Field

[0001] The present disclosure relates to the field of gene editing and specifically to the alteration of the Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCN10A) gene.

Related Applications

[0002] This application claims the benefit of U.S. Provisional Application No. 62/358,769 filed July 6, 2016 and U.S. Provisional Application No. 62/461,876 filed February 22, 2017, both of which are incorporated herein in their entirety by reference.

Incorporation by Reference of Sequence Listing

[0003] This application contains a Sequence Listing in computer readable form [filename: 170153PCT sequence listing (SCN10A)_(Part 1): 18,375,910 bytes - ASCII text file; created June 28, 2017, and 170153PCT sequence listing (SCN10A)_(Part 2): 15,048,608 bytes - ASCII text file; created June 28, 2017], which is incorporated herein by reference in its entirety and forms part of the disclosure.

Background

[0004] Genome engineering refers to the strategies and techniques for the targeted, specific modification of the genetic information (genome) of living organisms. Genome engineering is a very active field of research because of the wide range of possible applications, particularly in the areas of human health. For example, genome engineering can be used to alter (e.g., correct or knock-out) a gene carrying a harmful mutation or to explore the function of a gene. Early technologies developed to insert a transgene into a living cell were often limited by the random nature of the insertion of the new sequence into the genome. Random insertions into the genome may result in disrupting normal regulation of neighboring genes leading to severe unwanted effects. Furthermore, random integration technologies offer little reproducibility, as there is no guarantee that the sequence would be inserted at the same place in two different cells. Recent genome engineering strategies, such as zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), homing endonucleases (HEs) and MegaTALs, enable a specific area of the DNA to be modified, thereby increasing the precision of the correction or insertion compared to early technologies. These newer platforms offer a much larger degree of reproducibility, but still have their limitations.

[0005] Despite efforts from researchers and medical professionals worldwide who have been trying to address genetic disorders, and despite the promise of genome engineering approaches, there still remains a critical need for developing safe and effective treatments involving SCNIOA related indications.

[0006] By using genome engineering tools to create permanent changes to the genome that can address the SCNIOA related disorders or conditions with as few as a single treatment, the resulting therapy may completely remedy certain SCNIOA related indications and/or diseases.

Summary

[0007] Provided herein are cellular, ex vivo and in vivo methods for creating permanent changes to the genome by introducing one or more insertions, deletions or mutations of at least one nucleotide within or near the Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCNIOA) gene or other DNA sequences that encode regulatory elements of the SCNIOA gene by genome editing and reducing or eliminating Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCNIOA) gene products, which can be used to treat pain. Also provided performing herein are components and compositions, and vectors for performing such methods.

[0008] Provided herein is a method for editing a Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCNIOA) gene in a cell by genome editing comprising: introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the SCNIOA gene or SCNIOA regulatory elements that results in one or more permanent insertions, deletions or mutations of at least one nucleotide within or near the SCNIOA gene, thereby reducing or eliminating the expression or function of SCNIOA gene products.

[0009] Also provided herein is an ex vivo method for treating a patient having an SCNIOA related condition or disorder comprising: editing a patient specific induced pluripotent stem cell (iPSC) within or near a Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCNIOA) gene or other DNA sequences that encode regulatory elements of the SCNIOA gene; differentiating the edited iPSC into a neuron of the peripheral nervous system; and administering the neuron of the peripheral nervous system into the patient.

[00010] In some aspects, the editing step comprises: introducing into the iPSC one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the SCN10A gene or SCN10A regulatory elements that results in one or more permanent insertions, deletions or mutations of at least one nucleotide within or near the SCN10A gene, thereby reducing or eliminating the expression or function of SCN10A gene products.

[00011] Also provided herein is an ex vivo method for treating a patient having an SCN10A related condition or disorder comprising: editing a mesenchymal stem cell within or near a Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCN10A) gene or other DNA sequences that encode regulatory elements of the SCN10A gene; differentiating the edited mesenchymal stem cell into a neuron of the peripheral nervous system; and administering the neuron of the peripheral nervous system into the patient.

[00012] In some aspects, the editing step comprises: introducing into the mesenchymal stem cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the SCN10A gene or SCN10A regulatory elements that results in one or more permanent insertions, deletions or mutations of at least one nucleotide within or near the SCN10A gene, thereby reducing or eliminating the expression or function of SCN10A gene products.

[00013] Also provided herein is an in vivo method for treating a patient with an SCN10A related disorder comprising: editing the Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCN10A) gene in a cell of the patient.

[00014] In some aspects, the editing step comprises: introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the SCN10A gene or SCN10A regulatory elements that results in one or more permanent insertions, deletions or mutations of at least one nucleotide within or near the SCN10A gene, thereby reducing or eliminating the expression or functi on of S CN 1 OA gene products .

[00015] In some aspects, the cell is a neuron of the peripheral nervous system. In some aspects, the one or more deoxyribonucleic acid (DNA) endonuclease is delivered to the neuron of the peripheral nervous system via direct intraganglionic or intraspinal injection, or intrathecal delivery.

[00016] Also provided herein is a method of altering the contiguous genomic sequence of an SCN10A gene in a cell comprising: contacting the cell with one or more deoxyribonucleic acid (DNA) endonuclease to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs). In some aspects, the alteration of the contiguous genomic sequence occurs in one or more exons of the SCN10A gene.

[00017] In some aspects, the one or more deoxyribonucleic acid (DNA) endonuclease is selected from any of those sequences in SEQ ID NOs: 1-620 and variants having at least 90% homology to any of those disclosed in SEQ ID NOs: 1-620.

[00018] In some aspects, the one or more deoxyribonucleic acid (DNA) endonuclease is one or more protein or polypeptide. In some aspects, the one or more deoxyribonucleic acid (DNA) endonuclease is one or more polynucleotide encoding the one or more DNA endonuclease. In some aspects, the one or more deoxyribonucleic acid (DNA) endonuclease is one or more ribonucleic acid (RNA) encoding the one or more DNA endonuclease. In some aspects, the one or more ribonucleic acid (RNA) is one or more chemically modified RNA. In some aspects, the one or more ribonucleic acid (RNA) is chemically modified in the coding region. In some aspects, the one or more polynucleotide or one or more ribonucleic acid (RNA) is codon optimized.

[00019] In some aspects, the methods further comprise: introducing into the cell one or more gRNA or one or more sgRNA. In some aspects, the one or more gRNA or one or more sgRNA comprises a spacer sequence that is complementary to a DNA sequence within or near the SCN10A gene. In some aspects, the one or more gRNA or one or more sgRNA is chemically modified. In some aspects, the one or more gRNA or one or more sgRNA is pre-complexed with the one or more deoxyribonucleic acid (DNA) endonuclease. In some aspects, the pre- complexing involves a covalent attachment of the one or more gRNA or one or more sgRNA to the one or more deoxyribonucleic acid (DNA) endonuclease.

[00020] In some aspects, the one or more deoxyribonucleic acid (DNA) endonuclease is formulated in a liposome or lipid nanoparticle. In some aspects, the one or more

deoxyribonucleic acid (DNA) endonuclease is formulated in a liposome or lipid nanoparticle which also comprises the one or more gRNA or one or more sgRNA.

[00021] In some aspects, the one or more deoxyribonucleic acid (DNA) endonuclease is encoded in an AAV vector particle. In some aspects, the one or more gRNA or one or more sgRNA is encoded in an AAV vector particle. In some aspects, the one or more

deoxyribonucleic acid (DNA) endonuclease is encoded in an AAV vector particle which also encodes the one or more gRNA or one or more sgRNA. In some aspects, the AAV vector particle is selected from the group consisting of any of those disclosed in SEQ ID NOs: 4734- 5302 and Table 2. [00022] Also provided herein is a single-molecule guide RNA comprising: at least a spacer sequence that is an RNA sequence corresponding to any of SEQ ID NOs: 5305-76012. In some aspects, the single-molecule guide RNA further comprises a spacer extension region. In some aspects, the single-molecule guide RNA further comprises a tracrRNA extension region. In some aspects, the single-molecule guide RNA is chemically modified.

[00023] In some aspects, the single-molecule guide RNA is pre-complexed with a sited- directed polypeptide. In some aspects, the site-directed polypeptide is a DNA endonuclease. In some aspects, the DNA endonuclease is a Cas9 or CPfl endonuclease. In some aspects, the Cas9 or Cpfl endonuclease is selected from a group consisting of: S. pyogenes Cas9, S. aureus Cas9, N. meningitides Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR 3 Cas9, T. denticola Cas9, L. bacterium ND2006 Cpfl and Acidaminococcus sp. BV3L6 Cpfl, and variants having at least 90% homology to these endonucleases. In some aspects, the Cas9 or Cpfl endonuclease comprises one or more nuclear localization signals (NLSs). In some aspects, at least one NLS is at or within 50 amino acids of the amino-terminus of the Cas9 or Cpfl endonuclease and/or at least one NLS is at or within 50 amino acids of the carboxy -terminus of the Cas9 or Cpfl endonuclease.

[00024] Also provided herein is RNA encoding the single-molecule guide polynucleotide described herein.

[00025] Also provided herein is RNA encoding the CRISPR/Cas system described herein.

[00026] Also provided herein is a DNA encoding the single-molecule guide RNA described herein.

[00027] Also provided herein is a DNA encoding the CRISPR/Cas system described herein.

[00028] Also provided herein is a vector comprising a DNA encoding the single-molecule guide RNA or CRISPR/Cas system. In some aspects, the vector is a plasmid. In some aspects, the vector is an AAV vector particle, wherein the AAV vector particle is selected from those listed in SEQ ID NOs: 4734-5302 or Table 2.

Brief Description of the Drawings

[00029] Various aspects of materials and methods disclosed and described in this specification can be better understood by reference to the accompanying figures, in which:

[00030] Figures 1 A-B depict the type II CRISPR/Cas system;

[00031] Figure 1 A is a depiction of the type II CRISPR/Cas system including gRNA;

[00032] Figure IB is another depiction of the type II CRISPR/Cas system including sgRNA; [00033] Figures 2A-H describe the cutting efficiencies of S. pyogenes gRNAs selected via an in-vitro transcribed (IVT) gRNA screen;

[00034] Figure 2A describes the cutting efficiencies in the range of 90.4 - 98.6% of S.

pyogenes gRNAs selected via an in-vitro transcribed (IVT) gRNA screen;

[00035] Figure 2B describes the cutting efficiencies in the range of 84.6 - 90.3% of S.

pyogenes gRNAs selected via an in-vitro transcribed (IVT) gRNA screen;

[00036] Figure 2C describes the cutting efficiencies in the range of 78.7 - 84.3% of S.

pyogenes gRNAs selected via an in-vitro transcribed (IVT) gRNA screen;

[00037] Figure 2D describes the cutting efficiencies in the range of 71.4 - 77.6% of S.

pyogenes gRNAs selected via an in-vitro transcribed (IVT) gRNA screen;

[00038] Figure 2E describes the cutting efficiencies in the range of 62 - 71.4% of S.pyogenes gRNAs selected via an in-vitro transcribed (IVT) gRNA screen;

[00039] Figure 2F describes the cutting efficiencies in the range of 44 - 59.9% of S. pyogenes gRNAs selected via an in-vitro transcribed (IVT) gRNA screen;

[00040] Figure 2G describes the cutting efficiencies in the range of 15.4 - 43.7% of S.

pyogenes gRNAs selected via an in-vitro transcribed (IVT) gRNA screen;

[00041] Figure 2H describes the cutting efficiencies in the range of 1.6 - 14.7% of S. pyogenes gRNAs selected via an in-vitro transcribed (IVT) gRNA screen;

[00042] Figures 3A-C describe the cutting efficiency of S. pyogenes gRNAs in HEK293T cells targeting the SCN10A gene;

[00043] Figure 3 A describes the cutting efficiency in the range of 81.1 - 98.6% of S. pyogenes gRNAs in HEK293T cells targeting the SCN10A gene;

[00044] Figure 3B describes the cutting efficiency in the range of 62.1 - 81.1% of S.

pyogenes gRNAs in HEK293T cells targeting the SCN10A gene; and

[00045] Figure 3C describes the cutting efficiency in the range of 1.6 - 62% of S. pyogenes gRNAs in HEK293T cells targeting the SCN10A gene.

Brief Description of Sequence Listing

[00046] SEQ ID NOs: 1-620 are Cas endonuclease ortholog sequences.

[00047] SEQ ID NOs: 621-631 do not include sequences.

[00048] SEQ ID NOs: 632-4715 are microRNA sequences.

[00049] SEQ ID NOs: 4716-4733 do not include sequences.

[00050] SEQ ID NOs: 4734-5302 are AAV serotype sequences. [00051] SEQ ID NO: 5303 is a SCNIOA nucleotide sequence.

[00052] SEQ ID NO: 5304 is a gene sequence including 1-5 kilobase pairs upstream and/or downstream of the SCNIOA gene.

[00053] SEQ ID NOs: 5305 - 5702 are 20 bp spacer sequences for targeting within or near a SCNIOA gene or other DNA sequence that encodes a regulatory element of the SCNIOA gene with a T. denticola Cas9 endonuclease.

[00054] SEQ ID NOs: 5703 - 6771 are 20 bp spacer sequences for targeting within or near a SCNIOA gene or other DNA sequence that encodes a regulatory element of the SCNIOA gene with a S. thermophilics Cas9 endonuclease.

[00055] SEQ ID NOs: 6772 -9983 are 20 bp spacer sequences for targeting within or near a SCNIOA gene or other DNA sequence that encodes a regulatory element of the SCNIOA gene with a S. aureus Cas9 endonuclease.

