DESCRIPTION

MATERIALS AND METHODS FOR THE TREATMENT OF ENTERIC BACTERIAL INFECTIONS AND ASSOCIATED PATHOLOGIES INCLUDING COLORECTAL CANCER

CROSS-REFERENCE TO A RELATED APPLICATION This application claims priority to U.S. Provisional Application No. 62/486,708, filed on April 18, 2017. The entire content of the foregoing application is expressly incorporated herein by reference.

The Sequence Listing for this application is labeled "SeqList-18Aprl7-ST25.txt", which was created on April 18, 2017, and is 9 KB. The entire content is incorporated herein by reference in its entirety. BACKGROUND OF INVENTION

The intestinal microbiota is a complex ecological system implicated in numerous health processes, including immunological responses, metabolic and nutritional functions as well as protection from enteric pathogen infection. For example, the intestinal microbiota is involved in vitamin synthesis, innate and adaptive immune responses, and competitive exclusion of enteropathogens. In the intestine, the microbiota is a relatively stable ecosystem, the disruption of which can foster expansion of enteric pathogens. Antibiotics have significant and long-lasting effects on the intestinal microbiota and can reduce colonization resistance against pathogens.

Campylobacter jejuni (C. jejuni), a prevalent food bom bacterial pathogen is one of the most prevalent causes of bacteria-induced diarrheal illness in the United States. Clinical symptoms of C. jejuni infection include abdominal cramps, watery to bloody diarrhea, fever and gastrointestinal inflammation. In 2014, more cases of C. jejuni-denved bacterial diarrhea were diagnosed than the combined incidences of the following 8 bacterial pathogens. The Centers for Disease Control and Prevention estimate that 2.4 million subjects are infected with C. jejuni resulting in more than 100 deaths every year in the United States. However, the interplay between intestinal microbiota and host susceptibility to C. jejuni infection is unknown. At the cellular level, C. jejuni infected patients display infiltration of immune cells such as neutrophils, crypt abscesses and presence of fecal leukocytes. Although the intestinal disease self-resolves within one week, a small portion of patients (1 : 1000) develop serious post-infection complications, including arthritis, Guillian-Barre Syndrome, Irritable Bowel Syndrome and Inflammatory Bowel Diseases (IBD).

The Applicants established an acute model of campylobacteriosis using germ-free mo-1- mice. In this model, C. jejuni induced a rapid (5 days) and robust inflammatory (bloody diarrhea) response to the microorganism. However, the cellular and molecular details responsible for this host response remained undefined.

Gnotobiotic technology applied to germ free (GF) II 10-/- mice (129 SvEv) showed that the human clinical C. jejuni strain 81-176 induced acute intestinal inflammation resembling key features of human campylobacteriosis (neutrophils infiltration, crypt abscesses, and bacterial invasion). ¹ Subsequent studies showed that innate immunity was critical for campylobacteriosis as the inflammatory response was similar between II 10-/- and 1110-/-; Rag2-/- mice. Moreover, phosphatidylinositol 3-kinases gamma (ΡΒΚγ) signaling mediated neutrophil migration into colonic tissues and was essential for C. je/wra-induced colitis. ²

Colorectal cancer (CRC), one of the most common and deadly malignancies in the United States, with approximately 135,430 new CRC cases and over 50,260 CRC-related deaths nationwide in 2017 ³ . Substantial evidence points to an essential role of the intestinal microbiota in CRC pathogenesis ^4"6 . Various pathobionts and enteric pathogens have been associated with development of CRC, including Bacteroides, Fusobacterium, Salmonella, Escherichia and Campylobacter spp. ^1A0 Mechanisms by which bacteria influence development of CRC include change in inflammatory environment, production of molecules affecting DNA stability and alteration of proliferative response ⁶ . For example, the pathogenic island pks, present in certain infectious and pathobiont Esherichial coli B2 groups, and responsible for the synthesis of the secondary metabolite colibactin, is critical for CRC development in III 0 ^' and IllO^ ^' ^- lpc ¹ ^" ⁷ ^ mice and required an inflammatory milieu to promote carcinogenesis ^{1 1"13} . Moreover, microbial-derived toxins may have synergistic effect on carcinogenesis as recently demonstrated with high prevalence of E. co/ -derived pks and Bacteroides fragilis-derw ^' ed bft in patients with familial adenomatous polyposis ¹⁴ . Another bacterial genotoxin is cytolethal distending toxin (CDT) produced by selective strains of enteric pathogens such as Salmonella, Escherichia and Campylobacter spp ^15-17 The genotoxin CDT is composed of three subunits CdtA, CdtB and CdtC, which possesses DNase I-like ability to induce host DNA damage.

Interestingly, co-occurrence of Fusobacteria and Campylobacter spp. have been observed in CRC patients as well as an increased prevalence of Escherichia and Campylobacter spp. in colorectal tumor lesions compared to normal adjacent tissue ^9,10 . A study from a Swedish cohort found no significant difference in gastrointestinal cancer risk between subjects diagnosed with C. jejuni infection and control subjects after ~7.6 years follow-up .

The mammalian target of rapamycin (mTOR), a downstream target of PI3 , has been implicated in many functions, including cell growth, proliferation, survival, and innate and adaptive immune responses. ^19"21 The mTOR inhibitor rapamycin prevented and treated C. y ^' e/ww ^' -induced campylobacteriosis in II 10-/- mice. ²² These findings highlighted the important role of PI3K/mTOR in C. ye/ww ^' -induced colitis. However, the role of commensal gut microbiota in controlling host susceptibility to C. jejuni infection was unknown. Interestingly, C. jejuni colonic luminal colonization level was not associated with the bacterial ability to induce colitis, ² ' ^22-24 suggesting a complex interaction between the pathogen, microbiota and host response. The intestinal microbiota exerts numerous effects on the host, especially on immune response following infection. For example, the microbiota regulated granulocytosis

25

and neonate response to Escherichia coli Kl and Klebsiella pneumoniae sepsis. In addition, the microbiota enhanced myelopoiesis and protected against Listeria monocytogenes infection. ²⁶ At the gastrointesitnal level, acetate derived from Bifidobacteria metabolism protected host against enterohaemorrhagic E. coli 0157:H7 infection by inhibiting its Shiga toxin translocation. '

Commensal segmented filamentous bacterium induced IL17- and IL22-producing

Thl7 cells ²⁹ and mice with deficiency of IL22 succumbed to Citrobacter rodentium infection. ³⁰ Recently microbiota transplantation has shown tremendous success against recurrent Clostridium difficile infection, ³¹ suggesting that microbial manipulation has the potential to treat infectious microorganisms. In addition, the biotransformation of secondary bile acids by C. scindens was found to inhibit C. difficile colonization and infection, ³² suggesting a critical role of microbial metabolites on C difficile pathogenesis. Intriguingly, bile acids, particularly secondary bile acid deoxycholic acid (DCA), are associated with various chronic diseases such as metabolic diseases, intestinal inflammation, and colorectal cancers. ^" Whether the microbiota-derived bile acid metabolism can prevent colonization of and host response to C. jejuni is unknown.

Members of the gastrointestinal microbiota play a pivotal role in lipid and bile acid metabolism. Bile acids are synthesized from cholesterol by hepatic enzymes, and they modulate lipoprotein, glucose, drug, and energy metabolism. Once synthesized in the liver, primary bile acids taurocholic acid (TCA) and cholic acid (CA) travel through the small intestine where 95% of bile is absorbed in the terminal ileum and through the hepatic system. The small amount of bile acids that reach the large intestine are further biotransformed by members of the gut microbiota via deconjugation and dehydroxylation into secondary bile acids, including deoxycholate (DCA), lithocholate (LCA), and ursodeoxycholate (UDCA). In general, antibiotics alter the bacterial community that is capable of deconjugation and dehydroxylation of primary bile acids in the intestine, resulting in decreased secondary bile acids and increased primary and conjugated bile acids.

Bile acids have been shown to either enhance or inhibit, for example, C. difficile spore germination and vegetative cell outgrowth. Furthermore, bacterial cocktails to replenish the level of secondary bile acids in the large intestine may have unwanted effects. For example, bile acids including DCA have been shown to increase the risk of colon cancer and hepatocellular carcinoma, while other bile acids, including UDCA appear to protect against colon cancer. Bile acids, especially DCA, have also been shown to induce the synthesis of Campylobacter invasion antigens and increase host cell invasion.

Therefore, methods and compositions to prevent and/or treat specific enteropathogen infections at a low risk of adverse effects are needed.

BRIEF SUMMARY

The subject invention provides methods, assays, and products for the prevention and/or treatment of enterocolitis. In some embodiments, the methods comprise diagnosing enterocolitis in a subject and administering to the subject an effective amount of a composition of the subject invention to treat the enterocolitis. In other embodiments, the methods comprise detecting enterocolitis-causing bacteria in a subject and administering to the subject an effective amount of a composition of the subject invention to prevent the occurrence of enterocolitis. The subject invention further provides methods, assays, and products for the prevention and/or treatment of gastrointestinal cancers. In some embodiments, the methods comprise diagnosing gastrointestinal cancer in a subject and administering to the subject an effective amount of a composition of the subject invention to treat the gastrointestinal cancer. In other embodiments, the methods comprise detecting gastrointestinal adenomas in a subject and administering to the subject an effective amount of a composition of the subject invention to prevent the occurrence of gastrointestinal cancers.

In some embodiments, the invention comprises administering microbiota to the subject. In some embodiments, the microbiota is genetically modified to express proteins that prevent and/or treat enterocolitis and prevent and/or treat gastrointestinal cancer. In other embodiments, the invention comprises administering metabolites of the microbiota to the subject. In some embodiments, the metabolites are partially purified; in some embodiments, the metabolites are substantially pure. In preferred embodiments, the invention comprises administering to the subject microbiota-derived bile acid-derivatives. In further preferred embodiments, the invention comprises administering to the subject therapeutically effective amounts of microbiota-derived bile acid-derivatives. In some embodiments, the invention comprises administering therapeutically effective amounts of conjugated bile acids and/or secondary bile acids, or salts thereof.

Further provided are methods of producing compositions to be used in the methods of the subject invention. In some embodiments, the methods comprise culturing microbiota under anaerobic conditions. In other embodiments, the methods comprise culturing microbiota under microaerobic conditions. The subject invention further provides compositions comprising microbiota or microbiota-derived products useful for the prevention and/or treatment of enterocolitis and/or prevention and/or treatment of gastrointestinal cancer.

In preferred embodiments, the compositions comprise microbiota cultured under anaerobic or microanaerobic conditions. In other preferred embodiments, the compositions comprise microbiota-derived metabolites partially purified or substantially pure, i.e., substantially free from other microbiota-derived components.

In a specific embodiment, the method of the subject invention comprises administering a composition comprising an effective amount of deoxycholic acid or a salt thereof, to a subject suspected to suffer or suffering from enterocolitis and/or suspected to suffer or suffering from a gastrointestinal cancer. The effective amount of deoxycholic acid in said composition is an amount sufficient to prevent and/or inhibit activation of the mTOR pathway in the intestinal tissue of the subject. In many embodiments, the enterocolitis treated or prevented is C. y ^' e/wm ^' -induced enterocolitis. In further embodiments, the gastrointestinal cancer-associated agent treated or prevented to induce gastrointestinal cancer is C. jejuni.

In some embodiments, the methods comprise administering to a subject an effective amount of a composition that increases deoxycholic acid in the intestinal tract of the subject. In some embodiments, the methods comprise administering an effective amount of a composition comprising taurocholic acid. In some embodiments, the compositions comprising taurocholic acid also comprise microbiota.

In other embodiments, the methods comprise administering one or more bacterial genera isolated from microbiota cultured under specific anaerobic conditions, where the bacterial genera include but are not limited to Clostridium cluster XI, Bifidobacterium, Butyricicoccus, Lactobacillus, Roseburia, Hydrogenoanaerobacterium, Coprobacillus and Oscillibacter .

In some embodiments, the methods further comprise administering microbiota genetically modified to express one or more enzymes that catalyze the conversion of primary bile acids to deoxycholic acid or a salt thereof.

In further embodiments, the methods comprise the steps of treating a subject suffering from or suspected to suffer from enterocolitis and/or suffering from or suspected to suffer from gastrointestinal cancer with antibiotic agents that target enterobacteria other than anaerobic bacteria, or antibiotic agents that target enterobacteria other than bile acid producing bacteria, and administering a composition of the subject invention to the subject treated with antibiotic agents. The treatment with antibiotic agents and the administration of a composition of the invention can be performed simultaneously or sequentially. In preferred embodiments, the treatment with an antibiotic agent is performed prior to the administration of the composition of the subject invention.

BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1A-1C: Pan-depletion of microbiota exacerbates C. y ^' e/ww ^' -induced intestinal inflammation in II 10-/- mice. Cohorts of 5-9 GF or SPF II 10-/- mice were gavaged with a single dose of 109 CFU C. jejuni/mouse and were euthanized 12 or 21 days post-infection. SPF II 10-/- mice were treated with an antibiotics (Abx) cocktail in their drinking water for 7 days before infection. Figure 1A H&E staining showing representative intestinal histology of C yeyww-induced colitis in SPF (left), SPF+ Abx (middle) and GF (GF, right) II 10-/- mice. Figure IB Quantification of histological intestinal damage score. Figure 1C ΙΙΙβ, Cxcl2, and III 7a mRNA qPCR fold change relative to GF and normalized to Gapdh. **, P<0.01. Scale bar is 200 μπι. Results are representative of 3 independent experiments.

Figures 2A-2H: Microbiota prevents C. y ^' ey ^' ww ^' -induced intestinal inflammation in GF II 10-/- mice in a manner independent of luminal colonization exclusion. Cohorts of 5-6 GF II 10-/- mice were colonized with a conventionalized microbiota (CONV-Biota) for 14 days or left in GF conditions. The mice were then infected with a single dose of 109 CFU C. jejuni/ ouse and were euthanized 12 days post-infection. Figure 2 A Representative intestinal histology images. Figure 2B Quantification of histological intestinal damage score. Figure 2C C. jejuni colonic luminal colonization level using culture. Figure 2D Colonic ΙΠβ, Cxcl2, and III 7a mRNA qPCR fold change relative to GF and normalized to Gapdh. Figure 2E Immunohistochemistry of myeloperoxidase positive neutrophils (brown dots). Red arrows indicate neutrophil accumulation in the crypt lumen and formation of crypt abscesses. Figure 2F Presence of C. jejuni (red dots, counted as dots/slide (lower panel)) in colonic sections of infected mice, detected using fluorescence in situ hybridization (FISH) assay. Figure 2G Live C. jejuni count in the colon tissue (left panel) and MLN (right panel). Briefly, MLN and colon tissue were aseptically resected, weighed, homogenized in PBS, serially diluted, and plated on Campylobacter-selective blood plates. The bacteria were counted after 48 h at 37°C using the GasPak system. Figure 2H Western blot of total and phosphorylated p70S6 (T389) and S-6 (S235/236) and Actin from resected colon tissues. Scale bar is 200 (Figure 2A), 50 (Figure 2E) or 10 (Figure 2F) μηι. All graphs depict mean ± SEM. NS, not significant, *, P<0.05; **, P<0.01. Results are representative of 3 independent experiments.

Figures 3A-3D: Anaerobic bacteria are enriched in campylobacteriosis resistant mice. Stool samples from mice conventionalized for 3 or 14 days and then infected with C. jejuni were subjected to 16S rDNA sequencing 12 days after C. jejuni infection (see Figure 10). Figure 3A PCoA comparing the microbiome composition of C. jejuni infected mice conventionalized for 3 or 14 days. Histological inflammation scores are shown as color code. PCoA 1 FDR-P = 0.01 (linear mixed effect model) and 1.26e-05 (t-test) and cage FDR-P= 0.97 (linear mixed effect). Figure 3B Shannon diversity and Figure 3C Choal richness show no differences or correlation with histological inflammation scores (FDR-P > 0.05 linear mixed effect and t-test). Figure 3D Histological inflammation scores are shown as color code Heatmap representation of genera significantly different (FDR-P < 0.05, t-test) between 3 days conventionalized and 14 days conventionalized II 10-/- mice prior to C. jejuni infection. Majority of the genera enriched in Campylobacteriosis resistant mice are anaerobic. Fac anaerobic: facultative anaerobic.

Figures 4A-4G: Anaerobic microbiota isolated from CONV-Biota attenuates C. ye ww-induced colitis. Cohorts of 4-8 GF II 10-/- mice were colonized with microbiota cultured under aerobic (Aero), microaerobic (Microaero), or anaerobic (Anaero) conditions, or all three groups pooled for 14 days. The mice were then gavaged with a single dose of 109 CFU Cjejuni/ ouse and were euthanized 12 days post-infection. Stool samples from Anaero- and Aero-Biota mice were subjected to 16S rDNA sequencing and HPLC/MS analysis of bile acids. Figure 4A H&E staining showing representative intestinal histology of C. je wra ^' -induced colitis in II 10-/- mice. Figure 4B Quantification of histological intestinal damage score. Figure 4C C. jejuni colonic luminal colonization level using culture in mice colonized with Aero- or Anaero-Biota. Figure 4D Colonic ΙΙΙβ, Cxcl2, and III 7a mRNA qPCR fold change relative to GF and normalized to Gapdh. Figure 4E PCoA comparing Anaero- and Aero-Biota microbiome composition pre- and post-C. jejuni infection, based on 16S rDNA sequencing. Figure 4F Heatmap representation of genera significantly different between Anaeroand Aero-Biota-colonized II 10-/- mice following C. jejuni infection, plus Campylobacter (red), which was not significant. Their abundance prior to infection is also shown. Green font indicates genera associated with anti -inflammatory response. Asterisks indicate the p-value after multiple hypothesis correction. Figure 4G Relative stool bile acid profile measured by HPLC/MS. TCA, taurocholic acid and tauromuricholic acid; CA, cholate; LCA, lithocholic acid; UDCA, Ursodeoxycholic acid; DCA, deoxycholate. ****, P < 0.0001 ; ***, P < 0.001 ; **, P < 0.01; *, P< 0.05; NS, not significant. Scale bar is 200 um. Results are representative of 3 independent experiments.

Figures 5A-5D: The microbial metabolite deoxycholate inhibits mTOR activity and prevents and treats C. y ^' e/ww ^' -induced colitis. Figure 5A Splenocytes isolated from II 10-/- mice were infected with C. jejuni (multiplicity of infection 50) and cultured in the presence of CA and DCA. Total and phosphorylated p70S6K (T389) and Actin was measured by Western Blot. Figure 5B Cohorts of 4-7 GF II 10-/- mice infected with a single dose of 109 CFU C jejuni/mouse were gavaged with the secondary bile acid DCA daily (DCA prevention (Prev)). For DCA treatment (DCA trt), mice infected with C. jejuni were gavaged with DCA on days 5-12 post-infection. H&E staining showing representative day 12 intestinal histology of C. jejuni- induced colitis in IllO-/- mice. Figure 5C Quantification of histological intestinal damage score. Figure 5D C. jejuni colonic luminal colonization level using culture. **, P < 0.01 ; *, P < 0.05; NS, not significant. Scale bar is 200 μηι. Results are representative of 3 independent experiments.

Figures 6A-6C: Microbial metabolites of the secondary bile acids LCA and UDCA minimally impact C. jejuni-m ^' duced colitis. Cohorts of 4-7 GF 1110-/- mice infected with a single dose of 109 CFU C. jejuni/mouse were gavaged with the secondary bile acids UDCA, LCA or DCA daily. The mice were then euthanized 12-days after infection. Figure 6 A H&E staining showing representative intestinal histology of C. y ^' e wra ^' -induced colitis in II 10-/- mice. Figure 6B Quantification of histological intestinal damage score. Figure 6C Colonic II β, Cxcl2, and // 7a rnRNA qPCR fold change relative to GF and normalized to Gapdh. **, PO.01 ; *, P<0.05; NS, not significant. Scale bar is 200 μηι. Results are representative of 3 independent experiments.

Figures 7A-7C: Targeted depletion of secondary bile acid-metabolizing microbiota promotes 1110-/- mouse susceptibility to C. jejuni. Cohorts of 4 SPF 1110-/- mice gavaged with the antibiotics clindamycin (Clind) or nalidixic acid ( alid) for 7 days prior to infection with a single dose of 109 CFU C. jejuni/mouse. Figure 7A H&E staining showing representative intestinal histology of C. jejuni-m ^' duced colitis in 1110-/- mice 21 days postinfection. Figure 7B Quantification of histological intestinal damage score. Figure 7C Relative stool bile acid profile measured by HPLC/MS (see Table 5 for values). *, P<0.05. Scale bar is 200 μιη. Results are representative of 3 independent experiments.

