerobacter cannot be used. Examples of counterselectable markers which are based on proteins from mesophilic organisms, and are therefore not tolerant to high temperature, include sacB, tetR, rpsL, pheS, thyA, lacY, gata-1, and ccdB. In order to reach the goal of achieving a double marker free mutant of Thermoanaerobacter, it was therefore necessary to develop a new method for marker-free deletion of genes in Thermoanaerobacter.

In the genetically engineered thermophilic bacterium of the invention, the inactivated gene in the lactic acid pathway and/or the inactivated gene in the acetic acid pathway may be inactivated by the mutation, deletion or insertion of one or more nucleotides in said gene.

Typically, the genetically engineered thermophilic bacterium of the invention comprises a native pyrF, tdk and hpt gene in its native position on the chromosome. Accordingly, the engineering of the bacterium does not require either the deletion or the insertion of any one or more of these genes in its genome.

According to the invention the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus, can be a species of Thermoanaerobacter selected from among T. acetoethylicus, T. brockii, T. ethanolicus, T. indiensis, T. inferii, T. italicus, T.

keratinophilus, T. kivui, T. mathranii, T. pseudethanolicus, T. siderophilus, T. sulfurigignens, T. sulfurophilus, T. thermocopriae, T. thermohydrosulfuricus, T. uzonensis, and T. wiegelii.

In an example the genetically engineered thermophilic bacterium is BG463 (DSMZ Accession number DSM 26411). The present invention provides methods required for isolating a selected microorganism from a mixed culture of microorganisms without the need for marker based selection techniques, such as antibiotic resistance marker genes.

A mixed culture of microorganisms is a population of microorganisms where the individual microorganisms within the population differ with respect to a known consecutive sequence of at least 15 nucleic acid base pairs in their DNA (e.g. chromosomal or plasmid DNA molecules). The population of microorganisms in the mixed culture comprises a selected microorganism.

A selected microorganism is a specific microorganism present within the mixed culture of microorganisms, wherein cells of the specific microorganism comprise one or more nucleic acid molecule (e.g. chromosomal or plasmid DNA), and wherein the molecule comprises a known consecutive sequence of at least 15 nucleic acid base pairs (or nucleotides) that are not present in cells of the other microorganisms in the culture. Cells of the specific microorganism can be selected from the mixed culture of microorganisms, by selecting for a microorganism cell comprising this at least 15 consecutive nucleic acid base pairs. The specific microorganism can also be selected from the mixed culture of microorganisms, by selecting for a microorganism cell comprising at least two nucleic acid molecules comprising at least 15 nucleic base pairs, and wherein the at least two molecules are comprised within a larger nucleic acid molecule comprising 50 to 10,000 nucleic acid base pairs, preferably 150 to 3,000 nucleic acid base pairs and even more preferably 150 to 1500 nucleic acid base pairs.

The isolation of the selected microorganism present in a mixed culture of microorganisms using the method of the invention is particularly suitable where the frequency of the selected microorganism in the mixed culture is less than 10 ^"3 . The method of the invention is also suitable where the frequency of the selected microorganism in the mixed culture is 10 ^"4 , 10 ^s , 10 ^"6 , 10 ^"7 , or lower.

This method for isolating a selected microorganism employs a surprisingly effective technique that is schematically represented in Table 1. In Table 1 each tube illustrates a container, wherein the microorganism is grown. This container could also be a well in a microtitre plate or any other enclosed space containing a liquid growth medium. Growth medium, in liquid form, is used to culture the mixed culture of microorganisms and dilutions of this culture. The growth medium serves to support growth of the

microorganisms, and the composition of the medium is adapted to provide all essential nutrients required for the growth of the respective microorganism. The method does not rely on, nor requires, that the growth medium selectively promotes the growth of the specific microorganism to be selected, and hence can be a non-selective growth medium.

In (a) a tube is shown comprising a mixed culture of microorganisms, wherein the culture comprises a selected microorganism.

In step (b) the mixed culture is diluted by consecutive transfer into liquid growth medium. The number of dilutions will depend on the cell density of the mixed culture, but typically dilutions ranging from 10 ^"2 - 10 ^~9 are contemplated; more typically a dilution range extending down to 10 ^"6 is suitable. The dilution factor is preferably 1:10, although smaller or greater dilution factors are contemplated. It is both contemplated and sufficient that each dilution of the mixed culture is represented by one dilution culture. The diluted cultures in step (b) are then incubated until sufficient cell mass is obtained for the subsequent detection step. The incubation conditions employed to support growth of the microorganism are adapted to meet the growth requirements of the respective microorganism. Selection of growth temperature, supply of air for aerobic growth, or non- aerobic growth conditions, shaking conditions are all optimized to support growth based on the known growth requirements of the respective microorganism. The period of incubation is selected based on the growth rate of the respective microorganism, but will normally continue until the growth medium no longer provides conditions suitable for growth of the organism e.g. if the growth medium nutrients are exhausted.

The detection step is used to detect the presence of the one or more nucleic acid molecule, that comprises a known consecutive sequence of at least 15 nucleic acid base pairs, and that is unique to the selected microorganism in one or more of the dilutions of the mixed culture. It is contemplated that the detection step is performed on at least two, and preferably more than two of the dilutions of the mixed culture prepared and cultivated in step (b), where each dilution to be screened is represented by one dilution culture. The nucleic acid detection method will normally be optimized for the respective microorganism. Release of nucleic acid molecules (DNA) from a cell for the purpose of DNA detection normally requires cell disruption or cell permeabilisation. Preferably total DNA is extracted from a sample of each dilution culture. Methods for detection of the one or more nucleic acid molecule that is unique to the selected microorganism include Polymerase Chain Reaction (PCR) employing nucleic acid primers that can specifically amplify the one or more nucleic acid molecule. Other methods of nucleic acid molecule detection include hybridization with DNA probes that hybridize specifically with the nucleic acid molecule or its complementary strand. Suitable methods for DNA extraction and DNA detection by PCR or hybridization are detailed in standard textbooks e.g. Molecular Cloning a laboratory manual [17] The DNA detection step serves to identify which dilutions comprise the selected microorganism.

The frequency of said selected microorganism in said mixed culture is determined by dividing the dilution of the dilution culture where the said microorganism can be detected by the dilution of the most dilute sample in the dilution series where growth of the mixed microbial culture is observed.