[00056] SEQ ID NOs: 9984 - 12753 are 20 bp spacer sequences for targeting within or near a SCNIOA gene or other DNA sequence that encodes a regulatory element of the SCNIOA gene with a N. meningitides Cas9 endonuclease.

[00057] SEQ ID NOs: 12754 - 40530 are 20 bp spacer sequences for targeting within or near a SCNIOA gene or other DNA sequence that encodes a regulatory element of the SCNIOA gene with a S. pyogenes Cas9 endonuclease.

[00058] SEQ ID NOs: 40531 - 76012 are 20 bp spacer sequences for targeting within or near a SCNIOA gene or other DNA sequence that encodes a regulatory element of the SCNIOA gene with an Acidaminococcus, a Lachnospiraceae, and a Franciscella Novicida Cpf 1 endonuclease.

[00059] SEQ ID NOs: 76013-76042 do not include sequences.

[00060] SEQ ID NO: 76043 is a sample guide RNA (gRNA) for a S. pyogenes Cas9 endonuclease.

[00061] SEQ ID NOs: 76044-76046 show sample sgRNA sequences.

Detailed Description

I. INTRODUCTION

Genome Editing

[00062] The present disclosure provides strategies and techniques for the targeted, specific alteration of the genetic information (genome) of living organisms. As used herein, the term "alteration" or "alteration of genetic information" refers to any change in the genome of a cell. In the context of treating genetic disorders, alterations may include, but are not limited to, insertion, deletion and correction. As used herein, the term "insertion" refers to an addition of one or more nucleotides in a DNA sequence. Insertions can range from small insertions of a few nucleotides to insertions of large segments such as a cDNA or a gene. The term "deletion" refers to a loss or removal of one or more nucleotides in a DNA sequence or a loss or removal of the function of a gene. In some cases, a deletion can include, for example, a loss of a few

nucleotides, an exon, an intron, a gene segment, or the entire sequence of a gene. In some cases, deletion of a gene refers to the elimination or reduction of the function or expression of a gene or its gene product. This can result from not only a deletion of sequences within or near the gene, but also other events (e.g., insertion, nonsense mutation) that disrupt the expression of the gene. The term "correction" as used herein, refers to a change of one or more nucleotides of a genome in a cell, whether by insertion, deletion or substitution. Such correction may result in a more favorable genotypic or phenotypic outcome, whether in structure or function, to the genomic site which was corrected. One non-limiting example of a "correction" includes the correction of a mutant or defective sequence to a wild-type sequence which restores structure or function to a gene or its gene product(s). Depending on the nature of the mutation, correction may be achieved via various strategies disclosed herein. In one non-limiting example, a missense mutation may be corrected by replacing the region containing the mutation with its wild-type counterpart. As another example, duplication mutations (e.g., repeat expansions) in a gene may be corrected by removing the extra sequences.

[00063] In some aspects, alterations may also include a gene knock-in, knock-out or knockdown. As used herein, the term "knock-in" refers to an addition of a DNA sequence, or fragment thereof into a genome. Such DNA sequences to be knocked-in may include an entire gene or genes, may include regulatory sequences associated with a gene or any portion or fragment of the foregoing. For example, a cDNA encoding the wild-type protein may be inserted into the genome of a cell carrying a mutant gene. Knock-in strategies need not replace the defective gene, in whole or in part. In some cases, a knock-in strategy may further involve substitution of an existing sequence with the provided sequence, e.g., substitution of a mutant allele with a wild- type copy. On the other hand, the term "knock-out" refers to the elimination of a gene or the expression of a gene. For example, a gene can be knocked out by either a deletion or an addition of a nucleotide sequence that leads to a disruption of the reading frame. As another example, a gene may be knocked out by replacing a part of the gene with an irrelevant sequence. Finally, the term "knock-down" as used herein refers to reduction in the expression of a gene or its gene product(s). As a result of a gene knock-down, the protein activity or function may be attenuated or the protein levels may be reduced or eliminated.

[00064] Genome editing generally refers to the process of modifying the nucleotide sequence of a genome, preferably in a precise or pre-determined manner. Examples of methods of genome editing described herein include methods of using site-directed nucleases to cut deoxyribonucleic acid (DNA) at precise target locations in the genome, thereby creating single-strand or double- strand DNA breaks at particular locations within the genome. Such breaks can be and regularly are repaired by natural, endogenous cellular processes, such as homology-directed repair (HDR) and non-homologous end joining (NHEJ), as reviewed in Cox et al., Nature Medicine 21(2), 121-31 (2015). These two main DNA repair processes consist of a family of alternative pathways. NHEJ directly joins the DNA ends resulting from a double-strand break, sometimes with the loss or addition of nucleotide sequence, which may disrupt or enhance gene expression. HDR utilizes a homologous sequence, or donor sequence, as a template for inserting a defined DNA sequence at the break point. The homologous sequence can be in the endogenous genome, such as a sister chromatid. Alternatively, the donor can be an exogenous nucleic acid, such as a plasmid, a single-strand oligonucleotide, a double-stranded oligonucleotide, a duplex

oligonucleotide or a virus, that has regions of high homology with the nuclease-cleaved locus, but which can also contain additional sequence or sequence changes including deletions that can be incorporated into the cleaved target locus. A third repair mechanism can be microhomology- mediated end joining (MMEJ), also referred to as "Alternative NHEJ," in which the genetic outcome is similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ can make use of homologous sequences of a few base pairs flanking the DNA break site to drive a more favored DNA end joining repair outcome, and recent reports have further elucidated the molecular mechanism of this process; see, e.g., Cho and Greenberg, Nature 518, 174-76 (2015); Kent et al, Nature Structural and Molecular Biology, Adv. Online

doi: 10.1038/nsmb.2961(2015); Mateos-Gomez et al., Nature 518, 254-57 (2015); Ceccaldi et al, Nature 528, 258-62 (2015). In some instances, it may be possible to predict likely repair outcomes based on analysis of potential microhomologies at the site of the DNA break.

[00065] Each of these genome editing mechanisms can be used to create desired genomic alterations. A step in the genome editing process can be to create one or two DNA breaks, the latter as double-strand breaks or as two single-stranded breaks, in the target locus as near the site of intended mutation. This can be achieved via the use of site-directed polypeptides, as described and illustrated herein. CRISPR Endonuclease System

[00066] A CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) genomic locus can be found in the genomes of many prokaryotes (e.g., bacteria and archaea). In prokaryotes, the CRISPR locus encodes products that function as a type of immune system to help defend the prokaryotes against foreign invaders, such as virus and phage. There are three stages of CRISPR locus function: integration of new sequences into the CRISPR locus, expression of CRISPR RNA (crRNA), and silencing of foreign invader nucleic acid. Five types of CRISPR systems (e.g., Type I, Type II, Type III, Type U, and Type V) have been identified.

[00067] A CRISPR locus includes a number of short repeating sequences referred to as "repeats." When expressed, the repeats can form secondary structures (e.g., hairpins) and/or comprise unstructured single-stranded sequences. The repeats usually occur in clusters and frequently diverge between species. The repeats are regularly interspaced with unique intervening sequences referred to as "spacers," resulting in a repeat-spacer-repeat locus architecture. The spacers are identical to or have high homology with known foreign invader sequences. A spacer-repeat unit encodes a crisprRNA (crRNA), which is processed into a mature form of the spacer-repeat unit. A crRNA comprises a "seed" or spacer sequence that is involved in targeting a target nucleic acid (in the naturally occurring form in prokaryotes, the spacer sequence targets the foreign invader nucleic acid). A spacer sequence is located at the 5' or 3' end of the crRNA.

[00068] A CRISPR locus also comprises polynucleotide sequences encoding CRISPR

Associated (Cas) genes. Cas genes encode endonucleases involved in the biogenesis and the interference stages of crRNA function in prokaryotes. Some Cas genes comprise homologous secondary and/or tertiary structures.

Type II CRISPR Systems

[00069] crRNA biogenesis in a Type II CRISPR system in nature requires a trans-activating CRISPR RNA (tracrRNA). Non-limiting examples of Type II CRISPR systems are shown in Figures 1A and IB. The tracrRNA can be modified by endogenous RNaselll, and then hybridizes to a crRNA repeat in the pre-crRNA array. Endogenous RNaselll can be recruited to cleave the pre-crRNA. Cleaved crRNAs can be subjected to exoribonuclease trimming to produce the mature crRNA form (e.g., 5' trimming). The tracrRNA can remain hybridized to the crRNA, and the tracrRNA and the crRNA associate with a site-directed polypeptide (e.g., Cas9). The crRNA of the crRNA-tracrRNA-Cas9 complex can guide the complex to a target nucleic acid to which the crRNA can hybridize. Hybridization of the crRNA to the target nucleic acid can activate Cas9 for targeted nucleic acid cleavage. The target nucleic acid in a Type II CRISPR system is referred to as a protospacer adjacent motif (PAM). In nature, the PAM is essential to facilitate binding of a site-directed polypeptide (e.g., Cas9) to the target nucleic acid. Type II systems (also referred to as Nmeni or CASS4) are further subdivided into Type II-A (CASS4) and II-B (CASS4a). Jinek et al, Science, 337(6096): 816-821 (2012) showed that the CRISPR/Cas9 system is useful for RNA-programmable genome editing, and international patent application publication number WO2013/176772 provides numerous examples and applications of the CRISPR/Cas endonuclease system for site-specific gene editing.

Type V CRISPR Systems

[00070] Type V CRISPR systems have several important differences from Type II systems. For example, Cpf 1 is a single RNA-guided endonuclease that, in contrast to Type II systems, lacks tracrRNA. In fact, Cpf 1 -associated CRISPR arrays can be processed into mature crRNAs without the requirement of an additional trans-activating tracrRNA. The Type V CRISPR array can be processed into short mature crRNAs of 42-44 nucleotides in length, with each mature crRNA beginning with 19 nucleotides of direct repeat followed by 23-25 nucleotides of spacer sequence. In contrast, mature crRNAs in Type II systems can start with 20-24 nucleotides of spacer sequence followed by about 22 nucleotides of direct repeat. Also, Cpfl can utilize a T- rich protospacer-adjacent motif such that Cpfl-crRNA complexes efficiently cleave target DNA preceded by a short T-rich PAM, which is in contrast to the G-rich PAM following the target DNA for Type II systems. Thus, Type V systems cleave at a point that is distant from the PAM, while Type II systems cleave at a point that is adjacent to the PAM. In addition, in contrast to Type II systems, Cpfl cleaves DNA via a staggered DNA double-stranded break with a 4 or 5 nucleotide 5' overhang. Type II systems cleave via a blunt double-stranded break. Similar to Type II systems, Cpfl contains a predicted RuvC-like endonuclease domain, but lacks a second HNH endonuclease domain, which is in contrast to Type II systems.

Cas Genes/Polypeptides and Protospacer Adjacent Motifs

[00071] Exemplary CRISPR/Cas polypeptides include the Cas9 polypeptides as published in Fonfara et al, Nucleic Acids Research, 42: 2577-2590 (2014). The CRISPR/Cas gene naming system has undergone extensive rewriting since the Cas genes were discovered. Fonfara et al. also provides PAM sequences for the Cas9 polypeptides from various species (see also Table 1 infra).

II. COMPOSITIONS AND METHODS OF THE DISCLOSURE [00072] Provided herein are cellular, ex vivo and in vivo methods for using genome engineering tools to create permanent changes to the genome by deleting or mutating the SCN10A gene or other DNA sequences that encode regulatory elements of the SCN10A gene. Such methods use endonucleases, such as CRISPR-associated (Cas9, Cpf 1 and the like) nucleases, to permanently edit within or near the genomic locus of the SCN10A gene or other DNA sequences that encode regulatory elements of the SCN10A gene. In this way, examples set forth in the present disclosure can help to reduce or eliminate the expression of the SCN10A gene with as few as a single treatment (rather than deliver potential therapies for the lifetime of the patient).

Site-Directed Polypeptides (endonucleases, enzymes)

[00073] A site-directed polypeptide is a nuclease used in genome editing to cleave DNA. The site-directed polypeptide can be administered to a cell or a patient as either: one or more polypeptides, or one or more mRNAs encoding the polypeptide. Any of the enzymes or orthologs listed in SEQ ID NOs: 1-620, or disclosed herein, may be utilized in the methods herein. Single-molecule guide RNA can be pre-complexed with a site-directed polypeptide. The site-directed polypeptide can be any of the DNA endonuclease disclosed herein.

[00074] In the context of a CRISPR/Cas9 or CRISPR/Cpfl system, the site-directed polypeptide can bind to a guide RNA that, in turn, specifies the site in the target DNA to which the polypeptide is directed. In the CRISPR/Cas9 or CRISPR/Cpfl systems disclosed herein, the site-directed polypeptide can be an endonuclease, such as a DNA endonuclease.

[00075] A site-directed polypeptide can comprise a plurality of nucleic acid-cleaving (i.e., nuclease) domains. Two or more nucleic acid-cleaving domains can be linked together via a linker. For example, the linker can comprise a flexible linker. Linkers can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40 or more amino acids in length.

[00076] Naturally-occurring wild-type Cas9 enzymes comprise two nuclease domains, a UNH nuclease domain and a RuvC domain. Herein, the term "Cas9" refers to both a naturally- occurring and a recombinant Cas9. Cas9 enzymes contemplated herein can comprise a HNH or HNH-like nuclease domain, and/or a RuvC or RuvC-like nuclease domain.