Figures 8A-8B: Antibiotic cocktail depletes microbiota. Cohorts of 5 conventionally- derived 1110-/- mice were treated for 7 days with antibiotic. Stool samples were collected, serially diluted, and cultured in Brain Heart Infusion (BHI) agar for 48 hours under aerobic or anaerobic conditions. Stool DAN was isolated and bacteria were estimated using real time PCR. Figure 8A Live aerobic and anaerobic bacterial count on BHI. Figure 8B Stool bacteria were estimated using PCR.

Figures 9A-9D: . Cohorts of 5-6 GF 1110-/- mice were -induced colitis in GF mice at 5- and 12-day post infection. Cohorts of 5-6 GF IllO-/- mice were infected with a single dose of 10 ⁹ CFU C. jejuni/mouse and were euthanized 5 or 12 days post-infection. Figure 9A Representative intestinal histology images. Figure 9B Quantification of histological intestinal damage score. Figure 9C C. jejuni was quantified using culture in stool and tissues of liver and MLN. Figure 9D Colonic ΙΙΙβ, Cxcl2, and III 7a mRNA qPCR fold change relative to GF and normalized to Gapdh at 5 and 12 days post-infection. All graphs depict mean ± SEM. *, P<0.05; **, P<0.01 ; NS, not significant. Scale bar is 200 μιη. Results are representative of 3 independent experiments.

Figures 10A-10B: GF mice conventionalized for 4 days resist against C. jejunu- induced colitis, Cohorts of 5-6 GF II 10-/- mice were transferred to SPF housing (conventionalization) for 3 or 14 days and were infected with a sing le dose of 10 ⁹ CFU C. jejunilmo sQ. The mice were euthanized 12 days post-infection. Figure 10A Representative intestinal histology images. Figure 10B Quantification of histological intestinal damage score. All graphs depict mean ± SEM. **, P<0.01. Scale bar is 200 μιη. Results are representative of 2 independent experiments.

Figure 11: CONV-Biota attenuates C. jejunu- duczd p-S6 positive cells in colon.

Cohorts of 5-6 GF II 10-/- mice were orally gavaged a single dose of CONV-Biota for 14 days and were infected with C. jejunu as in Figure 2. The p-S6 positive cells (brown dots) in epithelial and lamina propria immune cells ere detected using immunohistochemistry of anti- S6 antibody (S235/236).

Figure 12: Human clinical isolate C. jejuni 81-176 promotes colorectal tumorigenesis and tumor growth in mice. A cohort of GF Apc ^{Mm +} mice (n=5-7) were transferred to SPF environment and immediately gavaged with a sing le dose (10 ⁵ CFU) of C. jejuni (or PBS in control group). After 14 days, the mice were exposed to 1%DSS for 10 days and euthanized three weeks post-DSS. Figure 12A Schematic diagram showing the experimental design for CRC. Figure 12B Representative colonoscopy, Figure 12C macroscopic morphologies and Figure 12 D H&E staining sections from colons of mice in control group and C. jejuni group. Figure 12E Macroscopic colon tumor counts from mice in control group (n=5) and C. jejuni group (n=7). Figure 12F Histological inflammation score and Figure 12G PCNA and β- catenin IHC from mice in control group and C. jejuni group. Data, mean ± Standard error of mean (SEM). Unpaired two-tailed t test. *P < .05; NS, not significant.

Figures 13A-13E: C. jejuni CdtB subunit is critical for DNA damage in vitro. IEC-6, HT-29 and mouse enteroids were exposed to bacterial lysates from C. jejuni-ΨΎ or mutCdtB. Cells were incubated with lysates (5μ§/ηι1) or PBS for 24h for γΗ2ΑΧ staining and comet assay, or 48h for cell cycle analysis. Enteroids were incubated with lysates (5(^g/ml) for 12h. Figure 13 A Representative images of γΗ2ΑΧ immunofluorescence staining, Figure 13B γΗ2ΑΧ flow cytometry histograms, Figure 13C comet assay, Fiuger 13D cell cycle histograms showing IEC-6 cells (left panel) and HT-29 cells (right panel) treated with PBS (control), or lysates from C. jejuni or mutCdtB. Figure 13E Representative images of γΗ2ΑΧ immunofluorescence staining in enteroids incubated with PBS (control) or bacterial lysates. At least four independent experiments were performed. Data, mean ± SEM. Chi-Square test. ****p < 0001 ; NS, not significant.

Figures 14A-14I: C. jejuni induces tumorigenesis in Apc ^Mm/+ /OSS mice required functioanal cdtB. A cohort of GF Apc ^Mm/+ mice (n=7-9) were transferred to SPF environment and immediately gavaged with a single dose (10 ⁵ CFU) of C. jejuni (WT or mutCdtB). After 14 days, the mice were exposed to 1%DSS for 10 days and euthanized three weeks post-DSS. Figure 14A Schematic diagram showing the experimental design. Figure 14B Representative colonoscopy images, Figure 14C macroscopic morphologies and Figure 14D H&E staining sections from colons of mice infected with C. jejuni-WT or mutCdtB. Figure 14E Macroscopic tumor counts from mice in C jejuni-WT group (n=7) and mutCdtB group (n=9). Figure 14F Histological inflammation score and Figure 14G PCNA and β-catenin IHC from mice in C. jejuni-WT group and mutCdtB group. Figure 14H CFU counts of C. jejuni in the stool of mice colonized with C. jejuni-WT and mutCdtB at different time points. Figure 141 Presence of C. jejuni (red dot) in colonic sections from infected mice at the end point of experiment, detect by fluorescence in situ hybridization (FISH) assay. Data, mean ± SEM. Unpaired two-tailed t test. ****/ ^> < .0001 ; NS, not significant.

Figures 15A-15F: CDT-producing C. jejuni impacts mouse transcriptomes. RNA from distal colon samples from mice infected with C. jejuni-WT (n=3), mutCdtB (n=3) and controls (n=3) were subject to RNA-seq. Figure 15A PCA comparing mouse transcriptomes between C. jejuni group and control group, Figure 15B mutCdtB group and control group, and Figure 15C C. jejuni group and mutCdtB group. Figure 15D Word clouds showing the mouse KEGG pathways enriched by C. jejuni when compared C. jejuni- iected mice with control mice, Figure 15E mutCdtB when compared mutCdtB- infected mice with control mice, and Figure 15F C. jejuni when compared mice in C. jejuni group with mice in mutCdtB group. Significant enriched pathways (FDR-adjusted P value <0.05) are represented by red font and font size are positive corresponding to -log(FDR-adjusted P value). KEGG, Kyoto Encyclopedia of Gene and Genomes. FDR, false discovery rate.

Figures 16A-16F: CDT-producing C jejuni alters microbial transcriptomes and compositions. RNA from distal colon samples from mice infected with C. jejuni-VJl (n=3), mutCdtB (n=3) and controls (n=3) were subject to R A-seq. DNA from stool samples collected at the endpoint of experiments from mice infected with C. jejuni-WT (n=7), mutCdtB (n=7) and controls (n=5) were subject to 16S rDNA sequencing. Figure 16A Bacterial transcriptomes were compared using PCoA between C. jejuni group and control group, Figure 16B mutCdtB group and control group, and Figure 16C C. jejuni group and mutCdtB group. Figure 16D Using PCoA, microbial compositions in fecal samples were compared between C jejuni group and control group, Figure 16E mutCdtB group and control group, and Figure 16F C. jejuni group and mutCdtB group. Figure 16G Heatmap representation of genera significantly different (FDR-adjusted P value< 0.05, t-test) between mice infected with C. jejuni and mutCdtB.

Figures 17A-17I: Rapamycin alleviates C. ^' e/ww-promoted colorectal tumorigenesis and tumor growth in Apc ^{Min +} /OSS mice. Cohorts of GF Ape ¹ mice (n=7-8) orally infected with C. jejuni (10 ⁵ CFU) were intraperitoneally injected with rapamycin (1.5mg/kg body weight, daily) for 14 days, and subsequently exposed to 1 %DSS for 10 days. Three weeks post-DSS, the mice were euthanized. Figure 17A Schematic diagram showing the experimental design. Figure 17B Representative colonoscopy images, Figure 17C macroscopic morphologies and Figure 17D H&E staining sections from colons of mice in control group (n=7) and rapamycin group (n=8). Figure 17E Macroscopic tumor counts of mice in control group and rapamycin group. Two independent experiments were performed. Figure 17F Histological inflammation score, Figure 17G PCNA and β-catenin IHC and (H) p-S6 (S235/236) IHC from mice in control group and rapamycin group. Figure 171 CFU counts of C. jejuni in the stool from mice in control group and rapamycin group at different time points. Data, mean ± SEM. Unpaired two-tailed t test. **P < .01 ; NS, not significant.

Figure 18. Campylobacter spp. is enriched both in colorectal carcinoma and its adjacent tissue compared to normal tissue. The level of Campylobacter spp. in colorectal carcinoma and their paired adjacent tissue (n=52) and healthy controls (n=61). Mann- Whitney U test, *P < .05. ** *P < .001. Figure 19: C. jejuni promotes colorectal tumor growth in Apc ^Mm/+ /OSS mice. Macroscopic tumor size in mice infected with C. jejuni (n=7) and control mice (n=5). Chi- Square test, * < .05.

Figure 20: C. jejuni induces tumor growth in Apc ^M,n/+ /DSS mice required functional cdtB. Macroscopic tumor size in mice infected with C. jejuni (n=7) and mutCdtB (n=9). Chi- Square test, < .0001.

Figure 21: Rapamycin alleviates C. y ^' e «w ^' -promoted colorectal tumor growth in Apc ^M,n/+ fD$$ mice. Macroscopic tumor size in C. jejuni- fected Apc ^M,n/+ /OSS mice from control group (n=7), and rapamycin group (n=8). Chi-Square test, **P < .01.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO: 1 shows the amino acid sequence of 7-hydroxylase from C. sordelli (Clostridium cluster XI).

SEQ ID NO: 2 shows the amino acid sequence of 7-hydroxylase from Cscindens.

SEQ ID NO: 3 shows the amino acid sequence of 7-hydroxylase from C. hiranonis.

SEQ ID NO:4 shows the amino acid sequence of 7-hydroxylase from C. hylemonae (Clostridium cluster XVIa).

DETAILED DISCLOSURE

Provided herein are methods, assays, and products for the prevention and/or treatment of enterocolitis. In some embodiments, the methods comprise diagnosing enterocolitis in a subject and administering to the subject a therapeutically effective amount of a composition of the subject invention to treat the enterocolitis. In other embodiments, the methods comprise detecting enterocolitis-causing bacteria in a subject and administering to the subject a therapeutically effective amount of a composition of the subject invention to prevent the occurrence of enterocolitis.

Further provided are methods, assays, and products for the prevention and/or treatment of gastrointestinal cancers. In some embodiments, the methods comprise diagnosing gastrointestinal cancer in a subject and administering to the subject a therapeutically effective amount of a composition of the subject invention to treat the gastrointestinal cancer. In other embodiments, the methods comprise detecting gastrointestinal adenomas in a subject and administering to the subject a therapeutically effective amount of a composition of the subject invention to prevent the occurrence of gastrointestinal cancers.

In some aspects, the subject invention is based on the observation that the human isolate C. jejuni 81-176 induces DNA damage and promotes colorectal tumorigenesis in GF Apc ^Mw/+ mice. In contrast, C. jejuni harboring a mutated cdtB allele significantly attenuated DNA damage and tumorigenesis. In accordance with the subject invention, the mTOR inhibitor, rapamycin alleviates C. jejuni-m ^' duced colorectal tumorigenesis and tumor growth in Apc ^Mm/+ mice. Further, C. jejuni infection greatly modifies mucosal microbiota composition and gene expression, whereas alteration in host gene expression was limited.

The methods of diagnosing enterocolitis include, but are not limited to, using clinical parameters to diagnose enterocolitis, determining the presence of certain bacterial genera in the microbiota of a subject suffering from symptoms of enterocolitis, and any and all methods known to the skilled clinician to diagnose an enterocolitis.

The methods of diagnosing gastrointestinal cancer, i.e., determine whether a subject is suffering from gastrointestinal cancer, include, but are not limited to, using clinical parameters to diagnose gastrointestinal cancer including, but not limited to, performing an occult blood test in a stool of a subject, performing blood tests, x-ray, performing endoscopic evaluation of the gastrointestinal tract to detect adenomas and potential cancerous lesions and obtaining a biopsy from an adenoma or a potential cancerous lesion, determining the presence of certain bacterial genera in the microbiota of the subject, and any and all methods known to the skilled clinician to diagnose a gastrointestinal cancer.

The term "subject who is suffering from a cancer" refers to a subject who has been tested and found to have cancer cells in his/her body.

The methods for determining a "therapeutically effective amount" of a composition of the subject invention to prevent and/or treat enterocolitis and/or gastrointestinal cancer comprise determining an amount of the composition that effectively inhibits activation of the mTOR signaling pathway in a cell exposed to an enteropathogen involved in the pathogenesis of enterocolitis and/or gastrointestinal cancer.

In some embodiments, a method for determining a therapeutically effective amount of a microbiota of the composition of the subject invention comprises obtaining a blood sample from a subject to whom a composition of the subject invention is to be administered; isolating T lymphocytes from the blood sample; incubating the T lymphocytes of the blood sample with increasing amounts of a composition comprising the microbiota and the enteropathogen that causes or is suspected to cause the enterocolitis and/or the gastrointestinal cancer in the subject; and quantifying the amount of phosphorylated p70S6K in the T lymphocytes. Using such method, the therapeutically effective amount of the composition is determined to be the amount of the composition at which amount phosphorylation of p70S6K in the T lymphocytes is substantially reduced compared to T lymphocytes incubated with the enteropathogen in the absence of the composition of the invention and/or the amount of the composition at which amount phosphorylation of p70S6K is completed absent in the T lymphocytes incubated with the composition of the invention and the enteropathogen.

In some embodiments, the therapeutically effective amount can be an amount of a microbiota of the subject invention that is effective in inducing a regulatory immune response including, but is not limited to, reducing levels of pro-inflammatory cytokine, for example, IL-Ιβ, TNF-a, IL-6, INF-γ, Cxcl2 and 1117a; decreased frequency of IL-1 β ⁺ dendritic cells (DCs); increased number of regulatory dendritic cells such as IL-10 ⁺ DCs; reduced ΙΡΝγ in T cells; increased Tregs in the MLNs and/or in the spleens (reduced IFNy in T cells); increased FoxP3 ⁺ Tregs and decreased CD4 ⁺ and/or CD8 ⁺ T cells expressing IFNy. The protective immune response includes, but is not limited to, immune responses that clear the intestinal pathogens.

Accordingly, in some embodiments, the methods for determining a therapeutically effective amount of a microbiota of the composition of the subject invention, e.g. , comprise obtaining a blood sample from a subject to whom a composition of the subject invention is to be administered; isolating T lymphocytes from the blood sample; incubating the T lymphocytes of the blood sample with increasing amounts of a composition comprising the microbiota and the enteropathogen that causes or is suspected to cause the enterocolitis and/or gastrointestinal cancer of the subject; and quantifying the amount of IFNy in T lymphocytes. The therapeutically effective amount determined using these methods is the amount of the composition at which the ΓΡΝγ expression is reduced in T lymphocytes exposed to the composition and the enteropathogen compared to T lymphocytes exposed to the enteropathogen in the absence of the composition.

A therapeutically effective amount of a composition of the subject invention varies with the content of the composition, the subject to which the composition is administered and the enteropathogen with which the subject is infected. For example, the therapeutically effective amount of microbiota of the composition can be expressed as an absolute number, for example, colony forming units (CFU), or as a body weight based dosage, for example CFU/Kg of body weight of the subject. Typically, the therapeutically effective amount of a microbiota according to the subject invention is about 10 ⁴ to about 10 ¹² CFU, about 10 ⁵ to about 10 ^{1 1} CFU, about 10 ⁶ to about 10 ¹⁰ CFU, about 10 ⁸ to about 10 ¹⁰ CFU or about 10 ^s to about 10 ¹² CFU. In a specific embodiment, the therapeutically effective amount is about 10 ⁴ to about 10 ¹² CFU/Kg, about 10 ⁵ to about 10" CFU/Kg, about 10 ⁶ to about 10 ¹⁰ CFU/Kg, about 10 ⁸ to about 10 ¹⁰ CFU/Kg or about 10 ⁸ to about 10 ¹² CFU/Kg of the body weight of the subject to which the composition is administered. In one embodiment, the therapeutically effective amount is about 10 ¹² to about 10" CFU/Kg of the body weight of the subject to which the composition is administered.

The subject invention also provides methods for generating compositions that prevent and/or treat enterocolitis and/or gastrointestinal cancer including enterocolitis and/or gastrointestinal cancer induced by and/or associated with C. jejuni.

In preferred embodiments, the methods and compositions are used to prevent and/or treat C. y ^' e/nwz ^' -induced enterocolitis. Advantageously, it has been found that microbiota cultured under anaerobic and microaerobic conditions can be used in methods to prevent and/or treat enterocolitis including enterocolitis induced by C. jejuni because said microbiota generate enhanced amounts of the secondary bile acid deoxycholic acid that block mTOR activation in cells including, but not limited to, immune cells exposed to C. jejuni.

In some embodiments, the methods comprise diagnosing a subject as suffering from, or being at risk of developing, enterocolitis and administering to a subject suffering from enterocolitis, or being at risk of developing enterocolitis, an effective amount of a composition of the invention, which composition increases deoxycholic acid in the intestinal tract of the subject and prevents and/or treats the enterocolitis. In preferred embodiments, the subject is suffering from or at risk of developing C.jejuni-induced enterocolitis.

In preferred embodiments, the subject invention provides methods for preventing and/or treating gastrointestinal cancer including gastrointestinal cancer associated with and/or induced by C. jejuni.

The subject to which the compositions of the subject invention are administered may be, for example, a human or other primate, bovine, porcine, equine, or other vertebrate or mammal. In some embodiments, the invention comprises administering microbiota to the subject. In some embodiments, the microbiota are cultured on controlled anaerobic and/or microaerobic conditions.

In some embodiments, the microbiota is genetically modified to express proteins that prevent and/or treat enterocolitis and prevent and/or treat gastrointestinal cancer. In other embodiments, the invention comprises administering metabolites of the microbiota to the subject. In some embodiments, the metabolites are partially purified; in some embodiments, the metabolites are substantially pure. In preferred embodiments, the invention comprises administering to the subject microbiota-derived bile acid-derivatives. In further preferred embodiments, the invention comprises administering to the subject therapeutically effective amounts of microbiota-derived bile acid-derivatives. In some embodiments, the invention comprises administering therapeutically effective amounts of conjugated bile acids and/or secondary bile acids, or salts thereof.

The microbiota useful according to the subject invention may be obtained commercially, obtained from a subject to be treated according to the subject invention and/or produced according to methods known in the art and/or provided herein.

Microbiota obtained from a subject can be microbiota obtained from any region of the gastrointestinal tract. The upper gastrointestinal tract comprises the esophagus, stomach, and duodenum of the small intestine. The lower gastrointestinal tract comprises the remainder of the small intestine, i.e., the jejunum and ileum, and all of the large intestine, i.e., the cecum, colon, rectum, and anal canal. Microbiota can be found throughout the gut, e.g., in the gastrointestinal tract, and particularly in the intestines.

Microbiota useful in the subject invention can be non-pathogenic bacteria. Nonpathogenic bacteria refer to bacteria that are not capable of causing disease or harmful responses in a host. In some embodiments, non-pathogenic bacteria are Gram-negative bacteria. In some embodiments, non-pathogenic bacteria are Gram-positive bacteria. In some embodiments, non-pathogenic bacteria are commensal bacteria, which are present in the indigenous micro biota of the gut. Examples of non-pathogenic bacteria include, but are not limited to Bacillus, Bacteroides, Bifidobacterium, Brevibacteria, Clostridium, Enterococcus, Escherichia, Lactobacillus, Lactococcus, Saccharomyces, and Staphylococcus, e.g., Bacillus coagulans, Bacillus subtilis, Bacteroides fragilis, Bacteroides subtilis, Bacteroides thetaiotaomicron, Bifidobacterium bifidum, Bifidobacterium in/antis, Bifidobacterium lactis, Bifidobacterium longum, Clostridium butyricum, Enterococcus faecium, Escherichia coli, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactobacillus johnsonii, Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus, Lactococcus lactis, and Saccharomyces boulardii.

General methods of producing different culture/growth media and conditions that allow culturing/growing of microbiota of interest are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention. Methods of recovering metabolites of interest from culture/growth media are also well known in the art and such embodiments are within the purview of the invention.

