ZHANG, Hangning (4239 NW 35th Street, Gainesville, FL, 32605, US)
ALTPETER, Fredy (3415 NW 60th Lane, Gainesville, FL, 32653, US)
ZHANG, Hangning (4239 NW 35th Street, Gainesville, FL, 32605, US)
| CLAIMS
We claim:
1. A transformed or transgenic grass having an improved vegetative characteristic, wherein said grass comprises a heterologous polynucleotide, wherein said polynucleotide encodes a leucine zipper class I protein, or a protein having the same or substantially the same biological activity as Arabidopsis ATHB 16 protein, or a biologically active fragment thereof.
2. The grass according to claim 1, wherein said grass is a turfgrass or a forage grass.
3. The grass according to claim 2, wherein said turfgrass is selected from the group consisting of Bahiagrass, St. Augustine, Bermudagrass, Bentgrass, Zoysia, Tall fescue, Perennial Ryegrass, Kentucky Bluegrass, Buffalograss, Carpetgrass, Seashore Paspalum, and Centipedegrass.
4. The grass according to claim 2, wherein said forage grass is selected from the group consisting of Bahiagrass, Bachiaria, Stargrass, Bermudagrass, Tall Fescue, Perennial Ryegrass, Annual Ryegrass, Rye, Wheat, Pennisetum, and Limpograss.
5. The grass according to claim 3 or 4, wherein said grass is Bahiagrass.
6. The grass according to claim 5, wherein said Bahiagrass is the cultivar "Argentine."
7. The grass according to claim 1, wherein said polynucleotide is provided in an expression construct.
8. The grass according to claim 7, wherein said expression construct provides for overexpression or constitutive expression of said polynucleotide and/or the protein encoded thereby.
9. The grass according to claim 1, wherein said improved vegetative characteristic is one or more of suppressed or reduced numbers of seedheads, delayed or later seedhead production, increased vegetative tillers per plant, shorter tillers, shorter leaves, finer leaves, reduced senescence, increased forage quality, and increased resistance to abiotic stress conditions such as drought and temperature (e.g., resistance to cold and/or heat stress conditions).
10. The grass according to claim 1, wherein said polynucleotide encodes an Arabidopsis ATHB 16 protein, or a biologically active fragment thereof.
I L The grass according to claim 1, wherein said polynucleotide comprises the nucleotide sequence shown in SEQ DD NO: 1.
12. The grass according to claim 1, wherein said polynucleotide comprises the nucleotide sequence shown in SEQ ID NO: 7.
13. The grass according to claim 1, wherein said Arabidopsis ATHB 16 protein comprises the amino acid sequence shown in SEQ ED NO: 2.
14. A method for producing a transformed grass having an improved vegetative characteristic, comprising introducing a heterologous polynucleotide into a grass, or a tissue or cell thereof, wherein said polynucleotide encodes a leucine zipper class I protein, or a protein having the same or substantially the same biological activity as Arabidopsis ATHB 16 protein, or a biologically active fragment thereof.
15. The method according to claim 14, wherein said method further comprises producing a transgenic grass from said transformed grass.
16. The grass according to claim 14, wherein said Arabidopsis ATHB16 protein comprises the amino acid sequence shown in SEQ ID NO: 2.
17. The grass according to claim 14, wherein said polynucleotide comprises the nucleotide sequence shown in SEQ ID NO: 1.
18. The grass according to claim 14, wherein said polynucleotide comprises the nucleotide sequence shown in SEQ DD NO: 7.
19. The method according to claim 14, wherein said grass is a turfgrass or a forage grass.
20. The method according to claim 19, wherein said turfgrass is selected from the group consisting of Bahiagrass, St. Augustine, Bermudagrass, Bentgrass, Zoysia, Tall fescue, Perennial Ryegrass, Kentucky Bluegrass, Buffalograss, Carpetgrass, Seashore Paspalum, and Centipedegrass.
21. The method according to claim 19, wherein said forage grass is selected from the group consisting of Bahiagrass, Bachiaria, Stargrass, Bermudagrass, Tall Fescue, Perennial Ryegrass, Annual Ryegrass, Rye, Wheat, Pennisetum, and Limpograss.
22. The method according to claim 15 or 16, wherein said grass is Bahiagrass.
23. The method according to claim 22, wherein said Bahiagrass is the cultivar "Argentine."
24. The method according to claim 14, wherein said polynucleotide is provided in an expression construct.
25. The method according to claim 24, wherein said expression construct provides for overexpression or constitutive expression of said polynucleotide and/or the protein encoded thereby.
26. The method according to claim 14, wherein said improved vegetative characteristic is one or more of suppressed or reduced numbers of seedheads, delayed or later seedhead production, increased vegetative tillers per plant, shorter tillers, shorter leaves, finer leaves, reduced senescence, increased forage quality, and increased resistance to abiotic stress 43
18. The grass according to claim 14, wherein said polynucleotide comprises the nucleotide sequence shown in SEQ ID NO: 7.
19. The method according to claim 14, wherein said grass is a turfgrass or a forage grass.
20. The method according to claim 19, wherein said turfgrass is selected from the group consisting of Bahiagrass, St. Augustine, Bermudagrass, Bentgrass, Zoysia, Tall fescue, Perennial Ryegrass, Kentucky Bluegrass, Buffalograss, Carpetgrass, Seashore Paspalum, and Centipedegrass.
21. The method according to claim 19, wherein said forage grass is selected from the group consisting of Bahiagrass, Bachiaria, Stargrass, Bermudagrass, Tall Fescue, Perennial Ryegrass, Annual Ryegrass, Rye, Wheat, Pennisetum, and Limpograss.
22. The method according to claim 15 or 16, wherein said grass is Bahiagrass.
23. The method according to claim 22, wherein said Bahiagrass is the cultivar "Argentine."
24. The method according to claim 14, wherein said polynucleotide is provided in an expression construct.
25. The method according to claim 24, wherein said expression construct provides for overexpression or constitutive expression of said polynucleotide and/or the protein encoded thereby.
26. The method according to claim 14, wherein said improved vegetative characteristic is one or more of suppressed or reduced numbers of seedheads, delayed or later seedhead production, increased vegetative tillers per plant, shorter tillers, shorter leaves, finer leaves, reduced senescence, increased forage quality, and increased resistance to abiotic stress conditions such as drought and temperature (e.g., resistance to cold and/or heat stress conditions). |
DESCRIPTION
MATERIALS AND METHODS FOR IMPROVING QUALITY AND CHARACTERISTICS OF GRASSES
CROSS-REFERENCE TO RELATED APPLICATION
This application claims the benefit of U.S. Provisional Application Serial No. 60/837,749, filed August 15, 2006, which is hereby incorporated by reference in its entirety, including all figures, nucleic acid sequences, amino acid sequences, and tables.
BACKGROUND OF THE INVENTION
Bahiagrass (Paspalum notatutri) represents the prime utility turf along highways in the Southeastern US and is a popular perennial grass for low input residential lawns (http://hortbusiness.ifas.ufl.edu/turfgrass.pdf). Bahiagrass tolerates marginal soil fertility, and its excellent persistence is supported by drought tolerance, heat tolerance, insect- and disease resistance and nematode suppression. However, the turf quality of bahiagrass is compromised by its open-growth habit and the more than 60 cm tall seed heads formed during summer. Improvement of turf quality will necessitate suppression of seed heads and increased number of vegetative tillers per plant. The former will reduce the need for frequent mowing to control seedhead emergence. The latter will also reduce weed encroachment and erosion. In the absence of conventional bred dwarf bahiagrass cultivars, plant growth retardants (PGR' s) are being used increasingly to suppress seedheads and leaf growth due to rising mowing costs (Unruh and Brecke 1999). Traditionally, plant growth retardants have been used to suppress bahiagrass seedhead production exclusively in low maintenance areas such as highway roadsides, airports, and golf course roughs. However, in recent years, new chemicals which may be used in higher maintained commercial situations have been developed. Several undesirable characteristics which have been associated with application of growth retardants include: phytotoxicity; reduced recuperative potential from physical damage to treated turf; and increased weed pressure due to reduced competition from treated plants (Unruh and Brecke 1999).
Improvement of turf quality by genetic engineering represents a promising alternative. Obligate apomixes in the bahiagrass cultivar "Argentine" allows the production of uniform seed progeny and might prevent unintended transgene dispersal in contrast to sexual
bahiagrass cytotypes. Many of the genes controlling initiation and outgrowth of axillary buds, elongation of stems and architecture of inflorescences are conserved between dicotyledonous and monocotyledonous plants (Wang and Li 2006). This facilitates the genetic engineering of regulatory pathways which determine plant architecture and flowering. Dwarf plants with suppression of seedhead development were reported following constitutive over-expression of gibberellin catabolizing enzyme GA 2-oxidase in rice (Sakamoto et al, 2001), wheat (Hedden and Phillips, 2000), Arabidopsis, and tobacco (Schomburg et al., 2003). Over- expression of a pumpkin GA 20-oxidase in lettuce resulted in the production of inactive GAs and dwarf plants (Niki et al., 2001). Expression of the Arabidopsis homeobox transcription factor gene ATHl gene in ryegrass produced late heading or non-flowering plants with more vegetative tillers and without dwarfing, which may be useful to improve fodder quality (van derValk ef α/., 2004).
Recently, an efficient tissue culture and genetic transformation system was established for the apomictic turf-type bahiagrass cultivar "Argentine" in our laboratory (Altpeter and James, 2005; Altpeter and Positano, 2005). This transformation protocol allows for the introduction and evaluation of transgenes with the potential to improve the turf quality of this important grass by genetic engineering. The obligate apomictic nature of bahiagrass cultivar "Argentine" results in uniform transgenic progenies and reduces the risk of unintended transgene dispersal.
Genes functioning in plant architecture, especially those controlling the initiation and outgrowth of axillary buds, elongation of stems and architecture of inflorescences have been extensively reviewed in recent years (Leyser, 2005; McSteen and Leyser, 2005; Schmitz and Theres, 2005; Wang and Li, 2006; Ward and Leyser, 2004). Most of these genes are conserved between dicotyledonous and monocotyledonous plants, indicating that these plants rely on similar regulatory pathways to establish their shape. The conservation of these genes together with the rapid development of plant biotechnology, allows us now to genetically modify plant architecture to breed more desirable crops and turfgrasses.