[00077] HNH or HNH-like domains comprise a McrA-like fold. HNH or HNH-like domains comprises two antiparallel β-strands and an a-helix. HNH or HNH-like domains comprises a metal binding site (e.g., a divalent cation binding site). HNH or HNH-like domains can cleave one strand of a target nucleic acid (e.g., the complementary strand of the crRNA targeted strand). [00078] RuvC or RuvC-like domains comprise an RNaseH or RNaseH-like fold. RuvC/RNaseH domains are involved in a diverse set of nucleic acid-based functions including acting on both RNA and DNA. The RNaseH domain comprises 5 β-strands surrounded by a plurality of a-helices. RuvC/RNaseH or RuvC/RNaseH-like domains comprise a metal binding site (e.g., a divalent cation binding site). RuvC/RNaseH or RuvC/RNaseH-like domains can cleave one strand of a target nucleic acid (e.g., the non-complementary strand of a double- stranded target DNA).

[00079] Site-directed polypeptides can introduce double-strand breaks or single-strand breaks in nucleic acids, e.g., genomic DNA. The double-strand break can stimulate a cell's endogenous DNA-repair pathways (e.g., homology-dependent repair (HDR) or NHEJ or alternative nonhomologous end joining (A-NHEJ) or microhomology-mediated end joining (MMEJ)). NHEJ can repair cleaved target nucleic acid without the need for a homologous template. This can sometimes result in small deletions or insertions (indels) in the target nucleic acid at the site of cleavage, and can lead to disruption or alteration of gene expression. HDR can occur when a homologous repair template, or donor, is available. The homologous donor template can comprise sequences that are homologous to sequences flanking the target nucleic acid cleavage site. The sister chromatid can be used by the cell as the repair template. However, for the purposes of genome editing, the repair template can be supplied as an exogenous nucleic acid, such as a plasmid, duplex oligonucleotide, single-strand oligonucleotide or viral nucleic acid. With exogenous donor templates, an additional nucleic acid sequence (such as a transgene) or modification (such as a single or multiple base change or a deletion) can be introduced between the flanking regions of homology so that the additional or altered nucleic acid sequence also becomes incorporated into the target locus. MMEJ can result in a genetic outcome that is similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ can make use of homologous sequences of a few base pairs flanking the cleavage site to drive a favored end-joining DNA repair outcome. In some instances, it may be possible to predict likely repair outcomes based on analysis of potential microhomologies in the nuclease target regions.

[00080] Thus, in some cases, homologous recombination can be used to insert an exogenous polynucleotide sequence into the target nucleic acid cleavage site. An exogenous polynucleotide sequence is termed a "donor polynucleotide" (or donor or donor sequence) herein. The donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide can be inserted into the target nucleic acid cleavage site. The donor polynucleotide can be an exogenous polynucleotide sequence, i.e., a sequence that does not naturally occur at the target nucleic acid cleavage site.

[00081] The modifications of the target DNA due to NHEJ and/or HDR can lead to, for example, mutations, deletions, alterations, integrations, gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, translocations and/or gene mutation. The processes of deleting genomic DNA and integrating non-native nucleic acid into genomic DNA are examples of genome editing.

[00082] The site-directed polypeptide can comprise an amino acid sequence having at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity to a wild-type exemplary site-directed polypeptide [e.g., Cas9 from S. pyogenes, US2014/0068797 Sequence ID No. 8 or Sapranauskas et al, Nucleic Acids Res, 39(21): 9275-9282 (2011)], and various other site-directed polypeptides. The site-directed polypeptide can comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100%) identity to a wild-type site-directed polypeptide {e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids. The site-directed polypeptide can comprise at most: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids. The site-directed polypeptide can comprise at least: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S.

pyogenes, supra) over 10 contiguous amino acids in a HNH nuclease domain of the site-directed polypeptide. The site-directed polypeptide can comprise at most: 70, 75, 80, 85, 90, 95, 97, 99, or 100%) identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a HNH nuclease domain of the site-directed polypeptide. The site-directed polypeptide can comprise at least: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a RuvC nuclease domain of the site-directed polypeptide. The site-directed polypeptide can comprise at most: 70, 75, 80, 85, 90, 95, 97, 99, or 100%) identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a RuvC nuclease domain of the site-directed polypeptide.

[00083] The site-directed polypeptide can comprise a modified form of a wild-type exemplary site-directed polypeptide. The modified form of the wild- type exemplary site-directed polypeptide can comprise a mutation that reduces the nucleic acid-cleaving activity of the site- directed polypeptide. The modified form of the wild-type exemplary site-directed polypeptide can have less than 90%, less than 80%>, less than 70%, less than 60%>, less than 50%, less than 40%), less than 30%>, less than 20%, less than 10%>, less than 5%, or less than 1% of the nucleic acid-cleaving activity of the wild-type exemplary site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra). The modified form of the site-directed polypeptide can have no substantial nucleic acid-cleaving activity. When a site-directed polypeptide is a modified form that has no substantial nucleic acid-cleaving activity, it is referred to herein as "enzymatically inactive."

[00084] The modified form of the site-directed polypeptide can comprise a mutation such that it can induce a single-strand break (SSB) on a target nucleic acid (e.g., by cutting only one of the sugar-phosphate backbones of a double-strand target nucleic acid). In some aspects, the mutation can result in less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nucleic acid-cleaving activity in one or more of the plurality of nucleic acid-cleaving domains of the wild-type site directed polypeptide (e.g., Cas9 from S. pyogenes, supra). In some aspects, the mutation can result in one or more of the plurality of nucleic acid-cleaving domains retaining the ability to cleave the complementary strand of the target nucleic acid, but reducing its ability to cleave the non-complementary strand of the target nucleic acid. The mutation can result in one or more of the plurality of nucleic acid-cleaving domains retaining the ability to cleave the non-complementary strand of the target nucleic acid, but reducing its ability to cleave the complementary strand of the target nucleic acid. For example, residues in the wild-type exemplary S. pyogenes Cas9 polypeptide, such as Asp 10, His840, Asn854 and Asn856, are mutated to inactivate one or more of the plurality of nucleic acid-cleaving domains (e.g., nuclease domains). The residues to be mutated can correspond to residues Asp 10, His840, Asn854 and Asn856 in the wild-type exemplary S. pyogenes Cas9 polypeptide (e.g., as determined by sequence and/or structural alignment). Non-limiting examples of mutations include D10A, H840A, N854A or N856A. One skilled in the art will recognize that mutations other than alanine substitutions can be suitable.

[00085] In some aspects, a D10A mutation can be combined with one or more of H840A, N854A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. A H840A mutation can be combined with one or more of D10A, N854A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. A N854A mutation can be combined with one or more of H840A, D10A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. A N856A mutation can be combined with one or more of H840A, N854A, or D10A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. Site-directed polypeptides that comprise one substantially inactive nuclease domain are referred to as

"nickases."

[00086] Nickase variants of RNA-guided endonucleases, for example Cas9, can be used to increase the specificity of CRISPR-mediated genome editing. Wild type Cas9 is typically guided by a single guide RNA designed to hybridize with a specified -20 nucleotide sequence in the target sequence (such as an endogenous genomic locus). However, several mismatches can be tolerated between the guide RNA and the target locus, effectively reducing the length of required homology in the target site to, for example, as little as 13 nt of homology, and thereby resulting in elevated potential for binding and double-strand nucleic acid cleavage by the CRISPR/Cas9 complex elsewhere in the target genome - also known as off-target cleavage. Because nickase variants of Cas9 each only cut one strand, in order to create a double-strand break it is necessary for a pair of nickases to bind in close proximity and on opposite strands of the target nucleic acid, thereby creating a pair of nicks, which is the equivalent of a double-strand break. This requires that two separate guide RNAs - one for each nickase - must bind in close proximity and on opposite strands of the target nucleic acid. This requirement essentially doubles the minimum length of homology needed for the double-strand break to occur, thereby reducing the likelihood that a double-strand cleavage event will occur elsewhere in the genome, where the two guide RNA sites - if they exist - are unlikely to be sufficiently close to each other to enable the double-strand break to form. As described in the art, nickases can also be used to promote HDR versus NHEJ. HDR can be used to introduce selected changes into target sites in the genome through the use of specific donor sequences that effectively mediate the desired changes.

[00087] Mutations contemplated can include substitutions, additions, and deletions, or any combination thereof. The mutation converts the mutated amino acid to alanine. The mutation converts the mutated amino acid to another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, or arginine). The mutation converts the mutated amino acid to a non-natural amino acid (e.g., selenomethionine). The mutation converts the mutated amino acid to amino acid mimics (e.g., phosphomimics). The mutation can be a conservative mutation. For example, the mutation converts the mutated amino acid to amino acids that resemble the size, shape, charge, polarity, conformation, and/or rotamers of the mutated amino acids (e.g., cysteine/serine mutation, lysine/asparagine mutation, histidine/phenylalanine mutation). The mutation can cause a shift in reading frame and/or the creation of a premature stop codon. Mutations can cause changes to regulatory regions of genes or loci that affect expression of one or more genes.

[00088] The site-directed polypeptide (e.g., variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive site-directed polypeptide) can target nucleic acid. The site- directed polypeptide (e.g., variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive endoribonuclease) can target DNA. The site-directed polypeptide (e.g., variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive

endoribonuclease) can target RNA.

[00089] The site-directed polypeptide can comprise one or more non-native sequences (e.g., the site-directed polypeptide is a fusion protein).

[00090] The site-directed polypeptide can comprise an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), a nucleic acid binding domain, and two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain).

[00091] The site-directed polypeptide can comprise an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain).

[00092] The site-directed polypeptide can comprise an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleaving domains, wherein one or both of the nucleic acid cleaving domains comprise at least 50% amino acid identity to a nuclease domain from Cas9 from a bacterium (e.g., S.

pyogenes).

[00093] The site-directed polypeptide can comprise an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain), and a non-native sequence (for example, a nuclear localization signal) or a linker linking the site-directed polypeptide to a non- native sequence.

[00094] The site-directed polypeptide can comprise an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain), wherein the site-directed polypeptide comprises a mutation in one or both of the nucleic acid cleaving domains that reduces the cleaving activity of the nuclease domains by at least 50%. [00095] The site-directed polypeptide can comprise an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain), wherein one of the nuclease domains comprises mutation of aspartic acid 10, and/or wherein one of the nuclease domains can comprise a mutation of histidine 840, and wherein the mutation reduces the cleaving activity of the nuclease domain(s) by at least 50%.

[00096] The one or more site-directed polypeptides, e.g. DNA endonucleases, can comprise two nickases that together effect one double-strand break at a specific locus in the genome, or four nickases that together effect or cause two double-strand breaks at specific loci in the genome. Alternatively, one site-directed polypeptide, e.g. DNA endonuclease, can effect or cause one double-strand break at a specific locus in the genome.

[00097] Non-limiting examples of Cas9 orthologs from other bacterial strains include but are not limited to, Cas proteins identified in Acaryochloris marina MBIC11017; Acetohalobium arabaticum DSM 5501; Acidithiobacillus caldus; Acidithiobacillus ferrooxidans ATCC 23270; Alicyclobacillus acidocaldarius LAAl; Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446; Allochromatium vinosum DSM 180; Ammonifex degensii KC4; Anabaena variabilis ATCC 29413; Arthrospira maxima CS-328; Arthrospira platensis sir. Paraca; Arthrospira sp. PCC 8005; Bacillus pseudomycoides DSM 12442; Bacillus selenitireducens MLS10;

Burkholderiales bacterium 1 1 47; Caldicelulosiruptor becscii DSM 6725; Candidatus Desulforudis audaxviator MP104C; Caldicellulosiruptor hydrothermalis 108; Clostridium phage c-st; Clostridium botulinum A3 str. Loch Mar ee ; Clostridium botulinum Ba4 str. 657; Clostridium difficile QCD-63q42; Crocosphaera watsonii WH 8501; Cyanothece sp. ATCC 51142; Cyanothece sp. CCY0110; Cyanothece sp. PCC 7424; Cyanothece sp. PCC 7822;

Exiguobacterium sibiricum 255-15; Finegoldia magna ATCC 29328; Ktedonobacter racemifer DSM 44963; Lactobacillus delbrueckii subsp. bulgaricus PB2003/044-T3-4; Lactobacillus salivarius ATCC 11741; Listeria innocua; Lyngbya sp. PCC 8106; Marinobacter sp. ELB17; Methanohalobium evestigatum Z-7303; Microcystis phage Ma-LMMO 1 ; Microcystis aeruginosa NIES-843 ; Microscilla marina ATCC 23134; Microcoleus chthonoplastes PCC 7420; Neisseria meningitidis; Nitrosococcus halophilus Nc4; Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111; Nodularia spumigena CCY9414; Nostoc sp. PCC 7120; Oscillatoria sp. PCC 6506; Pelotomaculum thermopropionicum SI; Petrotoga mobilis SJ95; Polar omonas

naphthalenivorans CJ2; Polaromonas sp. JS666; Pseudoalter omonas haloplanktis TAC125; Streptomyces pristinaespiralis ATCC 25486; Streptomyces pristinaespiralis ATCC 25486; Streptococcus thermophilics; Streptomyces viridochromogenes DSM 40736; Streptosporangium roseum DSM 43021; Synechococcus sp. PCC 7335; and Thermosipho africanus TCF52B (Chylinski et al., RNA Biol, 2013; 10(5): 726-737).