In some embodiments, the methods for producing microbiota of the composition of the subject invention comprise the following steps: the microbiota is grown on a suitable medium, under conditions of strict anaerobiosis, in the presence of a carbon-based substrate and/or of H2/CO2 as energy source; the microbiota are recovered and the recovered microbiota are packaged. A preferred method for recovering the microbiota is centrifugation, for example, between 10,000 g and 15,000 g, advantageously 12,000 g, for 15 to 20 minutes. The microbiota may be washed in, for example, an anaerobic phosphate buffer, by resuspension of the cells, agitation, and a further centrifugation step. The microbiota may be packaged in an anaerobic environment, i.e. , in an oxygen-free atmosphere. For example, the microbiota is packaged into a capsule in an oxygen-free atmosphere.

Methods of culturing microbiota under anaerobiosis and microaerobiosis are known in the art. For anaerobic conditions oxygen can be present during bacterial culture from a low of about 0 mbar, about 0.1 mbar, or about 0.2 mbar to a high of about 3 mbar, about 4 mbar or about 5 mbar. For example, oxygen can be present from about 0 mbar to about 5 mbar; from about 0 mbar to about 4.5 mbar; from about 0.1 mbar to about 5 mbar; from about 0.1 mbar to about 4.5 mbar; from about 0.2 mbar to about 5 mbar; from about 0.2 mbar to about 3 mbar; from about 0.5 mbar to about 2.5 mbar; from about 0.1 mbar to about 1 mbar; from about 0.1 mbar to about 2 mbar; from about 0.2 mbar to about 2 mbar; from about 0.2 mbar to about 2 mbar.

For microaerobic conditions, oxygen can be present during bacterial culture from a low of about 6 mbar, about 7 mbar, or about 10 mbar to a high of about 15 mbar, about 18 mbar or about 20 mbar. For example, oxygen can be present during bacterial culture from about 6 mbar to about 20 mbar; from about 6 mbar to about 10 mbar; from about 7 mbar to about 20 mbar; from about 7 mbar to about 15 mbar; from about 8 mbar to about 20 mbar; from about 8 mbar to about 15 mbar; from about 8 mbar to about 10 mbar; from about 10 mbar to about 20 mbar.

In preferred embodiments, the at least one microbiota of the composition comprise at least one microbiota of the group consisting of Clostridium cluster XI, Bifidobacterium, Butyricicoccus, Lactobacillus, Roseburia, Hydrogenoanaerobacterium, Coprobacillus and Oscillibacter.

The recovered microbiota may be dried. The drying of microbiota is known to the skilled person. See for example, EP 0 818 529 (SOCIETE DES PRODUITS NESTLE), which is incorporated herein by reference in its entirety, where a drying process of pulverisation is described, or WO 0144440 (INRA), which is also incorporated by reference in its entirety. Usually, microbiota are concentrated from a medium and dried by spray drying, fluidized bed drying, lyophilization (freeze drying) or other drying processes. Microbiota can be mixed, for example, with a carrier material such as a carbohydrate such as sucrose, lactose or maltodextrin, a lipid or a protein, for example, milk powder during or before the drying.

The microbiota of the subject invention need not necessarily be present in a dried form. It may also be suitable to mix the microbiota directly with a food or beverage product and, optionally, perform a drying process thereafter. Such an approach is disclosed in PCT/EP02/01504) (SOCIETE DES PRODUITS NESTLE), which is incorporated herein by reference in its entirety. Likewise, a composition of the subject invention may also be consumed directly. Further processing, for example, for the sake of the manufacture of convenient food or beverage products, is not a precondition for the beneficial properties of the microbiota provided in the composition of the subject invention.

The compositions according to the subject invention may be enterally consumed in any form. In some embodiments, they may be added to a nutritional composition, such as a food or drink product. In other embodiments, they may also be consumed directly, for example, in a dried form or directly after production.

In some embodiments, the food is a fermented food, such as fermented milk products (yogurt, cheese) or fermented vegetables (sour kraut, kimchi, pickles, etc.) Dried powder containing the microbiota can be lyophilized powder. In some embodiments, the compositions of the subject invention comprise: microbiota produced by the methods of the invention; a delivery system for delivering the microbiota by, e.g. , immobilizing it on a surface and/or encapsulating it. Advantageously, microbiota thus immobilized or encapsulated are isolated from other microbes of the environment and/or can more effectively move through the intestinal tract; and a carrier.

The delivery system of the subject invention can comprise a capsule, such as a capsule comprising a semi-permeable membrane, and/or a support, such as a polymer structure.

In specific embodiments, the subject invention provides a composition of immobilized or encapsulated microbiota for preventing and/or treating enterocolitis.

In some embodiments, the composition of the subject invention comprises a carrier that is intended for oral administration and is optionally in the form of a nutraceutical or functional food or beverage product. In some embodiments, the composition comprises a pharmaceutical composition and the carrier comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers are intended to protect the microbiota and genetically engineered microorganisms of the subject invention from adverse environmental conditions that may kill the microbiota and microorganisms in the absence of the pharmaceutically acceptable carriers. Such carriers include biodegradable and edible polymers and other known ingredients that protect microbiota and microorganisms. Accordingly, the microbiota and microorganisms of the subject invention can be provided in an encapsulated form in order to ensure a high survival rate of the microbiota and microorganisms during passage through the gastrointestinal tract or during storage or shelf life of the product. The pharmaceutical acceptable carrier may comprise excipients. It is preferably administered orally or directly in situ, e.g. , rectally via suppositories. The term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples include, but are not limited to, calcium bicarbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and surfactants, including, for example, polysorbate 20.

For example, the at least one microbiota can be mixed with conventional excipients, such as gelatin, starch, lactose, magnesium stearate, talc, gum arabic and the like. It may also be advantageous to use less conventional excipients that, for example, make it possible to increase the ability of the at least one microbiota and genetically engineered microorganism used to be active in the gastrointestinal tract. For example, cellobiose, maltose, mannose, salicine, trehalose, amygdalin, arabinose, melobiose, rhamnose and/or xylose may be added. This list is not exhaustive and the substrates are chosen and adapted as a function of the microbiota considered. These substrates may promote growth of the at least one microbiota and microorganism present in the composition. Thus, the composition preferably comprises at least one additive that promotes the activity of the at least one microbiota and microorganism in the digestive environment.

The subject invention also provides methods wherein a composition of the invention is administered to a subject by oral administration or implantation of the composition in the subject. The microbiota and microorganisms can be administered in a delivery system, for example, immobilized on a surface and/or encapsulated. In some embodiments, the microbiota and microorganisms of the subject invention are encapsulated or microencapsulated in a membrane made of alginate-polylysine-alginate (APA). Alternatively, the biologically active agent is encapsulated or microencapsulated in a membrane made of Alginate/Poly-l-lysine/Pectin/Poly-l-lysine/Alginate (APPPA), Alginate/Poly-1- lysine/Pectin/Poly-l-lysine/Pectin (APPPP), and Alginate/Poly-L-lysine/Chitosan/Poly-1- lysine/ Alginate (APCPA) membranes.

The composition according to the invention can be administered orally in the form of capsules, tablets, powders, granules, solutions, or suspensions.

In some embodiments, the microbiota and microorganisms present in the pharmaceutical and/or nutritional composition are administered in a form that allows them to be active in the lower gastrointestinal tract, e.g., the colon.

After production of the microbiota and, depending on the methods of production, it is also possible to maintain the microbiota under anaerobic packaging conditions in order to enable it to remain viable. In preferred embodiments, the microbiota is packaged in an anaerobic environment, . e. , it is packaged in an oxygen-free atmosphere.

In preferred embodiments, the microbiota used in the methods has been cultured under anaerobic conditions and is packaged in an oxygen-free atmosphere. It has advantageously been discovered that differential oxygen tension leads to the propagation of distinct microbiota, which distinct microbiota have differential effects on, e.g., C. jejuni- induced enterocolitis and C. y ^' e/ ^' ww ^' -associated gastrointestinal cancer. For example, microbiota cultured under anaerobic, but not those cultured under aerobic conditions, prevent and/or treat C. jejuni-m ^' daced enterocolitis and C. /e/wra ^' -associated gastrointestinal cancer. Further, a mixture of microbiota cultured under aearobic, microaerobic and anaerobic conditions can be used in the instant methods because such mixture also attenuates C. jejuni¬s ' induced enterocolitis and C. y ^' e/i w ^' -associated gastrointestinal cancer.

Microbiota cultured under anaerobic conditions when administered to a subject having C. jejuni enterocolitis or C. y ^' e wra ^' -associated gastrointestinal cancer lead to an increased colonization of the subject's lower gastrointestinal tract with bacterial genera that are capable of preventing and/or treating C. jejuni-induced enterocolitis and C. jejuni-0 associated gastrointestinal cancer. Such bacterial genera include, but are not limited to, Clostridium cluster XI, Bifidobacterium, Butyricicoccus, Lactobacillus, Roseburia, Hydrogenoanaerobacterium, Coprobacillus and Oscillibacter.

Without wanting to be bound by theory, it is believed that the effectiveness of culture conditions employing different oxygen tensions leading to the generation of microbiota that5 are capable of preventing and/or treating C jejuni-m ^' duced enterocolitis and C. jejuni- associated gastrointestinal cancer is based on the capability of such microbiota to express specific primary bile converting enzymes.

Advantageously, following administration of microbiota cultured under anaerobic conditions to a subject suffering from C. jejuni-m ^' duced colitis or C. /e/ ^' ww ^' -associated0 gastrointestinal cancer the bile acid composition of the stool contains an increased amount of deoxycholic acid compared to a subject with C. y ^' e/ww ^' -induced enterocolitis or C. jejuni- associated gastrointestinal cancer who has been administered microbiota cultured under aerobic conditions; and the subject with increased deoxycholic acid in the stool has less damage to the intestinal tissue and less DNA damage in intestinal mucosa cells.

5 Further, the methods of the subject invention comprise administering to a subject suffering from enterocolitis or enteropathogen-associated gastrointestinal cancer, or being at risk of developing enterocolitis or enteropathogen-associated gastrointestinal cancer, a composition generated according to the subject invention.

For example, in some embodiments, the methods comprise administering to a subject0 suffering from enterocolitis or enteropathogen-associated gastrointestinal cancer, or being at risk of developing enterocolitis or enteropathogen-associated gastrointestinal cancer, a composition comprising a therapeutically effective amount of microbiota cultured under anaerobic conditions and/or a therapeutically effective amount of deoxycholic acid and/or a therapeutically effective amount of taurocholic acid and/or a combination thereof.

In further embodiments, the compositions of the subject invention comprise microorganisms that have been genetically modified to contain one or more genes encoding enzymes that metabolize primary bile acids.

In some embodiments, the microorganisms are genetically modified to increase the expression or activity of at least one bile acid inducible protein. In certain embodiments, the microorganisms are genetically modified to increase the expression or activity of a 7- hydroxylase protein. For example, the microorganism is genetically modified to increase the expression or activity of any of the 7-hydroxylase proteins of SEQ ID NOs: 1 -4.

The genetic modifications that increase the expression of 7-hydroxylase include the expression via plasmids, mutations in the genomic DNA of microorganisms that result in the increased expression of 7-hydroxylase, or mutations in the regulatory region of genes that cause overexpression of 7-hydroxylase.

In some embodiments, the genetic modifications resulting in the increased expression of 7-hydroxylase comprise introducing into the microorganism a nucleotide, for example, DNA or RNA, comprising a gene encoding 7-hydroxylase. In certain embodiments, a 7- hydroxylase present in a DNA molecule introduced into a microorganism is identical to the 7- hydroxylase gene present in the genome of the microorganism, i.e., the DNA molecule provides extra copies of the endogenous 7-hydroxylase gene. In other embodiments, a 7- hydroxylase gene present in a DNA molecule is different from the 7-hydroxylase gene present in the genome of the microorganism, i.e., the DNA molecule provides a homolog of the 7-hydroxylase gene present in the genome of the microorganism. In further embodiments, a 7-hydroxylase gene is not present in the genome of the microorganism into which a 7- hydroxylase gene in a DNA molecule introduced, i.e., the DNA molecule is the only source of a 7-hydroxylase gene in the microorganism. In specific embodiments, a 7-hydroxylase gene in a DNA molecule introduced into a microorganism is the 7-hydroxylase gene from C. sordelli (Clostridium cluster XI), C. scindens, C. hiranonis, and/or C. hylemonae (Clostridium cluster XVIa). Examples of DNA molecules suitable for the expression of a gene of interest in a microorganism are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention. A typical DNA molecule suitable for the expression of a gene of interest in a microorganism contains an origin of replication, a promoter that drives the expression of the gene, one or more selectable markers, and one or more restriction enzyme cleavage sites for cloning the gene of interest into the DNA molecule. The promoter can be an inducible promoter or a constitutive promoter. The selectable markers can be, for example, an antibiotic resistance gene or a gene providing for a missing biochemical function in the microorganism. Additional examples of promoters as well as selectable markers are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention. As used herein, the term "expression construct" refers to a combination of nucleic acid sequences that provides for transcription of an operably linked nucleic acid sequence where operably linked components are in contiguous relation.

In some embodiments, the methods comprise administering at least one genetically engineered microorganism, which microorganism comprises a polynucleotide sequence to express one of the polypeptides of SEQ ID NOs: 1 to 4. The genetically engineered microorganism may be formulated into pharmaceutical compositions comprising one or more pharmaceutically acceptable carriers, thickeners, diluents, buffers, buffering agents, surface active agents, neutral or cationic lipids, lipid complexes, liposomes, penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers or agents.

The at least one microorganism can endogenously express at least one of the polypeptides of SEQ ID NOs: 1 to 4. In one specific embodiment, the at least one microorganism has been genetically modified to comprise a polynucleotide sequence to express one of the polypeptides of SEQ ID NOs: 1 to 4. Expression constructs and vectors to be used to genetically modify microorganisms to express at least one of the polypeptides of SEQ ID NOs: 1 to 4 are within the art and a skilled artisan will readily be able to devise such expression vector and generate such genetically modified microorganisms.

In some embodiments, the DNA molecule comprising the 7-hydroxylase gene is incorporated into the genome of the microorganism. In other embodiments, the DNA molecule comprising the 7-hydroxylase gene is present as an extra-genomic genetic material. In particular embodiments, the microorganism is a bacterium and the DNA molecule is a plasmid carrying the 7-hydroxylase gene.

Non-limiting examples of the genetically modified bacterial microorganisms according to the subject invention include Escherichia coli, Klebsiella spp., K. oxytoca, K. variicola, Gluconobacter oxydans, Gluconobacter asaii, Achromobacter delmarvae, Achromobacter viscosus, Achromobacter lacticum, Agrobacterium tumefaciens, Agrobacterium radiobacter, Alcaligenes faecalis, Arthrobacter cilreus, Arthrobacter tumescens, Arthrobacter parafflneus, Arthrobacter hydrocarboglutamicus, Arthrobacter oxydans, Aureobacterium saperdae, Azolobacter indicus, Brevibacterium ammoniagenes, Brevibacteri m lactofermentum, Brevibacterium flavum, Brevibacterium globosum, Brevibacterium fuscum, Brevibacterium ketoglutamicum, Brevibacterium helcolum, Brevibacterium pusillum, Brevibacterium testaceum, Brevibacterium roseum, Brevibacterium immariophilium, Brevibacterium linens, Brevibacterium protopharmiae, Corynebacterium acetophilum, Corynebacterium glutamicum, Corynebacterium callunae, Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Enterobacter aerogenes, Erwinia amylovora, Erwinia carotovora, Erwinia herbicola, Erwinia chrysanthemi, Flavobacterium peregrinum, Flavobacterium fucatum, Flavobacterium aurantinum, Flavobacterium rhenanum, Flavobacterium sewanense, Flavobacterium breve, Flavobacterium meningosepticum, Micrococcus sp. CCM825, Morganella morganii, Nocardia opaca, Nocardia rugosa, Planococcus eucinatus, Proteus rettgeri, Propionibacterium shermanii, Pseudomonas synxantha, Pseudomonas azotoformans, Pseudomonas fluorescens, Pseudomonas ovalis, Pseudomonas stutzeri, Pseudomonas acidovolans, Pseudomonas mucidolens, Pseudomonas testosteroni, Pseudomonas aeruginosa, Rhodococcus erythropolis, Rhodococcus rhodochrous, Rhodococcus sp. ATCC 15592, Rhodococcus sp. ATCC 19070, Sporosarcina ureae, Staphylococcus aureus, Vibrio metschnikovii, Vibrio tyrogenes, Actinomadura madurae, Actinomyces violaceochromogenes, Kitasatosporia parulosa, Streptomyces coelicolor, Streptomyces flavelus, Streptomyces griseolus, Streptomyces lividans, Streptomyces olivaceus, Streptomyces tanashiensis, Streptomyces virginiae, Streptomyces antibioticus, Streptomyces cacaoi, Streptomyces lavendulae, Streptomyces viridochromogenes, Aeromonas salmonicida, Bacillus pumilus, Bacillus circulans, Bacillus subtilis, Bacillus thiaminolyticus, Escherichia freundii, Microbacterium ammoniaphilum, Serratia marcescens, Salmonella typhimurium, Salmonella schottmulleri, or Xanthomonas citri. In preferred embodiments, the microorganism of the invention is E. coli or Klebsiella spp. , particularly, K. oxytoca or K. variicola.

In some embodiments, the genetically engineered microorganisms are coated for release into the gastrointestinal tract or a particular region of the gastrointestinal tract, e.g., the large intestine. The typical pH profile from the stomach to the colon is about 1-4 (stomach), 5.5-6.0 (duodenum), 7.3-8.0 (ileum), and 5.5-6.5 (colon). In some diseases, the pH profile may be modified. In some embodiments, the coating is degraded in specific pH environments in order to specify the site of release. In some embodiments, at least two coatings are used. In some embodiments, the outside coating and the inside coating are degraded at different pH levels to ensure delivery of live microbiota and/or genetically engineered microorganisms to the desired location in the gastrointestinal tract.

In some embodiments, the methods comprise administering one or more polypeptides that catalyze the conversion of primary bile acids to deoxycholic acid or a salt thereof. The polypeptides useful in the method of the invention include, but are not limited to, any of the polypeptides of SEQ ID NOs: 1 to 4. In further embodiments, the methods comprise administering a pharmaceutical composition comprising at least one of the polypeptide of SEQ ID NOs: 1 to 4. The pharmaceutical composition can be administered in a protective coating for release in the lower intestinal tract. Methods for encapsulating one or more polypeptides in a protective coating for release in the lower intestinal tract are within the knowledge of the art.

In some embodiments, the methods comprise administering a composition that comprises polynucleotide sequences encoding at least one polypeptide of SEQ ID NOs: 1 to 4. The polynucleotide sequences can include expression constructs for expressing the polypeptides, which expression constructs comprise regulatory sequences to provide expression of the polypeptides in intestinal cells of the subject. Expression constructs and vectors to be used to express the polypeptides of the invention in intestinal cells of a subject are within the art and a skilled artisan will readily be able to devise such expression vector comprising the specific expression constructs. The polypeptide of the invention can be readily expressed by any one of the recombinant technology methods known to those skilled in the art having the benefit of the instant disclosure.

The polynucleotide vectors can be administered to the subject suffering from enterocolitis in the form of polynucleotides encapsulated in liposomes or in form of polynucleotides contained in, e.g., a viral vector. Liposomes and viral vectors to target cells of the lower intestine are within the knowledge of the art and can be readily generated by the skilled artisan. In some embodiments, the viral vectors used to deliver the polynucleotides encoding polypeptides of SEQ ID NOs: 1 to 4 are viral vectors that allow transient gene expression in intestinal cells of the subject. In other embodiments where viral vectors are used that allow long-term expression of the polypeptides of SEQ ID NOs: 1 to 4. Expression of such polypeptides can be controlled through inducible promoters such that administration of an inducing agent to the subject can initiate expression of the polypeptides of SEQ ID NOs: 1 to 4 in transduced intestinal cells of the subject.

Further provided are compositions of the subject invention, which compositions comprise microbiota metabolites. For example, the metabolites can be partially purified from microbiota according to the subject invention or be provided in a substantially pure form prior to inclusion in a composition of the invention. Methods to partially purify and generate substantially pure forms of microbiota metabolites are within the knowledge of the person skill in the art and such embodiments are within the purview of the invention.