The culture originating from the most diluted sample of the mixed culture in which the one or more nucleic acid molecule unique to the selected microorganism is detected is named P. The culture originating from the least diluted sample of the mixed culture in which the one or more nucleic acid molecule unique to the selected microorganism can no longer be detected is named N. The dilution factor between the diluted samples from which P and N originate is named D, where D is greater than 1, and will preferably be 10; and the total dilution factor for obtaining culture N relative to the undiluted mixed culture is Dt.

In step (c) between 2 and 500 replications of dilution culture N (starting from P and having the dilution factor Dt) are made in growth medium in order to increase the probability of finding the selected microorganism in at least one of these replicates. If dilution culture N originates from a 10-fold dilution of the diluted sample from which P originates, at least 10 - 20 replicates will be made of dilution culture N. The replicates of dilution culture N are allowed to grow in step (d) until sufficient cell mass is obtained for the subsequent detection step (e). Typically, the replicates will be grown under the same conditions as in step (b) to give approximately the same cell density as the cell culture from which the dilution was made (P). The presence of the one or more nucleic acid molecule that is unique to the selected microorganism is then detected in the replicate cultures of N, step (e). Only a fraction of the replicate dilution cultures of N will contain the nucleic acid molecule of the selected microorganism. However, in the cultures where the nucleic acid molecule of the selected microorganism is now detected, the frequency of the selected microorganism relative to other organisms in the culture will be higher. If for example the selected microorganism is detected in two out of 20 cultures, the frequency of the selected microorganism will now be approximately 10 fold higher than in the dilution culture (P) from which the dilutions were made. In step (f), a replicate dilution culture of N, in which the selected microorganism is detected, is then used as culture P for performing a new step (c) in a secondary cycle of dilution and selection. This cycle will be repeated until the frequency of the selected microorganism is greater than 10 ^"3 , preferably 10 ^"2 or even more preferably higher than 10 ^"1 . The number of repetitions of steps (c) to (f) is generally at least 1, but is more likely to require 2, 3, 4, 5 or 6 or more repetitions, where after the selected microorganism can then be isolated from a replicate dilution culture (N) comprising the selected microorganism, by using standard techniques for single cell colony isolation such as plating on solid growth medium, incubation and growth of single cell colonies followed by detection of the one or more nucleic acid molecule of the selected microorganism.

This method of isolation has the major and surprising advantage that it reduces the number of screening experiments from screening of thousands of isolated cells to screening of a few hundred. The method can be used to isolate a selected microorganism characterized by the deletion of a nucleic acid sequence (e.g. gene deletion mutant) or by the insertion of a nucleic acid sequence (e.g. gene insertion mutant). The method can also be used to isolate a selected microorganism characterized by containing a natural unique nucleic acid sequence which is not present in other microorganisms in the mixed culture.

The method is suitable for any microorganism capable of single cell growth in liquid culture, in particular bacterial and fungal (e.g. yeast) cells capable of single cell growth. The method is particularly useful for making marker-free deletions or insertions in extremophiles such as: • The acidophilic Archaea Sulfolobales, Thermoplasmatales, A MAN (Archaeal Richmond Mine Acidophilic Nanoorganisms), Acidianus brierleyi, A. infernus and Metallosphaera sedula, and the acidophilic Bacteria Acidobacterium and

Acidithiobacillales, Thiobacillus prosperus, Thiobacillus acidophilus, Thiobacillus organovorus, Thiobacillus cuprinus and Acetobacter aceti.

• The alkaliphilic Bacteria Geoalkalibacter ferrihydriticus, Bacillus okhensis, and

Alkalibacterium iburiense

• The halophilic Archaea belonging to the family of Halobacterium and halophilic bacterium Halobacterium halobium and Chromohalobacter beijerinckii.

• The hyperthermophilic archea Methanopyrus kandleri, Pyrolobusfumarii,

Pyrococcus furiosus, and the hyperthermophilic bacterium Geothermobacterium ferrireducens, and Aquifex aeolicus.

• Thermophilic Bacteria belonging to the Bacillus stearothermophilus species and the Thermoanaerobacter genus.

The method is particularly useful for isolating microbial cells which produce a product for which no selection procedure exist e.g. cells producing chemical building blocks such as:

• acids (such as maleic-, aspartic-, malonic-, propionic-, succinic-, fumaric-, citric-, acetic-, glutamic-, itaconic-, levulinic-, acotinic-, glucaric-, gluconic-, and lactic-acid),

• amino acids (such as serine, lysine, threonine),

• alcohols (ethanol, butanol, propanediol, butanediol, arabitol) or

• other high value products (such as acetoin, furfural, and levoglucosan), or

• cells which produce an enzyme in amounts that is insufficient for a selection procedure.

The method is particularly useful for isolating microbial cells which are present in the mixed culture of microorganisms at a frequency which is insufficient for detection of the activity of an expressed microbial enzyme.

A method of isolation solves the problem of how to isolate a selected microorganism without the need for any form of marker gene for selection purposes, and without the need to introduce genes into the microorganism to be selected such as a complete gene, [18] a heterologous recombinase, an antibiotic resistance marker, a plasmid or a transposon into the selected microorganism.

The invention futher provides a method of producing a fermentation product comprising culturing the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus according to any the above embodiments, under suitable conditions, such as a fermentation process is performed under strict anaerobic conditions. The fermentation process may be operated at temperature in the range of about 40-95oC, such as the range of about 50-90oC, such as the range of about 60-85oC, such as the range of about 65-75oC. The fermentation process is a batch fermentation process or a continuous fermentation process, and may be used for the production of a fermentation product selected from the group consisting of an acid, an alcohol, a ketone and hydrogen. Where the product is ethanol, the alcohol may be ethanol, butanol, propanol, methanol, propanediol or butanediol. Where the product is an acid, the acid may be any of lactic acid, propionic acid, acetic acid, succinic acid, butyric acid and formic acid. Where the product is a ketone, the ketone may be acetone.

The invention provides for the use of the genetically engineered thermophilic bacterium of the Thermoanaerobacter genus for the production of a fermentation product selected from the group consisting of an acid, an alcohol, a ketone and hydrogen.

Table 1

Sample N is replicated in at least D samples to increase the probability that the selected nucleic acid fragment is present in at least one sample microorganism is first sample in which the

selected for selected nucleic acid

screening. The fragment is not present.