[00098] In addition to Cas9 orthologs, other Cas9 variants such as fusion proteins of inactive dCas9 and effector domains with different functions may be served as a platform for genetic modulation. Any of the foregoing enzymes may be useful in the present disclosure.

[00099] Further examples of endonucleases that may be utilized in the present disclosure are provided in SEQ ID NOs: 1-620. These proteins may be modified before use or may be encoded in a nucleic acid sequence such as a DNA, RNA or mRNA or within a vector construct such as the plasmids or AAV vectors taught herein. Further, they may be codon optimized.

[000100] SEQ ID NOs: 1-620 disclose a non-exhaustive listing of endonuclease sequences. Genome-targeting Nucleic Acid

[000101] The present disclosure provides a genome-targeting nucleic acid that can direct the activities of an associated polypeptide {e.g., a site-directed polypeptide) to a specific target sequence within a target nucleic acid. The genome-targeting nucleic acid can be an RNA. A genome-targeting RNA is referred to as a "guide RNA" or "gRNA" herein. A guide RNA can comprise at least a spacer sequence that hybridizes to a target nucleic acid sequence of interest, and a CRISPR repeat sequence. In Type II systems, the gRNA also comprises a second RNA called the tracrRNA sequence. In the Type II guide RNA (gRNA), the CRISPR repeat sequence and tracrRNA sequence hybridize to each other to form a duplex. In the Type V guide RNA (gRNA), the crRNA forms a duplex. In both systems, the duplex can bind a site-directed polypeptide, such that the guide RNA and site-direct polypeptide form a complex. The genome- targeting nucleic acid can provide target specificity to the complex by virtue of its association with the site-directed polypeptide. The genome-targeting nucleic acid thus can direct the activity of the site-directed polypeptide.

[000102] Exemplary guide RNAs include the spacer sequences in SEQ ID NOs: 5305-76012 of the Sequence Listing. As is understood by the person of ordinary skill in the art, each guide RNA can be designed to include a spacer sequence complementary to its genomic target sequence. For example, each of the spacer sequences in SEQ ID NOs: 5305-76012 of the Sequence Listing can be put into a single RNA chimera or a crRNA (along with a corresponding tracrRNA). See Jinek et al, Science, 337, 816-821 (2012) and Deltcheva et al, Nature, 471, 602-607 (2011). [000103] The genome-targeting nucleic acid can be a double-molecule guide RNA. The genome-targeting nucleic acid can be a single-molecule guide RNA.

[000104] A double-molecule guide RNA can comprise two strands of RNA. The first strand comprises in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence and a minimum CRISPR repeat sequence. The second strand can comprise a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3 ' tracrRNA sequence and an optional tracrRNA extension sequence.

[000105] A single-molecule guide RNA (sgRNA) in a Type II system can comprise, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3 ' tracrRNA sequence and an optional tracrRNA extension sequence. The optional tracrRNA extension can comprise elements that contribute additional functionality (e.g., stability) to the guide RNA. The single-molecule guide linker can link the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension can comprise one or more hairpins.

[000106] The sgRNA can comprise a 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. The sgRNA can comprise a less than a 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. The sgRNA can comprise a more than 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. The sgRNA can comprise a variable length spacer sequence with 17-30 nucleotides at the 5' end of the sgRNA sequence (see Table 1).

[000107] The sgRNA can comprise no uracil at the 3 'end of the sgRNA sequence, such as in SEQ ID NO: 76045 of Table 1. The sgRNA can comprise one or more uracil at the 3 'end of the sgRNA sequence, such as in SEQ ID NO: 76046 in Table 1. For example, the sgRNA can comprise 1 uracil (U) at the 3 ' end of the sgRNA sequence. The sgRNA can comprise 2 uracil (UU) at the 3 ' end of the sgRNA sequence. The sgRNA can comprise 3 uracil (UUU) at the 3 ' end of the sgRNA sequence. The sgRNA can comprise 4 uracil (UUUU) at the 3 ' end of the sgRNA sequence. The sgRNA can comprise 5 uracil (UUUUU) at the 3 ' end of the sgRNA sequence. The sgRNA can comprise 6 uracil (UUUUUU) at the 3 ' end of the sgRNA sequence. The sgRNA can comprise 7 uracil (ULJLJUUUU) at the 3 ' end of the sgRNA sequence. The sgRNA can comprise 8 uracil (UUUUUUUU) at the 3 ' end of the sgRNA sequence.

[000108] The sgRNA can be unmodified or modified. For example, modified sgRNAs can comprise one or more 2'-0-methyl phosphorothioate nucleotides. Table 1

[000109] A single-molecule guide RNA (sgRNA) in a Type V system can comprise, in the 5' to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence.

[000110] By way of illustration, guide RNAs used in the CRISPR/Cas9 or CRISPR/Cpfl system, or other smaller RNAs can be readily synthesized by chemical means, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 or Cpf 1 endonuclease, are more readily generated enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and/or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described in the art.

Spacer Extension Sequence

[000111] In some examples of genome-targeting nucleic acids, a spacer extension sequence can modify activity, provide stability and/or provide a location for modifications of a genome- targeting nucleic acid. A spacer extension sequence can modify on- or off-target activity or specificity. In some examples, a spacer extension sequence can be provided. The spacer extension sequence can have a length of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, or 7000 or more nucleotides. The spacer extension sequence can have a length of less than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, 7000 or more nucleotides. The spacer extension sequence can be less than 10 nucleotides in length. The spacer extension sequence can be between 10-30 nucleotides in length. The spacer extension sequence can be between 30-70 nucleotides in length.

[000112] The spacer extension sequence can comprise another moiety (e.g., a stability control sequence, an endoribonuclease binding sequence, a ribozyme). The moiety can decrease or increase the stability of a nucleic acid targeting nucleic acid. The moiety can be a transcriptional terminator segment (i.e., a transcription termination sequence). The moiety can function in a eukaryotic cell. The moiety can function in a prokaryotic cell. The moiety can function in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include: a 5' cap (e.g., a 7-methylguanylate cap (m7 G)), a riboswitch sequence (e.g., to allow for regulated stability and/or regulated accessibility by proteins and protein complexes), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like), a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and/or a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like).

Spacer Sequence

[000113] The spacer sequence hybridizes to a sequence in a target nucleic acid of interest. The spacer of a genome-targeting nucleic acid can interact with a target nucleic acid in a sequence- specific manner via hybridization (i.e., base pairing). The nucleotide sequence of the spacer can vary depending on the sequence of the target nucleic acid of interest.

[000114] In a CRISPR/Cas system herein, the spacer sequence can be designed to hybridize to a target nucleic acid that is located 5' of a PAM of the Cas9 enzyme used in the system. The spacer may perfectly match the target sequence or may have mismatches. Each Cas9 enzyme has a particular PAM sequence that it recognizes in a target DNA. For example, S. pyogenes recognizes in a target nucleic acid a PAM that comprises the sequence 5'-NRG-3', where R comprises either A or G, where N is any nucleotide and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.

[000115] The target nucleic acid sequence can comprise 20 nucleotides. The target nucleic acid can comprise less than 20 nucleotides. The target nucleic acid can comprise more than 20 nucleotides. The target nucleic acid can comprise at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target nucleic acid can comprise at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target nucleic acid sequence can comprise 20 bases immediately 5' of the first nucleotide of the PAM. For example, in a sequence comprising 5'-NNNNNNNNNNNNNNNNNNNNNRG-3' (SEQ ID NO: 76043), the target nucleic acid can comprise the sequence that corresponds to the Ns, wherein N is any nucleotide, and the underlined NRG sequence is the S. pyogenes PAM. This target nucleic acid sequence is often referred to as the PAM strand, and the complementary nucleic acid sequence is often referred to the non-PAM strand. One of skill in the art would recognize that the spacer sequence hybridizes to the non-PAM strand of the target nucleic acid (Figures 1 A and IB).

[000116] The spacer sequence that hybridizes to the target nucleic acid can have a length of at least about 6 nucleotides (nt). The spacer sequence can be at least about 6 nt, at least about 10 nt, at least about 15 nt, at least about 18 nt, at least about 19 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 35 nt or at least about 40 nt, from about 6 nt to about 80 nt, from about 6 nt to about 50 nt, from about 6 nt to about 45 nt, from about 6 nt to about 40 nt, from about 6 nt to about 35 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, from about 6 nt to about 20 nt, from about 6 nt to about 19 nt, from about 10 nt to about 50 nt, from about 10 nt to about 45 nt, from about 10 nt to about 40 nt, from about 10 nt to about 35 nt, from about 10 nt to about 30 nt, from about 10 nt to about 25 nt, from about 10 nt to about 20 nt, from about 10 nt to about 19 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 19 nt to about 60 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt, or from about 20 nt to about 60 nt. In some examples, the spacer sequence can comprise 20 nucleotides. In some examples, the spacer can comprise 19 nucleotides. In some examples, the spacer can comprise 18 nucleotides. In some examples, the spacer can comprise 22 nucleotides.

[000117] In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%), at least about 65%>, at least about 70%, at least about 75%, at least about 80%, at least about 85%), at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%), at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99%, or 100%. In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is 100% over the six contiguous 5'-most nucleotides of the target sequence of the complementary strand of the target nucleic acid. The percent complementarity between the spacer sequence and the target nucleic acid can be at least 60%) over about 20 contiguous nucleotides. The length of the spacer sequence and the target nucleic acid can differ by 1 to 6 nucleotides, which may be thought of as a bulge or bulges.

[000118] The spacer sequence can be designed or chosen using a computer program. The computer program can use variables, such as predicted melting temperature, secondary structure formation, predicted annealing temperature, sequence identity, genomic context, chromatin accessibility, % GC, frequency of genomic occurrence (e.g., of sequences that are identical or are similar but vary in one or more spots as a result of mismatch, insertion or deletion), methylation status, presence of S Ps, and the like.

Minimum CRISPR Repeat Sequence

[000119] In some aspects, a minimum CRISPR repeat sequence is a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%), about 90%, about 95%, or 100% sequence identity to a reference CRISPR repeat sequence {e.g., crRNA from S. pyogenes).

[000120] In some aspects, a minimum CRISPR repeat sequence comprises nucleotides that can hybridize to a minimum tracrRNA sequence in a cell. The minimum CRISPR repeat sequence and a minimum tracrRNA sequence can form a duplex, i.e. a base-paired double-stranded structure. Together, the minimum CRISPR repeat sequence and the minimum tracrRNA sequence can bind to the site-directed polypeptide. At least a part of the minimum CRISPR repeat sequence can hybridize to the minimum tracrRNA sequence. At least a part of the minimum CRISPR repeat sequence can comprise at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100%) complementary to the minimum tracrRNA sequence. In some aspects, at least a part of the minimum CRISPR repeat sequence comprises at most about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum tracrRNA sequence.

[000121] The minimum CRISPR repeat sequence can have a length from about 7 nucleotides to about 100 nucleotides. For example, the length of the minimum CRISPR repeat sequence is from about 7 nucleotides (nt) to about 50 nt, from about 7 nt to about 40 nt, from about 7 nt to about 30 nt, from about 7 nt to about 25 nt, from about 7 nt to about 20 nt, from about 7 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. In some aspects, the minimum CRISPR repeat sequence is approximately 9 nucleotides in length. In some aspects, the minimum CRISPR repeat sequence is approximately 12 nucleotides in length.

[000122] The minimum CRISPR repeat sequence can be at least about 60% identical to a reference minimum CRISPR repeat sequence (e.g., wild-type crRNA from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the minimum CRISPR repeat sequence can be at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical or 100% identical to a reference minimum CRISPR repeat sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides.

Minimum tracrRNA Sequence

[000123] A minimum tracrRNA sequence can be a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%), about 95%, or 100%) sequence identity to a reference tracrRNA sequence (e.g., wild type tracrRNA from S. pyogenes).

[000124] A minimum tracrRNA sequence can comprise nucleotides that hybridize to a minimum CRISPR repeat sequence in a cell. A minimum tracrRNA sequence and a minimum CRISPR repeat sequence form a duplex, i.e. a base-paired double-stranded structure. Together, the minimum tracrRNA sequence and the minimum CRISPR repeat can bind to a site-directed polypeptide. At least a part of the minimum tracrRNA sequence can hybridize to the minimum CRISPR repeat sequence. The minimum tracrRNA sequence can be at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%), about 95%), or 100% complementary to the minimum CRISPR repeat sequence.

[000125] The minimum tracrRNA sequence can have a length from about 7 nucleotides to about 100 nucleotides. For example, the minimum tracrRNA sequence can be from about 7 nucleotides (nt) to about 50 nt, from about 7 nt to about 40 nt, from about 7 nt to about 30 nt, from about 7 nt to about 25 nt, from about 7 nt to about 20 nt, from about 7 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt or from about 15 nt to about 25 nt long. The minimum tracrRNA sequence can be approximately 9 nucleotides in length. The minimum tracrRNA sequence can be approximately 12 nucleotides. The minimum tracrRNA can consist of tracrRNA nt 23-48 described in Jinek et al, supra.

[000126] The minimum tracrRNA sequence can be at least about 60% identical to a reference minimum tracrRNA {e.g., wild type, tracrRNA from S. pyogenes) sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the minimum tracrRNA sequence can be at least about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85%) identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical or 100% identical to a reference minimum tracrRNA sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides.

[000127] The duplex between the minimum CRISPR RNA and the minimum tracrRNA can comprise a double helix. The duplex between the minimum CRISPR RNA and the minimum tracrRNA can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. The duplex between the minimum CRISPR RNA and the minimum tracrRNA can comprise at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides.