Microbiota metabolites according to the subject invention include specific microbial metabolites that modulate host-derived inflammatory signaling. In some embodiments, the compositions of the subject invention comprise metabolites of anaerobically grown microbiota which metabolites can block inflammatory signaling pathways including, but not limited to, mTOR signaling pathways and IFN-γ production in immune cells of subjects treated with the metabolites. Advantageously, the compositions of the subject invention comprise metabolites that inhibit enterocolits-induced and/or gastrointestinal cancer- associated mTOR signaling and/or IFN-γ production in cells including, but not limited to, T lymphocytes, splenocytes, and gastrointestinal mucosa cells and mucosa-associated cells of subjects exposed to enterocolitis-inducing pathogens. In preferred embodiments, the compositions of the subject invention comprise therapeutically effective amounts of the microbiota metabolite deoxycholic acid. In other preferred embodiments, the compositions of the subject invention comprise therapeutically effective amounts of microbiota of the subject invention and/or microorganisms of the invention genetically engineered to express at least one polypeptides that catalyze the conversion of primary bile acids to deoxycholic acid or a salt thereof and taurocholic acid.

Advantageously, the methods for determining a therapeutically effective amount of a microbiota metabolite including, but not limited to, deoxycholic acid allow the prevention and/or treatment of enterocolitis and/or C. ^' e wm-associated gastrointestinal cancer in a subject in need of such prevention and/or treatment while reducing health-adverse effects of the respective microbiota metabolite. For example, some microbiota metabolites may cause adverse events in subjects when administered in large amounts. It is, therefore, preferred to determine the minimal amount of a metabolite of microbiota of the invention required to achieve a therapeutic effect of preventing and/or treating enterocolits and C. jejuni-associated gastrointestinal cancer while minimizing adverse health effects potentially caused by the metabolite.

The therapeutically effective amount of at least one metabolite of microbiota of the invention can be determined using the method of the invention as described for the therapeutically effective amount of microbiota. Therefore, in some embodiments, methods for determining a therapeutically effective amount of composition comprising a metabolite of a microbiota of the subject invention comprise obtaining a blood sample from a subject to whom a composition of the subject invention is to be administered; isolating T lymphocytes from the blood sample; incubating the T lymphocytes of the blood sample with increasing amounts of a composition comprising at least one metabolite of the microbiota and the enteropathogen that causes or is suspected to cause the enterocolitis or C. _/e ww-associated gastrointestinal cancer of the subject; and quantifying the amount of phosphorylated p70S6K in the T lymphocytes. Using such method, the therapeutically effective amount of the composition is determined to be the amount of the composition at which amount phosphorylation of p70S6 in the T lymphocytes is substantially reduced compared to T lymphocytes incubated with the enteropathogen in the absence of the composition of the invention and/or the amount of the composition at which amount phosphorylation of p70S6K is completed absent in the T lymphocytes incubated with the composition of the invention and the enteropathogen.

In some embodiments, the methods for determining a therapeutically effective amount of a composition comprising at least one metabolite of a microbiota of the invention comprise obtaining a blood sample from a subject to whom a composition of the subject invention is to be administered; isolating T lymphocytes from the blood sample; incubating the T lymphocytes of the blood sample with increasing amounts of a composition comprising the at least one metabolite and the enteropathogen that causes or is suspected to cause the enterocolitis or C. y ^' e/ww ^' -associated gastrointestinal cancer of the subject; and quantifying the amount of ΙΡΝγ in T lymphocytes. The therapeutically effective amount determined using these methods is the amount of the composition at which the IFNy expression is reduced in T lymphocytes exposed to the composition and the enteropathogen compared to T lymphocytes exposed to the enteropathogen in the absence of the composition.

The therapeutically effective amount of a composition of the subject invention is expressed as "unit dose," which refers to a physically discrete unit suitable for use in a subject, each unit containing a predetermined quantity of the therapeutic composition calculated to produce the beneficial effect in association with its administration. The quantity to be administered, both according to number of treatments and unit dose, depends on the subject to be treated, the state of the subject and the protection desired. Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual. Generally, the dosage of a microbiota will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and medical history.

In some embodiments of the invention, a therapeutically effective amount comprises administration of multiple doses of a microbiota and/or metabolite of a microbiota and/or genetically modified microorganisms of the subject invention. The therapeutically effective amount may comprise, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, or more doses of a composition comprising a microbiota and/or metabolite of a microbiota and/or genetically modified microorganisms. In some embodiments, doses are administered over the course of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 14 days, 21 days, 30 days, or more than 30 days. Moreover, treatment of a subject with a therapeutically effective amount of a microbiota and/or metabolite of a microbiota and/or genetically modified microorganisms can include a single treatment or can include a series of treatments. The therapeutically effective dosage of a microbiota and/or metabolite of a microbiota and/or genetically modified microorganisms used for treatment may increase or decrease over the course of a particular treatment.

In certain embodiments, the methods comprise administering to a subject suffering from enterocolitis or enteropathogen-associated gastrointestinal cancer, or being at risk of developing enterocolitis or enteropathogen-associated gastrointestinal cancer, a composition comprising an effective amount of taurocholic acid. In preferred embodiments, the methods comprise administering to a subject suffering from enterocolitis or C. ye wra ^' -associated gastrointestinal cancer, or being at risk of developing enterocolitis or C. jejuni-associated gastrointestinal cancer, a composition comprising an effective amount of taurocholic acid. The amount of taurocholic acid or a salt thereof administered can be an amount from a low of about 1 mg/day, about 5 mg/d or about 10 mg/d to a high of about 750 mg/d, about 800 mg/d or about lg/d. For example the amount of taurocholic acid can be from about lmg/d to about 1 g/d, about 1 mg/d to about 10 mg/d, about 1 mg/d to about 100 mg/d, about 5 mg/d to about 100 mg/d, about 5 mg/d to about 200 mg/d, about 5 mg/d to about 750 md/d, about 10 mg/d to about 50 mg/d, about 10 mg/d to about 100 mg/d, about 20 mg/d to about 100 mg/d, 20 mg/d to about 500 mg/d, 20 mg/d to about 750 mg/d, about 50 mg/d to about 500 mg/d, about 50 mg/d to about 750 mg/d, about 50 mg/d to about 1 g/d, about 100 mg/d to about 500 mg/ d, about 10 mg/d to about 750 mg/d, about 250 mg/d to about 750 mg/d, about 250 mg/d to about 900 mg/d, about 250 mg/d to about lg/d, or about 500 mg/d to about lg/d.

In some embodiments, the methods comprise administering to a subject suffering from enterocolitis or enteropathogen-associated gastrointestinal cancer, or being at risk of developing enterocolitis or enteropathogen-associated gastrointestinal cancer, a composition comprising an effective amount of deocycholic acid .

In preferred embodiments, the methods comprise administering to a subject suffering from enterocolitis or C. jej uni-associated gastrointestinal cancer, or being at risk of developing enterocolitis or C. ye «w ^' -associated gastrointestinal cancer, a composition comprising an effective amount of deoxycholic acid.

The amount of deoxycholic acid or a salt thereof administered can be an amount from a low of about 1 mg/day, about 5 mg/d or about 10 mg/d to a high of about 750 mg/d, about 800 mg/d or about lg/d. For example the amount of deoxycholic acid can be from about lmg/d to about 1 g/d, about 1 mg/d to about 10 mg/d, about 1 mg/d to about 100 mg/d, about 5 mg/d to about 100 mg/d, about 5 mg/d to about 200 mg/d, about 5 mg/d to about 750 md/d, about 10 mg/d to about 50 mg/d, about 10 mg/d to about 100 mg/d, about 20 mg/d to about 100 mg/d, 20 mg/d to about 500 mg/d, 20 mg/d to about 750 mg/d, about 50 mg/d to about 500 mg/d, about 50 mg/d to about 750 mg/d, about 50 mg/d to about 1 g/d, about 100 mg/d to about 500 mg/ d, about 10 mg/d to about 750 mg/d, about 250 mg/d to about 750 mg/d, about 250 mg/d to about 900 mg/d, about 250 mg/d to about lg/d, or about 500 mg/d to about lg/d.

Preferably the amount of deoxycholic acid or a salt thereof, is an amount that inhibits mTOR activation in cells of a subject. In one embodiment, the mTOR inhibition can be detected by reduced and/or absent phosphorylation of p70S6K. Methods to measure phosphorylation of p70S6K are within the knowledge of the art. In one embodiment of the instant invention, the effective amount of deoxycholic acid is determined by measuring phospho-70S6K in cells of a subject following infection of the cells with C. jejuni at, at least, a multiplicity of infection of 50 in the presence and absence of deoxycholic acid. The cells of the subject can be cells isolated from a blood sample of the subject such as mononuclear cells, including, but not limited to, T lymphocytes, B lymphocytes, macrophages, monocytes, and dendritic cells. The cells of the subject can be cells isolated from the gastrointestinal tract of the subject obtained, e.g., by gastrointestinal biopsy.

In some embodiments, the methods further comprise administering a composition comprising an effective amount of taurocholic acid and microbiota. In some embodiments, the microbiota is cultured under anaerobic conditions.

Any bacterium that expresses an enzyme that converts primary bile acids to deoxycholic acid can be used in the method of the instant invention. In preferred embodiments, the composition comprises at least one microbiota of the group consisting of Clostridium cluster XI, Bifidobacterium, Butyricicoccus, Lactobacillus, Roseburia, Hydrogenoanaerobacterium, Coprobacillus and Oscillibacter.

The enteropathogen causing enterocolitis according to the subject invention can belong to phyla: Firmucutes, Bacteroidetes, Actinobacteria or Proteobacteria. Non-limiting examples of enterocolitis causing bacteria include Enterobacteriacea spp., Bacteroides fragilis, Pseudomonas aeruginosa , Bacteroides distasonis, B. vulgatus, Fuscobacterium varium and Clostridium spp. such as C. difficile. In further embodiments the enterocolitis is caused by bacteria of the genera including, but not limited to, Campylobacter, Salmonella, Shigella, Escherichia, and Yersinia. In preferred embodiments, the pathogen causing enterocolitis is C. jejuni. Additional examples of pathogens that cause enterocolitis and/or enteropathogen-associated gastrointestinal cancer and can be used in the methods of the current invention are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.

In further embodiments of the invention, methods, assays and animal models are provided to determine the efficacy of prevention and/or treatment of C. jejuni-m ^' duced enterocolitis and C. ye/ww-associated gastrointestinal cancer.

In some embodiments, germ-free C57BL/6 IL10-/- mice are provided as a suitable model to determine the effects of defined microbiota on C. y ^' e/ww ^' -induced enterocolitis. In some embodiments, germ-free Apc ^Mm/+ mice are provided as a suitable model to determine the effects of defined microbiota on C. y ^' e ww ^' -associated gastrointestinal cancer.

For example, the germ-free C57BL/6 IL10-/- mice are colonized with conventionalized microbiota (CONV-biota) for 14 days and infected with a single dose of C. jejuni (10 ⁹ CFU/mouse). In preferred embodiments, CONV-biota are cultured under aerobic (Aer-biota), microaerobic (Microaer-biota) or anaerobic (Anaer-biota) condition on BHI plates and transplanted into germ-free IL10-/- mice.

In further embodiments, specific pathogen free (SPF) mice are infected with C. jejuni after 7 days of antibiotics treatment and host responses are determined using histology score (HS), real time PCR, western blot and tissue culture after 12 or 21 day post infection.

In some embodiments, the methods comprise diagnosing a subject as suffering from, or being at risk of developing, enterocolitis: determining an effective amount of a composition of the invention comprising the steps of: obtaining a colon tissue and/or blood sample from an animal exposed to a enteropathogen, e.g., C. jejuni and isolating T lymphocytes from the blood sample; incubating the colon tissue sample and/or T lymphocytes of the blood sample with increasing amounts of a composition and, e.g., C. jejuni at, at least, a multiplicity of infection of 50; quantifying the amount of phosphorylated p70S6K in the T lymphocytes incubated with the increasing amounts of a composition and C. jejuni and/or quantifying the amount of proinflammatory III β, Cxcl2 and // 7a mRNAs in colonic tissue sample incubated with the increasing amounts of a composition and C. jejuni; and determining the effective amount of the composition as the amount of the composition at which amount reduced or no phosphorylated p70S6K is detected in the T lymphocytes and/or reduced 777 β, Cxcl2 and 77/ 7a mRNAs are detected in the colonic tissue sample.

In further embodiments, the germ-free C57BL/6 IL10-/- mice are colonized with conventionalized microbiota (CONV-biota) for 14 days and infected with a single dose of C. jejuni (10 ⁹ CFU/mouse). In preferred embodiments, CONV-biota are cultured under aerobic (Aer-biota), microaerobic (Microaer-biota) or anaerobic (Anaer-biota) condition on BHI plates and transplanted into germ-free IL10-/- mice.

In other embodiments, germ-free Apc ^{Mlll +} mice are colonized with C. jejuni, e.g. , C. jejuni strain 81-176 or mutant C. jejuni that lack the B subunit of cytolethal distending toxin (CDT). The animals are then exposed to, e.g., 1% dextran sulfate sodium (DSS), and host responses and effects on colon luminal microbiota and the microbiota transcriptome are determined.

In some embodiments, the methods comprise diagnosing a subject as suffering from, or being at risk of developing, C. y ^' e/ww ^' -associated gastrointestinal cancer: determining an effective amount of a composition of the invention comprising the steps of: obtaining a colon tissue and/or blood sample from an animal exposed to a enteropathogen, e.g., C. jejuni and isolating T lymphocytes from the blood sample; incubating the colon tissue sample and/or T lymphocytes of the blood sample with increasing amounts of a composition and, e.g., C. jejuni at, at least, a multiplicity of infection of 50; quantifying the amount of phosphorylated p70S6 in the T lymphocytes incubated with the increasing amounts of a composition and C. jejuni and/or quantifying the amount of DNA damage including, but not limited to, measuring the amount of phosphorylated histone H2AX and measuring DNA damage using a comet assay and/or measuring the levels of PCNA ad nuclear β-catenin in colonic tissue sample incubated with the increasing amounts of a composition and C. jejuni; and determining the effective amount of the composition as the amount of the composition at which amount reduced or no phosphorylated p70S6K is detected in the T lymphocytes and/or reduced histone H2AX phosphorylation, reduced DNA damage in the comet assay, and reduced levels of PCNA ad nuclear β-catenin are detected in the colonic tissue sample.

In accordance with the subject invention it has been found that C. j ^' e/wm ^' -induced carcinogenesis is accompanied by changes in microbiota transcriptional profile and that such changes in the microbiota transcriptional profile are dependent on a functional C. jejuni CDT. Further, the mTOR signaling is important in C. jejuni-induccd carcinogenesis. This shows the carcinogenic potential of C. jejuni and the key role of CDT in this process.

Lysates from mutant C.jejuni, mwXCdtB, exhibited impaired DNA damage ability in vitro, and infection with the muiCdtB C. jejnui resulted in decreased tumor multiplicity and tumor growth with concomitant lower nuclear β-catenin accumulation and PCNA staining compared to C. jejuni-WT, infected Apc ^{Mm +} /DSS mice. In accordance with the subject invention, CDT-producing C. jejuni induces DNA damage in host cells, stimulates cell proliferation and promotes nuclear translocation of β-catenin, thereby promoting colorectal tumorigenesis.

Dysregulated interaction between intestinal bacteria and the host is associated with a number of pathologies including CRC. Interestingly, despite no significant difference in host gene expression profiles between mice colonized with C. jejuni-ΨΎ and mutCdtB, microbial transcriptomic profiles were significant difference between those two groups. Furthermore, 16S rDNA gene sequencing data demonstrated that bacterial community composition was altered by cdtB condition of C. jejuni, which showed enrichment of Lactobaciliaceae, Bacteroidaceae, Enter ococcaceae, S24-7, but depletion of Turicibacteraceae and Lachnospiraceae in the mice infect with C. jejuni-WT compared to mice infected with mutCdtB. This suggests that microbial abundance and function are more sensitive to the action of cdt than the host. Since inflammation was shown to impact microbial genes and function ¹⁰ , one possible explanation could be difference in inflammatory environment triggered by C. jejuni mutCdtB and C. jejuni-ΨΊ. It is possible that presence of intestinal tumors creates an environmental condition permissive to microbial changes.

Rapamycin, an inhibitor of mTOR signaling abrogates the ability of C. jejuni to promote CRC, independently of luminal C. jejuni colonization level. It was previously shown by the Applicants that rapamycin prevented C. jejuni induced intestinal inflammation in III 0 ^'A mice without affecting luminal abundance of the pathogen ²⁴ . These two studies demonstrate that tissue associated C. jejuni, and not luminal levels drive intestinal pathologies. Interestingly, anaerobic-derived bile acid metabolite DCA prevented C. jejuni induced mTOR activation and tissue invasion, thereby blocking intestinal inflammation in a manner similar to rapamycin. Previous study showed that rapamycin inhibited cellular proliferation, β-catenin activation and colorectal tumorigenesis in pc-deficient mice model ³⁴ ' . This observation is in line with the instant results of reduced PCNA and β-catenin activation following rapamycin exposure. Therefore, rapamycin is able to antagonize both microbial-induced carcinogenesis (throught impaired invasion) and spontaneous CRC development afforded by genetic predisposition (Ape).

In accordance with the subject invention, it has been found that the human clinic isolate C. jejuni 81-176 induces DNA damage and promotes colorectal tumorigenesis and tumor growth through the action of CDT, a process dependent on mTOR signaling in Apc ^M,n/+ mice. Importantly, C. jejuni infection greatly alters mucosal microbiota composition and gene expression, while alteration in host gene expression was limited.

Because dysregulated interaction between intestinal bacteria and the host is associated with a number of pathologies including gastrointestinal cancer, the subject invention provides methods and compositions to prevent and/or treat pathologies including, but not limited to, enterocolitis and gastrointestinal cancers by administering a composition that targets the dysregulated interaction between intestinal bacteria and the host.

In some embodiments, the compositions of the subject invention comprise microbiota cultured under microaerobic or anaerobic conditions. In some embodiments, the compositions additionally comprise bile acids. In some embodiments, the bile acid is selected from taurocholic acid and deoxycholic acid. Preferably the amount of deoxycholic acid or a salt thereof, is an amount that inhibits mTOR activation in cells of a subject exposed to an enteropathogen, e.g., C. jejuni.

Although rapamycin abrogates the ability of C. jejuni to promote gastrointestinal cancer, independently of luminal C. jejuni colonization level, reduces PCNA and β-catenin activation in mucosal cells and is able to antagonize carcinogenesis, the use of mTOR inhibitors, in general, and rapamycin, in specific, as therapeutic agents has been limited by a number of factors, including that fact that rapamycin inhibits only some of the effect so mTOR, the existence of several feedback loops; and the crucial importance of mTOR in normal physiology.

Therefore, in specific embodiments, compositions are provided that elicit effects similar to mTOR inhibitors in the gastrointestinal tract of subjects suffering from or suspected to suffer from enterocolitis and/or gastrointestinal cancers while not having the risks associated with mTOR inhibitors.

Advantageously, the compositions provided are effective in blocking mTOR signaling in colonic tissue and immune cells and abrogate the ability of enteropathogens, e.g., C. jejuni to promote tumorigenesis, e.g., growth of gastrointestinal cancers including, but not limited to, colorectal carcinomas.

The compositions of the subject invention, e.g., comprise microbiota cultured under anaerobic and microaerobic conditions as a therapeutic means to modulate colonic luminal and mucosal-associated bacterial content such that enteropathogen-induced, e.g., C. jejuni- induced mTOR activation and C. jejuni tissue association and/or colon tissue invasion and C e ww/ ^' -associated tumorigenesis are inhibited.

In further embodiments, the compositions comprise microorganisms genetically engineered to express at least one enzyme that converts primary bile acids to deoxycholic acid. Advantageously, it was determined that DCA can inhibit mTOR signaling in colonic tissue and inhibit enteropathogen-associated, e.g, C y ^' e/wra ^' -associated tumorigenesis. In preferred embodiments, the methods of the instant invention administer at least one microbiota of the group consisting of Clostridium cluster XI, Bifidobacterium, Butyricicoccus, Lactobacillus, Roseburia, Hydrogenoanaerobacterium, Coprobacillus and Oscillibacter.

In further embodiments, the methods of the instant invention administer at least one microbiota of the group consisting of Clostridium cluster XI, Bifidobacterium, Butyricicoccus, Lactobacillus, Roseburia, Hydrogenoanaerobacterium, Coprobacillus and Oscillibacter and taurocholic acid.

In further embodiments, the methods comprise administering a therapeutically effective amount of DCA.

In accordance with the subject invention and its findings that the human clinic isolate C. jejuni 81-176 induces DNA damage and promotes colorectal tumorigenesis and tumor growth through the action of CDT, a process dependent on mTO signaling in Apc ^Mm/+ mice, the methods and compositions of the subject invention are directed at reducing or blocking processes involving mTOR signaling in subjects suffering from or being at risk of developing C. ye/ewra ^' -associated gastrointestinal cancer. Because C. jejuni infection alters mucosal microbiota composition and gene expression, the methods of the subject invention provide compositions that, in turn, modify the mucosal microbiota composition and gene expression in such a manner that prevents and/or treats C. y_y ^' ewn -associated gastrointestinal cancer.