Transcription factors are key components in the regulation of gene expression and play important roles in plant development and its response to the environment. The functions of an increasing number of plant transcription factors are being elucidated, some of them have been used in genetic engineering for stress tolerance (Valliyodan and Nguyen, 2006; Yamaguchi-Shinozaki and Shinozaki, 2005) and to engineer metabolic pathways (Broun, 2004). Transcriptional regulation of plant development via repression of genes involved in
cell elongation, leaf expansion or flowering provides an opportunity for improvement of turf and forage grasses. Expression of the Arabidopsis homeobox transcription factor gene ATHl gene in ryegrass produced late heading or non-flowering plants with more vegetative tillers, which may be useful to improve fodder quality of perennial ryegrass (van der VaIk et al., 2004). ATHl affects the plant growth as a negative regulator in the light regulated gibberellin biosynthesis pathway (Garcia-Martinez and Gil, 2001; Quaedvlieg et al., 1995). In contrast, ATHB 16 represses cell elongation in Arabidopsis independent of GA signal transduction (Wang et al., 2003). The ATHB 16 gene encodes a homeodomain leucine zipper class I (HDZip) protein, which acts to regulate plant development as a mediator of plant growth response to light. Over-expression of ATHBl 6 in Arabidopsis reduces leaf expansion, leads to reduced shoot length but increased number of shoots, and reduces the sensitivity of flower induction to photoperiod (Wang et al., 2003).
BRIEF SUMMARY OF THE INVENTION
The subject invention concerns materials and methods for improving grass quality and characteristics, including suppression or reduction of seedheads, increasing vegetative tillers per plant, increasing forage quality, and increasing resistance to abiotic stress conditions such as drought. Grasses within the scope of the invention include turfgrasses and forage grasses. In one embodiment, the turfgrass is bahiagrass. Methods of the invention comprise introducing a nucleic acid encoding a homeodomain leucine zipper class I protein into a grass plant. In one embodiment, a grass is transformed with a nucleic acid that encodes Arabidopsis ATHB 16 protein, or a fragment, variant, or homolog thereof that has substantially the same activity as the ATHB 16 protein. The subject invention also concerns grass plants that comprise a heterologous nucleic acid encoding a homeodomain leucine zipper class I protein or that have been modified or engineered to overexpress or constitutively express a nucleic acid encoding a homeodomain leucine zipper class I protein, or a fragment, variant, or homolog thereof.
The presented data indicate that over-expression of the Arabidopsis ATHB 16 gene in bahiagrass significantly changes plant architecture of this important low input turfgrass. All transgenic plants investigated produced significant more vegetative and less reproductive tillers, shorter leaves and shorter tillers. Over-expression of ATHB 16 resulted in proportional reduction of leaf width and leaf length. Formation of seedheads under natural photoperiod
was delayed in some transgenic lines for approximately 4 weeks. Total root or shoot biomass and seed set were not compromised in semi-dwarf bahiagrass plants over-expressing A THB 16.
The present invention provides for changes in plant architecture and flowering of soil and hydroponic grown grass plants, following constitutive over-expression of nucleic acid encoding a leucine zipper class I protein, such as the ATHB 16 transcription factor from Arabidopsis.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A-1G show generation and molecular characterization of transgenic (ATHB16) bahiagrass plants. Figure IA shows induction of bahiagrass callus from germinating mature seeds of apomictic bahiagrass cultivar "Argentine". Figure IB shows selection of transgenic bahiagrass callus on paramomycin containing culture medium following biolistic co-transfer of ATHB 16 and nptll expression cassettes. Figure 1C shows regeneration of transgenic bahiagrass plants on paromomycin containing culture medium. Figure ID shows transgenic bahiagrass plants expressing ATHB16 (left) in comparison to transgenic (nptll) plants not-expressing ATHB 16 (right) three weeks after transfer to soil. Figure IE shows PCR analysis of genomic DNA isolated from wildtype plants (WT) or putative transgenic (ATHBl 6) plants (I-4b; I-10b; I-18a; I-28a; I-30a; I-32a) regenerated from paramomycin (50mgr') selection medium in comparison to ATHB 16 plasmid. Figure IF shows RT-PCR analysis for expression of the ATHB 16 gene in wildtype (WT) or transgenic bahiagrass (I-4b; I-10b; I-18a; l-28a; I-30a; I-32a) in comparison to ATHBl 6 plasmid. Figure IG shows southern blot analysis of BamHI restricted genomic DNA from wildtype (WT) or transgenic bahiagrass plants (1-3; I-4b; I-10b; I-18a; I-32a). Signals following hybridization with a full length A THBl 6 cDNA probe are shown.
Figures 2 A-2H show transgenic bahiagrass following 4 weeks of propagation from single tillers in hydroponics culture in comparison to wildtype plants. Figure 2A shows establishment of hydroponic bahiagrass culture from single rooted tillers. Figure 2B shows Hydroponic culture four weeks after establishment. Figure 2C shows side view of transgenic bahiagrass lines (I-4b; I- 10b; I-32a) in comparison to wildtype bahiagrass (WT) following 4 weeks of propagation from single tillers in hydroponics culture. Figure 2D shows number of tillers of transgenic bahiagrass lines (I-4b; I-10b; I-32a) and wildtype bahiagrass (WT) following 4 weeks of propagation from single tillers in hydroponics culture. Figure 2E shows length of the longest root of transgenic bahiagrass lines (I-4b; I- 10b; I-32a) and wildtype bahiagrass (WT) following 4 weeks of propagation from single tillers in hydroponics culture.
Figure 2F shows length of tillers from crown to leaf tip of transgenic bahiagrass lines (I-4b; I- 10b; I-32a) and wildtype bahiagrass (WT) following 4 weeks of propagation from single tillers in hydroponics culture. Figure 2G shows root biomass dry weight of transgenic bahiagrass lines (I-4b; I-10b; I-32a) and wildtype bahiagrass (WT) following 4 weeks of propagation from single tillers in hydroponics culture. Figure 2H shows shoot biomass dry weight of transgenic bahiagrass lines (I-4b; I-10b; I-32a) and wildtype bahiagrass (WT) following 4 weeks of propagation from single tillers in hydroponics culture.
Figures 3A-3F show transgenic bahiagrass grown in soil in comparison to wildtype plants. Figure 3 A shows number of tillers. Figure 3B shows length of tillers from crown to leaf tip. Figure 3 C shows width of leaves. Figure 3D shows length of leaves of transgenic bahiagrass lines (I-4b; I- 10b; I-32a) and wildtype bahiagrass (WT) following two months of vegetative propagation of single tillers in the greenhouse. Figure 3E shows top view of transgenic bahiagrass lines (I-4b; HOb; I-32a) in comparison to wildtype bahiagrass (WT) following a 2 months propagation period of single tillers. Figure 3F shows side view of transgenic bahiagrass line I- 10b in comparison to wildtype bahiagrass (WT) following 17 weeks of vegetative propagation from single tillers in the greenhouse.
Figure 4 shows RT-PCR analysis for expression of the ATHB 16 gene in transgenic I lines. (NC: negative control, PC: positive control, and WT: wild type).
Figures 5A-5C show propagation and field establishment of transgenic lines. Figure 5A shows propagation of plants under greenhouse conditions. Figure 5B shows establishment of field plots, and Figure 5C shows field plots 4 weeks after transplanting.
Figure 6 shows visual ratings for establishment (l=poor; 9=excellent) of transgenic lines (110, 132, 14) in comparison to wild-type bahiagrass (WT) and Floratam St. Augustine grass (SA) 4 weeks after transplanting. Bars of the same observation timepoint with different letters indicate significant difference at P<0.05.
Figure 7 shows chlorophyll content measured with a Minolta SPAD 502 meter 4 weeks after transplanting (diagonal cross bar column), 8 weeks after transplanting (filled-in column), and 12 weeks (open column) after transplanting. Bars of the same observation timepoint with different letters indicate significant difference at P<0.05.
Figures 8A-8B show comparison transgenic lines four weeks after transplanting. Figure 8 A shows 1 10 on the right and wildtype on the left. Figure 8B shows 132 on the right) and wild type on the left.
Figure 9 shows number of tillers produced by transgenic lines and wild-type in a 10x10 cm area 8 weeks after transplanting. Bars of the same observation timepoint with different letters indicate significant difference at P<0.05.
Figure 10 shows NTEP ratings for mowing quality (l=poor; 9=excellent) of transgenic lines in comparison to wild-type bahiagrass taken immediately after mowing and fourteen weeks after transplanting. Bars of the same observation timepoint with different letters indicate significant difference at P<0.05.
Figures HA and HB show freshly mowed transgenic lines Hl and 1-10 (Figure HA) compares to wild-type (Figure 1 IB) following weekly mowing at 8cm mowing height and fourteen weeks after transplanting.
Figure 12A shows establishment of transgenic lines and wild-types in treepots. Figure 12B shows transgenic lines and wild-types after six weeks under non-irrigated conditions. Figure 12C shows transgenic lines and wild-types after twelve weeks under non- irrigated conditions.
Figures 13A-13B show transgenic lines and wild-types three weeks after re-hydration. Figures 14A-14C show Relative Water Content of transgenic lines and wild-types. Figure 14A shows Relative Water Content of transgenic lines and wild-types under well-watered conditions. Figure 14B shows Relative Water Content of transgenic lines and wild-types six weeks after withholding irrigation. Figure 14C shows Relative Water Content of transgenic lines and wild-types eight weeks after withholding irrigation (• indicates significant difference from the wild-type bahiagrass (WT-AB) and * indicates significant differences from St. Augustinegrass (WT-SA) atP<0.05).
Figure 15 shows Volumetric Soil Water Content measured under well-watered conditions (line with filled-in diamonds), six weeks after withholding irrigation (line with filled-in squares), and eight weeks after withholding irrigation (line with filled-in triangles) (• indicates significant difference from the wild-type bahiagrass (WT-AB) and * indicates significant differences from St. Augustinegrass (WT-SA) at P<0.05).
Figures 16A-16B show visual scores (10 = full recovery of all replications; 0 = no recovery of any replication) given to transgenic lines and wild-types. Figure 16A shows visual scores one week after re-hydration. Figure 16A shows visual scores two weeks after re-hydration (• indicates significant difference from the wild-type bahiagrass (WT-AB) and * indicates significant differences from St. Augustinegrass (WT-SA) at P<0.05).
Figure 17A shows shoot growth of transgenic lines and wild-types three weeks after re-hydration. Figure 17B shows shoot total biomass (dead and green). Figure 17C shows root biomass of transgenic lines and wild-types three weeks after re-hydration (• indicates significant difference from the wild-type bahiagrass (WT-AB) and * indicates significant differences from St. Augustinegrass (WT-SA) at PO.05).