Sample name:

selected

microorganism

contains a selected

known unique f) Selecting a cultivated sample containing the selected

nucleic acid nucleic acid fragment and repeating steps c to f until the

fragment. frequency of the selected microorganism is greater than

10 ³ , preferably greater than 0.1;

e) When this is achieved the procedure is completed in step

g) Isolating the selected microorganism using standard techniques d) The at least D samples are cultivated

Screening for the presence of the known

unique nucleic acid fragment using e.g.

PCR in the at least D samples.

Table 2

Fold of dilution: D=10

The 20 replicate samples were screened for the presence of the unique PAR nucleic acid fragment using PCR. In the first round of

repetition one out of four samples contained the PAR fragment.

EXAMPLES

Materials and methods

The following materials and methods were applied in the Examples below:

Enzymes and reagents: If not stated otherwise enzymes were supplied by MBI Fermentas (Germany) and used according to the suppliers recommendations. PCR-conditions were (15sec/15sec/15sec) _X 25 at temperatures (94°C/60°C /72°C). The products were amplified in a Techne PCR machine with Fermentas DreamTaq polymerase in PCR buffer (160mM (NH ₄ ) ₂ S0 ₄ ; 670mM Tris HCI (pH 8.8); 0.1% Tween-80, ImM Cresol Red, 0.125, 0.125M Ficoll 400). Gel electrophoresis: PCR results were evaluated on the basis of agarose gel electrophoresis using BioRad SubCell Equipment. Gels were run at 80V in 1% agarose for 20-30 minutes. Visualization was done by casting Ethidium Bromide (0^g/ml) into the gels.

Roll tube isolation: Hungate roll tubes [19] were used to isolate axenic cultures from solid surface cultivations. Isolations were transferred to liquid BA media [20]. Matrix screening of multiple samples: To establish a system for screening multiple samples simultaneously, pooling of samples was used. 20 samples were arranged in a matrix of 4 columns (A-D) x 5 rows (1-5). 400 μΙ from each sample (each column, A through D) were pooled into a single tube, and DNA from the mixture was used as PCR template. Individual samples from a column resulting in positive PCR were extracted and PCR amplified.

Cultivation and isolation: Pentocrobe 3120-411 (Thermoanaerobacter italicus) was originally isolated on solid surface cultivation medium using Hungate Roll Tu bes (Hungate 1969) and adapted to fermentation conditions through several generations in fully suspended reactors. HPLC: Sugars and fermentation products were quantified by HPLC-RI using a Dionex Ulitimate 3000 (Dionex corp., USA) fitted with an Rezex ROA-organic Acid 300x7.8mm (Phenomenex, USA) combined with a SecurityGuard Cartridge Carbo-H 4*3.0 mm. The analytes were separated isocratically with filtrated (0.22 μιη) 4mM H2S04 and at 60°C. Samples were centrifuged at 14.000 G for 10 minutes. All analytes were diluted to a maximum of 20 g/L using MQ-water.

Substrates and Chemicals: Pretreated material: Hammer milled wheat straw was pre- treated in a continuous pre-treatment system (BioGasol ApS WO2010081476,

WO2010081477, WO2010081478). The parameter settings were 165°C and 0.4% v/v sulphuric acid with a retention time 15 minutes. The resulting material was diluted to 20% DM, enzymatically hydrolyzed and separated on a Larox filter (Uototec, Finland). No removal of soluble fermentation inhibitors was carried out.

Fermentation Setup & Strategy: Continuous fermentations were carried out using suspended cells in water jacketed glass reactors with working volumes of 575 ml and a height/width ratio of around 6:1. Stirring was introduced by a magnetic bar of 6 X 25 mm and an IKA-Digital stirrer (Germany) operating at 350 rpm. Hot water was recirculated from a GD120 water bath (Grant, England) and fed parallel to either two or three identical reactors.

The entire reactor system was autoclaved at 121°C for 30 minutes, filled with sterile basal anaerobic medium (BA) (Larsen et al. 1997) supplemented with 2 g/L yeast extract and inoculated with a fresh culture of Pentocrobe BG463. Liquid samples for HPLC were taken from a sampling port located at the reactor top. The pH was maintained at 7.0 by addition of NaOH (2 M).

All media were prepared following a standard procedure and sterility was obtained by autoclaving. Carbon- and nitrogen sources were handled separately preventing undesired Maillard reactions during the sterilization process. Antifoam 204 (Sigma Aldrich, Germany) was added in concentrations ranging between 0.1 and 0.2%.

EXAMPLE 1 Marker-free gene deletion and insertion in a Thermoanaerobacter strain

1.1 Strains and growth conditions Thermoanaerobacter strain BGIO is deposited with DSMZ (DSMZ - Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg lb, 38124 Braunschweig) under deposit number 23015. All microbial strains were cultured at 70°C anaerobically in minimal medium (BA) with 2 g/L yeast extract as in unless otherwise stated. For solid medium, roll tubes containing BA medium with 11 g/L phytagel and additional 3.8 g/L MgCI ₂ -6H ₂ 0 was used., Escherichia coli ToplO (Invitrogen, USA) was used for cloning purposes. ToplO was routinely cultivated at 37°C in Luria-Bertani medium [17]

supplemented with 100 μg/mL ampicillin when needed.

1.2 Construction of Thermoanaerobacter BGlOAIdh strain

The LDH gene was deleted from the Thermoanaerobacter BG10 wt strain (DSM 23015) by homologuous recombination as described in [13] to generate LDH deficient strain BGIOXL.

1.3 Construction of the parM-ext insertion cassette

The DNA fragment used for insertion of the parM-Ext fragment into the lactate

dehydrogenase region of BGIOXL genome was cloned in the vector p3del-ParV2-K13, shown in Figure 1, and contains:

1) a DNA fragment upstream of the l-ldh gene of BG10, amplified using primers

IdhuplF ([SEQ ID NO:l]; 5' - TTC CAT ATC TGT AAG TCC CGC TAA AG - 3') and ldhup2 ([SEQ ID NO:2]; 5' -ATT AAT ACA ATA GTT TTG ACA AAT CC - 3'),

2) A non-coding parM-ext fragment used solely for identification, amplified using primers: parM-ext-Fw ([SEQ ID NO: 3]; 5' - CCC CCC GTT AAC ATC AAA CTA CAG TGG CAG GAA AG - 3') & parM-ext-re ([SEQ ID NO: 4]; 5' - CCC CCC TGC AGC GTT GCT TCA GAT AGT TAT TAT CTT TTC TG - 3')

3) a DNA fragment downstream of the l-ldh gene of BG10, amplified using primers ldhdown3F ([SEQ ID NO:5]; 5' - ATA TAA AAA GTC ACA GTG TGA A - 3') and ldhdown4R ([SEQ ID NO:6]; 5'- CAC CTA TTT TGC ACT TTT TTT C - 3').