The term "gastrointestinal cancer" includes, but is not limited to, colorectal cancers, gastric cancers, gastro-oesophageal junction cancers, gastrointestinal adenocarcinomas and gastrointestinal stromal tumors. Also included are sporadic colorectal cancers, familial colorectal cancers and hereditary colorectal syndromes including, but not limited to, Hereditary Nonpolyposis Colorectal Cancer, Adenomatous Polyposis Syndrome, Turcot Syndrome, Familial Adenomatous Polyposis, MUTYH-Associated Polyposis, Peutz-Jeghers Syndrome, PTEN Hamartoma Tumors Syndrome, Juvenile Polyposis Syndrome, Polymerase Proofreading- Associated Polyposis.

The compositions of the subject invention can be administered to a subject suffering from a gastrointestinal cancer in a combination therapy including, but not limited to, Adriamycin (Doxorubicin Hydrochloride), Adrucil (Fluorouracil), Afmitor (Everolimus), Aldara (Imiquimod), Aldesleukin, Alemtuzumab, Alimta (Pemetrexed Disodium), Aloxi (Palonosetron Hydrochloride), Ambochlorin (Chlorambucil), Amboclorin (Chlorambucil), Aminolevulinic Acid, Anastrozole, Aprepitant, Arimidex (Anastrozole), Aromasin (Exemestane), Arranon (Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwinia chrysanthemi, Avastin (Bevacizumab), Axitinib, Azacitidine, BEACOPP, Bendamustine Hydrochloride, BEP, Bevacizumab, Bexarotene, Bexxar (Tositumomab and I 131 Iodine Tositumomab), Bleomycin, Bortezomib, Bosulif (Bosutinib), Bosutinib, Brentuximab Vedotin, Cabazitaxel, Cabozantinib-S-Malate, CAF, Campath (Alemtuzumab), Camptosar (Irinotecan, ydrochloride), Capecitabine, CAPOX, Carboplatin, CARBOPLATIN- TAXOL, Carfilzomib, CeeNU (Lomustine), Cerubidine (Daunorubicin Hydrochloride), Cervarix (Recombinant HPV Bivalent Vaccine), Cetuximab, Chlorambucil, CHLORAMBUCIL-PREDNISONE, CHOP, Cisplatin, Clafen (Cyclophosphamide), Clofarabine, Clofarex (Clofarabine), Clolar (Clofarabine), CMF, Cometriq (Cabozantinib-S- Malate), COPP, Cosmegen (Dactinomycin), Crizotinib, CVP (COP), Cyclophosphamide, Cyfos (Ifosfamide), Cytarabine, Cytarabine, Liposomal, Cytosar-U (Cytarabine), Cytoxan (Cyclophosphamide), Dacarbazine, Dacogen, (Decitabine), Dactinomycin, Dasatinib, Daunorubicin Hydrochloride, Decitabine, Degarelix, Denileukin, diftitox, Denosumab, DepoCyt (Liposomal Cytarabine), DepoFoam (Liposomal Cytarabine), Dexrazoxane hydrochloride, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox-SL (Doxorubicin Hydrochloride Liposome), DTIC-Dome (Dacarbazine), Efudex (Fluorouracil), Elitek (Rasburicase), Ellence (Epirubicin Hydrochloride), Eloxatin (Oxaliplatin), Eltrombopag Olamine, Emend (Aprepitant), Enzalutamide, Epirubicin Hydrochloride, EPOCH, Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erlotinib Hydrochloride, Erwinaze (Asparaginase Erwinia chrysanthemi), Etopophos (Etoposide Phosphate), Etoposide, Etoposide Phosphate, Evacet (Doxorubicin Hydrochloride Liposome), Everolimus, Evista (Raloxifene Hydrochloride), Exemestane, Fareston (Toremifene), Faslodex (Fulvestrant), FEC, Femara (Letrozole), Filgrastim, Fludara (Fludarabine Phosphate), Fludarabine Phosphate, Fluoroplex (Fluorouracil), Fluorouracil, Folex (Methotrexate), Folex PFS (Methotrexate), FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRINOX, FOLFOX, Folotyn (Pralatrexate), FU-LV, Fulvestrant, Gardasil (Recombinant HPV Quadrivalent Vaccine), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINE-CISPLATIN, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine, ydrochloride), Gleevec (Imatinib Mesylate), Glucarpidase, Halaven (Eribulin Mesylate), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Quadrivalent Vaccine (Recombinant), Hycamtin (Topotecan Hydrochloride), Ibritumomab Tiuxetan, ICE, Iclusig (Ponatinib Hydrochloride), Ifex (Ifosfamide), Ifosfamide, Ifosfamidum (Ifosfamide), Imatinib Mesylate, Imiquimod, Inlyta (Axitinib), Ipilimumab, Iressa (Gefitinib), Irinotecan Hydrochloride, Istodax (Romidepsin), Ixabepilone, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), Jevtana (Cabazitaxel), Keoxifene (Raloxifene Hydrochloride), Kepivance (Palifermin), Kyprolis (Carfilzomib), Lapatinib Ditosylate, Lenalidomide, Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Levulan (Aminolevulinic (Acid), Linfolizin (Chlorambucil), LipoDox (Doxorubicin Hydrochloride Liposome), Liposomal Cytarabine, Lomustine, Lupron (Leuprolide Acetate), Lupron Depot (Leuprolide Acetate), Lupron Depot-Ped (Leuprolide Acetate), Lupron Depot-3 Month (Leuprolide Acetate), Lupron Depot-4 Month (Leuprolide Acetate), Marqibo (Vincristine Sulfate Liposome), Matulane (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Mesna, Mesnex (Mesna), Methazolastone (Temozolomide), Methotrexate, Methotrexate LPF (Methotrexate), Mexate (Methotrexate), Mexate-AQ (Methotrexate), Mitomycin C, Mitozytrex (Mitomycin C), MOPP, Mozobil (Plerixafor), Mustargen (Mechlorethamine hydrochloride), Mutamycin (Mitomycin C), Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel (Paclitaxel Albumin-stabilized Nanoparticle Formulation), Navelbine (Vinorelbine Tartrate), Nelarabine, Neosar (Cyclophosphamide), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Nilotinib, Nolvadex (Tamoxifen Citrate), Nplate (Romiplostim), Ofatumumab, Omacetaxine, Mepesuccinate, Oncaspar (Pegaspargase), Ontak (Denileukin Diftitox), Oxaliplatin, Paclitaxel, Paclitaxel Albumin-stabilized Nanoparticle Formulation, Palifermin, Palonosetron Hydrochloride, Panitumumab, Paraplat (Carboplatin), Paraplatin (Carboplatin), Pazopanib Hydrochloride, Pegaspargase, Pemetrexed Disodium, Perjeta (Pertuzumab), Pertuzumab, Platinol (Cisplatin), Platinol-AQ (Cisplatin), Plerixafor, Ponatinib Hydrochloride, Pralatrexate, Prednisone, Procarbazine Hydrochloride, Proleukin (Aldesleukin), Prolia (Denosumab), Promacta (Eltrombopag Olamine), Provenge (Sipuleucel-T), Raloxifene hydrochloride, Rasburicase, R-CHOP, R-CVP, Recombinant HPV Bivalent Vaccine, Recombinant HPV, Quadrivalent Vaccine, Regorafenib, Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Rituxan (Rituximab), Rituximab, Romidepsin, Romiplostim, Rubidomycin (Daunorubicin Hydrochloride), Ruxolitinib Phosphate, Sclerosol Intrapleural Aerosol (Talc), Sipuleucel-T, Sorafenib Tosylate, Sprycel (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate, Sutent (Sunitinib Malate), Synovir (Thalidomide), Synribo (Omacetaxine Mepesuccinate), Talc, Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib), Taxol (Paclitaxel), Taxotere (Docetaxel), Temodar (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid (Thalidomide), Toposar (Etoposide), Topotecan Hydrochloride, Toremifene, Torisel (Temsirolimus), Tositumomab and I 131 Iodine Tositumomab, Totect (Dexrazoxane Hydrochloride), Trastuzumab, Treanda (Bendamustine Hydrochloride), Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Vandetanib, VAMP, Vectibix (Panitumumab), VelP, Velban (Vinblastine Sulfate), Velcade (Bortezomib), Velsar (Vinblastine Sulfate), Vemurafenib, VePesid (Etoposide), Viadur (Leuprolide Acetate), Vidaza (Azacitidine), Vinblastine Sulfate, Vincasar PFS (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, Vismodegib, Voraxaze (Glucarpidase), Vorinostat, Votrient (Pazopanib Hydrochloride), Wellcovorin (Leucovorin Calcium), Xalkori (Crizotinib), Xeloda (Capecitabine), XELOX, Xgeva (Denosumab), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Zaltrap (Ziv-Aflibercept), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zinecard (Dexrazoxane Hydrochloride), Ziv-Aflibercept, Zoledronic Acid, Zolinza (Vorinostat), Zometa (Zoledronic Acid), and Zytiga (Abiraterone Acetate). Following are examples that illustrate procedures for practicing the invention. These examples should not be construed as limiting.

EXAMPLES EXAMPLE 1 - BACTERIA STRAINS AND CULTURE CONDITIONS

The human clinical isolate C. jejuni 81-176 (wild-type) and xmxXCdtB were cultured on Campylobacter selective medium (Remel) at 37°C for 48 hours under micro-aerobic condition using the GasPak system (BD) ²³ . EXAMPLE 2 - MOUSE EXPERIMENTS COLITIS MODEL

Cohorts of 8-12 weeks old age matched male or female 4 to 9 mice/group were used, and the sample size according to previous published reports showing significant colitis with that sample size. ¹ ' ⁶ ' ²⁰ The sibling littermate mice were fed ad libitum chew diet and water in individually ventilated cage (IVC) with Alpha Dri bedding. All animal procedures were performed at light cycle.

GF II 10-/- mice were transferred to SPF conditions for 3 or 14 days and 14-day stool was collected as conventionalized microbiota (CONV-Biota). Freshly collected stools were immediately suspended in 30% glycerol PBS stock, quantified (OD600 value of 1 was estimated as 10 ^s CFU/ml), and stored at -80 °C. Before oral gavage, the stool preparation was thawed, diluted and immediately gavaged to mice at 10 CFU/mouse.

The CONV-Biota was also cultured under aerobic (Aero-Biota), microaerobic (Microaero-Biota) or anaerobic (Anaero-Biota) conditions using Brain Hart Infusion (BHI) agar plates. For C. jejuni infection experiments, GF C57BT/6 1110 -/- mice were transferred from GF isolators to SPF housing and immediately gavaged with 10 ⁹ C. jejuni CFU/mouse (C. jejuni strain 81-176 ²⁴ ) for 12 days and sacrificed as described before. ⁶ For whole microbiota protection experiments, GF II 10 -/- mice were orally gavaged with a single dose of CONV-Biota (10 CFU/mouse) for 14 days before 12-day C. jejuni infection. For specific microbiota protection experiments, GF 1110 -/- mice were gavaged with a single dose of 10 ⁸ CFU/mouse Aero-Biota, Microaero-Biota, Anaero-Biota or the three microbiota pooled. The 12-day C. jejuni infection was started 14 days post-gavage.

To deplete mouse microbiota, C57BL/6 II 10 -/- mice in SPF housing were given an antibiotics cocktail in drinking water ⁹ or clindamycin (Sigma-Aldrich) was gavaged at 67 mg/kg body weight (BW) or nalidixic acid (Sigma-Aldrich) was gavaged at 200 mg/kg BW for 7 days. One day after the antibiotic treatment, the mice were gavaged with a single dose of 10 ⁹ C. jejuni CFU/mouse for 21 days.

To investigate the impact of bile acids on C. y ^' e/wm ^' -induced colitis, GF II 10-/- mice were infected as before and were gavaged daily with 30 mg kg BW of deoxycholic acid, lithocholic acid, or ursodeoxycholic acid (Sigma-Aldrich) for 12 days. Although intestinal inflammation was observed at different time points of C. jejuni infection (day 4, 5, 6, and 12 post infection) in ex-GF II 10-/- mice, the 12-day post-infection time point was chosen in this study because of the consistency in host response (severe colitis), and also because this colonization time was used to determine efficacy of therapeutic intervention in previous studies (neutrophil depletion, mTOR inhibition, and ΡΙ3Κγ blockade). 1 ' 2 ' 6 Mice were followed clinically for evidence of diarrhea, failure to thrive and mortality. At the end of experiments, tissue samples from mouse colon and stool were collected for protein, RNA, histology, and culture assay.

For live C. jejuni counting, MLN and liver were aseptically resected. Colon tissue was opened, resected, and washed three times in sterile PBS. Colonic luminal content (stool) was also collected. The freshly collected tissues and stool were weighed, homogenized in PBS, serially diluted, and plated on Campylobacter-selective blood plates (Remel) for 48 h at 37°C using the GasPak system (BD Biosciences). C. jejuni colonies were counted, and data were presented as CFU per gram tissue or stool. Histopathological images were acquired using a DP71 camera and DP Controller 3.1.1.276 (Olympus) as described before. ¹ Intestinal inflammation was scored using a score from (Ml.

EXAMPLE 3 - CONSTRUCTION OF CDTB MUTANT-C. JEJUNI (mutCdtB)

A 2.2 kb region of DNA encoding coding sequences of cdtABC was amplified by PCR and cloned into the BamHI site of pUC19 to create pDRH577. A Smal cat-rpsL cassette from pDRH265 was ligated into the EcoRV site within cdtB on pDRH577 to create pDRH2646 ²⁴ . This plasmid was then electroporated into DRH212 (81-176 rpsL ^Sm ) and transformants were selected on Mueller-Hinton agar with 10 μg/ml chloramphenicol ²⁴ . Transformants were screened by colony PCR to verify correct insertion of cat-rpsL into cdtB to obtain cdtB mutant-C. jejuni strain (mutCdtB).

EXAMPLE 4 - BACTERIAL LYSATE PREPARATION

Bacteria were harvested, suspended in sterilize PBS, pelleted at 3000rpm and washed twice in sterilize PBS. Bacteria suspensions were sonicated (Sonicator 3000, Misonix) on ice for four 30-seconds bursts with 30-seconds intervals in between. After sonication, bacterial lysate were centrifuged at 5000rpmx4°C for lOmin and passed on a 0.22μιη sterilize syringe filter (Olympus). The concentration of protein content was measured using Bio-Rad protein assay (Bio-Rad).

EXAMPLE 5 - ENTERIOD ISOLATION AND CULTURE

Small intestines from 4-8 weeks old wide type C57BL/6 mice were removed, cut open longitudinally, washed with cold PBS, and shaken vigorously to remove debris. The tissues were then cut into 2 mM sections and incubated in cold PBS with 3mM EDTA on ice. Tissue sections were then transferred to cold PBS, shaken vigorously to dislodge crypts and transferred to a new cold PBS solution. Tissue fractions were assessed for crypt abundance, and optimal fractions filtered through a 100 uM strainer to remove debris and villi fragments. The Filtered crypt solution was centrifuged at 400g for 5 minutes, and the resulting crypt pellet was re-suspended in a solution of 50% Matrigel (Corning) in basal organoid media, which consists of Advanced DMEM/F12 containing lx N-2 supplement (R&D Systems), lx B27 supplement (Fisher Scientific), 10 mM HEPES (Gibco), lx Glutamax (Gibco), and 100 U/mL Penicillin-Streptomycin (Gibco). 100 μΐ of crypt solution containing approximately 300-500 crypts were deposited per well into a pre-warmed 6-well culture plate, allowed to harden for 15 minutes at 37°C, and overlaid with pre-warmed complete organoid media. Complete organoid media consisted of basal organoid media supplemented with 50 ng/mL recombinant mouse EGF (R&D Systems), 50 ng/mL recombinant murine noggin (Peprotech), and 250 ng/mL recombinant mouse r-spondin 1, CF (R&D Systems). Organoid cultures were maintained by passaging every 5-7 days as previously described ²⁶ . Briefly, organoids were collected in cold PBS and dissociated using warm 0.05% Trypsin/0.5 mM EDTA for 5-10 minutes at 37°C before inactivation with FBS and resuspension in matrigel.

EXAMPLE 6 - MOUSE EXPERIMENTS CANCER MODEL

Mice with germline mutation in the Ape (adenomatous polyposis coli) locus, Apc ^Min/+ mice, are predisposed to intestinal adenoma formation. Germ-free (GF) Apc ^Mm/+ mice (129/SvEv background, 7—10 weeks old, mixed gender) were colonized with C. jejuni strain 81-176 or cdtB mutant via oral gavage (10 ⁵ cfu/mouse) upon the day being transferred to specific-pathogen- free (SPF) condition. Sham treatment consisted of PBS. Two weeks later, these mice were fed with 1 % dextran sulfate sodium (DSS, Alfa Aesar) with molecular weight 40kDa in the drinking water for 10 days. Tumor formation was monitored by colonoscopy. Three weeks post-DSS treatment, all mice were euthanized by C0 ₂ asphyxiation. For mTOR inhibition experiment, the mice were intraperitoneally injected with rapamycin (1.5mg/kg rapamycin) daily for 2 weeks after oral infection with C. jejuni (10 ⁵ cfu/mouse). The colons were cut open longitudinally and macroscopic tumors were counted. The tumor size was measured using electronic digital caliper (Control company). Approximately 0.5 cm ^χ 0.5 cm snips were taken from the distal colon, quickly frozen in liquid nitrogen, and store at -80°C. The rest of colonic specimens were Swiss-rolled, formalin-fixed, and paraffin-embedded for histologic examination. Sections of 5 μι ^η were stained with hematoxylin and eosin. Histological scoring of inflammation was performed

23 blindly using a scoring system with range from 0 to 4 as described previously and calculated the average of the proximal, middle and distal colon region scores.

EXAMPLE 7 - RNA EXTRACTION AND RNA-SEQUENCI G

Total RNA was extracted from frozen distal colon tissue snips using bead beater disruption followed the manufacturer's instructions of mirVana miRNA isolation kit with phenol (ThermoFisher Scientific). Extracted RNA was treated with the Turbo DNA-free Kit (ThermoFisher Scientific) to remove DNA. Quality control, rRNA depletion and cDNA library preparation was performed by the University of Florida's Interdisciplinary Center for Biotechnology Research (ICBR) Gene Expression and Genotyping core using the Agilent 2100 Bioanalyzer (Agilent Genomics), Ribo-Zero Gold rRNA Removal Kit (Epidemiology) (Illumina) and NEBNext Ultra Π Directional RNA Library Prep Kit for Illumina (NEB) starting with 550 ng total RNA. Samples were sequenced by the University of Florida ICBR NextGen DNA Sequencing core on the Illumina HiSeq 3000 (2x100 cycles).