[000128] The duplex can comprise a mismatch (i.e., the two strands of the duplex are not 100% complementary). The duplex can comprise at least about 1, 2, 3, 4, or 5 or mismatches. The duplex can comprise at most about 1, 2, 3, 4, or 5 or mismatches. The duplex can comprise no more than 2 mismatches.

Bulges

[000129] In some cases, there can be a "bulge" in the duplex between the minimum CRISPR RNA and the minimum tracrRNA. A bulge is an unpaired region of nucleotides within the duplex. A bulge can contribute to the binding of the duplex to the site-directed polypeptide. The bulge can comprise, on one side of the duplex, an unpaired 5'-XXXY-3' where X is any purine and Y comprises a nucleotide that can form a wobble pair with a nucleotide on the opposite strand, and an unpaired nucleotide region on the other side of the duplex. The number of unpaired nucleotides on the two sides of the duplex can be different.

[000130] In one example, the bulge can comprise an unpaired purine (e.g., adenine) on the minimum CRISPR repeat strand of the bulge. In some examples, the bulge can comprise an unpaired 5'-AAGY-3' of the minimum tracrRNA sequence strand of the bulge, where Y comprises a nucleotide that can form a wobble pairing with a nucleotide on the minimum

CRISPR repeat strand.

[000131] A bulge on the minimum CRISPR repeat side of the duplex can comprise at least 1, 2, 3, 4, or 5 or more unpaired nucleotides. A bulge on the minimum CRISPR repeat side of the duplex can comprise at most 1, 2, 3, 4, or 5 or more unpaired nucleotides. A bulge on the minimum CRISPR repeat side of the duplex can comprise 1 unpaired nucleotide.

[000132] A bulge on the minimum tracrRNA sequence side of the duplex can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. A bulge on the minimum tracrRNA sequence side of the duplex can comprise at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. A bulge on a second side of the duplex (e.g., the minimum tracrRNA sequence side of the duplex) can comprise 4 unpaired nucleotides.

[000133] A bulge can comprise at least one wobble pairing. In some examples, a bulge can comprise at most one wobble pairing. A bulge can comprise at least one purine nucleotide. A bulge can comprise at least 3 purine nucleotides. A bulge sequence can comprise at least 5 purine nucleotides. A bulge sequence can comprise at least one guanine nucleotide. In some examples, a bulge sequence can comprise at least one adenine nucleotide.

Hairpins

[000134] In various examples, one or more hairpins can be located 3' to the minimum tracrRNA in the 3' tracrRNA sequence.

[000135] The hairpin can start at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides 3' from the last paired nucleotide in the minimum CRISPR repeat and minimum tracrRNA sequence duplex. The hairpin can start at most about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleotides 3' of the last paired nucleotide in the minimum CRISPR repeat and minimum tracrRNA sequence duplex.

[000136] The hairpin can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more consecutive nucleotides. The hairpin can comprise at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or more consecutive nucleotides.

[000137] The hairpin can comprise a CC dinucleotide (i.e., two consecutive cytosine nucleotides).

[000138] The hairpin can comprise duplexed nucleotides (e.g., nucleotides in a hairpin, hybridized together). For example, a hairpin can comprise a CC dinucleotide that is hybridized to a GG dinucleotide in a hairpin duplex of the 3' tracrRNA sequence. [000139] One or more of the hairpins can interact with guide RNA-interacting regions of a site- directed polypeptide.

[000140] In some examples, there are two or more hairpins, and in other examples there are three or more hairpins.

3 ' tracrRNA sequence

[000141] A 3' tracrRNA sequence can comprise a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%), about 95%), or 100% sequence identity to a reference tracrRNA sequence (e.g., a tracrRNA from S. pyogenes).

[000142] The 3' tracrRNA sequence can have a length from about 6 nucleotides to about 100 nucleotides. For example, the 3' tracrRNA sequence can have a length from about 6 nucleotides (nt) to about 50 nt, from about 6 nt to about 40 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, from about 6 nt to about 20 nt, from about 6 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. The 3' tracrRNA sequence can have a length of approximately 14 nucleotides.

[000143] The 3' tracrRNA sequence can be at least about 60%> identical to a reference 3' tracrRNA sequence (e.g., wild type 3' tracrRNA sequence from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the 3' tracrRNA sequence can be at least about 60%) identical, about 65%> identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99%) identical, or 100% identical, to a reference 3' tracrRNA sequence (e.g., wild type 3' tracrRNA sequence from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides.

[000144] The 3' tracrRNA sequence can comprise more than one duplexed region (e.g., hairpin, hybridized region). The 3' tracrRNA sequence can comprise two duplexed regions.

[000145] The 3' tracrRNA sequence can comprise a stem loop structure. The stem loop structure in the 3' tracrRNA can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more nucleotides. The stem loop structure in the 3' tracrRNA can comprise at most 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleotides. The stem loop structure can comprise a functional moiety. For example, the stem loop structure can comprise an aptamer, a ribozyme, a protein-interacting hairpin, a CRISPR array, an intron, or an exon. The stem loop structure can comprise at least about 1, 2, 3, 4, or 5 or more functional moieties. The stem loop structure can comprise at most about 1, 2, 3, 4, or 5 or more functional moieties.

[000146] The hairpin in the 3' tracrRNA sequence can comprise a P-domain. In some examples, the P-domain can comprise a double-stranded region in the hairpin.

tracrRNA Extension Sequence

[000147] A tracrRNA extension sequence may be provided whether the tracrRNA is in the context of single-molecule guides or double-molecule guides. The tracrRNA extension sequence can have a length from about 1 nucleotide to about 400 nucleotides. The tracrRNA extension sequence can have a length of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, or 400 nucleotides. The tracrRNA extension sequence can have a length from about 20 to about 5000 or more nucleotides. The tracrRNA extension sequence can have a length of more than 1000 nucleotides. The tracrRNA extension sequence can have a length of less than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400 or more nucleotides. The tracrRNA extension sequence can have a length of less than 1000 nucleotides. The tracrRNA extension sequence can comprise less than 10 nucleotides in length. The tracrRNA extension sequence can be 10-30 nucleotides in length. The tracrRNA extension sequence can be 30-70 nucleotides in length.

[000148] The tracrRNA extension sequence can comprise a functional moiety {e.g., a stability control sequence, ribozyme, endoribonuclease binding sequence). The functional moiety can comprise a transcriptional terminator segment {i.e., a transcription termination sequence). The functional moiety can have a total length from about 10 nucleotides (nt) to about 100

nucleotides, from about 10 nt to about 20 nt, from about 20 nt to about 30 nt, from about 30 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. The functional moiety can function in a eukaryotic cell. The functional moiety can function in a prokaryotic cell. The functional moiety can function in both eukaryotic and prokaryotic cells.

[000149] Non-limiting examples of suitable tracrRNA extension functional moieties include a 3' poly-adenylated tail, a riboswitch sequence {e.g., to allow for regulated stability and/or regulated accessibility by proteins and protein complexes), a sequence that forms a dsRNA duplex {i.e., a hairpin), a sequence that targets the RNA to a subcellular location {e.g., nucleus, mitochondria, chloroplasts, and the like), a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and/or a

modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like). The tracrRNA extension sequence can comprise a primer binding site or a molecular index (e.g., barcode sequence). The tracrRNA extension sequence can comprise one or more affinity tags.

Single-Molecule Guide Linker Sequence

[000150] The linker sequence of a single-molecule guide nucleic acid can have a length from about 3 nucleotides to about 100 nucleotides. In Jinek et al, supra, for example, a simple 4 nucleotide "tetraloop" (-GAAA-) was used, Science, 337(6096):816-821 (2012). An illustrative linker has a length from about 3 nucleotides (nt) to about 90 nt, from about 3 nt to about 80 nt, from about 3 nt to about 70 nt, from about 3 nt to about 60 nt, from about 3 nt to about 50 nt, from about 3 nt to about 40 nt, from about 3 nt to about 30 nt, from about 3 nt to about 20 nt, from about 3 nt to about 10 nt. For example, the linker can have a length from about 3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, from about 20 nt to about 25 nt, from about 25 nt to about 30 nt, from about 30 nt to about 35 nt, from about 35 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt. The linker of a single-molecule guide nucleic acid can be between 4 and 40 nucleotides. The linker can be at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. The linker can be at most about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides.

[000151] Linkers can comprise any of a variety of sequences, although in some examples the linker will not comprise sequences that have extensive regions of homology with other portions of the guide RNA, which might cause intramolecular binding that could interfere with other functional regions of the guide. In Jinek et al, supra, a simple 4 nucleotide sequence -GAAA- was used, Science, 337(6096):816-821 (2012), but numerous other sequences, including longer sequences can likewise be used.

[000152] The linker sequence can comprise a functional moiety. For example, the linker sequence can comprise one or more features, including an aptamer, a ribozyme, a protein- interacting hairpin, a protein binding site, a CRISPR array, an intron, or an exon. The linker sequence can comprise at least about 1, 2, 3, 4, or 5 or more functional moieties. In some examples, the linker sequence can comprise at most about 1, 2, 3, 4, or 5 or more functional moieties.

Nucleic acid modifications (chemical and structural modifications)

[000153] In some aspects, polynucleotides introduced into cells can comprise one or more modifications that can be used individually or in combination, for example, to enhance activity, stability or specificity, alter delivery, reduce innate immune responses in host cells, or for other enhancements, as further described herein and known in the art.

[000154] In certain examples, modified polynucleotides can be used in the CRISPR/Cas9 or CRISPR/Cpfl system, in which case the guide RNAs (either single-molecule guides or double- molecule guides) and/or a DNA or an RNA encoding a Cas9 or Cpf 1 endonuclease introduced into a cell can be modified, as described and illustrated below. Such modified polynucleotides can be used in the CRISPR/Cas9 or CRISPR/Cpfl system to edit any one or more genomic loci.

[000155] Using the CRISPR/Cas9 or CRISPR/Cpfl system for purposes of non-limiting illustrations of such uses, modifications of guide RNAs can be used to enhance the formation or stability of the CRISPR/Cas9 or CRISPR/Cpfl genome editing complex comprising guide RNAs, which can be single-molecule guides or double-molecule, and a Cas9 or Cpfl endonuclease. Modifications of guide RNAs can also or alternatively be used to enhance the initiation, stability or kinetics of interactions between the genome editing complex with the target sequence in the genome, which can be used, for example, to enhance on-target activity. Modifications of guide RNAs can also or alternatively be used to enhance specificity, e.g., the relative rates of genome editing at the on-target site as compared to effects at other (off-target) sites.

[000156] Modifications can also or alternatively be used to increase the stability of a guide RNA, e.g., by increasing its resistance to degradation by ribonucleases (RNases) present in a cell, thereby causing its half-life in the cell to be increased. Modifications enhancing guide RNA half-life can be particularly useful in aspects in which a Cas9 or Cpfl endonuclease is introduced into the cell to be edited via an RNA that needs to be translated in order to generate

endonuclease, because increasing the half-life of guide RNAs introduced at the same time as the RNA encoding the endonuclease can be used to increase the time that the guide RNAs and the encoded Cas9 or Cpfl endonuclease co-exist in the cell. [000157] Modifications can also or alternatively be used to decrease the likelihood or degree to which RNAs introduced into cells elicit innate immune responses. Such responses, which have been well characterized in the context of RNA interference (RNAi), including small-interfering RNAs (siRNAs), as described below and in the art, tend to be associated with reduced half-life of the RNA and/or the elicitation of cytokines or other factors associated with immune responses.

[000158] One or more types of modifications can also be made to RNAs encoding an endonuclease that are introduced into a cell, including, without limitation, modifications that enhance the stability of the RNA (such as by increasing its degradation by RNases present in the cell), modifications that enhance translation of the resulting product (i.e. the endonuclease), and/or modifications that decrease the likelihood or degree to which the RNAs introduced into cells elicit innate immune responses.

[000159] Combinations of modifications, such as the foregoing and others, can likewise be used. In the case of CRISPR/Cas9 or CRISPR/Cpfl, for example, one or more types of modifications can be made to guide RNAs (including those exemplified above), and/or one or more types of modifications can be made to RNAs encoding Cas endonuclease (including those exemplified above).

[000160] By way of illustration, guide RNAs used in the CRISPR/Cas9 or CRISPR/Cpfl system, or other smaller RNAs can be readily synthesized by chemical means, enabling a number of modifications to be readily incorporated, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high-performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach that can be used for generating chemically-modified RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 endonuclease, are more readily generated enzymatically. While fewer types of modifications are available for use in

enzymatically produced RNAs, there are still modifications that can be used to, e.g., enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described further below and in the art; and new types of modifications are regularly being developed.

[000161] By way of illustration of various types of modifications, especially those used frequently with smaller chemically synthesized RNAs, modifications can comprise one or more nucleotides modified at the 2' position of the sugar, in some aspects a 2'-0-alkyl, 2'-0-alkyl-0- alkyl, or 2'-fluoro-modified nucleotide. In some examples, RNA modifications include 2'-fluoro, 2'-amino or 2'-0-methyl modifications on the ribose of pyrimidines, abasic residues, or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than 2'-deoxyoligonucleotides against a given target.