BRIEF DESCRIPTION OF THE SEQUENCES
SEQ ID NO: 1 is a nucleic acid sequence of ATHB16 gene in Arabidopsis thaliana that can be used according to the present invention.
SEQ ID NO: 2 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 1.
SEQ ID NO: 3 is a PCR primer that can be used according to the present invention.
SEQ ID NO: 4 is a PCR primer that can be used according to the present invention.
SEQ ID NO: 5 is a PCR primer that can be used according to the present invention.
SEQ ID NO: 6 is a PCR primer that can be used according to the present invention.
SEQ ED NO: 7 is a nucleotide coding sequence for the ATHB16 protein shown in SEQ ID NO: 2.
SEQ ID NO: 8 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 9 is a nucleic acid sequence that can be used according to the present invention.
SEQ ED NO: 10 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 9.
SEQ ED NO: 11 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 12 is an amino acid sequence encoded by the nucleic acid of SEQ ED NO: 11.
SEQ ED NO: 13 is a nucleic acid sequence that can be used according to the present invention.
SEQ ED NO: 14 is an amino acid sequence encoded by the nucleic acid of SEQ ED NO: 13.
SEQ ED NO: 15 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 16 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 15.
SEQ ID NO: 17 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 18 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 17.
SEQ ID NO: 19 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 20 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 19.
SEQ ID NO: 21 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 22 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 21.
SEQ ID NO: 23 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 24 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 23.
SEQ ID NO: 25 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 26 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 25.
SEQ ID NO: 27 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 28 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 27.
SEQ ID NO: 29 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 30 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 29.
SEQ ID NO: 31 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 32 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 31.
SEQ ID NO: 33 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 31.
SEQ DD NO: 34 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 35 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 34.
SEQ ID NO: 36 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 37 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 36.
SEQ ED NO: 38 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 39 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 38.
SEQ ED NO: 40 is a nucleic acid sequence that can be used according to the present invention.
SEQ ED NO: 41 is a nucleic acid sequence that can be used according to the present invention.
SEQ ED NO: 42 is an amino acid sequence encoded by the nucleic acid of SEQ ED NO: 41.
SEQ ED NO: 43 is a nucleic acid sequence that can be used according to the present invention.
SEQ ED NO: 44 is an amino acid sequence encoded by the nucleic acid of SEQ ED NO: 43.
SEQ ED NO: 45 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 46 is an amino acid sequence encoded by the nucleic acid of SEQ ED NO: 45.
SEQ ED NO: 47 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 48 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 47.
SEQ ID NO: 49 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 50 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 49.
SEQ ID NO: 51 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 52 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 51.
SEQ ID NO: 53 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 54 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 55 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 54.
SEQ ID NO: 56 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 57 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 56.
SEQ ID NO: 58 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 59 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 58.
SEQ DD NO: 60 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 61 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 60.
SEQ ID NO: 62 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 63 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 62.
SEQ ID NO: 64 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 65 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 66 is an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 65.
SEQ ED NO: 67 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 68 is an amino acid sequence encoded by the nucleic acid of SEQ ED NO: 67.
SEQ ED NO: 69 is a nucleic acid sequence that can be used according to the present invention.
SEQ ED NO: 70 is an amino acid sequence encoded by the nucleic acid of SEQ ED NO: 69.
SEQ ED NO: 71 is a nucleic acid sequence that can be used according to the present invention.
SEQ ID NO: 72 is an amino acid sequence encoded by the nucleic acid of SEQ ED NO: 71.
DETAILED DISCLOSURE OF THE INVENTION
The subject invention concerns materials and methods for improving quality and characteristics of grasses, including suppressed or reduced numbers of seedheads, delayed or later seedhead production, increased number of vegetative tillers per plant, shorter tillers, shorter leaves, finer leaves, reduced senescence, increased forage quality, and increased resistance to abiotic stress conditions such as drought and temperature {e.g., resistance to cold and/or heat stress conditions). Grasses included within the scope of the invention are both turfgrasses and forage grasses. Turfgrasses contemplated within the scope of the invention include, but are not limited to, Bahiagrass, Brachiariagrass, St. Augustine, Bermudagrass, Bentgrass, Zoysia, Tall fescue, Perennial Ryegrass, Kentucky Bluegrass, Buffalograss, Carpetgrass, Seashore Paspalum, and Centipedegrass. hi an exemplified embodiment, the turfgrass is bahiagrass. Forage grasses contemplated within the scope of the invention includes, but are not limited to, Bahiagrass, Bachiariagrass, Stargrass, Bermudagrass, Tall Fescue, Perennial Ryegrass, Annual Ryegrass, Rye, Wheat, Pennisetum, and Limpograss.
In an exemplified embodiment of the present invention, over-expression of Arabidopsis ATHBl 6 gene in bahiagrass reduced leaf expansion, and resulted in up to 40% shorter leaves and tillers (Figure 3) along with up to 26% reduced leaf width (Figure 3). This almost proportional reduction of both leaf length and leaf width enhances the visual appearance of the turf in contrast to disproportional dwarfing with shorter and wider leaves than wild-type following constitutive over-expression of gibberellin catabolizing enzyme GA 2-oxidase (Sakamoto et ai, 2001).
Flowering in the bahiagrass cultivar "Argentine" is very sensitive to daylength and largest number of seedheads are produced in subtropical Florida around the summer solstice with approximately 14h day length. The production of seedheads was delayed by approximately 1 month in transgenic bahiagrass lines I-4b and I- 10b grown under natural day length in the greenhouse (Table 1).
The number of seedheads and their length was reduced in transgenic bahiagrass up to 76% and 41% respectively (Table 1). Formation of normal flowers and seed set was not compromised in transgenic bahiagrass constitutively over-expressing ATHB 16 in contrast to constitutive over-expression of gibberellin catabolizing enzyme GA 2-oxidase (Sakamoto et al., 2001). Most of the warm season turfgrasses are vegetatively mass-propagated and installed as sod, eliminating the need for seed production. Typically, seed production is not desired to prevent introduction of genetic variability by open pollination which might compromise the uniformity of the turf and might result in transgene dispersal by pollen.
However, "Argentine" bahiagrass is an obligate apomict which results in uniform, asexual seed progeny and reduces the risk of unintended transgene dispersal. Transgenic bahiagrass plants produced up to 38% or 77% more vegetative tillers in soil or hydroponics nutrient solution than wildtype (see Figure 2 and Figure 3). The difference between soil and hydroponic growth potential of wildtype and transgenic bahiagrass might reflect the performance as a result of available nutrients. Hydroponics experiments indicated that none of the evaluated transgenic lines had less root biomass or shorter roots than the wildtype plants (see Figure 2G and Figure 2E) this was confirmed by visual inspection of roots from plants grown in soil (see Figure 3F). It appears that the genes involved in root expansion are not under negative control of the ATHB 16 transcription factor. Along with a shift from production of reproductive to more vegetative tillers (see Table 1; Figure 2D; and Figure 3A), total root and shoot biomass were not reduced in any of the evaluated transgenic bahiagrass lines (see Figure 2). These attributes are very desirable to enhance turf density and maintain drought tolerance.
ATHl affects the plant growth as a negative regulator in the light regulated gibberellin biosynthesis pathway (Garcia-Martinez and Gil, 2001; Quaedvlieg et al., 1995). In contrast, Axabidopsis ATHBl 6 represses cell elongation independent of GA signal transduction (Wang et αl., 2003). Target genes downstream of ATHB 16 have still to be identified. Potential target genes for the ATHBI6 repressor include receptors for auxin-dependent cell expansion (Jones et αl., 1998; Schwob et αl., 1993). HDzip genes like ATHB16 represent a large gene family with 42 members in Arabidόpsis. Different members of HDzip proteins may form heterodimers and then bind to regulatory DNA region of downstream genes (Sessa et αl., 1993; Wang, 2001). ATHB16 can interact with other HDzip proteins especially with ATHB6 (Wang, 2001). ATHB6 is known to be upregulated in response to water- deficit conditions and to treatment of abscisic acid, and has been proposed to function as a regulator of growth and development in response to limited water conditions (Himmelbach et αl., 2002; Sδderman et αl., 1999). This implies that over-expression of ATHB 16 can, optionally in concert with ATHB 6, reduce plant growth during water deficit, which can enhance the drought tolerance of transgenic plants over-expressing ATHB 16.
Bahiagrass cultivar "Argentine" is also a very popular forage grass in subtropical regions. Since total biomass production does not seem to be negatively impacted in transgenic bahiagrass plants, over-expressing ATHB 16 can also improve the forage quality of bahiagrass by higher production of better digestible young, vegetative tillers on expense of
poorly digestible seedheads. In floral stems, low digestible compounds such as lignin and cell wall compounds cross-linked with lignin accumulate, which reduce the palatability and therefore fodder quality of the grass. Digestibility and productivity can be analyzed using field grown transgenic bahiagrass.
"Argentine" bahiagrass has no leaf tissue freezing tolerance which compromises its performance in regions with seasonal freezing temperatures, e.g. Northern Florida. The altered growing pattern with shorter shoots and higher tiller density can also affect the micro- environment in the field and reduce the leaf tissue damage during short freezing periods, which are typically experienced in the Northern parts of the subtropical regions where bahiagrass is grown.