The p3del-ParV2-kl3 vector was amplified in E. coli GM2163 (CGSC 6581) and isolated using midi-size preparation (Nucleobond) as described in [21]. 1.4 Linearization of the vector - p3del-ParV2-K13 comprising the parM-ext insertion cassette

Quantification of the vector prior to digestion was carried out using an Eppendorf BioPhotometer, using the built in "DNA ds quantification". 50 μΙ vector p3del-ParV2-K13 was digested using restriction enzyme Ndel in a 100 μΙ reaction using 5μΙ Ndel fast Digest Enzyme. Digestion was carried out over night (ON) at 37°C in Fermentas fast digest buffer. Linearization was verified on a 0.7% agarose gel.

1.5 Transformation of Thermoanaerobacter BG10XL with linearized p3del- parM-ext 100 μΙ Ndel digested vector (~10 μg/μl) (p3del- parM-ext) was cooled to 0°C and mixed with 100 μΙ fully grown culture Thermoanaerobacter BGIOXL. The mixture was transferred to pre-cooled growth media, and incubated at 70°C for 16 hours. Subsequent to transformation and 16 hours incubation, four consecutive cultivation steps were applied using an inoculum of 1%. Consecutive transfers were implemented to eliminate a false positive signal originating from the Ndel digested transformation template rather than from the actual targeted inserted fragment. The mixed culture now contained the cells in which the antibiotic resistance marker (HTK) in BGIOXL was removed by substitution with the parM-ext element (the selected microorganisms) and cells in which substitution had not taken place (BGIOXL). The frequency of the selected microorganism was determined by dilution and detection of the parM-ext element.

1.6 PCR detection of parM-ext fragment

PCR-conditions applied in the screening procedure were: Denaturing at 94°C (15s), annealing at 60°C (15s), elongation at 72°C (15s). The PCR cycle was repeated 25 times in a Techne Progene PCR machine. Polymerase used was DreamTaq polymerase (Fermentas) and primers used in the screening were; parM-ext-Fw3 ([SEQ ID NO:7] 5' - GGC AAT ACA GCG ACG TTA ATG - 3') parM-ext-Re ([SEQ ID NO:8] 5' - CCC CCC TGC AGC GTT GCT TCA GAT AGT TAT TAT CTT TTC TG - 3')· 1.7 Detection and isolation of marker free Thermoanaerobacter BGIOXL transformed with parM-ext insertion cassette

The following steps were then performed to isolated and identify a Thermoanaerobacter BGIOXL, in which the kanamycin resistance cassette had been successfully replaced by theparM-ext insertion cassette , containing a known unique consecutive sequence of 703 bp which was used to detect the successful transformation by PC . Starting from the fully grown culture obtained immediately after the fourth transfer had successfully been completed (1.5), an initial 10-fold dilution series were set up in growth medium and incubated under the same growth conditions (Table 2). Growth was detected in cultures diluted up to 10 ^"9 . DNA was isolated from each of the cultures, followed by PCR screening for the presence of the parM-ext fragment. The fragment was only detected in dilutions from 10 ^"1 to 10 ^"4 , i.e. the frequency of the selected microorganism was approximately 1E-5 (1E-4 divided by 1E-9). 20 replicates of 10 ^s dilutions of the same culture (where the parM-ext fragment was not detectable) were prepared, and incubated over night to obtain fully grown cultures.

Four mixtures, each containing five individual dilution replicates (in total 20) were analyzed by PCR for the presence of the PAR-M-ext sequence (Figure 2). As seen Figure 2, at least two out of four mixtures (composed of pooled 10 ^s dilution cultures) contained parM-ext (5Cm and 5Dm). Further analysis of the individual five cultures from mixture 5Dm revealed that one out of four individual cultures in the 5Cm mixture contained the inserted parM-ext sequence (5C1, Figure 3). As one selected microorganism is now present in a 1E-5 dilution of a culture that grows to 1E-9, the frequency is now increased compared to the previous culture.

The fully grown culture 5C1 was used to make 20 dilution cultures each diluted by an additional factor of 10 fold to give a total dilution of 10 ^"6 with respect to the undiluted starting culture (5C1). The cultures were then grown overnight. Again, the presence of the parM-ext fragment was analyzed in mixtures of pooled samples of the 10 ^"6 dilution cultures and was subsequently identified in the single cultures 6D1, 6D2 and 6D4 (Figure 4). The frequency of the selected microorganism in 6D4 was now approximately 1E-3 (1E-6 divided by 1E-9). Tube 6D4 was used to set up 20 dilution cultures, each diluted by an additional factor of 10 fold to give a total dilution of 10 ^"7 with respect to the undiluted starting culture (6D4), and the cultures were allowed to grow overnight. The presence of the parM-Ext fragment was identified in culture 7D5 as seen in Figure 5. The frequency of the selected microorganism in 7D5 was now approximately 1E-2 (1E-7 divided by 1E-9).

7D5 was used to make 20 dilution cultures, each diluted by an additional factor of 10 fold to give a total dilution of 10 ^s fold with respect to the undiluted starting culture (7D5), which were allowed to grow over night. The presence of the parM-ext fragment was identified in culture 8A5 as seen in Figure 6.

8A5 was used to make 20 dilution cultures, each diluted by an additional factor of 10 fold to give a total dilution of 10 ^"9 fold with respect to the undiluted starting culture (8A5), which were allowed to grow. The presence of the parM-ext fragment was identified in culture 9A2 as seen in Figure 7. The frequency of the selected microorganism in 9A2 was now estimated to be between 0.1 and 1 (1E-9 divided by 1E-9).