[000162] A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligonucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Some oligonucleotides are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH ₂ -NH-0-CH ₂ ,

CH,~N(CH ₃ )~0~CH ₂ (known as a methylene(methylimino) or MMI backbone), CH ₂ -0-N

(CH ₃ )-CH ₂ , CH ₂ -N (CH ₃ )-N (CH ₃ )-CH ₂ and O-N (CH ₃ )- CH ₂ -CH ₂ backbones, wherein the native phosphodiester backbone is represented as O- P- O- CH,); amide backbones [see De Mesmaeker et al., Ace. Chem. Res., 28:366-374 (1995)]; morpholino backbone structures (see Summerton and Weller, U.S. Patent No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497). Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates,

phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and

boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5, 177, 196; 5, 188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321, 131; 5,399,676; 5,405,939; 5,453,496;

5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253;

5,571,799; 5,587,361; and 5,625,050. [000163] Morpholino-based oligomeric compounds are described in Braasch and David Corey, Biochemistry, 41(14): 4503-4510 (2002); Genesis, Volume 30, Issue 3, (2001); Heasman, Dev. Biol., 243 : 209-214 (2002); Nasevicius et al., Nat. Genet., 26:216-220 (2000); Lacerra et al, Proc. Natl. Acad. Sci., 97: 9591-9596 (2000); and U.S. Patent No. 5,034,506, issued Jul. 23, 1991.

[000164] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc, 122: 8595-8602 (2000).

[000165] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH ₂ component parts; see U.S. Patent Nos. 5,034,506; 5,166,315; 5, 185,444; 5,214, 134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086;

5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312;

5,633,360; 5,677,437; and 5,677,439.

[000166] One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH ₃ , F, OCN, OCH ₃ OCH ₃ , OCH ₃ 0(CH ₂ )n CH ₃ , 0(CH ₂ )n NH ₂ , or 0(CH ₂ )n CH ₃ , where n is from 1 to about 10; CI to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; CI; Br; CN; CF ₃ ; OCF ₃ ; 0-, S-, or N- alkyl; 0-, S-, or N-alkenyl; SOCH ₃ ; S0 ₂ CH ₃ ; ON0 ₂ ; N0 ₂ ; N ₃ ; NH ₂ ; heterocycloalkyl;

heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. In some aspects, a modification includes 2'- methoxyethoxy (2'-0-CH ₂ CH ₂ OCH ₃ , also known as 2'-0-(2-methoxyethyl)) (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other modifications include 2'-methoxy (2'-0-CH ₃ ), 2'-propoxy (2'- OCH ₂ CH ₂ CH ₃ ) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics, such as cyclobutyls in place of the pentofuranosyl group.

[000167] In some examples, both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units can be replaced with novel groups. The base units can be maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar- backbone of an oligonucleotide can be replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases can be retained and bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds comprise, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262. Further teaching of PNA compounds can be found in Nielsen et al, Science, 254: 1497-1500 (1991).

[000168] Guide RNAs can also include, additionally or alternatively, nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5- methylcytosine (also referred to as 5-methyl-2' deoxy cytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino) adenine, 2-

(imidazolylalkyl)adenine, 2-(aminoalklyamino) adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7- deazaguanine, N6 (6-aminohexyl) adenine, and 2,6-diaminopurine. Kornberg, A., DNA

Replication, W. H. Freeman & Co., San Francisco, pp. 75-77 (1980); Gebeyehu et al., Nucl. Acids Res. 15:4513 (1997). A "universal" base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2 °C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and

Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are aspects of base substitutions.

[000169] Modified nucleobases can comprise other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5- uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8- azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine.

[000170] Further, nucleobases can comprise those disclosed in U.S. Patent No. 3,687,808, those disclosed in 'The Concise Encyclopedia of Polymer Science And Engineering', pages 858- 859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al,

Angewandle Chemie, International Edition', 1991, 30, page 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications', pages 289- 302, Crooke, S.T. and Lebleu, B. ea., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the present disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) and are aspects of base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications. Modified nucleobases are described in U.S. Patent Nos. 3,687,808, as well as 4,845,205; 5, 130,302; 5, 134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502, 177; 5,525,711; 5,552,540; 5,587,469;

5,596,091; 5,614,617; 5,681,941; 5,750,692; 5,763,588; 5,830,653; 6,005,096; and U.S. Patent Application Publication 2003/0158403.

[000171] Thus, the term "modified" refers to a non-natural sugar, phosphate, or base that is incorporated into a guide RNA, an endonuclease, or both a guide RNA and an endonuclease. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single

oligonucleotide, or even in a single nucleoside within an oligonucleotide.

[000172] The guide RNAs and/or mRNA (or DNA) encoding an endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties comprise, but are not limited to, lipid moieties such as a cholesterol moiety [Letsinger et al, Proc. Natl. Acad. Sci. USA, 86: 6553-6556 (1989)]; cholic acid [Manoharan et al, Bioorg. Med. Chem. Let., 4: 1053- 1060 (1994)]; a thioether, e.g., hexyl-S- tritylthiol [Manoharan et al, Ann. N. Y. Acad. Sci., 660: 306-309 (1992) and Manoharan et a/., Bioorg. Med. Chem. Let., 3 : 2765-2770 (1993)]; a thiocholesterol [Oberhauser et a/., Nucl. Acids Res., 20: 533-538 (1992)]; an aliphatic chain, e.g., dodecandiol or undecyl residues [Kabanov et al., FEBS Lett., 259: 327-330 (1990) and Svinarchuk et al., Biochimie, 75: 49- 54 (1993)]; a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl- rac-glycero-3-H-phosphonate [Manoharan et al., Tetrahedron Lett., 36: 3651-3654 (1995) and Shea et al, Nucl. Acids Res., 18: 3777-3783 (1990)]; a polyamine or a polyethylene glycol chain [Mancharan et al, Nucleosides &

Nucleotides, 14: 969-973 (1995)]; adamantane acetic acid [Manoharan et a/., Tetrahedron Lett., 36: 3651-3654 (1995)]; a palmityl moiety [(Mishra et al., Biochim. Biophys. Acta, 1264: 229- 237 (1995)]; or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety [Crooke et al, J. Pharmacol. Exp. Ther., 277: 923-937 (1996)]. See also U.S. Patent Nos. 4,828,979;

4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731;

5,580,731; 5,591,584; 5,109, 124; 5, 118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439;

5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941;

4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;

5, 112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873;

5,317,098; 5,371,241; 5,391,723; 5,416,203; 5,451,463; 5,510,475; 5,512,667; 5,514,785;

5,565,552; 5,567,810; 5,574, 142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599, 928 and 5,688,941.

[000173] Sugars and other moieties can be used to target proteins and complexes comprising nucleotides, such as cationic polysomes and liposomes, to particular sites. For example, hepatic cell directed transfer can be mediated via asialoglycoprotein receptors (ASGPRs); see, e.g., Hu, et al, Protein Pept Lett. 21(10): 1025-30 (2014). Other systems known in the art and regularly developed can be used to target biomolecules of use in the present case and/or complexes thereof to particular target cells of interest.

[000174] These targeting moieties or conjugates can include conjugate groups covalently bound to functional groups, such as primary or secondary hydroxyl groups. Conjugate groups of the present disclosure include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this disclosure, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this present disclosure, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present disclosure. Representative conjugate groups are disclosed in International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992 (published as WO1993007883), and U.S. Patent No. 6,287,860. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium 1,2-di-O- hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, e.g., U.S. Patent Nos. 4,828,979; 4,948,882; 5,218, 105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5, 109,124;

5, 118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044;

4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582;

4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022;

5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241; 5,391,723;

5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142;

5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.

[000175] Longer polynucleotides that are less amenable to chemical synthesis and are typically produced by enzymatic synthesis can also be modified by various means. Such modifications can include, for example, the introduction of certain nucleotide analogs, the incorporation of particular sequences or other moieties at the 5' or 3' ends of molecules, and other modifications. By way of illustration, the mRNA encoding Cas9 is approximately 4 kb in length and can be synthesized by in vitro transcription. Modifications to the mRNA can be applied to, e.g., increase its translation or stability (such as by increasing its resistance to degradation with a cell), or to reduce the tendency of the RNA to elicit an innate immune response that is often observed in cells following introduction of exogenous RNAs, particularly longer RNAs such as that encoding Cas9.

[000176] Numerous such modifications have been described in the art, such as polyA tails, 5' cap analogs {e.g., Anti Reverse Cap Analog (ARC A) or m7G(5')ppp(5')G (mCAP)), modified 5' or 3' untranslated regions (UTRs), use of modified bases (such as Pseudo-UTP, 2-Thio-UTP, 5- Methylcytidine-5'-Triphosphate (5-Methyl-CTP) or N6-Methyl-ATP), or treatment with phosphatase to remove 5' terminal phosphates. These and other modifications are known in the art, and new modifications of RNAs are regularly being developed.

[000177] There are numerous commercial suppliers of modified RNAs, including for example, TriLink Biotech, AxoLabs, Bio-Synthesis Inc., Dharmacon and many others. As described by TriLink, for example, 5-Methyl-CTP can be used to impart desirable characteristics, such as increased nuclease stability, increased translation or reduced interaction of innate immune receptors with in vitro transcribed RNA. 5-Methylcytidine-5'-Triphosphate (5-Methyl-CTP), N6-Methyl-ATP, as well as Pseudo-UTP and 2-Thio-UTP, have also been shown to reduce innate immune stimulation in culture and in vivo while enhancing translation, as illustrated in publications by Kormann et al. and Warren et al. referred to below.

[000178] It has been shown that chemically modified mRNA delivered in vivo can be used to achieve improved therapeutic effects; see, e.g., Kormann et al., Nature Biotechnology 29, 154— 157 (2011). Such modifications can be used, for example, to increase the stability of the RNA molecule and/or reduce its immunogenicity. Using chemical modifications such as Pseudo-U, N6-Methyl-A, 2-Thio-U and 5-Methyl-C, it was found that substituting just one quarter of the uridine and cytidine residues with 2-Thio-U and 5-Methyl-C respectively resulted in a significant decrease in toll-like receptor (TLR) mediated recognition of the mRNA in mice. By reducing the activation of the innate immune system, these modifications can be used to effectively increase the stability and longevity of the mRNA in vivo; see, e.g., Kormann et al., supra.

[000179] It has also been shown that repeated administration of synthetic messenger RNAs incorporating modifications designed to bypass innate anti-viral responses can reprogram differentiated human cells to pluripotency. See, e.g., Warren, et al., Cell Stem Cell, 7(5):618-30 (2010). Such modified mRNAs that act as primary reprogramming proteins can be an efficient means of reprogramming multiple human cell types. Such cells are referred to as induced pluripotency stem cells (iPSCs), and it was found that enzymatically synthesized RNA incorporating 5-Methyl-CTP, Pseudo-UTP and an Anti Reverse Cap Analog (ARCA) could be used to effectively evade the cell's antiviral response; see, e.g., Warren et al., supra.

[000180] Other modifications of polynucleotides described in the art include, for example, the use of polyA tails, the addition of 5' cap analogs (such as m7G(5')ppp(5')G (mCAP)), modifications of 5' or 3' untranslated regions (UTRs), or treatment with phosphatase to remove 5' terminal phosphates - and new approaches are regularly being developed.

[000181] A number of compositions and techniques applicable to the generation of modified RNAs for use herein have been developed in connection with the modification of RNA interference (RNAi), including small-interfering RNAs (siRNAs). siRNAs present particular challenges in vivo because their effects on gene silencing via mRNA interference are generally transient, which can require repeat administration. In addition, siRNAs are double-stranded RNAs (dsRNA) and mammalian cells have immune responses that have evolved to detect and neutralize dsRNA, which is often a by-product of viral infection. Thus, there are mammalian enzymes such as PKR (dsRNA-responsive kinase), and potentially retinoic acid-inducible gene I (RIG-I), that can mediate cellular responses to dsRNA, as well as Toll-like receptors (such as TLR3, TLR7 and TLR8) that can trigger the induction of cytokines in response to such molecules; see, e.g., the reviews by Angart et al, Pharmaceuticals (Basel) 6(4): 440-468 (2013); Kanasty et al, Molecular Therapy 20(3): 513-524 (2012); Burnett et al, Biotechnol J.

6(9): 1130-46 (2011); Judge and MacLachlan, Hum Gene Ther 19(2): 111-24 (2008); and references cited therein.

[000182] A large variety of modifications have been developed and applied to enhance RNA stability, reduce innate immune responses, and/or achieve other benefits that can be useful in connection with the introduction of polynucleotides into human cells, as described herein; see, e.g., the reviews by Whitehead KA et al, Annual Review of Chemical and Biomolecular Engineering, 2: 77-96 (2011); Gaglione and Messere, Mini Rev Med Chem, 10(7):578-95 (2010); Chernolovskaya et al, Curr Opin Mol Ther., 12(2): 158-67 (2010); Deleavey et al, Curr Protoc Nucleic Acid Chem Chapter 16:Unit 16.3 (2009); Behlke, Oligonucleotides 18(4):305-19 (2008); Fucini et al, Nucleic Acid Ther 22(3): 205-210 (2012); Bremsen et al, Front Genet 3 : 154 (2012).