In one embodiment of the present invention, a grass plant, plant tissue, or plant cell is transformed with a nucleic acid encoding a homeodomain leucine zipper class I protein, or a biologically active fragment, variant, or homolog. Examples of nucleic acids, and homeodomain leucine zipper protein encoded thereby, included within the scope of the invention are disclosed at Genbank database under accession numbers DQ226915.1, AY336103.1, AF268422.1, AY101610.1, AB092574.1, AF443620.1, AF184277.2, AF402604.1, AP006364.1, CT571261.1, AC145165.9, AB028072.1, AC139840.1, AC135288.1, AC142505.1, AC145120.1, D26578.1, AM486924.2, AB028076.1, AB084623.1, AB028078.2, EF025304.1, CR954197.2, AB028080.2, AK247553.1, CU024864.5, X94947.1, AF402606.1, L22847.1, D26575.1, AC189549.1, NM 111013.3, AC009325.8, AB028079.1, M90416.1, AM483358.2, BT012922.1, AC189385.1, DQ191407.1, AF443623.1, DQ201170.1, L22848.1, D26573.1, AB028077.1, AK247497.1, AB028073.1, EF025305.1, AY347865.1, AF402605.1, and AY823671.1, the content of which is hereby incorporated by reference in its entirety. Transformed plant, plant tissue or plant cell incorporating the nucleic acid in its genome can be selected for and a transgenic grass produced therefrom. In an exemplified embodiment of the present invention, a grass is transformed with a nucleic acid that encodes Arabidopsis ATHB 16 protein, or a fragment, variant, or homolog thereof that has substantially the same activity as the ATHB 16 protein. Methods for screening for and obtaining fragments, variants, and homologs of a protein are known in the art. Variants and homologs of ATHB 16 proteins from other plant species are contemplated within the scope of the present invention. In one embodiment, the nucleic acid comprises the protein coding sequence of the nucleotide sequence of the ATHB 16 gene (Genbank Accession No. AF076641) of Arabidopsis that codes for the ATHB16 protein, or a
fragment, variant, or homolog thereof. In a specific embodiment, a nucleic acid of the invention used to transform a grass comprises the nucleotide sequence shown in SEQ DD NO: 1, or a fragment, variant, or homolog thereof. In another embodiment, the nucleic acid comprises a nucleotide sequence that encodes a protein having the amino acid sequence shown in SEQ ID NO: 2, or a fragment, variant, or homolog thereof that has substantially the same activity as the protein of SEQ ID NO: 2. In a further embodiment, the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 7 which encodes the protein having the amino acid sequence shown in SEQ ID NO: 2. In other embodiments, the nucleic acid comprises a nucleotide sequence that encodes a protein having an amino acid sequence shown in one or more of SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO:
37, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, and/or SEQ ID NO: 72. In specific embodiments, the nucleic acid can comprise a nucleotide sequence show in one or more of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ DD NO: 36, SEQ ID NO:
38, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45 SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, and/or SEQ ID NO: 71. A transformed plant, plant tissue, or plant cell can comprise in its genome one or more copies of a nucleic acid of the invention. In one embodiment, a plant, plant tissue, or plant cell is transformed with or comprises multiple copies of one or more nucleic acids of the invention.
Preferably, the nucleic acid is provided in an expression construct that results in overexpression or constitutive expression of the homeodomain leucine zipper class I protein, or a fragment, variant, or homolog thereof. In one embodiment, the nucleic acid is provided in a construct that results in. overexpression of the nucleic acid in the plant. Expression constructs of the invention can include regulatory elements that are functional in the intended host cell in which the expression construct is to be expressed. Thus, a person of ordinary skill in the art can select regulatory elements for use in plant host cells, yeast host cells,
bacterial host cells, insect host cells, mammalian host cells, and human host cells. Regulatory elements include promoters, transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements. As used herein, the term "expression construct" refers to a combination of nucleic acid sequences that provides for transcription of an operably linked nucleic acid sequence. As used herein, the term "operably linked" refers to a juxtaposition of the components described wherein the components are in a relationship that permits them to function in their intended manner. In general, operably linked components are in contiguous relation.
An expression construct of the invention can comprise a promoter sequence operably linked to a polynucleotide sequence of the invention. In one embodiment, the promoter is one that provides for overexpression of a polynucleotide of the invention. Promoters useful for overexpression of an operably linked nucleic acid sequence are known in the art. Promoters can be incorporated into a polynucleotide sequence or an expression construct using standard techniques known in the art. Multiple copies of promoters or multiple promoters can be used in an expression construct of the invention. In a preferred embodiment, a promoter can be positioned about the same distance from the transcription start site in the expression construct as it is from the transcription start site in its natural genetic environment. Some variation in this distance is permitted without substantial decrease in promoter activity. A transcription start site is typically included in the expression construct.
If the expression construct is to be provided in or introduced into a plant cell, then plant viral promoters, such as, for example, a cauliflower mosaic virus (CaMV) 35S (including the enhanced CaMV 35S promoter (see, for example U.S. Patent No. 5,106,739)) or a CaMV 19S promoter can be used. In an exemplified embodiment, the promoter is a CaMV 35S promoter. Other promoters that can be used for expression constructs in plants include, for example, prolifera promoter, Ap3 promoter, heat shock promoters, T-DNA 1'- or 2'-promoter of A. tumefaciens, polygalacturonase promoter, chalcone synthase A (CHS-A) promoter from petunia, tobacco PR- Ia promoter, ubiquitin promoter (U.S. Patent Nos. 6,528,701 and 6,054,574), actin promoter (e.g., from rice), alcA gene promoter, pin2 promoter (Xu et ah, 1993), maize Wipl promoter, maize trpA gene promoter (U.S. Patent No. 5,625,136), alfalfa His 3 promoter, maize ADHl promoter, maize CDPK gene promoter, tubulin promoter (Tub A, B, or C) (e.g., from rice or maize), nopaline synthase promoter, octopine synthase promoter, and RUBISCO SSU promoter (U.S. Patent No. 5,034,322) can
also be used. Tissue-specific promoters, for example fruit-specific promoters, such as the E8 promoter of tomato (accession number: AF515784; Good et al. (1994)), a hybrid E4/E8 promoter (U.S. Patent No. 6,118,049), the LeExp-1 promoter (U.S. Patent No. 6,340,748), and the polygalacturonase-β subunit promoter of tomato (U.S. Patent No. 6,127,179) can be used. Flower organ-specific promoters can be used with an expression construct of the present invention for expressing a polynucleotide of the invention in the flower organ of a plant. Examples of flower organ-specific promoters include any of the promoter sequences described in U.S. Patent Nos. 6,462,185; 5,859,328; 5,652,354; 5,639,948; and 5,589,610. Seed-specific promoters such as the promoter from a β-phaseolin gene {e.g., of kidney bean) or a glycinin gene (e.g., of soybean), and others, can also be used. Root-specific promoters, such as any of the promoter sequences described in U.S. Patent No. 6,455,760 or U.S. Patent No. 6,696,623, or in published U.S. patent application Nos. 20040078841; 20040067506; 20040019934; 20030177536; 20030084486; or 20040123349, can be used with an expression construct of the invention. Constitutive promoters (such as a CaMV, ubiquitin, actin, or NOS promoter), developmentally-regulated promoters, and inducible promoters (such as those promoters than can be induced by heat, light, hormones, or chemicals) are also contemplated" for use with polynucleotide expression constructs of the invention.
Expression constructs of the invention may optionally contain a transcription termination sequence, a translation termination sequence, a sequence encoding a signal peptide, and/or enhancer elements. Transcription termination regions can typically be obtained from the 3' untranslated region of a eukaryotic or viral gene sequence. Transcription termination sequences can be positioned downstream of a coding sequence to provide for efficient termination. A signal peptide sequence is a short amino acid sequence typically present at the amino terminus of a protein that is responsible for the relocation of an operably linked mature polypeptide to a wide range of post-translational cellular destinations, ranging from a specific organelle compartment to sites of protein action and the extracellular environment. Targeting gene products to an intended cellular and/or extracellular destination through the use of an operably linked signal peptide sequence is contemplated for use with the polypeptides of the invention. Classical enhancers are cis-acting elements that increase gene transcription and can also be included in the expression construct. Classical enhancer elements are known in the art, and include, but are not limited to, the CaMV 35 S enhancer element, cytomegalovirus (CMV) early promoter enhancer element, and the SV40 enhancer element. Intron-mediated enhancer elements that enhance gene expression are also known in
the art. These elements must be present within the transcribed region and are orientation dependent. Examples include the maize shrunken- 1 enhancer element (Clancy and Hannah, 2002).
DNA sequences which direct polyadenylation of mRNA transcribed from the expression construct can also be included in the expression construct, and include, but are not limited to, an octopine synthase or nopaline synthase signal. The expression constructs of the invention can also include a polynucleotide sequence that directs transposition of other genes, i.e., a transposon.
Expression constructs can also include one or more dominant selectable marker genes, including, for example, genes encoding antibiotic resistance and/or herbicide-resistance for selecting transformed cells. Antibiotic-resistance genes can provide for resistance to one or more of the following antibiotics: hygromycin, kanamycin, bleomycin, G418, streptomycin, paromomycin, neomycin, and spectinomycin. Kanamycin resistance can be provided by neomycin phosphotransferase (NPT II). Herbicide-resistance genes can provide for resistance to phosphinothricin acetyltransferase or glyphosate. Other markers used for cell transformation screening include genes encoding β-glucuronidase (GUS) 5 β-galactosidase, luciferase, nopaline synthase, chloramphenicol acetyltransferase (CAT), green fluorescence protein (GFP), or enhanced GFP (Yang et αl, 1996).
The subject invention also concerns polynucleotide vectors comprising a polynucleotide sequence of the invention that encodes a homeodomain leucine zipper class I polypeptide of the invention. Unique restriction enzyme sites can be included at the 5' and 3' ends of an expression construct or polynucleotide of the invention to allow for insertion into a polynucleotide vector. As used herein, the term "vector" refers to any genetic element, including for example, plasmids, cosmids, chromosomes, phage, virus, and the like, which is capable of replication when associated with proper control elements and which can transfer polynucleotide sequences between cells. Vectors contain a nucleotide sequence that permits the vector to replicate in a selected host cell. A number of vectors are available for expression and/or cloning, and include, but are not limited to, pBR322, pUC series, pGEM series, M 13 series, and pBLUESCRIPT vectors (Stratagene, La Jolla, CA).
Polynucleotides of the present invention can be composed of either RNA or DNA. Preferably, the polynucleotides are composed of DNA. The subject invention also encompasses those polynucleotides that are complementary in sequence to the
polynucleotides disclosed herein. Polynucleotides and polypeptides of the invention can be provided in purified or isolated form.
Because of the degeneracy of the genetic code, a variety of different polynucleotide sequences can encode a homeodomain leucine zipper class I polypeptide of the present invention (e.g., an ATHDB 16 protein), or a fragment, variant, or homolog thereof. A table showing all possible triplet codons (and where U also stands for T) and the amino acid encoded by each codon is described in Lewin (1985). In addition, it is well within the skill of a person trained in the art to create alternative polynucleotide sequences encoding the same, or essentially the same, polypeptides of the subject invention. These degenerate variant and alternative polynucleotide sequences are within the scope of the subject invention. As used herein, references to "essentially the same" sequence refers to sequences which encode amino acid substitutions, deletions, additions, or insertions which do not materially alter the functional activity of the polypeptide encoded by the polynucleotides of the present invention.