From 9A2, roll tubes were prepared in order to isolate pure cultures with a parM-ext genomic insertion. After two days of incubation, 5 single colonies were picked from Hungate Roll Tubes and incubated in each 10 ml of liquid medium. Two out of five monocultures contained the parM-ext fragment. The correct insertion of the parM-ext fragment [SEQ ID NO:9] was verified using primers in regions upstream and downstream of the lactate dehydrogenase.

The resulting PCR positive cultures were checked by PCR using primers annealing outside the region used for homologous recombination. In this way, Idh loci in which no recombination have taken place will also be amplified although the fragment will be of different length. Primers LDH-out-Up ([SEQ ID NO:10] 5' - GAG CTG CTT TAA GTG TCT CAG G - 3') and LDH-out-Dn3 ([SEQ ID NO:ll] 5' - GAA GTG GAT CCT TTA TAG GCC GGT - 3'). PCR conditions were identical to those described under "PCR detection of parM-ext fragment" but with a prolonged elongation time (2 minutes 30 seconds). The lactate dehydrogenase was efficiently removed and replaced with a parM-ext fragment without the need for an antibiotic resistance gene or any other functional DNA sequence to be incorporated into the genome of the bacterium. A total of 150 cultures and PC reactions were used to find the selected organism which has a frequency of 10 ^"4 . Should the identification have been made without the use of the current invention, which serves to increase the frequency of the selected microorganism, at least 10,000 single cultures would have had to be grown and PCR analyzed.

The resulting strain is deposited in the German Resource Centre for Biological Material (DSMZ) under the name Thermoanaerobacter italicus Pentocrobe 3100-401 with deposition number DSM 24725.

EXAMPLE 2 -Inactivation of the pta and ak genes in a Idh deletion mutant of Thermoanaerobacter italicus and engineering of the marker free double deletion mutant

The aim of this experiment was to isolate a mutant of BG401 with a deletion of

Phosphotransacetylase (PTA) and Acetate Kinase (AK). The experiment was divided into two consecutive steps: (1) initially knockout of PTA/AK by introduction of an antibiotic resistance gene (HTK). Followed by (2) antibiotic resistance marker removal; to produce a resulting in a strain which does not produce acetic acid, and does not contain the antibiotic resistance gene (HTK). 2.1 - PTA/AK knockout in BG401

Transformation vector: The transformation vector (p3-PKA-Large) was extracted from a plasmid extraction obtained using Plasmid Mini extraction kit (Aabiot, Poland) in the following mixture: 100 μΙ plasmid, 40 μΙ Fast digest buffer (Fermentas), 4 μΙ Ehel

(Fermentas), and 256 μΙ MQ. A graphical illustration of the vector can be found in Figure 10. The digest was carried out for 2 hours to ensure complete digestion.

Transformation: The knockout vector was introduced to BG401 by adding 100 μΙ vector digest (~1 μg/μl) pre-cooled to 0°C and mixed with 100 μΙ fully grown culture

Thermoanaerobacter, BG401. The mixture was transferred to pre-cooled growth media, and incubated at 65°C for 16 hours. Su bsequent to transformation and 16 hours incubation, one additional cultivation steps was applied using an inoculum of 1% (ΙΟΟμΙ grown culture + 9,9 ml media) supplemented with 100 μg/ml kanamycin (Sigma-Aldrich).

Roll tube isolation: A dilution series was used to produce a series of Hungate Roll Tubes (22) and 10 colonies were isolated from the roll-tubes at dilution 1E-6. Incubation was maintained at 65°C. A visual evaluation was carried out, aimed at selecting the isolations with the fastest growth (least transparent after overnight growth), and isolates "Isolate 1" and "Isolate 6" were selected for further analysis optimization.

PCR Verification of isolated mutants: Verification of successful insertion of the DNA fragment had occurred was done by PCR screening. PCR was done with primers:

PTAl-out-up-F (5'-GGTAAAGGTGTCCGTAGTGAAAAGC-3') [SEQ ID NO:15] and

AKl-out-dnl-re (5' - CCAATACTCTCAACGTCTTCCAC - 3' [SEQ ID NO:16].

PCR conditions were: (94/60/72)x25. As seen in the agarose gel (Figure 9) both samples "Isolate 2" & "Isolate 6" resulted in PCR products of the expected size (equal to positive control). After verification, "Isolate 1" was further subjected to another round of roll tube isolation followed by non-selective media incubation and it was thereafter deposited as BG411 in DSMZ 26410.

2.2 Marker removal

The following task was then to remove the kanamycin resistance gene (HTK) initially used to replace partial sequences of phospohtransacetylase (PTA) and acetate kinase (AK) in BG401 with a known non-coding DNA sequence, "14K". The vector used in the marker substitution was p3dPKA-14K-Bgl0dn, which has been developed from vector p3PKA-Large by substituting the HTK gene with the non-coding "14K" fragment. "14K" has no other apparent function than to serve as a known sequence which can be detected by PC primers. A graphical representation of the vector p3dPKA-14K-BG10dn is shown in Figure 10.

Transformation: The transformation procedure was identical to the procedure described above where 100 μΙ fully grown BG411 were transformed with 100 μΙ Ehel digested vector of p3dPKA-14K-BG10dn. Once transformation had been carried out, 4 consecutive transfers in BAxyl were carried out to ensure that background template was no longer detectable by PCR in the mixture. Every consecutive transfer was carried out by transferring 100 μΙ grown culture to 9.9 ml of fresh media. The mixed culture now contained the cells in which the antibiotic resistance marker (HTK) was removed by substitution with the 14k element (the selected microorganisms) and cells in which substitution had not taken place. The frequency of the selected microorganism was determined by dilution and detection of the 14k element.

Primary detection: The fourth transfer was then used to generate a primary dilution series, to verify a successful insertion of the "14K" DNA. After the dilution series had been cultivated for 18 hours DNA was extracted from lE-1→ 1E-5. A "14K" PCR was set up to evaluate the efficiency of transformation. Primers used for detection were:

14K-fw2 (5'-CAGAACCGAAACCACAAAGCC-3') [SEQ ID NO:17] and

14K-re2 (5'-TTACGAGCGTGTACTGAGAAC-3') [SEQ ID NO:18] resulting in amplicons of 156 bp. A total growth in the dilution series was seen to extent to lE-10.