EXAMPLE 8 - DNA EXTRACTION, 16S RDNA GENE AMPLIFICATION AND MULTIPARALLEL SEQUENCING

Mouse stool samples were collected and DNA was extracted using bead beater disruption and phenol: chloroform separation according to the recommendations of the manufacturer of DNeasy Blood & Tissue Kit (Qiagen) as described before. ³⁷ ' ³⁸ The VI -V3 region hypervariable region of the 16S rDNA was amplified using primer pair 8F (5'- AGAGTTTGATCCTGGCTCAG -3') and 534R (5 '-ATTACCGCGGCTGCTGG-3 '). Both the forward and the reverse primers contained universal Illumina paired-end adapter sequences, as well as unique individual 4 to 6 nucleotide barcodes between PCR primer sequence and the Illumina adapter sequence to allow multiplex sequencing. PCR products were visualized on an agarose gel, before samples were purified using the Agencourt AMPure XP kit (A63881, Beckman Coulter) and quantified by qPCR with the KAPA LibraryQuantification Kit (KK4824, KAPA Biosystems). Equimolar amount of samples were then pooled and sequenced with an Illumina MiSeq. The sequencing information for Aerobic and Anaerobic microbiota derived from the colitis model animals is disclosed in Table 1. Table 1. Aaero and Anaero Sequencing information

Sample Name SRA Number Mouse Group Timepoint C jejuni Cage

Accession of Reads (day) Infected? Number

aerobicCj_14-l SRR4733998 430372 aerobicCj -1 aerobic 14 No 3 aerobicCj_14-2 SRR4733997 529372 aerobicCj-2 aerobic 14 No 3 aerobicCj_14-3 SRR4734000 689266 aerobicCj-3 aerobic 14 No 3 aerobicCj_14-4 SRR4733999 403610 aerobicCj -4 aerobic 14 No 3 aerobicCj_14-5 SRR4734002 494406 aerobicCj -5 aerobic 14 No 4 aerobicCj_14-6 SRR4734001 578476 aerobicCj-6 aerobic 14 No 4 aerobicCj_26-l SRR4733981 482508 aerobicCj- 1 aerobic 26 Yes 3 aerobicCj 26-2 SRR4733980 620542 aerobicCj-2 aerobic 26 Yes 3 aerobicCj_26-3 SRR4733983 537518 aerobicCj-3 aerobic 26 Yes 3 aerobicCj_26-4 SRR4733982 633292 aerobicCj -4 aerobic 26 Yes 3 aerobicCj 26-5 SRR4733985 758800 aerobicCj-5 aerobic 26 Yes 4 aerobicCj_26-6 SRR4733984 603124 aerobicCj-6 aerobic 26 Yes 4 anaerobicCj_14-l SRR4734004 472368 anaerobicCj 1 anaerobic 14 No 5 anaerobicCj_14-2 SRR4734003 637652 anaerobicCj 2 anaerobic 14 No 5 anaerobicCj_14-3 SRR4733996 478088 anaerobicCj3 anaerobic 14 No 5 anaerobicCj_14-4 SRR4733995 596672 anaerobicCj4 anaerobic 14 No 5 anaerobicCj_14-5 SRR4733977 810348 anaerobicCj 5 anaerobic 14 No 6 anaerobicCj_14-6 SRR4733976 642718 anaerobicCj6 anaerobic 14 No 6 anaerobicCj 14-7 SRR4733979 761 544 anaerobicCj 7 anaerobic 14 No 6 anaerobicCj _ 14-8 SRR4733978 719414 anaerobicCj 8 anaerobic 14 No 6 anaerobicCj 26- 1 SRR4733987 689718 anaerobicCj 1 anaerobic 26 Yes 5 anaerobicCj 26-2 SRR4733988 636784 anaerobicCj2 anaerobic 26 Yes 5 anaerobicCj_26-3 SRR4733989 464632 anaerobicCj 3 anaerobic 26 Yes 5 anaerobicCj 26-4 SRR4733990 4161 10 anaerobicCj4 anaerobic 26 Yes 5 anaerobicCj_26-5 SRR4733991 496778 anaerobicCj 5 anaerobic 26 Yes 6 anaerobicCj 26-6 SRR4733992 555990 anaerobicCj6 anaerobic 26 Yes 6 anaerobicCj_26-7 SRR4733993 536190 anaerobicCj 7 anaerobic 26 Yes 6 anaerobicCj_26-8 SRR4733994 554584 anaerobicCj 8 anaerobic 26 Yes 6 Note: Aero- Aerobic microbiota, Anaero - Anaerobic microbiota

For 16s rDNA sequencing analysis, taxonomic ranks were assigned for the forward reads using the RDP (ribosomal database project) classifier 1 downloaded from https://github.com/rdpstaff/RDPTools on 08/26/2015 with confidence set to 80%. Reads were grouped by genera and the counts were normalized and logio transformed using the following formula: where RC is the read count for a particular genus in a particular sample, n is the total number of reads in that sample, the sum of x is the total number of reads in all samples and N is the total number of samples. The Principle Coordinate Analysis (PCoA) was generated from the Bray- Curtis distance of the normalized and log 10 transformed counts using the capscale function in the vegan R package. ⁴⁰

Significant genera were detected using R to perform a t-test comparing the Aero- vs. Anaero- post-C. jejuni infection log normalized abundances, after filtering genera absent in more than a quarter of the samples. The P-values were then adjusted for multiple hypothesis testing using the method of Benjamini & Hochberg. ¹ A linear mixed effect model of genus-colonization duration+l |cage was also tested (Figure 3) and genus~group+l |cage (Figure 4) (using cage as a random effect) to look for cage effects. Since no genera were significant for cage effects, only the t-test results are reported. The heatmaps were generated using the R function ggplot2. ² All sequences were uploaded the NCBI SRA (National Center for Biotechnology Information Sequence Read Archive) under BioProject PRJNA351834. See Table 1 for individual accession numbers. Code used to analyze the data can be found at https :// github. com/afodor/j ej uni .

EXAMPLE 9 - QUANTIFICATION OF BILE ACID SPECIES

Bile acids in mouse stool were extracted using methanol. Briefly, vacuum-dried stool was suspended in methanol and sonicated. After incubated with occasional shakes, the supernatant was collected after the suspension was centrifuged. The pellet was re-extracted in methanol for an additional two times. The three pooled supernatants were subject to HPLC/MS analysis. Calibration was made with the addition of individual or pooled bile acid standards (Sigma- Aldrich) into GF mouse stools and the bile acids were extracted. Bile acids were quantified as previously described. ⁴¹ Briefly, bile acid analysis was performed on liquid chromatography-tandem mass spectrometry (LC-MS, Agilent 6130 quadrupole) with an Agilent Zorbax SB-C18 1.8 μιη (2.1 ^χ 50 mm) column. Mobile phase A contained methanol/water (l :l,v/v) and mobile phase B consisted of methanol + l OmM ammonium acetate + 0.1% ammonia (pH=8.8). The running method was 100% A (0-1 min), linear increase to 50% B (1-9 min), then to 100% B (9- 13 min) followed by 100% A (13-18 min). Flow rate was 0.2ml/min. The column was reequilibrated from 18.1-24 min with 100% A. MS was performed using AP-ESI ionization technique and the spectra were analyzed in negative mode. Because tauromuricholic acid and TCA share same mass and retention time, we reported them as TCA. Data analysis was performed with Agilent ChemStation-B.04.03 software. The data were exported to Excel spreadsheets and the relative bile acid (%) within a sample was calculated by normalizing with the combined bile acid extracted ion intensity. EXAMPLE 10 - WESTERN BLOTTING OF INFECTED SPLENOCYTES AND COLON TISSUES

Splenocytes were isolated as described previously. ⁶ Briefly, C57BL/6 1110 -/- mice (8-12 wk old) were sacrificed, and spleens were resected. After lysing the red blood cells, the collected cells were plated at 2 x 10 ⁶ cells/well in 6-well plates. Cells were infected with C. jejuni (multiplicity of infection 50) in the presence of sodium cholate (CA) or sodium deoxycholate (DCA) for 4 h. The medium was then removed and the cells were lysed in Laemmli buffer. 20 μg of protein from lysed intestinal tissues or splenocytes was separated by SDS-PAGE, transferred to nitrocellulose membranes. Protein was detected using enhanced chemiluminescence reaction (ECL) as described previously. ⁶ Primary antibodies used were total and phosphor-p70S6K (T389) and phosphor-S6 (S235/236) (Cell Signaling).

EXAMPLE 1 1 - FLUORESCENCE IN SITU HYBRIDIZATION (FISH)

C. jejuni at intestinal tissue sections was visualized using FISH assay as previously described. ⁷ Briefly, tissue sections were deparaffinized, hybridized with the FISH probe, washed, stained with DAPI, and imaged using a fluorescent Microscope system. EXAMPLE 12 - IMMUNOHISTOCHEMISTRY, CYTOCHEMISTRY, FLOW CYTOMETRY, COMET ASSAY, AND CELL CYCLE ANALYSIS

Neutrophils in intestinal tissues were detected using anti-myeloperoxidase (MPO) IHC analysis as described previously. ³ Colonic p-S6 (S235/236) positive cells, PCNA and nuclear β-catenin positive cells were also detected using IHC. Briefly, intestinal tissue sections were deparaffmized, blocked, and incubated with an anti-MPO or the anti-p-S6 antibody (1 :400; Thermo Scientific) overnight. After incubation with anti -rabbit biotinylated antibody, avidin/biotin complex (Vectastain ABC Elite Kit, Vector Laboratories), diaminobenzidine (Dako), and hematoxylin-eosin (Fisher Scientific), the sections were imaged. For cytochemistry, the non-transformed rat small intestine epithelial cell lines IEC-6 and the human colon cancer cell line HT-29 were incubated with an anti-phospho-yH2AX antibody overnight, followed by incubation with fluorescently-labeled secondary antibodies. Cells were imaged using a fluorescent microscope and flow cytometry. For measurement of DNA damage, a commercially available comet assay and fluorescent microscopy were used. For cell cycle analysis, a commercially available assay and flow cytometry were used.

EXAMPLE 13 - REAL TIME RT-PCR

Total RNA from colonic tissue was extracted using TRIzol (Invitrogen). cDNA was prepared using M-MLV (Invitrogen). mRNA levels of proinflammatory genes were determined using SYBR Green PCR Master mix (Bio-Rad) on an Bio-Rad 384-well Real- Time PCR System and normalized to Gapdh. Stool DNA was extracted and the stool bacteria were subject to real time PCR. The PCR reactions were performed according to the manufacturer's recommendation. The following gene primers were used: Gapt Z/ forward: 5'- GGTGAAGGTCGGAGTCAACGGA-3 ' , Gapdhj verse: 5'- GAGGGATCTCGCTCCTGGAAGA-3 ' , //-/^ forward: 5'-

GCCCATCCTCTGTGACTCAT-3 ' , //-7/j_reverse: 5 ' -AGGCC AC AGGTATTTTGTCG-3 ' , Cxc/2_forward: 5'-AAGTTTGCCTTGACCCTGAA-3\ O c/2_reverse: 5'- AGGCACATCAGGTACGATCC-3', Il-l 7a_forward: 5'-TCCAGAAGGCCCTCAGACTA- 3', 7/-i 7a_reverse: 5'-ACACCCACCAGCATCTTCTC-3\ //6_forward: AGTTGCCTTCTTGGGACTGA, //^ reverse: TCCACGATTTCCCAGAGAAC, C c/7_forward: GCTGGGATTCACCTCAAGAA, Cxcll reverse:

TCTCCGTTACTTGGGGACAC, Cxcr2_forward: GGTGGGGAGTTCGTGTAGAA, Cecr2_reverse: CGAGGTGCTAGGATTTGAGC, 16S_Universal_926F:

GCACAAGCRGHGGARCATG 16S_Universal_1505R: ACGGYTACCTTGTTACGACTT.

EXAMPLE 14 - STATISTICAL ANALYSIS

Values were shown as mean ± standard error of the mean as indicated. All statistical tests were performed using SPSS (version 22), Microsoft Excel, and Graphpad Prism (version 6). All tests are two-tailed, P < 0.05 was considered statistically significant. Parametric tests were used only for normally distributed data, otherwise the non-parametric Mann- Whitney U test was used. Equality of proportions was tested by Chi-Square test. Bile acid data were analyzed using ANOVA in R. Experiments were considered statistically significant if P values were <,05.

EXAMPLE 15 - REDUCTION OF MICROBIOTA PROMOTES C. JZL/UM- INDUCED COLITIS

To define the interaction between microbiota and host susceptibility to campylobacteriosis, the intestinal microbial content was manipulated using antibiotics, fecal transfer and GF mice. First, GF and specific pathogen free (SPF) II 10-/- mice were infected with the human clinical C. jejuni isolate 81-176 (10 ⁹ colony forming unit (CFU)/mouse). Interestingly, C. jejuni failed to induce colitis in SPF 1110-/- mice (Figure 1 A, left panels and IB), whereas ex-GF 1110-/- mice developed severe colitis at 12 days post infection (Figure 1A, right panels). In addition, microbiotadepletion using a broad spectrum antibiotic cocktail (Figure 8 A and B), rendered conventionalized II 10-/- mice susceptible to C. ye ww-induced colitis (Figure 1A, middle panels) albeit to a lower extent than GF mice (Figure 1A, right panels). In line with the colitis severity, C. jejuni induced proinflammatory gene expression of Μβ, Cxcl2 and III 7a mRNA in colonic tissue of ex-GF IUO- mice and SPF III 0-1- mice with microbiota depleted, compared to their respective uninfected mice (Figure 1 C). C. jejuni induces colitis as early as 4-6 days post infection and these early time points have then been used for treatment intervention. ² ' ⁸ ' ¹⁰

Therefore, GF II ^' 10— I— mice were infected with C. jejuni and evaluated colitis 5 or 12 days post infection. Consistent with previous reports, C. jejuni induced colitis at 5 days post infection, although with less severity than 12-day infection (Figure 9 A and B). Interestingly, C. jejuni colonic luminal colonization level and invasion into liver and mesenteric lymph node (MLN) were comparable between 5- and 12-day infection (Figure 9C), whereas 116 and Cxcll mR A expression was greater in colonic tissue of 5-day infection mice (Figure 9D).

EXAMPLE 16 - MICROBIOTA TRANSPLANTATION ATTENTUATES C. JEJUNI- FNDUCED COLITIS IN GF MICE

From the observations of increased campy lobacterio sis susceptibility in microbiota- depleted SPF II 10-/- mice, it was reasoned that component of the microbiota confers resistance to C. jejuni induced colitis in II 10-/- mice. To gain a better understanding of the relationship between microbial acquisition and susceptibility to campylobacteriosis, (conventionalized) germ free II 10-/- mice were transferred to SPF housing for either 3 or 14 days, and these cohorts were infected with C. jejuni for 12 days. Interestingly, C. jejuni- induced colitis was attenuated in day 14, but not day 3 conventionalized II 10-/- mice (Figure 10 A and B), indicating the presence of protective microbiota. Therefore, 14-day conventionalized microbiota (CONV-Biota) were selected for the subsequent campylobacteriosis protection experiments. GF 1110-/- mice were transplanted by orogastric gavage with a single dose of CONV-Biota, and 14 days post inoculation the mice were infected with C. jejuni. Consistently, II 10-/- mice colonized with CONV-Biota resisted C, ye/wra-induced intestinal inflammation compared to mono-associated 1110-/- mice (Figure 2A and B). It was tested whether colonization resistance was implicated in the protective effect of microbiota against campylobacteriosis. Surprisingly, luminal C. jejuni colonization levels were comparable between mono-associated GF and CONV-Biota II 10-/- mice (Figure 2C), although their inflammatory status is dramatically different (Figure 2B). These results indicated that the microbiota exerted a protective role against C. jejuni infection through a novel mechanism, independent of luminal colonization exclusion.

A strong inflammatory host response was observed following C. y ^' eyww ^' -infection, ¹ ' ² thus the impact of the microbiota on various proinflammatory mediators was determined. C. jejuni strongly induced proinflammatory 111 , Cxcl2 and 1117 a mRNA accumulation in colonic tissue of ex GF III 0-1- mice, an effect attenuated by 85, 93, and 90%, respectively, in CONV-Biota mice (Figure 2D). Because neutrophils play a key role in C. /e/ww ^' -mediated colitis, ² the status of neutrophil infiltration was determined using immunohistochemistry (IHC). CONV-Biota significantly reduced MPO positive neutrophil migration into the colon of C. jejuni infected II 10-1- mice (Figure 2E). In addition, fluorescence in situ hybridization (FISH) showed that while C. jejuni was present deeply in the inflamed crypts and in the lamina propria section of the intestine of ex GF II 10-/- mice, the bacterium was barely detectable (90% less) in colonic tissues of CONV-Biota 1110-/- mice (Figure 2F). Consistent with the FISH results, mice transplanted with CONV-Biota displayed reduced C. jejuni invasion in colonic tissue (by 99%) and MLN (nondetectable) compared to ex GF II 10-/- mice (Figure 2G). The inhibitory effect of CONV-Biota on campylobacteriosis and host responses resembled the effect seen with mTOR inhibition in 1110-/- mice. ⁸ Therefore, the effect of the microbiota on attenuation of C. yeyw -induced mTOR signaling was determined. Interestingly, C. jejuni induced mTOR downstream target p-p70S6k T389 and p-S6 (S235/236) in colonic tissues of ex-GF 1110-/- mice was attenuated in mice colonized with CONV-Biota (Figure 2H). To further document the cellular distribution of C. ye/wm ^' -induced mTOR signaling and the effect of CONV-Biota, p-S6 positive cells were determined using IHC. Notably, p-S6 accumulation was detected in both epithelial and lamina propria immune cells of C. jejuni infected ex-GF mice, whereas tissues of mice colonized with CONV-Biota displayed strong reduction in p-S6 staining (Figure 1 1). Collectively, the results demonstrated that C. jejuni exploits host mTOR signaling and inflammatory responses to invade colonic tissues, a process blocked by the CONV-Biota without decreasing C. jejuni luminal load.

EXAMPLE 17 - SPECIFIC GROUPS OF ANAEROBIC MICROBIOTA PROTECT AGAINST C. J L/UM- INDUCED COLITIS

To identify the core bacterial community within the microbiota that granted resistance to campylobacteriosis, microbiota compositions were compared between campylobacteriosis- resistant CONV-Biota (14-day conventionalization) and colitis-permissive microbiota (3-day conventionalization) (Figure 10) and correlated it with histological colitis level. Interestingly, PCoA analysis revealed distinct separation between microbiota from II 10-/- mice conventionalized for 3 (Light blue: severe colitis) and 14 days (Dark blue: mild colitis) (Figure 3A), whereas no differences in diversity and richness were observed between conditions (Figure 3 B-C). Further analysis showed that significant genera (FDR-P < 0.05) that were different between the 3 and 14 day groups were mostly anaerobic strains (Figure 3D and Table 2). However, no differences in Campylobacter relative abundance were detected. Table 2. Statistical test results for genera in CONV-Biota

mean mean colonizatio

colonizatio colonizatio colonizatio n duration cage n duration n duration n duration adjusted p- cage p- adjusted genus name 3 days 14 days p-value* value value** p-value

Lachnobacterium 0.146478 3.756295 2.26E-08 2.31 E-06 0.988163 0.997033

Turicibacter 3.517553 0.947312 3.63E-07 1.85E-05 0.988168 0.997033

Lactonifactor 0.257502 1.827835 2.45E-05 0.000833 0.988032 0.997033

Butyricicoccus 0 1.784723 0.000137 0.003497 0.987858 0.997033

Fusicatenibacter 0 1.733742 0.000256 0.00378 0.987872 0.997033

Guggenheimella 0.086501 1.41572 0.000259 0.00378 0.987942 0.997033

Romboutsia 3.289619 1.601 13 0.000246 0.00378 0.988346 0.997033

Catonella 0.176396 1.062049 0.000638 0.007991 0.988001 0.997033

Methylorosula 0 1.301035 0.000705 0.007991 0.512589 0.997033

Sporobacterium 0 1.083812 0.001756 0.017909 0.987886 0.997033

Enterococcus 3.914447 4.163683 0.0031 0.02875 0.474148 0.997033

Sharpea 0 0.448312 0.005086 0.04323 0.988539 0.997033

Murimonas 0 0.639763 0.006842 0.053687 0.987966 0.997033

Campylobacter 3.918409 3.45661 1 0.008755 0.063788 0.988024 0.997033

Acetitomaculum 0 0.650167 0.010926 0.07004 0.548121 0.997033

Atopobacter 0.295537 0 0.012237 0.07004 0.987818 0.997033

Melissococcus 0.266028 0.839328 0.01 1713 0.07004 0.988642 0.997033

Paenibacillus 1.627173 0.050475 0.01236 0.07004 0.822291 0.997033

Vagococcus 0.91 1 194 1.203469 0.017935 0.096281 0.460283 0.997033

Bacillus 1.264614 0.478786 0.021409 0.109188 0.988618 0.997033

Corynebacterium 0.47278 0.065708 0.026 0.126286 0.994854 0.997033

Acetatifactor 0 0.410546 0.035436 0.163277 0.988916 0.997033

Pseudobutyrivibrio 0 0.326597 0.036817 0.163277 0.987819 0.997033

Bradyrhizobium 0.254917 0 0.046033 0.195642 0.250795 0.997033

Sporanaerobacter 0 0.388902 0.057865 0.236089 0.99486 0.997033

Bacteroides 0.16372 0 0.080675 0.264092 0.987897 0.997033

Catenibacterium 0 0.383133 0.0763 0.264092 3.17E-09 3.23E-07

Haloquadratum 0.171898 0 0.090154 0.264092 0.988624 0.997033

Intestinibacter 2.090688 2.277703 0.068295 0.264092 0.989079 0.997033

Methanomicrobium 0.148931 0 0.077263 0.264092 0.988533 0.997033

Oceanotoga 0 0.339738 0.085951 0.264092 0.750607 0.997033

Parasporobacterium 0 0.143531 0.078425 0.264092 0.988615 0.997033

Propionibacterium 0.21891 1 0.050475 0.08448 0.264092 0.241205 0.997033

Thermacetogenium 0 0.180362 0.081627 0.264092 0.987939 0.997033

Vulcanibacillus 0.233021 0 0.09062 0.264092 0.82931 0.997033

Pacearchaeota.Incertae.Sedis.AR

13 0.287601 0 0.097542 0.27637 0.988422 0.997033

Aeribacillus 0 0.114654 0.18516 0.331512 0.987851 0.997033

Akkermansia 0.118924 0 0.177352 0.331512 0.987826 0.997033

Calderihabitans 0 0.1 19246 0.180912 0.331512 0.188595 0.997033

Caminicella 0 0.075128 0.178837 0.331512 0.987831 0.997033

Candidatus.Anammoxoglobus 0.122302 0 0.193262 0.331512 0.987881 0.997033

Cetia 0 0.203891 0.206824 0.331512 0.296068 0.997033

Dehalobacter 0 0.101636 0.206448 0.331512 0.987937 0.997033 Table 2. Statistical test results for genera in CONV -Biota

mean mean colonizatio

colonizatio colonizatio colonizatio n duration cage n duration n duration n duration adjusted p- cage p- adjusted genus name 3 days 14 days p-value* value value** p-value