Substitution of amino acids other than those specifically exemplified or naturally present in a polypeptide of the invention are also contemplated within the scope of the present invention. For example, non-natural amino acids can be substituted for the amino acids of a polypeptide, so long as the polypeptide having the substituted amino acids retains substantially the same functional activity as the polypeptide in which amino acids have not been substituted. Examples of non-natural, amino acids include, but are not limited to, ornithine, citrulline, hydroxyproline, homoserine, phenylglycine, taurine, iodotyrosine, 2,4- diaminobutyric acid, α-amino isobutyric acid, 4-aminobutyric acid, 2-amino butyric acid, γ- amino butyric acid, ε-amino hexanoic acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3-amino propionic acid, norleucine, norvaline, sarcosine, homocitrulline, cysteic acid, τ- butylglycine, τ-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, C-methyl amino acids, N-methyl amino acids, and amino acid analogues in general. Non-natural amino acids also include amino acids having derivatized side groups. Furthermore, any of the amino acids in the protein can be of the D (dextrorotary) form or L (levorotary) form. Allelic variants of a protein sequence of a polypeptide of the present invention are also encompassed within the scope of the invention.
Amino acids can be generally categorized in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby a polypeptide encoded by a polynucleotide of the present invention having an amino acid of one class is
replaced with another amino acid of the same class fall within the scope of the subject invention so long as the polynucleotide encoding the substitution still retains substantially the same functional activity as the polynucleotide that does not have the substitution. Polynucleotides encoding a polypeptide having one or more amino acid substitutions in the sequence are contemplated within the scope of the present invention. Table 2 below provides a listing of examples of amino acids belonging to each class. Single letter amino acid abbreviations are defined in Table 3.
Table 2.
Class of Amino Acid Examples of Amino Acids
Nonpolar . Ala, VaI, Leu, He, Pro, Met, Phe, Trp Uncharged Polar GIy, Ser, Thr, Cys, Tyr, Asn, GIn Acidic Asp, GIu Basic Lys, Arg, His
The subject invention also concerns variants of the polynucleotides of the present invention that encode polypeptides of the invention. Variant sequences include those
sequences wherein one or more nucleotides of the sequence have been substituted, deleted, and/or inserted. The nucleotides that can be substituted for natural nucleotides of DNA have a base moiety that can include, but is not limited to, inosine, 5-fluorouracil, 5-bromouracil, hypoxanthine, 1-methylguanine, 5-methylcytosine, and tritylated bases. The sugar moiety of the nucleotide in a sequence can also be modified and includes, but is not limited to, arabinose, xylulose, and hexose. In addition, the adenine, cytosine, guanine, thymine, and uracil bases of the nucleotides can be modified with acetyl, methyl, and/or thio groups. Sequences containing nucleotide substitutions, deletions, and/or insertions can be prepared and tested using standard techniques known in the art.
Polynucleotides and proteins of the subject invention can also be defined in terms of more particular identity and/or similarity ranges with those exemplified herein. The sequence identity will typically be greater than about 60%, preferably greater than about 75%, more preferably greater than about 80%, even more preferably greater than about 90%, and can be greater than about 95%. The identity and/or similarity of a sequence can be about 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% as compared to a sequence exemplified herein. Unless otherwise specified, as used herein percent sequence identity and/or similarity of two sequences can be determined using the algorithm of Karlin and Altschul (1990), modified as in Karlin and Altschul (1993). Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990). BLAST searches can be performed with the NBLAST program, score = 100, wordlength = 12, to obtain sequences with the desired percent sequence identity. To obtain gapped alignments for comparison purposes, Gapped BLAST can be used as described in Altschul et al. (1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) can be used. See NCBI/NIH website.
The subject invention also contemplates those polynucleotide molecules having sequences which are sufficiently homologous with the sequences exemplified herein so as to permit hybridization with that sequence under standard stringent conditions and standard methods (Maniatis, T. et al., 1982). As used herein, "stringent" conditions for hybridization refers to conditions wherein hybridization is typically carried out overnight at 20-25 C below the melting temperature (Tm) of the DNA hybrid in 6x SSPE, 5x Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The melting temperature is described by the following formula (Beltz, G. A. et al, 1983):
Tm=81.5 C+16.6 Log[Na+]+0.41(%G+C)-0.61(% formamide)-600/length of duplex in base pairs.
Washes are typically carried out as follows:
(1) Twice at room temperature for 15 minutes in Ix SSPE, 0.1% SDS (low stringency wash).
(2) Once at Tm-20 C for 15 minutes in 0.2x SSPE, 0.1% SDS (moderate stringency wash).
Thus, specifically contemplated within the scope of the invention are polynucleotide sequences that hybridize under stringent conditions with the sequence of SEQ ID NO: 1 or SEQ ID NO: 7. Examples include sequences disclosed at Genbank accession numbers DQ226915, AY336103, and AYlOl 610.
As used herein, the terms "nucleic acid" and "polynucleotide" refer to a deoxyribonucleotide, ribonucleotide, or a mixed deoxyribonucleotide and ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, would encompass known analogs of natural nucleotides that can function in a similar manner as naturally-occurring nucleotides. The polynucleotide sequences include the DNA strand sequence that is transcribed into RNA and the strand sequence that is complementary to the DNA strand that is transcribed. The polynucleotide sequence includes both the sense and antisense strands either as individual strands or in the duplex.
The subject invention also concerns polynucleotides, and their use in the methods of the present invention, that encode a fragment, variant, or homolog of a leucine zipper class I polypeptide of the invention that have substantially the same activity as the leucine zipper class I polypeptide from which the fragment, variant, or homolog is derived. In one embodiment, polypeptide fragments of ATHB 16 protein typically comprise a contiguous span of about or at least 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 61, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,
208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, or 293 amino acids of SEQ ID NO: 2.
Polypeptide fragments of ATHB16 protein can be any integer in length from at least about 25 consecutive amino acids to 1 amino acid less than the sequence shown in SEQ ID NO: 2. Thus, for SEQ ID NO: 2, a polypeptide fragment can be any integer of consecutive amino acids from about 25 to 293 amino acids. The term "integer" is used herein in its mathematical sense and thus representative integers include: 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 61, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, and/or 293.
Each polypeptide fragment of ATHB 16 protein can also be described in terms of its N- terminal and C-terminal positions. For example, combinations of N-terminal to C-terminal fragments of about 25 contiguous amino acids to 1 amino acid less than the full length polypeptide of SEQ ID NO: 2 are included in the present invention. Thus, using SEQ ID NO: 2 as an example, a 25 consecutive amino acid fragment could correspond to amino acids of SEQ ID NO: 2 selected from the group consisting of 1-25, 2-26, 3-27, 4-28, 5-29, 6-30, 7-31, 8-32, 9-33, 10-34, 11-35, 12-36, 13-37, 14-38, 15-39, 16-40, 17-41, 18-42, 19-43, 20-44, 21- 45, 22-46, 23-47, 24-48, 25-49, 26-50, 27-51, 28-52, 29-53, 30-54, 31-55, 32-56, 33-57, 34- 58, 35-59, 36-60, 37-61, 38-62, 39-63, 40-64, 41-65, 42-66, 43-67, 44-68, 45-69, 46-70, 47-
71, 48-72, 49-73, 50-74, 51-75, 52-76, 53-77, 54-78, 55-79, 56-80, 57-81, 58-82, 59-83, 60- 84, 61-85, 62-86, 63-87, 64-88, 65-89, 66-90, 67-91, 68-92, 69-93, 70-94, 71-95, 72-96, 73- 97, 74-98, 75-99, 76-100, 77-101, 78-102, 79-103, 80-104, 81-105, 82-106, 83-107, 84-108, 85-109, 86- 110, 87-111, 88,-112, 89-113, 90-114, 91-115, 92-116, 93-117, 94-118, 95-119, 96-120, 97-121, 98-122, 99-123, 100-124, 101-125, 102-126, 103-127, 104-128, 105-129, 106-130, 107-131, 108-132, 109-133, 110-134, 111-135, 112-136, 113-137, 114-138, 115- 139, 116-140, 117-141, 118-142, 119-143, 120-144, 121-145, 122-146, 123-147, 124-148, 125-149, 126-150, 127-151, 128-152, 129-153, 130-154, 131-155, 132-156, 133-157, 134- 158, 135-159, 136-160, 137-161, 138-162, 139-163, 140-164, 141-165, 142-166, 143-167, 144-168, 145-169, 146-170, 147-171, 148-172, 149-173, 150-174, 151-175, 152-176, 153- 177, 154-178, 155-179, 156-180, 157-181, 158-182, 159-183, 160-184, 161-185, 162-186, 163-187, 164-188, 165-189, 166-190, 167-191, 168-192, 169-193, 170-194, 171-195, 172- 196, 173-197, 174-198, 175-199, 176-200, 177-201, 178-202, 179-203, 180-204, 181-205, 182-206, 183-207, 184-208, 185-209, 186-210, 187-211, 188-212, 189-213, 190-214, 191- 215, 192-216, 193-217, 194-218, 195-219, 196-220, 197-221, 198-222, 199-223, 200-224, 201-225, 202-226, 203-227, 204-228, 205-229, 206-230, 207-231, 208-232, 209-233, 210- 234, 211-235, 212-236, 213-237, 214-238, 215-239, 216-240, 217-241, 218-242, 219-243, 220-244, 221-245, 222-246, 223-247, 224-248, 225-249, 226-250, 227-251, 228-252, 229- 253, 230-254, 231-255, 232-256, 233-257, 234-258, 235-259, 236-260, 237-261, 238-262, 239-263, 240-264, 241-265, 242-266, 243-267, 244-268, 245-269, 246-270, 247-271, 248- 272, 249-273, 250-274, 251-275, 252-276, 253-277, 254-278, 255-279, 256-280, 257-281, 258-282, 259-283, 260-284, 261-285, 262-286, 263-287, 264-288, 265-289, 266-290, 267- 291, 268-292, 269-293, and 270-294. Similarly, the amino acids corresponding to all other fragments of sizes between 26 consecutive amino acids and 293 consecutive amino acids of SEQ ED NO: 2 are included in the present invention and can also be immediately envisaged based on these examples. Therefore, additional examples, illustrating various fragments of the polypeptides of SEQ ID NO: 2 are not individually listed herein in order to avoid unnecessarily lengthening the specification.