[000183] As noted above, there are a number of commercial suppliers of modified RNAs, many of which have specialized in modifications designed to improve the effectiveness of siRNAs. A variety of approaches are offered based on various findings reported in the literature. For example, Dharmacon notes that replacement of a non-bridging oxygen with sulfur

(phosphorothioate, PS) has been extensively used to improve nuclease resistance of siRNAs, as reported by Kole, Nature Reviews Drug Discovery 11 : 125-140 (2012). Modifications of the 2'- position of the ribose have been reported to improve nuclease resistance of the internucleotide phosphate bond while increasing duplex stability (Tm), which has also been shown to provide protection from immune activation. A combination of moderate PS backbone modifications with small, well -tolerated 2'-substitutions (2'-0-Methyl, 2'-Fluoro, 2'-Hydro) have been associated with highly stable siRNAs for applications in vivo, as reported by Soutschek et al. Nature 432: 173-178 (2004); and 2'-0-Methyl modifications have been reported to be effective in improving stability as reported by Volkov, Oligonucleotides 19: 191-202 (2009). With respect to decreasing the induction of innate immune responses, modifying specific sequences with 2'-0- Methyl, 2'-Fluoro, 2'-Hydro have been reported to reduce TLR7/TLR8 interaction while generally preserving silencing activity; see, e.g., Judge et al., Mol. Ther. 13 :494-505 (2006); and Cekaite et al., J. Mol. Biol. 365:90-108 (2007). Additional modifications, such as 2-thiouracil, pseudouracil, 5-methylcytosine, 5-methyluracil, and N6-methyladenosine have also been shown to minimize the immune effects mediated by TLR3, TLR7, and TLR8; see, e.g., Kariko, K. et al, Immunity 23 : 165-175 (2005).

[000184] As is also known in the art, and commercially available, a number of conjugates can be applied to polynucleotides, such as RNAs, for use herein that can enhance their delivery and/or uptake by cells, including for example, cholesterol, tocopherol and folic acid, lipids, peptides, polymers, linkers and aptamers; see, e.g., the review by Winkler, Ther. Deliv. 4:791- 809 (2013), and references cited therein.

Codon- Optimization

[000185] A polynucleotide encoding a site-directed polypeptide can be codon-optimized according to methods standard in the art for expression in the cell containing the target DNA of interest. For example, if the intended target nucleic acid is in a human cell, a human codon- optimized polynucleotide encoding Cas9 is contemplated for use for producing the Cas9 polypeptide.

Complexes of a Genome-targeting Nucleic Acid and a Site-Directed Polypeptide

[000186] A genome-targeting nucleic acid interacts with a site-directed polypeptide {e.g., a nucleic acid-guided nuclease such as Cas9), thereby forming a complex. The genome-targeting nucleic acid guides the site-directed polypeptide to a target nucleic acid.

Ribonucleoprotein complexes (RNPs)

[000187] The site-directed polypeptide and genome-targeting nucleic acid can each be administered separately to a cell or a patient. On the other hand, the site-directed polypeptide can be pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA. The pre-complexed material can then be administered to a cell or a patient. Such pre-complexed material is known as a ribonucleoprotein particle (RNP). The site-directed polypeptide in the RNP can be, for example, a Cas9 endonuclease or a Cpfl endonuclease. The site-directed polypeptide can be flanked at the N-terminus, the C-terminus, or both the N- terminus and C-terminus by one or more nuclear localization signals (NLSs). For example, a Cas9 endonuclease can be flanked by two NLSs, one NLS located at the N-terminus and the second NLS located at the C-terminus. The NLS can be any NLS known in the art, such as a SV40 NLS. The weight ratio of genome-targeting nucleic acid to site-directed polypeptide in the RNP can be 1 : 1. For example, the weight ratio of sgRNA to Cas9 endonuclease in the RNP can be 1 : 1.

Nucleic Acids Encoding System Components

[000188] The present disclosure provides a nucleic acid comprising a nucleotide sequence encoding a genome-targeting nucleic acid of the disclosure, a site-directed polypeptide of the disclosure, and/or any nucleic acid or proteinaceous molecule necessary to carry out the aspects of the methods of the disclosure.

[000189] The nucleic acid encoding a genome-targeting nucleic acid of the disclosure, a site- directed polypeptide of the disclosure, and/or any nucleic acid or proteinaceous molecule necessary to carry out the aspects of the methods of the disclosure can comprise a vector {e.g., a recombinant expression vector).

[000190] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional nucleic acid segments can be ligated.

Another type of vector is a viral vector, wherein additional nucleic acid segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced {e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors {e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.

[000191] In some examples, vectors can be capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors", or more simply "expression vectors", which serve equivalent functions.

[000192] The term "operably linked" means that the nucleotide sequence of interest is linked to regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers and other expression control elements {e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells, and those that direct expression of the nucleotide sequence only in certain host cells {e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the target cell, the level of expression desired, and the like.

[000193] Expression vectors contemplated include, but are not limited to, viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retrovirus (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus) and other recombinant vectors. Other vectors contemplated for eukaryotic target cells include, but are not limited to, the vectors pXTl, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). Other vectors can be used so long as they are compatible with the host cell.

[000194] In some examples, a vector can comprise one or more transcription and/or translation control elements. Depending on the host/vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. can be used in the expression vector. The vector can be a self-inactivating vector that either inactivates the viral sequences or the components of the CRISPR machinery or other elements.

[000195] Non-limiting examples of suitable eukaryotic promoters (i.e., promoters functional in a eukaryotic cell) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retrovirus, human elongation factor-1 promoter (EF1), a hybrid construct comprising the cytomegalovirus (CMV) enhancer fused to the chicken beta-actin promoter (CAG), murine stem cell virus promoter (MSCV), phosphogly cerate kinase- 1 locus promoter (PGK), and mouse metallothionein-I.

[000196] For expressing small RNAs, including guide RNAs used in connection with Cas endonuclease, various promoters such as RNA polymerase III promoters, including for example U6 and HI, can be advantageous. Descriptions of and parameters for enhancing the use of such promoters are known in art, and additional information and approaches are regularly being described; see, e.g., Ma, H. et al, Molecular Therapy - Nucleic Acids 3, el61 (2014) doi: 10.1038/mtna.2014.12.

[000197] The expression vector can also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector can also comprise appropriate sequences for amplifying expression. The expression vector can also include nucleotide sequences encoding non-native tags (e.g., histidine tag, hemagglutinin tag, green fluorescent protein, etc.) that are fused to the site-directed polypeptide, thus resulting in a fusion protein.

[000198] A promoter can be an inducible promoter (e.g., a heat shock promoter, tetracycline- regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor- regulated promoter, etc.). The promoter can be a constitutive promoter (e.g., CMV promoter, UBC promoter). In some cases, the promoter can be a spatially restricted and/or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.).

[000199] The nucleic acid encoding a genome-targeting nucleic acid of the disclosure and/or a site-directed polypeptide can be packaged into or on the surface of delivery vehicles for delivery to cells. Delivery vehicles contemplated include, but are not limited to, nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles. As described in the art, a variety of targeting moieties can be used to enhance the preferential interaction of such vehicles with desired cell types or locations.

[000200] Introduction of the complexes, polypeptides, and nucleic acids of the disclosure into cells can occur by viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.

Therapeutic approach

[000201] Provided herein are methods for treating a patient with pain. An aspect of such method is an ex vivo cell-based therapy. For example, a biopsy of the patient's peripheral nerves is performed. The nerve tissue can be isolated from the patient's skin or leg. Then, a cell of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) is isolated from the biopsied material. Then, the chromosomal DNA of the cell of the peripheral nervous system (e.g., a neuron, or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) can be edited using the materials and methods described herein. Finally, the edited cell of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) is implanted into the patient. Any source or type of cell may be used as the progenitor cell.

[000202] Another aspect of such method is an ex vivo cell-based therapy. For example, a patient specific induced pluripotent stem cell (iPSC) can be created. Then, the chromosomal DNA of these iPSC cells can be edited using the materials and methods described herein. Next, the genome-edited iPSCs can be differentiated into cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia). Finally, the differentiated cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) are implanted into the patient.

[000203] Yet another aspect of such method is an ex vivo cell-based therapy. For example, a mesenchymal stem cell can be isolated from the patient, which can be isolated from the patient's bone marrow or peripheral blood. Next, the chromosomal DNA of these mesenchymal stem cells can be edited using the materials and methods described herein. Next, the genome-edited mesenchymal stem cells can be differentiated into cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia). Finally, the differentiated cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) are implanted into the patient.

[000204] One advantage of an ex vivo cell therapy approach is the ability to conduct a comprehensive analysis of the therapeutic prior to administration. Nuclease-based therapeutics can have some level of off-target effects. Performing gene editing ex vivo allows one to characterize the edited cell population prior to implantation. The present disclosure includes sequencing the entire genome of the edited cells to ensure that the off-target effects, if any, can be in genomic locations associated with minimal risk to the patient. Furthermore, populations of specific cells, including clonal populations, can be isolated prior to implantation.

[000205] Another advantage of ex vivo cell therapy relates to genetic modification in iPSCs compared to other primary cell sources. iPSCs are prolific, making it easy to obtain the large number of cells that will be required for a cell-based therapy. Furthermore, iPSCs are an ideal cell type for performing clonal isolations. This allows screening for the correct genomic modification, without risking a decrease in viability. In contrast, other primary cells, such as glial cells, are viable for only a few passages and difficult to clonally expand. Thus,

manipulation of iPSCs for the treatment of pain can be much easier, and can shorten the amount of time needed to make the desired genetic modification.

[000206] Methods can also include an in vivo based therapy. Chromosomal DNA of the cells in the patient is edited using the materials and methods described herein. In some aspects, the target cell in an in vivo based therapy is a neuron of the peripheral nervous system.

[000207] Although certain cells present an attractive target for ex vivo treatment and therapy, increased efficacy in delivery may permit direct in vivo delivery to such cells. Ideally the targeting and editing would be directed to the relevant cells. Cleavage in other cells can also be prevented by the use of promoters only active in certain cells and or developmental stages.

Additional promoters are inducible, and therefore can be temporally controlled if the nuclease is delivered as a plasmid. The amount of time that delivered RNA and protein remain in the cell can also be adjusted using treatments or domains added to change the half-life. In vivo treatment would eliminate a number of treatment steps, but a lower rate of delivery can require higher rates of editing. In vivo treatment can eliminate problems and losses from ex vivo treatment and engraftment and post-engraftment integration of neurons and glial cells appropriately into existing brain circuits.

[000208] An advantage of in vivo gene therapy can be the ease of therapeutic production and administration. The same therapeutic approach and therapy will have the potential to be used to treat more than one patient, for example a number of patients who share the same or similar genotype or allele. In contrast, ex vivo cell therapy typically requires using a patient's own cells, which are isolated, manipulated and returned to the same patient.

[000209] Also provided herein is a cellular method for editing the SCN10A gene in a cell by genome editing. For example, a cell can be isolated from a patient or animal. Then, the chromosomal DNA of the cell can be edited using the materials and methods described herein.

[000210] The methods provided herein, regardless of whether a cellular or ex vivo or in vivo method, can involve reducing (knock-down) or eliminating (knock-out) the expression of the SCN10A gene by introducing one or more insertions, deletions or mutations within or near the SCN10A gene or other DNA sequences that encode regulatory elements of the SCN10A gene.

[000211] For example, the knock-down or knock-out strategy can involve disrupting the reading frame in the SCN10A gene by introducing random insertions or deletions (indels) that arise due to the imprecise NHEJ repair pathway. This can be achieved by inducing one single stranded break or double stranded break in the SCN10A gene with one or more CRISPR endonucleases and a gRNA (e.g., crRNA + tracrRNA, or sgRNA), or two or more single stranded breaks or double stranded breaks in the SCN10A gene with two or more CRISPR endonucleases and two or more sgRNAs. This approach can require development and optimization of sgRNAs for the SCN10A gene.

[000212] Alternatively, the knock-down or knock-out strategy can also involve deletion of one or more segments within or near the SCN10A gene or other DNA sequences that encode regulatory elements of the SCN10A gene. This deletion strategy requires at least a pair of gRNAs (e.g., crRNA + tracrRNA, or sgRNA) capable of binding to two different sites within or near the SCN10A gene and one or more CRISPR endonucleases. The CRISPR endonucleases, configured with the two gRNAs, induce two double stranded breaks at the desired locations. After cleavage, the two ends, regardless of whether blunt or with overhangs, can be joined by HEJ, leading to the deletion of the intervening segment. HEJ repair pathways can lead to insertions, deletions or mutations at the joints.

[000213] In addition to the above genome editing strategies, another strategy involves modulating expression, function, or activity of SCN10A by editing in the regulatory sequence.

[000214] In addition to the editing options listed above, Cas9 or similar proteins can be used to target effector domains to the same target sites that can be identified for editing, or additional target sites within range of the effector domain. A range of chromatin modifying enzymes, methylases or demethylases can be used to alter expression of the target gene. One possibility is decreasing the expression of the SCN10A protein if a mutation leads to undesirable activity. These types of epigenetic regulation have some advantages, particularly as they are limited in possible off-target effects.

[000215] A number of types of genomic target sites can be present in addition to the coding and splicing sequences.