Dehalospirillum 0 0.1 19246 0.180912 0.331512 0.188595 0.997033

Eisenbergiella 0.098304 0 0.176777 0.331512 0.172826 0.997033

Fuchsiella 0.104829 0 0.175593 0.331512 0.987821 0.997033

Geosporobacter 0 0.101636 0.206448 0.331512 0.987937 0.997033

Hungatella 0.055469 0.400972 0.127965 0.331512 0.000864 0.029359

Isobaculum 0.104829 0 0.175593 0.331512 0.987821 0.997033

Kandleria 0 0.194735 0.140508 0.33 1512 0.987859 0.997033

Ktedonobacter 0 0.1 14654 0.18516 0.331512 0.987851 0.997033

Lachnospiracea incertae sedis 0 0.078749 0.181903 0.331512 0.192443 0.997033

Lactobacillus 0.093462 0 0.175145 0.331512 0.98782 0.997033

Lutispora 0 0.097648 0.179472 0.33 1512 0.987833 0.997033

Mahella 0 0.174522 0.174714 0.331512 0.987818 0.997033

Mobilitalea 0 0.143899 0.208007 0.331512 0.301259 0.997033

Natribacillus 0 0.184643 0.191626 0.331512 0.231412 0.997033

Owenweeksia 0.104136 0 0.175824 0.331512 0.16926 0.997033

Oxobacter 0 0.121093 0.176621 0.331512 0.172242 0.997033

Paraeggerthella 0 0.107971 0.187044 0.331512 0.987858 0.997033

Stenoxybacter 0 0.098573 0.203085 0.331512 0.279807 0.997033

Terrisporobacter 0 0.075128 0.178837 0.331512 0.987831 0.997033

Wandonia 0 0.143516 0.188306 0.331512 0.987862 0.997033

Woesearchaeota. Incertae. Sedis. A

R15 0.104829 0 0.175593 0.331512 0.987821 0.997033

Cronobacter 0 0.10661 0.21 1792 0.33235 0.317982 0.997033

Sporobacter 0.055469 0.20655 0.217393 0.335971 0.987971 0.997033

Coprococcus 0. 108151 0.3731 19 0.243229 0.370289 0.027095 0.690927

Asaccharospora 0.967445 1.101479 0.278212 0.417318 0.853677 0.997033

Solobacterium 0.078436 0.230599 0.295684 0.437098 0.047866 0.976456

Abiotrophia 0.152715 0.032865 0.309497 0.44105 0.987943 0.997033

Alloiococcus 0 0.068771 0.363217 0.44105 0.985443 0.997033

Anaerotruncus 0 0.093812 0.363217 0.44105 0.985443 0.997033

Aquihabitans 0 0.151743 0.363217 0.44105 0.997033 0.997033

Candidatus. Carsonella 0.153496 0.306259 0.326826 0.44105 0.84555 0.997033

Desulfospira 0.077506 0 0.363217 0.44105 0.985443 0.997033

Jhaorihella 0.098074 0 0.363217 0.44105 0.985443 0.997033

Parvimonas 0.086501 0 0.363217 0.44105 0.985443 0.997033

Phycisphaera 0.077506 0 0.363217 0.44105 0.985443 0.997033

Robinsoniella 0.099207 0 0.363217 0.44105 0.993439 0.997033

Saccharibacter 0.230072 0 0.363217 0.44105 0.993439 0.997033

Sediminibacter 0 0.088131 0.363217 0.44105 0.985443 0.997033

Succinispira 0 0.10339 0.363217 0.44105 0.993439 0.997033

Succinivibrio 0.077506 0 0.363217 0.44105 0.985443 0.997033

Tuberibacillus 0.055469 0.15775 0.319441 0.44105 0.98798 0.997033

Marvinbryantia 0.154677 0.045883 0.369171 0.443005 0.325753 0.997033

Staphylococcus 0.391503 0.228572 0.386578 0.4585 0.987875 0.997033 Table 2. Statistical test results for genera in CONV-Biota

Notes: * using t-test;

** usig anova on linear mixed effect with cage versus linear mixed effect without

Cage

To functionally dissect the microbial population within the CONV-Biota providing protection against C. jejuni infection, the CONV-Biota were cultured under aerobic, microaerobic or anaerobic conditions using Brain Heart Infusion (BHI) agar plates. GF II 10- /- mice were then colonized with the respective microbiota and 14 days later we infected the mice with a single dose of C. jejuni and then measured inflammation 12 days later. Consistent with previous observations, ⁶ C. jejuni induced severe intestinal inflammation in GF II 10-/- mice (Figure 4A and B). II 10-/- mice pre-colonized with either aerobic (Aero- Biota) or microaerobic (Microaero-Biota) microbes also developed severe and comparable intestinal inflammation following C. y ^' e/ww ^' infection. In contrast, mice colonized with anaerobic microbes (Anaero-Biota) were protected against C. jejimi-induced intestinal inflammation, while C. jejuni luminal colonization level was comparable between mice colonized with Aero- and Anaero-Biota (Figure 4C). In addition, the protective effect was also observed in mice colonized with the three microbial groups pooled together. Consistent with colitis difference, C. jejuni induced stronger proinflammatory gene expression of III β, Cxcl2 and 1117a mR A in colonic tissue of mice colonized with Aero-Biota compared to mice colonized with Anaero-Biota (Figure 4D).

To investigate the select group of microbes within the Anaero-Biota that played a protective role against campylobacteriosis, 16S rDNA sequencing was performed using fecal samples of mice pre-colonized with Anaero- or Aero-Biota and infected with C. jejuni. PCoA analysis revealed distinct separation between Anaero- or Aero-Biota -reconstituted II 10-/- mice, and also between pre- and post- C. jejuni infection (Figure 4E). T-test was used to compare Aero- and Anaero-Biota mice, and the eight genera of Bifidobacterium, Clostridium XI, Butyricicoccus, Lactobacillus, Roseburia, Hydrogenoanaerobacterium, Coprobacillus, and Oscillibacter were found to be significantly increased in the protected Anaero-Biota- colonized II 10-/- mice compared to susceptible Aero-Biota-colonized II 10-/- mice (Figure 4F, Table 3), while two genera of Enter coccus and Clostridium sensu stricto were increased in susceptible Aero-Biota mice. Importantly, Campylobacter (red) relative abundance was not significantly different between Anaero- or Aero-Biota-colonized II 10-/- mice (Figure 4F), providing a culture-independent validation that C. jejuni colonization resistance was not the main mechanism by which Anaero-Biota protects against C. jejuni-induced colitis. Importantly, five (green color and Table 3) of the eleven genera, significantly different between Aero- and Anaero-Biota were typically associated with an anti-inflammatory response ^42"45 and generated a range of metabolites including bile acid derivatives and short chain fatty acids ^46"51 . Limited or conflicted information is currently available on the role of the other six bacterial genera.

Beyond their role in digestion, bile acids participate in numerous physiological processes through their ability to activate various signaling pathways such as the farnesoid X receptor, the vitamin D receptor, and the pregnane X receptor. ⁵⁰ In addition, bile acids play an important anti-inflammatory role in the intestine. ⁵¹ Because the genera Clostridium XI, Bifidobacterium, and Lactobacillus biotransform bile acids from conjugated (e.g. taurocholic acid, TCA) into primary, e.g., cholic acid (CA) and then to secondary forms, e.g., deoxycholic acid, DCA), the five bile acid profile was measured in the stool of GF, Aero- Biota or Anaero-Biota pre-colonized, C. ye ww ^' -infected mice using HPLC/MS. In accordance with previous reports, ⁵² bile acids of GF mice mainly consisted of the conjugated bile acid TCA. Interestingly, DCA and UDCA, but not the primary bile acid (CA), were depleted in Aero-Biota colonized and C. jejuni- infected mice (Figure 4G, Table 4), suggesting a potential protective role of these secondary bile acids in biota-mediated protection.

Table 3. Model results for all genera in Aero- and Anaero-Biota

Notes: Aero - Aaerobic microbiota, Anaero - Anaerobic microbiota.

Table 4. Bile acid profiles

Extracted ion intensity Relative bile acids, %

Treatment Mice TCA CA LCA UDCA DCA sum TCA CA LCA UDCA DCA sum

Germ free-1 86448 0 0 0 0 86448 100.00 0.00 0.00 0.00 0.00 100

Germ free-2 78600 0 0 0 0 78600 100.00 0.00 0.00 0.00 0.00 100

Germ free-3 22424 0 0 0 0 22424 loo.oo 0.00 0.00 0.00 0.00 100

Germ free-4 139968 0 0 0 0 139968 100.00 0.00 0.00 0.00 0.00 100

Germ free-S 618112 0 0 0 0 618112 loo.oo 0.00 0.00 0.00 0.00 100

Germ free-6 352128 0 0 0 0 352128 loo.oo 0.00 0.00 0.00 0.00 loo

Germ free-7 421952 0 0 0 0 421952 100.00 0.00 0.00 0.00 0.00 100

Germ free-8 57872 0 0 0 0 57872 100.00 0.00 0.00 0.00 0.00 100

Germ free-9 67992 0 0 0 0 67992 100.00 0.00 0.00 0.00 0.00 100

Germ free-10 54712 0 0 0 0 54712 loo.oo 0.00 0.00 0.00 0.00 loo

SPF-1 892 8922 0 8001 66808 84623 1.05 10.54 0.00 9.45 78.95 100

SPF-2 75 1 12469 0 1652 9635 24507 3.06 50.88 0.00 6.74 39.32 100

SPF-3 1038 3335 0 2727 18728 25828 4.02 12,91 0.00 10.56 72.51 100 Table 4. Bile acid profiles

Extracted ion intensity Relative bile acids, %

Notes * Severe colitis, no detectable bile acids; TCA - taurocholic acid, CA - holic acid, LCA - lithocholic acid, UDCA - ursodeoxycholic acid, DCA - deoxycholic acid; SPF- specific pathogen free; Aero - Aaerobic microbiota, Anaero - Anaerobic microbiota.

EXAMPLE 18 - DCA, MICROBIAL METABOLITE OF SECONDARY BILE ACID, PROTECTS AGAINST C COLITIS

We previously reported that rapamycin-treated II 10-1- mice do not develop campylobacteriosis, and observed that CONV-Biota inhibited C. y ^' e ww ^' -induced mTOR signaling in colonic tissue (Figure 2H and Figure 11). Therefore, it was determined whether secondary bile acids, metabolites of the Anaero-Biota derived from CONV-Biota (Figure 4G), could block the important inflammatory signaling pathway. It was shown that C. jejuni- induced mTOR signaling pathway in primary splenocytes isolated from II 10-/- mice ⁸ , and this cell system was used to test effect of CA and DCA on this pathway. Notably, secondary bile acid DCA but not primary bile acid CA inhibited C. ye/urn ^' -induced mTOR downstream target phosphor-p70S6K (Figure 5A). To functionally assess the potentially protective effect of secondary bile acids against C. jejuni-mduc d colitis, DCA, UDCA and LCA were gavaged to GF II 10-/- mice infected with C.jejuni. DCA was also gavaged to mice previously infected with C. jejuni for 5 days to evaluate treatment effect. Remarkably, both DCA prevention and treatment approaches 1110-/- mice exposed to UDCA and LCA (prevention) still developed colitis (Figure 6A and B). In addition, DCA strongly attenuated C. jejuni- induced proinflammatory gene expression of 111 β, Cxcl2 and 1117a mR A in colonic tissue, while UDCA exacerbate the mRNA accumulation (Figure 6C). To further assess the protective role against campylobacteriosis, SPF 1110-/- mice were treated with clindamycin, an antibiotic especially efficient against anaerobic bacteria, ^~ including bile acid producing bacteria. Clindamycin-treated 1110-/- mice were susceptible to C. ye ww-induced colitis, whereas mice exposed to nalidixic acid, an antibiotic predominantly targeting gram negative

53 *

bacteria, remained resistant to infection (Figure 7A and B). Using HPLC/MS analysis, it was determined that clindamycin treatment depleted all secondary bile acids, especially DCA, while nalidixic acid only reduced CA but failed to decrease DCA levels compared to SPF mice (Figure 7C, Table 4). EXAMLPE 19 -

It is disclosed herein that the commensal intestinal microbiota prevents C. jejuni- induced intestinal inflammation in ex-GF 1110-/- mice, an effect independent of pathogen luminal colonization level. Molecular and cellular analysis showed that the microbiota reduced C. j ^' e/ww ^' -induced epithelial and lamina propria mTOR activation, inflammatory cytokine expression, neutrophil infiltration and C. jejuni invasion into colon tissue. Culture and fecal transplantation experiments identified anaerobic commensal microbiota as main protective contributors against C. jejuni infection. 16S rDNA sequencing in conjunction with HPLC/MS analysis identified DCA produced by a specific group of anaerobic bacteria as the mechanism protecting the host against C. jejuni infection. Direct supplementation of DCA to ex-GF mice protected against C. y ^' e «m-induced colitis while targeted depletion of secondary bile acid-producers with the antibiotic clindamycin promoted campylobacteriosis in SPF II 10- /- mice. These findings disclosed a novel mechanism by which biota-derived metabolites (e.g. DCA) control resistance to C. jejuni infection by blocking activation of mTOR signaling. Importantly, microbiota-derived protection against C. jejuni pathogenesis operated independent of luminal colonization exclusion. Clearly, the presence of a conventionalized microbiota prevented C. jejuni invasion into intestinal mucosal tissues and MLN, but this response was not accompanied by a reduced level of luminal C. jejuni. This is in contrast with microbiota protection against C. difficile, ³² Citrobacter rodentium ⁵⁴ and Salmonella typhimurium ⁵⁵ infections. In these models, colonization resistance was the main mechanism because the microbiota prevented pathogenic bacterial growth and reduced luminal colonization. Microbiota could control susceptibility to enteropathogen infection by targeting various host-mediated signaling pathways. Indeed, gut pathogens exploit various host signaling events to circumvent microbiota inhibitory effects. For example, S. typhimurium induced host-driven production of a new electron acceptor tetrathionate and used the respiration to outgrow gut microbiota. ⁵⁶ Similarly, Escherichia coll utilized nitrate generated during the inflammatory response to expand its niche in the gut lumen. ⁵⁷ These enteric pathogens "fed" on inflammation to gain a competitive growth advantage over an established commensal microbial community to break colonization resistance. ^56"59 Unlike these strategies, C. jejuni exploited mTOR signaling to again access and invade mucosal tissues and MLN, a process antagonized by microbiota through decreased mTOR activation and downstream targets p-p70S6K and p-S6 in both intestinal epithelial and lamina propria cells. It was not clear why C. jejuni targeted or what the mechanism of mTOR signaling activation was. mTOR mediates innate signaling important in autophagy and bacterial clearance ⁶⁰ and targeting this pathway is expected to provide C. jejuni a survival advantage. It was previously shown that blocking mTOR signaling with rapamycin prevented C y ^' e/«w ^' -induced colitis and tissue invasion, although pathogen luminal load was not reduced. ⁸ The instant disclosures that the microbial metabolite DCA attenuated the C. j ^' e w ^' -induced mTOR downstream target p- p70S6K in colonic tissues and immune cells clearly highlight the importance of mTOR in enteric infection. Interestingly, bacterial product-induced mTOR signaling is dysregulated in II 10-/- mice and lead to colitis, a phenomenon due to decreased expression of the mTOR inhibitor DNA-damage-inducible transcript 4 protein (DDIT4). ⁶¹

Microbial-derived metabolism is a novel concept for host-resistance/susceptibility to enteropathogen infection. For example, microbial-derived tryptophan catabolism leading to generation of aryl hydrocarbon receptor (AhR) ligand has emerged as an important part of host-microbe interaction in infectious diseases. ⁶² Furthermore, bacterial-derived bile acid metabolites have been recently recognized as important modulators of C. difficile infection susceptibility. ⁶³ For example, anaerobic bacterium C. scindens transformed primary bile acids to secondary ones, which prevented C. difficile germination and growth, despite the bile acids' association with various chronic diseases. ^33-35 In vitro, secondary bile acids LCA and DCA but not primary bile acid CA inhibited C. difficile vegetable growth and toxin production. ³² ' ⁶⁴ However, whether secondary bile acids prevented or treated CDI in human or animal models is still unknown. In the instant disclosures secondary bile acids were directly supplemented to C. yeyw« -infected mice and it was determined that only the secondary bile acid DCA prevented and treated C. jejuni-m ^' duced colitis. Unlike C. difficile, C. jejuni growth was not impaired in medium containing DCA at concentrations as high as 0.2%, which is the upper limit of physiological range. ⁶⁵ Thus, the beneficial impact of DCA on campylobacteriosis was not mediated by impaired C. jejuni growth.

Taken together, the data revealed that the microbial metabolite secondary bile acid DCA attenuated campylobacteriosis through inhibition of C. jejuni-mdnced host inflammatory mTOR signaling. The results highlight the complex mechanism by which the microbiota controls host susceptibility to specific enteropathogen infection, and point to novel therapeutics approaches by targeting those microbial metabolites. EXAMPLE 20 - HUMAN CLINICAL ISOLATE C. JEJUNI 81-176 PROMOTES COLORECTAL TUMORIGENESIS AND TUMOR GRWOTH IN MICE

To assess a potential link between Campylobacter and colorectal cancer in human, mucosal 16S rRNA gene sequences were retrieved from samples taken at different stages of colorectal tumori genesis ²⁷ . The data were analyzed and confirmed a significantly higher abundance of Campylobacter in both carcinoma and its adjacent tissue compared to normal tissue (Figure 18).

To define the tumorigenesis potential of C jejuni, germ-free (GF) Apc ^Mm/+ mice were transferred to specific-pathogen-free (SPF) environment, colonized with human clinical isolate C. jejuni 81-176 (10 ⁵ cfu/oral gavage) or PBS alone (control group). Fourteen days later, mice were exposed to 1% dextran sulfate sodium (DSS) for 10 days and euthanized 3 weeks post-DSS treatment as illustrated in Figure 12A. Colonoscopy revealed presence of large tumors in the distal colon of C. yey ^' ww ^' -infected mice (Figure 12B). Upon euthanasia, the colons of C. e wn -infected mice displayed increased tumor number compared to the control group (Figures 12C-D). Enumeration of tumors in both groups showed significantly higher number of tumors (10.7 vs 4.0, P=0.025) with higher percentage of large tumors (percentage of tumors with diameter > 3mm: 77% (54/75) vs 43% (9/21), P=0.0\3) in C. jejuni-Mectcd mice compared to the control group (Figure 12E, Figure 19). Interestingly, there was no significant difference in histologic inflammation between mice in C. j ^' e/ww-infected group and control group (Figure 12F). However, increased presence of proliferating cell nuclear antigen (PCNA) and nuclear β-catenin were observed in colonic mucosa from C. jejuni- infected mice compared to those from control mice (Figure 12G). Taken together, these data indicated that the human clinical isolate C. jejuni 81-176 promoted colorectal tumorigenesis and tumor growth in mice.