Polypeptide fragments comprising: 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128,
129, 130, 131, 132, 133, 134, 135, 136. 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, and 293 consecutive amino acids of SEQ ID NO: 2 may alternatively be described by the formula "n to c" (inclusive), where "n" equals the N-terminal amino acid position and "c" equals the C-terminal amino acid position of the polypeptide. In this embodiment of the invention, "n" is an integer having a lower limit of 1 and an upper limit of the total number of amino acids of the full length polypeptide minus 24 (e.g., 294-24=270 for SEQ ID NO: 2). "c" is an integer between 25 and the number of amino acids of the full length polypeptide sequence (294 for SEQ ID NO: 2) and "n" is an integer smaller than "c" by at least 24. Therefore, for SEQ ID NO: 2, "n" is any integer selected from the list consisting of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, and 270; and "c" is any integer selected from the group consisting of: 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95,
96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248. 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, and 294 provided that "n" is a value less than "c" by at least 24. Every combination of "n" and "c" positions are included as specific embodiments of polypeptide fragments of ATHB 16 protein of the invention. All ranges used to describe any polypeptide fragment .embodiment of the present invention are inclusive unless specifically set forth otherwise.
The subject invention also concerns transformed and transgenic grasses and tissues and seeds thereof that exhibit improved phenotypic characteristics, such as turf quality, in comparison to wildtype grasses. In one embodiment, a grass plant comprises a nucleic acid encoding a leucine zipper class I polypeptide, or a fragment, variant, or homolog thereof. In an exemplified embodiment, a grass plant comprises a nucleic acid that encodes an Arabidopsis ATHB 16 protein, or a fragment, variant, or homolog thereof. In one embodiment, the ATHB 16 protein comprises the amino acid sequence shown in SEQ ID NO: 2, or a fragment, variant, or homolog thereof. In a specific embodiment, a grass plant comprises a nucleic acid comprising the nucleotide sequence shown in SEQ ED NO: 1 or SEQ ID NO: 7. In another embodiment, a grass plant comprises any of the nucleic acids having any of the sequences disclosed herein or that encode a protein having any of the sequences disclosed herein, or a fragment, variant, or homolog thereof. In one embodiment, the nucleic acid, or the protein encoded thereby such as ATHB 16, is overexpressed or constitutively expressed in the plant. Methods for transforming plants with heterologous nucleic acid are known in the art and any suitable method can be used with the present invention. Turfgrasses contemplated within the scope of the invention include Bahiagrass, St. Augustine, Bermudagrass, Bentgrass, Zoysia, Tall fescue, Perennial Ryegrass, Kentucky Bluegrass, Buffalograss, Carpetgrass, Seashore Paspalum, and Centipedegrass. Forage
grasses contemplated within the scope of the invention include Bahiagrass, Brachiariagrass, St. Augustine, Bermudagrass, Bentgrass, Zoysia, Tall fescue, Perennial Ryegrass, Kentucky Bluegrass, Buffalograss, Carpetgrass, Seashore Paspalum, and Centipedegrass. In one embodiment, the grass is transgenic.
Polynucleotides of the present invention can be introduced directly into plants, e.g., by biolistic or Agrobacterium-mediated transformation (see, for example, U.S. Patent No. 7,057,090), and transformed and transgenic plant lines prepared therefrom. Plants containing a polynucleotide of the invention can also be prepared through conventional breeding from a transformed or transgenic breeding line. Agrobαcterium containing a polynucleotide of the invention can be used to transform plant cells with the polynucleotide according to standard methods known in the art. For Agrobαcterium transformation, polynucleotide vectors of the invention can also include T-DNA sequences. Polynucleotides can also be introduced into plant cells by a biolistic method (Carrer, 1995), by electroporation, by direct gene injection, and by other methods known in the art. Plants can also be transformed with polynucleotides of the present invention using marker-free transformation techniques (Zuo et αl, 2002).
All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
MATERIALS AND METHODS Expression cassette.
The coding region of ATHB 16 gene was amplified from Arabidopsis ecotype Columbia cDNA using primers A16F: 5 -AGGATCCACGCGT
ATGAAGAGACTAAGCAGCTCO 1 (SEQ ID NO: 3) and A16R: 5'-AGAGCTC TCAAGTCCAATGATCTGAAG-S 1 (SEQ ID NO: 4) (underlined are the restriction sites for the enzymes of Bαtήαl, Mlul and Sαcl, respectively). The primer were designed based on the ATHB 16 gene coding DNA sequence (cds) present in GenBank under the accession number of AF076641. The total RNA was extracted for cDNA synthesis from three- week plantlets germinating from seeds on 14 strength MS medium (PhytoTechnology Laboratories, USA) supplemented with 1% sucrose and 0.3% gelrite under a long day photoperiod ( 16 h light/8h dark) at 20 0 C. The RNEASY Plant Mini Kit (Qiagen, Valencia, CA) and ISCRIPT cDNA Synthesis kit (BioRad, Hercules, CA) were used for RNA extraction and cDNA synthesis, respectively, according to the manufacturers' instruction. The amplified 885 bp fragment was
cloned in the pDrive vector (Qiagen, USA), sequenced and inserted into an expression vector between CaMV 35 S promoter (Odell et al, 1985)with HSP70 intron (Rochester et al, 1986) and NOS (nopaline synthase) 3' terminator (Bevan, 1984; Fraley et al, 1983) following excision with the restriction enzymes Barriαl and Sad. The fragment of 2.6 kb containing the entire expression cassette was isolated from the vector backbone for biolistic gene transfer following restriction digest and gel purification.
Plant material, tissue culture and transformation.
Mature seeds of bahiagrass 'Argentine', a tetraploid, apomictic cultivar, were used to initiate callus induction for genetic transformation (Fig. IA). The tissue culture and gene transformation procedures were as described by Altpeter and James (2005). For selective purpose, the gene npt II (neomycin phosphotransferase D) under the control of the maize ubiquitin promoter and first intron (Christensen and Quail, 1996) was co-transformed with ATHB 16 expression cassette. The ATHB 16 and npt II expression cassettes were mixed in a 2:1 ratio, and precipitated on 1.0 μm diameter gold particles as described previously (Sanford et al, 1991) and delivered to ernbryogenic calli of Argentine bahiagrass using a DuPontPDS- 1000/He device (Sanford et al, 1991) at 1100 psi. Transgenic callus (Fig. IB) and plantlets (Fig. 1C) were selected on medium containing 50 mgl "1 paromomycin sulfate. Rooted transgenic plants were transferred to soil and propagated under controlled environment conditions at 27°C/20°C day/night with 12 hour photoperiod and 800 InEnV 2 S "1 light.
Polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR).
For PCR screening of the transgenic plans, genomic DNA was extracted from approx. 100 mg leaf tissue using a DNEASY Plant Mini Kit (Qiagen, Valencia, CA), and about 100 ng genomic DNA was used as templates. PCR was carried out in an Eppendorf MASTERCYCLER (New York City, USA). Samples were denatured at 95 0 C for 15 min; followed by 30 cycles at 95 0 C for 30sec, 6O 0 C for 30sec, 72 0 C for lmin; and final extension at 72°C for 10 min. PCR products were analyzed by electrophoresis on a 1.5% agrose gel. The primer pair with sense 5'-TGGGTCTATCGGAGAAGAAG-S' (SEQ ID NO: 5) and anti- sense 5'-TTGGAGAAGGGAATCATTGT-S' (SEQ ID NO: 6) was designed to amplify a 278 bp fragment from the gene ATHB 16, the same primer pair was used for RT-PCR expression analysis.
For RT-PCR, total RNA was extracted from 100 mg leaves using the RNEASY Plant Mini Kit (Qiagen, Valencia, CA); 500 πg of total RNA was used for cDNA synthesis via reverse transcription with the ISCRJDPT cDNA Synthesis kit (BioRad, Hercules, CA) in a reaction volume of 20 μl. 2 μl of the cDNA were used as a template to detect the transcripts of the gene ATHB 16 by PCR with the same primer pair as described above for PCR from genomic DNA.
Southern blot analysis.
Total genomic DNA was isolated from leaves of transgenic and wild type plants as described by Saghai-Maroof et al (Saghai-Maroof et al., 1984). 20 μg of genomic DNA, fully digested with BamηI were separated with electrophoresis using a 1% agrose gel and then blotted onto a Hybond-N+ membrane (GE Healthcare (formerly Amersham Biosciences), Pistcataway, NJ). The amplified 897 bp fragment from the ATHB 16 gene was used as probe. Hybridization and detection were performed according to the manufacturers' instructions.
Evaluation of plant performance under hydroponics growth conditions.
Single tillers with newly formed, 2-3cm long roots were transferred to hydroponics nutrient solution made of 1.2% Boost and 0.3% Grow (Technaflora Plant Product, Canada). Roots were fully submerged into aerated nutrient solution with approximately 80% oxygen saturation. Four weeks after the culture initiation, the number of tillers, length of tillers, length of roots, biomass of tillers and biomass of roots were measured. The experiment was conducted as randomized block with six replications in a walk in growth chamber with 400 mEm '2 S "1 light intensity, 16/8 h light/dark, and 28 0 C / 20 0 C day/night temperature.
Green house evaluation of plant architecture.
Single rooted tillers from transgenic or wild type plants were transplanted per 8x8x7cm pot with steam sterilized topsoil, completely randomized with 48 replications and propagated in the greenhouse. After a two month growth period, the following parameters were evaluated: number of tillers, tiller length (from crown to tip of leaf), length of tiller base (from crown to first leaf), leaf length (average length of the three longest leaves), leaf width (average with of the three longest leaves). Number of inflorescences, length of fully expanded inflorescences, was recorded after a 12, 15 and 17 weeks growth period. The temperature was controlled with air conditioning to approximately 28 0 C during day and 20
0 C during night. Natural photoperiod without supplemental lighting was applied to the experiment. The experiment initiated one week before Spring equinox with 12h day length. Summer solstice with 14h day length was on June 21 st .
Statistical analysis
Statistical analysis was performed according to the randomization structure using the GLM-procedure of SAS version 6.12 (SAS Institute Inc. 1999). Means were compared by the t-test (LSD, p < 0.05). Standard error is shown in figures as bar.