Weak 14k PCR products were seen by gel electrophoresis in dilution 1E-4 (and less diluted samples) from a dilution series growing to lE-10 (Figure 11). The frequency of the selected microorganism was therefore approximately 1E-6 (1E-4 divided by lE-10). Based on the information, that a PCR product could be seen in a dilution series growing to lE-10, a rough estimate was that the next series of screening should be carried out on 1E-5 dilution. However, it was often seen, that dilutions only grew to dilution 1E-9 and it was thus, evaluated that 1E-4 could be the next targeted dilution as well.

The mixed culture containing the cells in which the antibiotic resistance marker (HTK) was removed by substitution with the 14k element (the selected microorganisms) and cells in which substitution had not taken place was now diluted in growth medium. 20 replicate samples each of the 1E-4 and 10-5 were made to provide diluted cultures. A graphical illustration showing the individual diluted cultures in the matrix is included in Figure 12. After overnight growth of each of the cultures in the above mentioned matrix system, DNA was extracted from mixtures of samples taken from tube 4A1-5 (4Am), 4B1-5 (4Bm), 4C1-5 (4Cm), 4D1-5 (4Dm), and from mixtures of samples taken from tube 5A1-5 (5Am), 5B1-5 (5Bm), 5C1-5 (5Cm), 5D1-5 (5Dm). The most dilute mixture from where 14K-PCR resulted in a PCR product was sample 5Bm (mixture of 5B1, 5B2, 5B3, 5B4, & 5B5). The agarose from the screening can be found in the gel in Figure 13.

2ml from each of the individual tubes (from 5Bm) was extracted and the resulting PCR showed easily recognizable presence of the targeted organism in samples. 5B2 was selected as the tube from where the most intense PCR product was generated. Here, 1E-5 is the most dilute culture from which the 14k nucleic acid molecule is detected (P). The least diluted culture in which 14k is not detected is 1E-6 (N) and the dilution factor is 10. The total dilution factor Dt is 1E-6. As growth was detected in lE-10 dilutions of the mixed culture and the target molecule was detected in 1E-5, the frequency of the selected microorganism is now 1E-5 and is therefore increased as compared to any dilution of the original mixed culture from undiluted to 1E-4.

The procedure was repeated, targeted primarily at dilution Dt =1Ε-6. This was done by selecting 5B2 for dilution and matrix set up as above except that 20 each of 1E-5 and 1E-6 dilutions were made. 14K PCR product was observed in all mixed samples from 5Am-5Cm samples but also in two of the more dilutemixed samples: 6Am and 6Cm. Samples 6C1-5 were analysed individually, and the resulting agarose gel can be found in the figure 14. As growth was detected in lE-10 dilutions of the mixed culture and the target molecule was detected in 1E-6, the frequency of the selected microorganism is now 1E-4 and is therefore increased as compared to any dilution of 5B2 from undiluted to 1E-5.

Sample 6C1 was selected as the one positive sample containing the 14k molecule from the mixture, and this sample was used for the next dilution, 1E-7, and the associated matrix was set up with multiple tu bes in dilutions 1E-6 and 1E-7. DNA was extracted from 1E-5, 6Am-6Dm, and 7Am-7Cm. 14k was detected in 7Cm and cultures 7C1-5 were therefore analyzed individually for the presence of the selected microorganism. From these individual samples it was clear that sample 7C3 was the one contained in the selected microorganism containing the 14k molecule.The resulting agarose gel can be found in figure 15.

Sample 7A1 was used for dilution, targeting dilution tubes in 1E-8, and the gel is shown in figure 16.

2.3 Solid surface isolation - and "matrix" screening of isolates.

Mixture 7C3 was selected for inoculation onto a solid surface op BA-Phythagel plates. The A requirement for approximately 100-1000 isolated colonies was estimated as the frequency of the selected microorganism is now approximately 1E-2 (14k is detected in sample 7C3 in a dilution of 1E-7 selected from a dilution series growing to 1E-9.

The sample "7C3" was diluted to 1E-5 to establish a quantity suitable for producing multiple single colony forming units (CFU) and plated onto BA-phytagel plates. After overnight growth each colony was picked from the surface and transferred into a separate micro-titer well containing ΙΟΟμΙ BAxyl to generate 80 colonies different isolated samples on each micro-titer plate. The microtiter plates were covered with adhesive plastic film prior to incubation at 70°C for 16 hours.

To enable handling of the large number of samples (480 isolates in 6 plates), the matrix screening method was once again implemented. After 16 hours of incubation, 20 μΙ from each individual well of a micro-titer plate was used as template for DNA extraction. This screening was used to determine whether the targeted isolate was among the 80 samples in the micro-titer plate or not. The gel of all 14k PC from DNA extracted from each of the six micro-titer plates is shown in Figure 3. As seen in the image (Figure 3) at least one sample from plate 3 and plate 4 contain the correct target i.e. the frequency of the selected microorganism was at least 2/480 = 0.4% in the 7C3 culture. From microtiter plate #3, 20 μΙ from each well of a column (columns 2-11) were pooled into mixtures representing each 8 individual cultures, DNA was extracted and PCR was applied to detect which column(s) contained the 14k molecule. The PCR gel from the screening of rows can be found in (Figure 4).

DNA from 20 μΙ of each of the samples (A-H) in column 8 was extracted individually and well 8B was found to result in correct PCR product (Figure 5). For verification of purity, the "negative" PCR was also included where the marker to be removed (HTK) was targeted. Figure 5 shows that no PCR product was seen from sample 8B indicating successful removal of the resistance marker whereas sample 8A was not found to have the marker removed as a PCR did indeed result from this sample. The resulting PCR gel illustrating the successful marker removal is found in Figure 5.

EXAMPLE 3 - Sucrose adaptation of double mutant strain BG463

The aim of adaptation was to develop a culture, which could efficiently ferment sucrose into ethanol. Initially the applied substrate (sucrose) was sterile filtered to avoid contamination from other thermophilic organsims such as e.g. Geobacillus

stearothermophilus. Growth conditions were created by adding sterile filtered sucrose to a final concentration of 3-5 g/l, in otherwise standardized anaerobic growth medium. ΙΟΟμΙ from a freeze culture (BG463) was used for initial inoculum. The cultures were kept in 10 ml anaerobic containers, and were grown at 70°C. When growth was easily recognized by visual inspection ΙΟΟμΙ actively growing culture was transferred to fresh growth medium.