EXAMPLE 21 - THE CDT SUBUNIT CDTB IS CRITICAL FOR C. JEJUNI INDUCED DNA DAMAGE IN VITRO

To define the mechanism of C. jejuni-mduced colorectal tumorigenesis, a cdtB mutant

C. jejuni 81-176 strain {mutCdtB) was engineered by electroporating an inactivated cdtB allele to C. jejuni 81 -176 wide type strain (C. jejuni-WT). To test the effect of C. jejuni mutCdtB (C. jejuni 81 -176 harboring cdtB mutant allele) on DNA damage, bacterial lysates from C. jejuni wide type and C. jejuni mutCdtB were prepared and non-transformed rat small intestine epithelial cell lines, IEC-6 and human colon cancer cell line, HT-29 were exposed to these extracts (5ng/ml) for 24 h. Extracts from C. jejuni increased phosphorylated histone H2AX (γΗ2ΑΧ), a surrogate marker for DNA damage in both IEC-6 cells and HT-29 cells when compared to un-treated cells (Figure 13 A). Interestingly, γΗ2ΑΧ induction was attenuated in cells exposed to lysates generated from C. jejuni mutCdtB (Figure 13A). Flow cytometry quantification revealed a decreased of -70% γΗ2ΑΧ staining in IEC-6 cells and -90%) in HT-29 cells exposed to lysates from C. jejuni-WT when compared to cells exposed to C. jejuni mutCdtB lysates (Figure 13B). Moreover, comet assay, a measurement of DNA damage showed that while bacterial lysates from C jejuni-WT promote DNA damage, this response was strongly attenuated in cells exposed to lysates from C. jejuni mutCdtB (Figure 13C). Finally, cell cycle assay revealed that while C. jejuni-WT promotes G2/M cell cycle arrest, cell exposed to extracts from C. jejuni mutCdtB failed to generate a similar response (Figure 13D). In addition, cultured enteroids were used to further evaluate the effect of cdtB on DNA damage in primary intestinal cells. Exposure of enteroids cells to C. jejuni lysates enhanced γΗ2ΑΧ phosphorylation compared to control cells, while this response was attenuated in cells exposed to C. jejuni mutCdtB (Figure 13E). These findings demonstrate that cdtB plays an important role in C. ye/wm ^' -induce DNA damage and cell cycle arrest in vitro.

EXAMPLE 22 - C. JEJUNI 81-176 INDUCED TUMORIGENESIS IN APC ^{M1N +} /DSS MICE REQUIRES FUNCTIONAL CDTB

To evaluate the role of cdtB in C. jejuni-mduced tumorigenesis in vivo, GF Apc ^{M,n +} mice were transferred to SPF environment, infected with C. jejuni-WT or C. jejuni mutCdtB via oral gavage (10 ⁵ cfu/mouse) and assessed tumor development (Figure 14A). Colonoscopy showed that there were less and smaller tumors in the distal colons from C. jejuni mutCdtB infected mice compared to C. jejuni-WT infected mice (Figure 14B). Upon euthanasia, the colons from C. jejuni mutCdtB infected mice displayed a reduced number of tumors compared to the colons from C. jejuni-WT infected mice (Figures 14C-D). Enumeration of tumors in both groups showed that significantly lower number of tumors (2.9 vs 9.6, PO.0001) with less percentage of bigger tumor (percentage of tumors with diameter > 3mm: 15.4% vs 58.2%, PO.0001) in C jejuni mutCdtB infected mice compared to the mice infected with C. jejuni-WT (Figure 14E, Figure 20). Concomitant to this phenotype, the colonic mucosa of C. jejuni mutCdtB infected mice showed attenuated level of PCNA and nuclear β-catenin compared to mice infected with C. jejuni-WT (Figure 14G). Importantly, cdtB mutation did not impair the colonic inflammation, colonization and invasion ability of C. jejuni in vivo (Figures 14F, H-I), suggesting that decreased tumorigenesis ability of . jejuni mutCdtB was not due to impaired bacterial colonization or decreased colitis. Overall, these data indicate that cdtB is critical for C. jejuni-m ^' duced tumorigenesis in vivo.

EXAMPLE 23 - TUMORIGENESIS ABILITY OF C. JEJUNI IS ASSOCITAED WITH ALTERATION OF HOST GENE EXPRESSION AND GUT MICROBIOTA TRANSCRIPTOMES

To determine the impact of C. jejuni and its CDT toxicity on host and microbial gene expression, RNA was extracted from flanking normal distal colons from control mice (n=3), C. jejuni-WT infected mice (n=3) and C. jejuni mutCdtB infected mice (n=3) and RNA-seq analysis was performed using Illumina HiSeq 3000 platform. Principal component analysis (PCA) revealed that the mouse transcriptomes of C. jejuni-WT but not C. jejuni mutCdtB- infected mice were different from those of control mice (P<0.05) (Figures 15A-B). Even though no significant difference was observed in mouse transcriptomes between mice infected C. jejuni-WT and C. jejuni mutCdtB, 22 genes differentially expressed between C. jejuni-WT infected mice and C. jejuni mutCdtB infected mice were still observed (Figure 15C), with 15 genes up-regulated and 7 genes down-regulated in C. jejuni-WT infected mice. These genes were involved in chemotaxis (Cxcll, Cxcl9 and CxcllO), immunoglobulin production (Ighvl-39, Ighvl-81, Ighv6-3, Ighv7-3, Ighv8-12, Ighvl4-3, Igkvl-110, Igkv8-27 and IgL· 10-94) and anti-infection response (Gbp4, Tgtpl and Tgtpl). Furthermore, KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analysis showed that some common carcinogenic pathways were enriched in C. jejuni-WT infected mice compared to control group and mice infected with C. jejuni mutCdtB (Figures 15D-F). Steroid hormone synthesis pathway, peroxisome proliferator-activated receptors (PPARs) signaling pathway and calcium signaling pathway were differently expression among these groups (Figures 15D-F).

Interestingly, PPARs signaling pathway and calcium signaling pathway were not enriched in C. jejuni mutCdtB infected mice when compared to the controls (Figure 15E), indicating that the enrichment of these two carcinogenic signaling pathways could be due to the effect of cdtB. Microbial gene expression was defined using the same RNA-seq data described above. In contrast to mammalian transcriptomic response, microbial transcriptomic profiles were significantly different between C. jejuni-WT and C. jejuni mutCdtB infected mice (Figures 16A-C). Collectively, C. jejuni infection changed gene expression profiles in host, and also affected microbiota transcriptome during colorectal tumorigenesis process.

EXAMPLE 24 - ALTERATION OF GUT MICROBIOTA COMPOSITION IS ASSOCIATED WITH C. JEJUNI TUMORIGENESIS CAPACITY

To investigate the interaction between C. jejuni and gut microbiota composition, 16S rRNA gene sequencing was performed using fecal samples collected from control group, C. jejuni-WT group and C. jejuni mutCdtB group. Principal coordinates analysis (PCoA) showed that the compositions of microbiota in these three groups were significantly different when compared to each other (C. jejuni-WT vs control: P=0.009; C. jejuni mutCdtB vs control: O.OOOl ; C. jejuni-WT vs C. jejuni m tCdtB: PO.0001) (Figures 16D-F). Comparing microbiota compositions in C. jejuni-WT group and C. jejuni niCdtB group, 70 OTUs with different relative abundance were found, which included the enrichment of Lactobacillaceae, Bacteroidaceae, Enter ococcaceae, S24-7, but depletion of Turicibacteraceae and Lachnospiraceae in the mice infect with C. jejuni-WT (all FDR adjusted-^0.05) (Figure 16G). Overall, microbial composition and transcriptome were sensitive to the presence of C. jejuni, with some of these changes under the influence of cdtB.

EXAMPLE 25 - RAPAMYCIN ALLEVIATES C. JEJUNI-PROMOTED COLORECTAL TUMORIGENESIS AND TUMOR GROWTH IN APC ^MIN+ /DSS MICE

C. jejuni induced colitis has been shown to dependent on activation of mammalian target of rapamycin (mTOR) signaling in GF III 0 ^~f' mice ^{23, 25} . To explore the impact of mTOR signaling on C. jejuni-m ^' duccd carcinogenesis, GF Apc ^{Mm +} mice infected with C. jejuni were intraperitoneally injected with rapamycin (1.5mg/kg body weight) daily for 14 days and subsequently exposed to 1% DSS for 10 days, after which mice were euthanized 3 weeks post-DSS treatment (Figure 17A). Colonoscopy demonstrated that less visible tumors in rapamycin-treated mice compared to control mice (Figure 17B). The colons of rapamycin- treated mice showed reduced tumorigenesis compared to control group (Figures 17C-D). Enumeration of tumors showed significant lower numbers of tumors (1.3 vs 5.1 , P=0.008, Fi gure 17E) with lower percentage of large tumors (percentage of tumors with diameter > 3mm: 10% (1/10) vs 48.8% (20/41), =0.034, Figure 21) in rapamycin-treated mice compared to the control group. Rapamycin did not affect the severity of colon inflammation (Figure 17F). Importantly, rapamycin attenuated level of PCNA and nuclear β-catenin of colonic mucosa (Figure 17G). These effects correlated with lower p-S6 (S235/236) level, a down-stream target of mTOR signaling in colonic tissues of rapamycin-treated mice (Figure 17H). In addition, consistent with a previous report ²³ , rapamycin did not affect C. jejuni luminal colonization levels (Figure 171). Collectively, these findings demonstrated that C. jejuni promoted tumorigenesis in Apc ^Mln/+ /OSS mice through the action of CdtB, a process under the control of mTOR signaling. All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.

REFERENCES

1. Lippert E, Karrasch T, Sun X, et al. Gnotobiotic IL-10; NF-kappaB mice develop rapid and severe colitis following Campylobacter jejuni infection. PLoS One 2009;4:e7413.

2. Sun X, Liu B, Sartor RB, et al. Phosphatidylinositol 3-kinase-gamma signaling promotes Campylobacter jejuni-induced colitis through neutrophil recruitment in mice. J

Immunol 2013;190:357-65.

3. Siegel RL, Miller KD, Jemal A. Cancer Statistics, 2017. CA Cancer J Clin 2017;67:7- 30.

4. Schwabe RF, Jobin C. The microbiome and cancer. Nat Rev Cancer 2013; 13:800-12. 5. Sears CL, Garrett WS. Microbes, microbiota, and colon cancer. Cell Host Microbe

2014;15:317-28.

6. Garrett WS. Cancer and the microbiota. Science 2015;348:80-6.

7. Wu N, Yang X, Zhang R, et al. Dysbiosis signature of fecal microbiota in colorectal cancer patients. Microb Ecol 2013;66:462-70.

8. Borges-Canha M, Portela-Cidade JP, Dinis-Ribeiro M, et al. Role of colonic microbiota in colorectal carcinogenesis: a systematic review. Rev Esp Enferm Dig 2015;107:659-71.

9. Warren RL, Freeman DJ, Pleasance S, et al. Co-occurrence of anaerobic bacteria in colorectal carcinomas. Microbiome 2013; 1 : 16.

10. Allah I, Delgado S, Marron PI, et al. Gut microbiome compositional and functional differences between tumor and non-tumor adjacent tissues from cohorts from the US and Spain. Gut Microbes 2015;6: 161-72.

1 1. Arthur JC, Perez-Chanona E, Muhlbauer M, et al. Intestinal inflammation targets cancer-inducing activity of the microbiota. Science 2012;338: 120-3.

12. Arthur JC, Gharaibeh RZ, Muhlbauer M, et al. Microbial genomic analysis reveals the essential role of inflammation in bacteria-induced colorectal cancer. Nat Commun 2014;5:4724.

13. Tomkovich S, Yang Y, Winglee K, et al. Locoregional Effects of Microbiota in a Preclinical Model of Colon Carcinogenesis. Cancer Res 2017;77:2620-2632.

14. Dejea CM, Fathi P, Craig JM, et al. Patients with familial adenomatous polyposis harbor colonic biofilms containing tumorigenic bacteria. Science 2018;359:592-597.

15. Lara-Tejero M, Galan JE. A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein. Science 2000;290:354-7. 16. Guerra L, Cortes-Bratti X, Guidi R, et al. The biology of the cytolethal distending toxins. Toxins (Basel) 201 1 ;3:172-90.

17. Bezine E, Vignard J, Mirey G. The cytolethal distending toxin effects on Mammalian cells: a DNA damage perspective. Cells 2014;3:592-615.

18. Brauner A, Brandt L, Frisan T, et al. Is there a risk of cancer development after Campylobacter infection? Scand J Gastroenterol 2010;45:893-7.

19. Janes MR, Fruman DA. Immune Regulation by Rapamycin: Moving Beyond T Cells. Science Signaling 2009;2:pe25-pe25.

20. Weichhart T, Saemann MD. The PI3K7Akt/mTOR pathway in innate immune cells: emerging therapeutic applications. Annals of the Rheumatic Diseases 2008;67:iii70-iii74.

21. Gomez-Cambronero J, Horn J, Paul CC, et al. Granulocyte -macrophage colony- stimulating factor is a chemoattractant cytokine for human neutrophils: involvement of the ribosomal p70 S6 kinase signaling pathway. J Immunol 2003; 171 :6846-55.

22. Sun X, Threadgill D, Jobin C. Campylobacter jejuni induces colitis through activation of mammalian target of rapamycin signaling. Gastroenterology 2012;142:86-95 e5.

23. Stahl M, Ries J, Vermeulen J, et al. A novel mouse model of Campylobacter jejuni gastroenteritis reveals key pro-inflammatory and tissue protective roles for Toll-like receptor signaling during infection. PLoS Pathog 2014;10:el004264.

24. Sun X, Jobin C. Nucleotide-binding oligomerization domain-containing protein 2 controls host response to Campylobacter jejuni in 1110-/- mice. J Infect Dis 2014;210: 1 145-

54.

25. Deshmukh HS, Liu Y, Menkiti OR, et al. The microbiota regulates neutrophil homeostasis and host resistance to Escherichia coli Kl sepsis in neonatal mice. Nat Med 2014.

26. Khosravi A, Yanez A, Price JG, et al. Gut microbiota promote hematopoiesis to control bacterial infection. Cell Host Microbe 2014;15:374-81.

27. Fukuda S, Toh H, Hase K, et al. Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature 201 1 ;469:543-7.

28. Ubeda C, Djukovic A, Isaac S. Roles of the intestinal microbiota in pathogen protection. Clin Transl Immunology 2017;6:el28.

29. Ivanov, II, Atarashi K, Manel N, et al. Induction of intestinal Thl7 cells by segmented filamentous bacteria. Cell 2009;139:485-98. 30. Satoh-Takayama N, Vosshenrich CA, Lesjean-Pottier S, et al. Microbial flora drives interleukin 22 production in intestinal NKp46+ cells that provide innate mucosal immune defense. Immunity 2008;29:958-70.

31. Silverman MS, Davis I, Pillai DR. Success of self-administered home fecal transplantation for chronic Clostridium difficile infection. Clin Gastroenterol Hepatol

2010;8:471-3.

32. Buffie CG, Bucci V, Stein RR, et al. Precision microbiome reconstitution restores bile acid mediated resistance to Clostridium difficile. Nature 2015;517:205-8.

33. Ma H, Patti ME. Bile acids, obesity, and the metabolic syndrome. Best Pract Res Clin Gastroenterol 2014;28:573-83.

34. Bernstein C, Holubec H, Bhattacharyya AK, et al. Carcinogenicity of deoxycholate, a secondary bile acid. Arch Toxicol 201 1 ;85:863-71.

35. Blackler RW, De Palma G, Manko A, et al. Deciphering the pathogenesis of NSAID enteropathy using proton pump inhibitors and a hydrogen sulfide-releasing NSAID. Am J Physiol Gastrointest Liver Physiol 2015;308:G994-1003.

36. Xie J, Wang X, Proud CG. MTOR inhibitors in cancer therapy. F 1 OOOResearch 2016, 5:2078.

37. Uronis JM, Arthur JC, Keku T, et al. Gut microbial diversity is reduced by the probiotic VSL#3 and correlates with decreased TNBS-induced colitis. Inflamm Bowel Dis 201 1 ;17:289-97.

38. Arthur JC, Perez-Chanona E, Muhlbauer M, et al. Intestinal inflammation targets cancer-inducing activity of the microbiota. Science 2012;338: 120-3.

39. Blaser MJ. Epidemiologic and clinical features of Campylobacter jejuni infections. J Infect Dis 1997;176 Suppl 2:S103-5.

40. van Spreeuwel JP, Duursma GC, Meijer CJ, et al. Campylobacter colitis: histological immunohistochemical and ultrastructural findings. Gut 1985;26:945-51.

41. Scherer M, Gnewuch C, Schmitz G, et al. Rapid quantification of bile acids and their conjugates in serum by liquid chromatography-tandem mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 2009;877:3920-5.

42. Underwood MA, Arriola J, Gerber CW, et al. Bifidobacterium longum subsp. infantis in experimental necrotizing enterocolitis: alterations in inflammation, innate immune response, and the microbiota. Pediatr Res 2014;76:326-33. 43. Sgouras DN, Panayotopoulou EG, Martinez-Gonzalez B, et al. Lactobacillus johnsonii Lai attenuates Helicobacter pylori-associated gastritis and reduces levels of proinflammatory chemokines in C57BL/6 mice. Clin Diagn Lab Immunol 2005;12:1378-86.

44. Eeckhaut V, Machiels K, Perrier C, et al. Butyricicoccus pullicaecorum in inflammatory bowel disease. Gut 2013;62: 1745-52.

45. Machiels K, Joossens M, Sabino J, et al. A decrease of the butyrate-producing species Roseburia hominis and Faecalibacterium prausnitzii defines dysbiosis in patients with ulcerative colitis. Gut 2014;63: 1275-83.

46. Ridlon JM, Kang DJ, Hylemon PB. Bile salt biotransformations by human intestinal bacteria. J Lipid Res 2006;47:241-59.

47. Kitahara M, Takamine F, Imamura T, et al. Clostridium hiranonis sp. nov., a human intestinal bacterium with bile acid 7alpha-dehydroxylating activity. Int J Syst Evol Microbiol 2001 ;51 :39-44.

48. Eeckhaut V, Van Immerseel F, Teirlynck E, et al. Butyricicoccus pullicaecorum gen. nov., sp. nov., an anaerobic, butyrate-producing bacterium isolated from the caecal content of a broiler chicken. Int J Syst Evol Microbiol 2008;58:2799-802.

49. Duncan SH, Aminov RI, Scott KP, et al. Proposal of Roseburia faecis sp. nov., Roseburia hominis sp. nov. and Roseburia inulinivorans sp. nov., based on isolates from human faeces. Int J Syst Evol Microbiol 2006;56:2437-41.

50. Copple BL, Li T. Pharmacology of bile acid receptors: Evolution of bile acids from simple detergents to complex signaling molecules. Pharmacol Res 2016; 104:9-21.

51. Duboc H, Rajca S, Rainteau D, et al. Connecting dysbiosis, bile-acid dysmetabolism and gut inflammation in inflammatory bowel diseases. Gut 2013;62:531-9.

52. Swann JR, Want EJ, Geier FM, et al. Systemic gut microbial modulation of bile acid metabolism in host tissue compartments. Proc Natl Acad Sci U S A 201 1 ; 108 Suppl 1 :4523-

30.

53. Crumplin GC, Smith JT. Nalidixic acid: an antibacterial paradox. Antimicrob Agents Chemother 1975;8:251-61.

54. Willing BP, Vacharaksa A, Croxen M, et al. Altering host resistance to infections through microbial transplantation. PLoS One 201 1 ;6:e26988.

55. Bohnhoff M, Drake BL, Miller CP. The effect of an antibiotic on the susceptibility of the mouse's intestinal tract to Salmonella infection. Antibiot Annu 1955;3:453-5. 56. Winter SE, Thiennimitr P, Winter MG, et al. Gut inflammation provides a respiratory electron acceptor for Salmonella. Nature 2010;467:426-9.

57. Winter SE, Winter MG, Xavier MN, et al. Host-derived nitrate boosts growth of E. coli in the inflamed gut. Science 2013;339:708-1 1.

58. Thiennimitr P, Winter SE, Winter MG, et al. Intestinal inflammation allows Salmonella to use ethanolamine to compete with the microbiota. Proc Natl Acad Sci U S A 201 1 ;108: 17480-5.

59. Lupp C, Robertson ML, Wickham ME, et al. Host-mediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae. Cell Host Microbe 2007;2: 1 19- 29.

60. Abdel-Nour M, Tsalikis J, Kleinman D, et al. The emerging role of mTOR signalling in antibacterial immunity. Immunol Cell Biol 2014;92: 346-53.

61. Ip W E, Hoshi N, Shouval DS, et al. Anti-inflammatory effect of IL-10 mediated by metabolic reprogramming of macrophages. Science 2017;356:513-519.

62. Romani L, Zelante T, De Luca A, et al. Microbiota control of a tryptophan- AhR pathway in disease tolerance to fungi. Eur J Immunol 2014;44:3192-200.

63. Abt MC, McKenney PT, Pamer EG. Clostridium difficile colitis: pathogenesis and host defence. Nat Rev Microbiol 2016;14:609-20.

64. Sorg JA, Sonenshein AL. Bile salts and glycine as cogerminants for Clostridium difficile spores. J Bacteriol 2008; 190:2505-12.

65. Lertpiriyapong K, Gamazon ER, Feng Y, et al. Campylobacter jejuni type VI secretion system: roles in adaptation to deoxycholic acid, host cell adherence, invasion, and in vivo colonization. PLoS One 2012;7:e42842.