Following are examples that illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
EXAMPLE 1— PLANT TRANSFORMATION AND MOLECULAR CHARACTERIZATION OF TRANSGENIC LINES
Vector backbone sequences of both the constitutive ATHB 16 expression cassette and the nptll expression cassette were removed by restriction digestion and gel purification. Unlinked expression cassettes were precipitated on gold particles in a 2:1 (ATHB 16: nptll) molar ratio, introduced into mature seed derived callus by biolistic gene transfer and transgenic events were selected by growth and regeneration on paromomycin containing culture medium as described earlier (Altpeter and James 2005). A total of twenty-one independent paramomycin-resistant bahiagrass plants were regenerated from 300 bombarded callus pieces. PCR (Figure 2A) with primers annealing to the ATH 16 coding region revealed that 18 of them had at least one copy of the ATHB 16 transgene. The PCR positive lines were subjected to RT-PCR expression analysis (Figure 2B). ATHB 16 transcript was detected in nine transgenic lines. Southern blot analysis was carried out following restriction digest of genomic DNA with BamHI which cuts within the coding region of the ATHB 16. Probing with the full length ATHB16 coding region is consequently expected to result in one hybridization signal per transgene copy. Southern blot analysis confirmed the independent nature of the transgenic lines. Ethidium bromide staining (not shown) confirmed equal loading of genomic DNA. All lines had multiple transgene copies inserted with line 1-1 Ob showing the least complex and line 1-3 showing the most complex transgene integration pattern (Figure IG).
EXAMPLE 2— EVALUATION OF THE TURF QUALITY OF THE TRANSGENIC "ARGENTINE" BAHIAGRASS
ATHB 16 expression was correlated with an increased number of vegetative tillers and a proportional semi-dwarfing (shorter and finer leaves), while transgenic lines without detectable transcript displayed a phenotype like the wildtype "Argentine" bahiagrass. Three lines expressing ATHB 16 and differing in the severity of the semi-dwarf and dense phenotype were selected for more detailed morphological analysis. Mass propagation was achieved by using rooted tillers of equal size to initiate soil or hydroponics culture. The hydroponic grown transgenic lines (I-4b, 10b and 32a) showed a significantly increased number of tillers (Fig. 2C and 2D), reduced tiller length (Figure 2F). None of the transgenic lines produced less root (Fig. 2G) or shoot biomass (Figure 2H) than wildtype. Transgenic line I- 10b showed the highest density with 77% more tiller ' s generated than wild type (Fig. 2D) and 87% more shoot biomass than wildtype (Figure 2H) with no significant difference in root biomass to wildtype but 20% longer roots. The length of the transgenic tillers were 29%; 18% or 17% less than wild type, for I-4b; I-10b or I-32a respectively (Fig. 2F). 1-32 represents the transgenic line that is most similar to wildtype in tiller length (Figure 2F) but produced 34% more shoot (Fig. 2H) and 32% more root biomass (Fig. 2G) dry weight and 39% longer roots (Fig. 2E) than wildtype. I-4b, the line with the shortest tillers (Figure 2F) did not show any significant difference to wildtype in shoot (Figure 2H) or root biomass (Figure 2G) dry weight, or length of the longest root (Figure 2E).
AU soil grown transgenic lines (I-4b, 10b and 32a) showed a significantly increased number of tillers (Figure 3A), reduced tiller length (Figure 3B) resulting from shorter leaves (Fig. 3D) and a shorter tiller base (data not shown), narrower leaves (Figure 3C) than the wild type plants. Transgenic line I-10b showed the highest density with 38% more tillers generated than wild type (Figure 3A). The length and width of the leaves of I- 10b were 36% (Fig. 3B) and 17% (Figure 3C) less than wild type, respectively. Further, I-10b displayed delayed flowering compared to the wildtype and had significantly less and shorter seedheads (Figure 3F; Table 1). Line I-32a represented the transgenic line which was most similar to the wildtype but also displayed significant differences with 15% more tillers generated than wild type (Figure 3A). The length and width of the leaves of I-32a were 26% (Figure 3B) and 20% less (Figure 3C) than wild type, respectively. Transgenic lines produced a large number of roots similar or better than wildtype as shown for I-10b (Figure 3F). While all
transgenic plants produced seedheads with normal flower morphology. Heading was delayed for more than a month in transgenic lines I-4b and I-10b (Table 1). Two weeks after the summer solstice with I4h day-length all wildtype plants had at least one seedhead with an average of 4 seedheads per plant, while 36%; 35% or 2% of the plants from I-4b; I-10b or I- 32a respectively did not have any seedhead (Table 1). The average number of seedheads per transgenic plant ranged from 1 to 2.5 for lines I-10b and I-32a respectively. The length of seedheads was on average 41 %, 26% or 4% less than wildtype for lines I-4b, 1-1 Ob or I-32a respectively (Table 1).
EXAMPLE 3— EVALUATION OF BAHIAGRASS CONTAINING ATHB16 UNDER FIELD CONDITIONS
Plants from three transgenic lines (1-4, 1-10 and 1-32) expressing ATHB16 (Figure 4) were propagated under greenhouse conditions along with wildtype "Argentine" bahiagrass and St. Augustine grass "Floratam" (Figure 5A). Transgenic and wild-type plants were established (Figure 5B) and evaluated at the UF-IFAS Plant Research and Education Center in Citra, Florida (USDA permit 05-364-0Ir) in a randomized block design with a total of 24 replications evaluated in small field plots (Figure 5C). Data on establishment, turf density, chlorophyll content, and seed-head production and length was gathered during three months of growth after transplanting.
All transgenic and non-transgenic plants survived the establishment phase. However, St. Augustine grass had to be treated with insecticide and fungicide 6 weeks after transplanting. Transgenic I- 10 lines showed overall faster establishment with more vegetative tillers than other lines and wild type bahiagrass and St. Augustine grass (Figure 6).
Dark-green color is usually desired for lawn grasses. The grass color is highly dependent on chlorophyll content in plant leaves. Higher chlorophyll content was observed in transgenic line 1-32 eight and twelve weeks after transplanting, while 1-10 was not significantly different from wildtype and 1-4 has significantly less chlorophyll than wild type. The highest chlorophyll content was observed four weeks after transplanting and two weeks after the nitrogen application, which took place two weeks after transplanting (Figure 7).
The turf quality of wild-type bahiagrass is compromised by its open growth habit. The sparse looking lawn will affect its aesthetic value and facilitates weed encroachment. The transgenic line 1-10 displayed the highest turf density (Figure 8) as a consequence of
significantly more tillers per area then wild-type (Figure 9). Transgenic lines also displayed proportional dwarfing (Figure 8).
Based on the standards provided by the National Turf Evaluation Program (NTEP), the mowing quality of transgenic plants was further evaluated and compared to wild type bahiagrass. All NTEP ratings for transgenic lines were significantly higher than the wild type (Figure 10). The denser growing transgenic grass with shorter and finer leaves improve the turf quality (Figure 11).
The major drawback of bahiagrass as lawn turf is the presence of tall (>50 cm) seedheads during the summer. In transgenic lines expressing the ATHB 16 gene, emergence of inflorescences was delayed by two to three weeks, and the length and number of inflorescences was also significantly reduced in most transgenic lines compared to the wild type (Table 4).
Table 4. Emergence and length of inflorescences of transgenic lines compared to wild type
In summary, transgenic bahiagrass lines over-expressing ATHBl 6 displayed improved turf quality under field conditions including higher turf density and delayed or reduced seed- head formation. The low-input characteristics of bahiagrass, including ease of establishment and persistence were maintained in the transgenic plants.
EXAMPLE 4— EVALUATION OF BAHIAGRASS LINES CONTAINING ATHB 16 FOR DROUGHT STRESS RESPONSE IN COMPARISON TO WILD-TYPE BAHIAGRASS PLANTS AND ST. AUGUSTINEGRASS UNDER CONTROLLED ENVIRONMENT CONDITIONS
Transgenic lines and the wild-types were established in top soil using single uniform tillers per pot (15 cm diameter) in five replications. The plants were allowed to grow under
greenhouse conditions until closed canopy was achieved. The plants were then transplanted into 15x15 cm wide and 41 cm deep treepots using top soil (Figure 12A). The pots were placed in two bins in a completely randomized design with five replications. Following transplanting, the plants were allowed to grow in the bins for four weeks with daily irrigation.
Before drought treatment, pots were saturated with water by filling the bins with water up to 3 A height of the bins for four hours. The bins were then drained and total volumetric water content was measured using a Time Domain Reflectometer (TDR) to evaluate uniformity of soil moisture. Pre-stress measurements were taken for relative water content (RWC). The plants were then maintained for 12 weeks without irrigation (Figures 12B and 12C). During this time, all measurements were made every two weeks.
At the end of 12 weeks, the bins were flooded again and the plants were irrigated overnight. The water was then drained and the plants were watered daily. Weekly visual scores from 1-9 were given for recovery from drought stress with 1 representing a dead plant and 9 representing a fully recovered plant.
At the end of three weeks after re-hydration (Figures 13A and 13B), the plants were removed from the pots and the soil was washed off. Shoot and root fresh weights were recorded and the samples were then dried in an 80 0 C oven for 1 week. Following drying, shoot and root dry weights were evaluated. Shoot growth during recovery was estimated by deducting the shoot dry weight from the shoot total biomass (dead and green).
For measurement of RWC, the first fully expanded leaf was harvested from three tillers per pot. Each leaf was then weighed (FW) and submerged in de-ionized water (DIH 2 O) for 16 hours in a 15 ml tube. The leaf was then taken out of the water, excess water was removed using absorbent tissue paper and the turgid weight was measured (TW). The leaf was then placed in a paper envelope and dried at 8O 0 C for 16-18 hours. Following this, the dry weight (DW) of the leaf was estimated. The RWC was then calculated by applying the equation RWC = (FW-DW)/(TW-DW).
Pre-stress RWC measurements indicated that transgenic lines 14 and 132 were significantly lower than St. Augustinegrass (WT-SA) (P<0.05; Figure 14A). Six weeks after withholding irrigation, there were no significant differences among the transgenic lines, wild- type bahiagrass and St. Augustinegrass (PO.05; Figure 14B). Eight weeks after withholding irrigation, transgenic line 14 had the highest RWC and was significantly higher than both wild-type bahiagrass and St. Augustinegrass (P<0.05; Figure 14C).
Soil moisture monitored using TDR indicated that there were no significant differences among the transgenic lines, wild-type bahiagrass and St. Augustinegrass under well-watered pre-stress conditions (P<0.05; Figure 15). Six weeks after withholding irrigation, transgenic line 14 had the highest soil moisture and was significantly different from both wild-type bahiagrass and St. Augustinegrass (P<0.05; Figure 15). At the end of eight weeks under non-irrigated conditions, there were no significant differences among the transgenic lines, wild-type bahiagrass and St. Augustinegrass (P<0.05; Figure 15).
Recovery scores indicated that line 132 had significantly higher recovery scores compared to St. Augustinegrass and wild- type bahiagrass at the end of the second week (PO.05; Figure 16A and 16B).