3.1 Starting point

During the first transfers, growth on sucrose was monitored and was evaluated to be insufficient, as 48-72 hours were required for full conversion of the added sucrose. HPLC values after the first 24 hours of growth were: Glucose: 1.2 g/l, Fructose: 1.1 g/l, Lactate: 0.06 g/l, Acetate: 0.1 g/l, and Ethanol: 0.77 g/l. Sucrose is detected as glucose and fructose on the HPLC and the sum of the two is used as the sucrose concentration.

3.2 Adaptations/Transfers Initially, directed selection (adaptation) was introduced by transferring 100 μΙ culture to fresh medium for every 24 hours of growth. By doing so, the fastest growing bacteria (highest fitness) in the mixture would be most abundant, and would consequently also be the most abundant strain inoculated into fresh medium during transfers. After the 8th transfer, a growth rate was achieved where transfers were enabled twice a day, putting even more stress on the fermentation organisms regarding fast substrate fermentation. After 19 transfers, a full adaptation towards complete fermentation of the introduced substrate had been achieved. A nearly complete fermentation was obtained after 24 hours of fermentation, and ethanol was observed as (close to) the only generated product.

Lactate and Acetate were only generated in negligible amounts.

The ethanol yield was used as primary verification of adaptation success, and the calculated yield was 0.453 g Ethanol/g sugar (including glycerol).

Table 3. Concentrations of sugars, lactate, acetate and ethanol before and after 24 hour incubation of BG463 in a 10 ml batch as described above.

EXAMPLE 4 - Continuous thermophilic fermentation using strain BG463

A continuous reactor system was set up as described in materials and methods. All influents were prepared using C5 liquor from pretreated biomass at 10% dry matter produced as above to which dextrose monohydrate ( oquette, France) was added in a concentration simulating the result of an enzymatic hydrolysis with 80 % efficiency. Batch conditions were maintained for 18 hours before the continuous wheat straw based influent was started using a hydraulic retention time of around 111 hours.

The influent sugar concentration in this example was glucose 30.6, xylose 20.0, and arabinose 3.2 g/L (53.8 g/L total concentration) and the resulting ethanol concentration at this influent concentration was 23.4 g/L. On average 0.6 and 0.5 g/L acetic acid and lactic acid were produced respectively and the sugar conversion was 100, 85 and 59% for glucose, xylose and arabinose respectively (Figure 17 and 18).

In a separate experiment, BG463 was grown on C5 sugar containing liquid from pretreated biomass at 15% dry matter with additional xylose added. The influent sugar concentration in this example was glucose 52.8, xylose: 32.9, and arabinose 3.6 g/L (89.3 g/L total concentration) and the resulting ethanol concentration at this influent concentration was 39.7 g/L. Sugar conversion was 83, 72 and 77% for glucose, xylose and arabinose respectively.

EXAMPLE 5: Halogenated compounds are shown be ineffective as growth inhibitors in Thermoanaerobacter

To assess the potential for introducing a specific inhibitory effect on Thermoanaerobacter strains by halogenated compounds as described for Thermoanaerobacterium strains using pyrF/5FOA [1] four different variants of halogenated acetate were tested. Floro-, Bromo-, Chloro-, & lodo-acetates were tested at different concentrations. Targeted genes in this assay were PTA/AK genes, and thereby the enzymes produced to catalyze the conversion to acetate from acetyl-CoA. However, in addition, these enzymes can also catalyze the opposite reaction making it possible for the bacteria to take up acetate. Thus, if a halogenated chemical compound taken up, the strain will be inhibited as the compound is toxic to the strains. However, this will only be suitable if PTA & AK genes are functional in the strain and when they mediate the conversion of the compound. If the strain does not have the PTA + AK genes, and is not inhibited by the chemical compound the system can potentially be used as a counter selection method.

5.1 The method:

Two strains were included in the current experiment: BG401 (-LDH, +PTA, +AK) and BG411 (-dLDH, -dPTA, -AK). As both strains were derivate of the same strain BG10 (BG302) the only difference between the two is one knock out (PTA & AK) in BG411 whereas BG401 still have the indigenous genes in this region. If the halogenated acetate variants were to be applied as counter selection in the tested Thermoanaerobacter strains, they should inhibit only BG401 (with the intact PTA & AK), whereas BG411 should continue to grow unaffected.

Concentrations tested on the two strains can be found in Table 4.

+ = growth observed

- = No growth observed

Based on the above listed results fluoroacetate was initially selected for further studies. To obtain a maximal effect, evaluated by inhibition of BG401 at conditions where no inhibition was observed on BG411, FA concentrations were increased to 50 mM & 100 mM and OD600 was used as quantitative measurement of cell growth (after 24h). The results of the inhibitory effect can be found in Table 5.

As seen in the table, an easily recognizable inhibition was observed in BG401 whereas no inhibition was seen on BG411. Based on the conducted experiments, it was concluded that an inhibition was observed at concentrations of 20mM and above.

However, it was never possible to fully obstruct growth in the tu bes regardless of the applied FA concentration. Consequently, OD-values of approximately 0.15-0.20 were always observed after incubations. In addition, the observed inhibition was not maintained during consecutive transfers. After the first transfer to fresh medium it was easily recognized, that inhibition was no longer as efficient as seen in the initial incubation. Transfers thereafter showed no inhibition, resulting in OD values fully comparable to the non-influenced control tube. Thus, in all experiments BG401 has adapted to circumvent the chemical inhibition. The adaptation mechanism is believed to occur almost instantaneously in (at least) a sub- population from first inoculation, as the phenotypic effect is already visable after first transfer to fresh media. After the second transfer, no inhibitory effect was observed, regardless FA concentration.

5.2 Chloro-, Bromo-, & lodo-acetate compounds:

It was also studied whether the observed inhibitory effect and associated adaption could also be observed when other suggested halogenated variants of acetate were applied to the growth media.

From the results of Table 1, it was obvious that the initially tested concentrations did influence both strains in the experiment. Thus an attempt to find a suitable window of concentrations was carried out, and multiple concentrations were tested. However, none of the three compounds were found to induce the same specific inhibition on BG401. As a consequence thereof, multiple decreased concentrations of the compounds were tested to determine the minimal inhibitory concentration (MIC). Although the acetate-based system had been verified using FA, it was not possible to find concentrations where BG401 was inhibited when, at the same time BG411 was not.

For all experiments the tolerance to the halogenated acetate gradually increased during consecutive transfers, ending in adapted BG401 strains, where no inhibition was observed regardless of halogenated compound tested.