At the end of the three week recovery period, growth of transgenic lines was measured by estimating the difference between the total biomass (dead and necrotic) and dry weight of the shoots of transgenic lines and wild-types. Line 132 had the highest differential between freshweight and dry weight biomass and was significantly higher than wild-type bahiagrass and St. Augustinegrass (PO.05; Figure 17A) indicating better regrowth after drought stress. Total biomass of shoot dry weight for line 132 was also the highest and differed significantly from the wild-type bahiagrass and St. Augustinegrass (P<0.05; Figure 17B). The dry weight of the roots of transgenic lines was not significantly different from wild-type bahiagrass and St. Augustinegrass (P<0.05; Figure 17C).
It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims. In addition, any elements or limitations of any invention or embodiment thereof disclosed herein can be combined with any and/or all other elements or limitations (individually or in any combination) or any other invention or embodiment thereof disclosed herein, and all such combinations are contemplated with the scope of the invention without limitation thereto.
REFERENCES U.S. Patent No. 5,106,739 U.S. Patent No. 6,528,701 U.S. Patent No. 6,054,574 U.S. Patent No. 5,625,136 U.S. Patent No. 5,034,322 U.S. Patent No. 6,340,748 U.S. Patent No. 6,127,179 U.S. Patent No. 6,118,049 U.S. Patent No. 6,462,185 U.S. Patent No. 5,859,328 U.S. Patent No. 5,652,354 U.S. Patent No. 5,639,948 U.S. Patent No. 5,589,610 U.S. Patent No. 6,455,760 U.S. Patent No. 6,696,623
U.S. Published Patent Application No. 20040078841 U.S. Published Patent Application No. 20040067506 U.S. Published Patent Application No. 20040019934 U.S. Published Patent Application No. 20030177536 U.S. Published Patent Application No. 20030084486 U.S. Published Patent Application No. 20040123349
Altpeter, F., and James, V.A. (2005) "Genetic transformation of turf-type bahiagrass (Paspalum notatum Flugge) by biolistic gene transfer" International Turfgrass Society Research Journal. 10:1-5.
Altpeter, F., and Positano, M. (2005) "Efficient plant regeneration from mature seed derived embryogenic callus of turf-type bahiagrass (Paspalum notatum Flugge)" International Turfgrass Society Research Journal. 10:479-484.
Altschul et al. (1997) Nucl. Acids Res. 25:3389-3402.
Beltz, G. A., K.A. Jacobs, T.H. Eickbush, P.T. Cherbas, and F.C. Kafatos (1983) Methods of Enzymology, R. Wu, L. Grossman and K. Moldave [eds.] Academic Press, New York 100:266-285.
Bevan, M. (1984) "A New Agrobacterium Vector for Plant Transformation" Heredity. 53:577-578.
Broun, P. (2004) "Transcription factors as tools for metabolic engineering in plants" Current opinion in plant biology. 7:202-209.
Carrer, H., P. Maliga (1995) "Targeted insertion of foreign genes into the tobacco plastid genium without physical linkage to the selectable marker" Biotechnology 13:791-794.
Christensen, A.H., and Quail, P.H. (1996) "Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants" Transgenic Research. 5:213-218.
Clancy, M. and Hannah, L.C. (2002) "Splicing of the maize ShI first intron is essential for enhancement of gene expression, and a T-rich motif increases expression without affecting splicing" Plant Physiol. 130(2):918-29.
Fraley, R.T., Rogers, S.G., Horsch, R.B., Sanders, P.R., Flick, J.S., Adams, S.P., Bittner, MX., Brand, L. A., Fink, CL, Fry, J.S., Galluppi, G.R., Goldberg, S. B., Hoffmann, N.L., and Woo, S-C. (1983) "Expression of Bacterial Genes in Plant-Cells" Proceedings of the National Academy of Sciences of the United States of America. 80:803-4807.
Garcia-Martinez, J.L., and Gil, J. (2001) "Light regulation of gibberellin biosynthesis and mode of action" Journal of Plant Growth Regulation. 20:354-368.
Good, X. et al. (1994) "Reduced ethylene synthesis by transgenic tomatoes expressing S- adenosylmethionine hydrolase" Plant Molec. Biol. 26:781-790.
Hedden, P., and Phillips, A.L. (2000) "Gibberellin metabolism: new insights revealed by the genes" Trends in plant science. 5:523-530.
Himmelbach, A., Hoffmann, T., Leube, M., Hohener, B., and Grill, E. (2002) "Homeodomain protein ATHB6 is a target of the protein phosphatase ABIl and regulates hormone responses in Arabidopsis" Embo Journal. 21 :3029-3038.
Jones, A.M., Im, K.H., Savka, M.A., Wu, M.J., DeWitt, N.G., Shillito, R., and Binns, A.N. (1998) "Auxin-dependent cell expansion mediated by overexpressed auxin-binding protein 1" Science. 282:1114-1117.
Karlin and Altschul (1990) Proc. Natl. Acad. ScL USA 87:2264-2268. Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Lewin, B. (1985) Genes II. John Wiley & Sons, Inc., p. 96.
Leyser, O. (2005) "The fall and rise of apical dominance" Current opinion in genetics & development. 15:468-471.
Maniatis, T., E.F. Fritsch, J. Sambrook (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
McSteen, P., and Leyser, O. (2005) "Shoot branching" Annual review of plant biology. 56:353-374.
Niki, T. 3 Nishijima, T., Nakayama, M., Hisamatsu, T., Oyama-Okubo, N., Yamazaki, H., Hedden, P., Lange, T., Mander, L.N., and Koshioka, M. (2001) "Production of dwarf lettuce by overexpressing a pumpkin gibberellin 20-oxidase gene" Plant physiology. 126:965-972.
Odell, J.T., Nagy, F., and Chua, N.H. (1985) "Identification of DNA-S equences Required for Activity of the Cauliflower Mosaic Virus-35s Promoter" Nature. 313:810-812.
Quaedvlieg, N., Dockx, J., Rook, F., Weisbeek, P., and Smeekens, S. (1995) "The Homeobox Gene Athl of Arabidopsis Is Derepressed in the Photomorphogenic Mutants Copl and Detl" Plant Cell. 7:117-129.
Rochester, D.E., Winer, J. A., and Shah, D.M. (1986) "The structure and expression of maize genes encoding the major heat shock protein, hsp70" Embo J. 5:451-458.
Saghai-Maroof, M.A., Soliman, K.M., Jorgensen, R.A., and Allard, R.W. (1984) "Ribosomai DNA spacer-length polymorphisms in barley: mendelian inheritance, chromosomal location, and population dynamics" Proceedings of the National Academy of Sciences of the United States of America. 81 :8014-8018.
Sakamoto, T., Kobayashi, M., Itoh, H., Tagiri, A., Kayano, T., Tanaka, H., Iwahori, S., and Matsuoka, M. (2001) "Expression of a gibberellin 2-oxidase gene around the shoot apex is related to phase transition in rice" Plant physiology. 125:1508-1516.
Sanford, J.C., De Vit, MJ., Russell, J.A., Smith, E.D., Harpending, P.R., Roy, M.K., and Johnson, S.A. (1991) "An improved helium-driven biolistic device" Technique. 3.
Schmitz, G., and Theres, K. (2005) "Shoot and inflorescence branching" Current opinion in plant biology. 8:506-511.
Schomburg, F.M., Bizzell, CM., Lee, DJ., Zeevaart, J.A., and Amasino, R.M. (2003) "Overexpression of a novel class of gibberellin 2-oxidases decreases gibberellin levels and creates dwarf plants" Plant Cell. 15:151-163.
Schwob, E., Choi, S.Y., Simmons, C, Migliaccio, F., Hag, L., Hesse, T., Palme, K., and Soil, D. (1993) "Molecular analysis of three maize 22 kDa auxin-binding protein genes- transient promoter expression and regulatory regions" Plant J. 4:423-432.
Sessa, G., Morelli, G., and Ruberti, I. (1993) "The Athb-1 and Athb-2 Hd-Zip Domains Homodimerize Forming Complexes of Different DNA-Binding Specificities" Embo Journal. 12:3507-3517.
Soderman, E., Hjellstrδm, M., Fahleson, J., and Engstrom, P. (1999) "The HD-Zip gene ATHB6 in Arabidopsis is expressed in developing leaves, roots and carpels and up- regulated by water deficit conditions" Plant molecular biology. 40:1073-1083.
Unruh, J.B., and Brecke, BJ. (1999) "Plant growth retardants for fine turf and roadsides/utilities" Florida Cooperative Extension Service, IFAS publication AGR- 17.
Valliyodan, B., and Nguyen, H.T. (2006) "Understanding regulatory networks and engineering for enhanced drought tolerance in plants" Current opinion in plant biology. 9:189-195. van der VaIk, P., Proveniers, M.C.G., Pertijs, J.H., Lamers, J., van Dun, C.M.P., and Smeekens, J.C.M. (2004) "Late heading of perennial ryegrass caused by introducing an Arabidopsis homeobox gene" Plant Breeding. 123:531-535.
Wang, Y. (2001) "The Role of the Homeobox Gene ATHBl 6 in Development Regulation in Arabidopsis thaliana" PhD Thesis, Uppsala University, Uppsala, Sweden.
Wang, Y., Henriksson, E., Soderman, E., Henriksson, K.N., Sundberg, E., and Engstrom, P. (2003) "The Arabidopsis homeobox gene, ATHB 16, regulates leaf development and the sensitivity to photoperiod in Arabidopsis" Developmental biology. 264:228-239.
Wang, Y., and Li, J. (2006) "Genes controlling plant architecture" Current opinion in biotechnology. 17:123-129.
Ward, S.P., and Leyser, O. (2004) "Shoot branching" Current opinion in plant biology. 1:12>- 78.
Xu, D., McElroy, D., Thornburg, R. W., Wu, R. et al (1993) "Systemic induction of a potato pin2 promoter by wounding, methyl jasmonate, and abscisic acid in transgenic rice plants" Plant Molecular Biology 22:573-588.
Yamaguchi-Shinozaki, K., and Shinozaki, K. (2005) "Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters" Trends in plant science. 10:88-94.
Yang, T. T. et al (1996) "Optimized Codon Usage and Chromophore Mutations Provide Enhanced Sensitivity with the Green Fluorescent Protein" Nucleic Acid Research 24(22):4592-4593.
Zuo, J. et al. (2002) "Marker-free Transformation: Increasing Transformation Frequency by the Use of Regeneration-Promoting Genes" Current Opinion in Biotechnology 13:173-180.