The initial concentrations and associated growth is listed in the Table 6

However, after three consecutive transfers, none of the halogenated acetate variants could be used to induce inhibition at the tested concentrations, and both strains seemed to adapt to higher concentrations, simultaneously. Based on the apparent adaptation, it was found that the halogenated acetate variants could not be applied in a counter-selective system targeted at Thermoanaerobacter, as an adaptation to the otherwise toxic compound was observed for all the tested chemicals.

The observed results of this study corresponds well with our previous observations from inhibition studies of Thermoanaerobacter sp. where otherwise toxic compounds 5-FOA had no effect on Thermoanaerobacter matranii (DSM 11426) at conditions comparable to those applied to inhibit Thermoanaerobacterium [23]. Moreover, it was also found that strains Thermoanaerobacter italicus (DSM 9252) & Thermoanaerobacter ethanolicus (DSM 2246) & Thermoanaerobacter wiegelii (DSM 10319) responded identically to the introduced halogenated chemicals, as a general initial inhibition was observed, but was diminished as a result of an adaptation/mutation in all tested strains. Thus, it was concluded that a halogenated chemically induced specific inhibition was found to be non-applicable to the tested Thermoanaerobacter strains.

Bloor, A. E. & Cranenburgh, . M. An efficient method of selectable marker gene excision by Xer recombination for gene replacement in bacterial chromosomes. Appl Environ Microbiol 72, 2520-2525, (2006).

Leenhouts, K. et al. A general system for generating unlabelled gene replacements in bacterial chromosomes. Mol Gen Genet 253, 217-224, (1996).

Link, A. J., Phillips, D. & Church, G. M. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J Bacteriol 179, 6228-6237, (1997).

Court, D. L, Sawitzke, J. A. & Thomason, L. C. Genetic engineering using homologous recombination. Annual Review of Genetics 36, 361-388, (2002).

Leslie, N. R. & Sherratt, D. J. Site-specific recombination in the replication terminus region of Escherichia coli: functional replacement of dif. Embo Journal 14, 1561-

1570, (1995).

Morimoto, T., Ara, K., Ozaki, K. & Gasawara, N. A new simple method to introduce marker-free deletions in the Bacillus subtilis genome. Genes & Genetic Systems 84, 315-318, (2009).

Zubko, E., Scutt, C. & Meyer, P. Intrachromosomal recombination between attP regions as a tool to remove selectable marker genes from tobacco transgenes. Nature Biotechnology 18, 442-445, (2000).

Datsenko, K. A. & Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America 97, 6640-6645, (2000).

Sugita, K., Kasahara, T., Matsunaga, E. & Ebinuma, H. A transformation vector for the production of marker-free transgenic plants containing a single copy transgene at high frequency. Plant Journal 22, 461-469, (2000).

Sanchis, V., Agaisse, H., Chaufaux, J. & Lereclus, D. A recombinase-mediated system for elimination of antibiotic resistance gene markers from genetically engineered Bacillus thuringiensis strains. Applied and Environmental Microbiology 63, 779-784, (1997).

Zakataeva, N. P., Nikitina, O. V., Gronskiy, S. V., Romanenkov, D. V. & Livshits, V. A. A simple method to introduce marker-free genetic modifications into the chromosome of naturally nontransformable Bacillus amyloliquefaciens strains. Applied Microbiology and Biotechnology 85, 1201-1209, (2010).

Tripathi, S. A. et al. Development of pyrF-Based Genetic System for Targeted Gene Deletion in Clostridium thermocellum and Creation of a pta Mutant. Applied and Environmental Microbiology 76, 6591-6599, (2010).

Mikkelsen, M., Just (Stenl0sevej 52, Br0nsh0j, DK-2700, DK) & Ahring, B., Kiaer (Fruerh0j 43, H0rsholm, DK-2970, DK). Thermoanaerobacter mathranii Strain BG1. (2007).

Vlieg, J., Poelarends, G. J., Mars, A. E. & Janssen, D. B. Detoxification of reactive intermediates during microbial metabolism of halogenated compounds. Current Opinion in Microbiology 3, 257-262, (2000). 15 The International Service for the Acquisition of Agri-biotech Applications (ISAAA). Pocket K No. 36: Marker-Free GM Plants. (2009).

16 Lorenz, P. & Eck, J. Metagenomics and industrial applications. Nat Rev Micro 3, 510- 516, (2005).

17 Sambrook, J. & Russell, D. W. Molecular Cloning a laboratory manual. (Cold Spring Harbor Laboratory Press, 2001).

18 Ethanol production by thermophilic bacteria: physiological comparison of solvent effects on parent and alcohol-tolerant strains of Clostridium

thermohydrosulfuricum. Applied And Enviromental Microbiology 48, 171-177, (1984).

19 Hungate, R. E. in Methods in microbiology eds J. R. Norris & D. W. Ribbons) Ch. 4, 118-132 (Academic Press, 1969).

20 Angelidaki, I., Petersen, S. P. & Ahring, B. K. Effects of Lipids on Thermophilic

Anaerobic-Digestion and Reduction of Lipid Inhibition Upon Addition of Bentonite. Applied Microbiology and Biotechnology 33, 469-472, (1990).

21 Mikkelsen, M., Just (Stenmaglevej 13, Br0nsh0j, DK-2700, DK) & Yao, S. G. P., st. th, S0borg, DK-2860, DK). Increased Ethanol Production in Recombinant Bacteria. (2010).

22 Hungate RE. A roll tube method for cultivation of strict anaerobes. In: Norris JR, Ribbons DW, editors. Methods in microbiology. New York: Academic Press; 1969. p.

118-32.

23 Shaw, A.J., et al., A marker removal system for Thermoanaerobacterium

saccharolyticum and development of a markerless ethanologen. Appl Environ Microbiol, 2011,

24 Reyrat et al., Counterselectable markers: untapped tools for bacterial gentics and pathogenesis, Infection and Immunity 66, 4011-4017, (1998).

1 /2

PCT

Print Out (Original in Electronic Form)

(This sheet is not part of and does not count as a sheet of the international application)

Indications are Made All designations

FOR RECEIVING OFFICE USE ONLY

0-4 This form was received with the

international application:

(yes or no) YES

0-4-1 Authorized officer

Appelen, Annik