[000216] The regulation of transcription and translation implicates a number of different classes of sites that interact with cellular proteins or nucleotides. Often the DNA binding sites of transcription factors or other proteins can be targeted for mutation or deletion to study the role of the site, though they can also be targeted to change gene expression. Sites can be added through non-homologous end joining NHEJ or direct genome editing by homology directed repair (HDR). Increased use of genome sequencing, RNA expression and genome-wide studies of transcription factor binding have increased our ability to identify how the sites lead to developmental or temporal gene regulation. These control systems can be direct or can involve extensive cooperative regulation that can require the integration of activities from multiple enhancers. Transcription factors typically bind 6-12 bp-long degenerate DNA sequences. The low level of specificity provided by individual sites suggests that complex interactions and rules are involved in binding and the functional outcome. Binding sites with less degeneracy can provide simpler means of regulation. Artificial transcription factors can be designed to specify longer sequences that have less similar sequences in the genome and have lower potential for off-target cleavage. Any of these types of binding sites can be mutated, deleted or even created to enable changes in gene regulation or expression (Canver, M.C. et al., Nature (2015)). [000217] Another class of gene regulatory regions having these features is microRNA

(miRNA) binding sites. miRNAs are non-coding RNAs that play key roles in post- transcriptional gene regulation. miRNA can regulate the expression of 30% of all mammalian protein-encoding genes. Specific and potent gene silencing by double stranded RNA (RNAi) was discovered, plus additional small noncoding RNA (Canver, M.C. et a/., Nature (2015)). The largest class of non-coding RNAs important for gene silencing is miRNAs. In mammals, miRNAs are first transcribed as a long RNA transcript, which can be separate transcriptional units, part of protein introns, or other transcripts. The long transcripts are called primary miRNA (pri-miRNA) that include imperfectly base-paired hairpin structures. These pri-miRNA can be cleaved into one or more shorter precursor miRNAs (pre-miRNAs) by Microprocessor, a protein complex in the nucleus, involving Drosha.

[000218] Pre-miRNAs are short stem loops -70 nucleotides in length with a 2-nucleotide 3'- overhang that are exported, into the mature 19-25 nucleotide miRNA:miRNA* duplexes. The miRNA strand with lower base pairing stability (the guide strand) can be loaded onto the RNA- induced silencing complex (RISC). The passenger strand (marked with *), can be functional, but is usually degraded. The mature miRNA tethers RISC to partly complementary sequence motifs in target mRNAs predominantly found within the 3' untranslated regions (UTRs) and induces posttranscriptional gene silencing (Bartel, D.P. Cell 136, 215-233 (2009); Saj, A. & Lai, E.C. Curr Opin Genet Dev 21, 504-510 (2011)).

[000219] miRNAs can be important in development, differentiation, cell cycle and growth control, and in virtually all biological pathways in mammals and other multicellular organisms. miRNAs can also be involved in cell cycle control, apoptosis and stem cell differentiation, hematopoiesis, hypoxia, muscle development, neurogenesis, insulin secretion, cholesterol metabolism, aging, viral replication and immune responses.

[000220] A single miRNA can target hundreds of different mRNA transcripts, while an individual miRNA transcript can be targeted by many different miRNAs. More than 28645 microRNAs have been annotated in the latest release of miRBase (v.21). Some miRNAs can be encoded by multiple loci, some of which can be expressed from tandemly co-transcribed clusters. The features allow for complex regulatory networks with multiple pathways and feedback controls. miRNAs can be integral parts of these feedback and regulatory circuits and can help regulate gene expression by keeping protein production within limits (Herranz, H. & Cohen, S.M. Genes Dev 24, 1339-1344 (2010); Posadas, D M. & Carthew, R.W. Curr Opin Genet Dev 27, 1-6 (2014)). [000221] miRNA can also be important in a large number of human diseases that are associated with abnormal miRNA expression. This association underscores the importance of the miRNA regulatory pathway. Recent miRNA deletion studies have linked miRNA with regulation of the immune responses (Stern-Ginossar, N. et al., Science 317, 376-381 (2007)).

[000222] miRNA also has a strong link to cancer and can play a role in different types of cancer. miRNAs have been found to be downregulated in a number of tumors. miRNA can be important in the regulation of key cancer-related pathways, such as cell cycle control and the DNA damage response, and can therefore be used in diagnosis and can be targeted clinically. MicroRNAs can delicately regulate the balance of angiogenesis, such that experiments depleting all microRNAs suppress tumor angiogenesis (Chen, S. et al., Genes Dev 28, 1054-1067 (2014)).

[000223] As has been shown for protein coding genes, miRNA genes can also be subject to epigenetic changes occurring with cancer. Many miRNA loci can be associated with CpG islands increasing their opportunity for regulation by DNA methylation (Weber, B., Stresemann, C, Brueckner, B. & Lyko, F. Cell Cycle 6, 1001-1005 (2007)). The majority of studies have used treatment with chromatin remodeling drugs to reveal epigenetically silenced miRNAs.

[000224] In addition to their role in RNA silencing, miRNA can also activate translation (Posadas, D M. & Carthew, R.W. Curr Opin Genet Dev 27, 1-6 (2014)). Knocking out miRNA sites may lead to decreased expression of the targeted gene, while introducing these sites may increase expression.

[000225] Individual miRNA can be knocked out most effectively by mutating the seed sequence (bases 2-8 of the microRNA), which can be important for binding specificity.

Cleavage in this region, followed by mis-repair by NHEJ can effectively abolish miRNA function by blocking binding to target sites. miRNA could also be inhibited by specific targeting of the special loop region adjacent to the palindromic sequence. Catalytically inactive Cas9 can also be used to inhibit shRNA expression (Zhao, Y. et al., Sci Rep 4, 3943 (2014)). In addition to targeting the miRNA, the binding sites can also be targeted and mutated to prevent the silencing by miRNA.

[000226] According to the present disclosure, any of the microRNA (miRNA) or their binding sites may be incorporated into the compositions of the invention.

[000227] The compositions may have a region such as, but not limited to, a region comprising the sequence of any of the microRNAs listed in SEQ ID NOs: 632-4715, the reverse complement of the microRNAs listed in SEQ ID NOs: 632-4715 or the microRNA anti-seed region of any of the microRNAs listed in SEQ ID NOs: 632-4715. [000228] The compositions of the present disclosure may comprise one or more microRNA target sequences, microRNA sequences, or microRNA seeds. Such sequences may correspond to any known microRNA such as those taught in U.S. Publication 2005/0261218 and U.S.

Publication 2005/0059005. As a non-limiting example, known microRNAs, their sequences and their binding site sequences in the human genome are listed in SEQ ID NOs: 632-4715.

[000229] A microRNA sequence comprises a "seed" sequence, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which sequence has perfect Watson-Crick

complementarity to the miRNA target sequence. A microRNA seed may comprise positions 2-8 or 2-7 of the mature microRNA. In some aspects, a microRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature microRNA), wherein the seed-complementary site in the corresponding miRNA target is flanked by an adenine (A) opposed to microRNA position 1. In some aspects, a microRNA seed may comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature microRNA), wherein the seed-complementary site in the corresponding miRNA target is flanked by an adenine (A) opposed to microRNA position 1. See for example, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6;27(1):91-105. The bases of the microRNA seed have complete complementarity with the target sequence.

[000230] Identification of microRNA, microRNA target regions, and their expression patterns and role in biology have been reported (Bonauer et al., Curr Drug Targets 2010 11 : 943 -949; Anand and Cheresh Curr Opin Hematol 2011 18: 171-176; Contreras and Rao Leukemia 2012 26:404-413 (2011 Dec 20. doi: 10.1038/leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al, Cell, 2007 129: 1401-1414; Gentner and Naldini, Tissue Antigens. 2012 80:393-403).

[000231] For example, if the composition is not intended to be delivered to the liver but ends up there, then miR-122, a microRNA abundant in liver, can inhibit the expression of the sequence delivered if one or multiple target sites of miR-122 are engineered into the

polynucleotide encoding that target sequence. Introduction of one or multiple binding sites for different microRNA can be engineered to further decrease the longevity, stability, and protein translation hence providing an additional layer of tenability.

[000232] As used herein, the term "microRNA site" refers to a microRNA target site or a microRNA recognition site, or any nucleotide sequence to which a microRNA binds or associates. It should be understood that "binding" may follow traditional Watson-Crick hybridization rules or may reflect any stable association of the microRNA with the target sequence at or adjacent to the microRNA site. [000233] Conversely, for the purposes of the compositions of the present disclosure, microRNA binding sites can be engineered out of (i.e. removed from) sequences in which they naturally occur in order to increase protein expression in specific tissues.

[000234] Specifically, microRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen presenting cells (APCs) (e.g. dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, natural killer cells, etc. Immune cell specific microRNAs are involved in immunogenicity,

autoimmunity, the immune -response to infection, inflammation, as well as unwanted immune response after gene therapy and tissue/organ transplantation. Immune cells specific microRNAs also regulate many aspects of development, proliferation, differentiation and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are exclusively expressed in the immune cells, particularly abundant in myeloid dendritic cells. Introducing the miR-142 binding site into the 3'-UTR of a polypeptide of the present disclosure can selectively suppress the gene expression in the antigen presenting cells through miR-142 mediated mRNA degradation, limiting antigen presentation in professional APCs (e.g. dendritic cells) and thereby preventing antigen-mediated immune response after gene delivery (see, Annoni A et al., blood, 2009, 114, 5152-5161).

[000235] In one example, microRNAs binding sites that are known to be expressed in immune cells, in particular, the antigen presenting cells, can be engineered into the polynucleotides to suppress the expression of the polynucleotide in APCs through microRNA mediated RNA degradation, subduing the antigen-mediated immune response, while the expression of the polynucleotide is maintained in non-immune cells where the immune cell specific microRNAs are not expressed.

[000236] Many microRNA expression studies have been conducted, and are described in the art, to profile the differential expression of microRNAs in various cancer cells /tissues and other diseases. Some microRNAs are abnormally over-expressed in certain cancer cells and others are under-expressed. For example, microRNAs are differentially expressed in cancer cells

(WO2008/154098, US2013/0059015, US2013/0042333, WO2011/157294); cancer stem cells (US2012/0053224); pancreatic cancers and diseases (US2009/0131348, US2011/0171646, US2010/0286232, US8389210); asthma and inflammation (US8415096); prostate cancer (US2013/0053264); hepatocellular carcinoma (WO2012/151212, US2012/0329672,

WO2008/054828, US8252538); lung cancer cells (WO2011/076143, WO2013/033640,

WO2009/070653, US2010/0323357); cutaneous T-cell lymphoma (WO2013/011378); colorectal cancer cells (WO2011/0281756, WO2011/076142); cancer positive lymph nodes (WO2009/100430, US2009/0263803); nasopharyngeal carcinoma (EP2112235); chronic obstructive pulmonary disease (US2012/0264626, US2013/0053263); thyroid cancer

(WO2013/066678); ovarian cancer cells ( US2012/0309645, WO2011/095623); breast cancer cells (WO2008/154098, WO2007/081740, US2012/0214699), leukemia and lymphoma

(WO2008/073915, US2009/0092974, US2012/0316081, US2012/0283310, WO2010/018563).

[000237] Non-limiting examples of microRNA sequences and the targeted tissues and/or cells are disclosed in SEQ ID NOs: 632-4715.

Genome engineering strategies

[000238] In some aspects, the methods of the present disclosure can involve editing one or both alleles. Gene editing to modify the allele(s) has the advantage of permanently altering the target gene or gene products.

[000239] A step of the ex vivo methods of the present disclosure can comprise editing the cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) isolated from the patient using genome engineering. Alternatively, a step of the ex vivo methods of the present disclosure can comprise editing the patient specific iPSC or mesenchymal stem cell. Likewise, a step of the in vivo methods of the present disclosure involves editing the cells in patients experiencing pain using genome engineering. Similarly, a step in the cellular methods of the present disclosure can comprise editing the SCN10A gene in a human cell by genome engineering.

[000240] Any CRISPR endonuclease may be used in the methods of the present disclosure, each CRISPR endonuclease having its own associated PAM, which may or may not be disease specific.

[000241] For example, expression of the SCN10A gene may be disrupted or eliminated by introducing random insertions or deletions (indels) that arise due to the imprecise NHEJ repair pathway. The target regions may be the coding sequences of the SCN10A gene (i.e., exons). Inserting or deleting nucleotides into the coding sequence of a gene may cause a "frame shift" where the normal 3-letter codon pattern is disturbed. In this way, gene expression and therefore protein production can be reduced or eliminated. This approach may also be used to target any intron, intron:exon junction, or regulatory DNA element of the SCN10A gene where sequence alteration may interfere with the expression of the SCN10A gene.

[000242] As another example, NHEJ can also be used to delete segments of the gene, either directly or by altering splice donor or acceptor sites through cleavage by one gRNA targeting several locations, or several gRNAs. This can be useful if small random indels are inefficient to knock-out the target gene. Pairs of gRNAs have been used for this type of deletions.

[000243] Without a donor present, the ends from a DNA break or ends from different breaks can be joined using the several non-homologous repair pathways in which the DNA ends are joined with little or no base-pairing at the junction. In addition to canonical NHEJ, there are similar repair mechanisms, such as alt-NHEJ. If there are two breaks, the intervening segment can be deleted or inverted. NHEJ repair pathways can lead to insertions, deletions or mutations at the joints.

[000244] NHEJ can also lead to homology-independent target integration. For example, inclusion of a nuclease target site on a donor plasmid can promote integration of a transgene into the chromosomal double-strand break following in vivo nuclease cleavage of both the donor and the chromosome (Cristea., Biotechnol Bioeng. 2013 Mar; l 10(3): 871-80). NHEJ was used to insert a 15-kb inducible gene expression cassette into a defined locus in human cell lines after nuclease cleavage. (See e.g., Maresca, M., Lin, V.G., Guo, N. & Yang, Y., Genome Res 23, 539- 546 (2013); Cristea et al. Biotechnology and Bioengineering 2013; Suzuki et al. Nature, 540, 144-149 (2016)). The integrated sequence may disrupt the reading frame of the SCN10A gene or alter the structure of the gene.

[000245] As a further alternative, homology directed repair (HDR) can also be used to knockout a gene or alter the gene function. For example, the HDR knock-out strategy can involve disrupting the structure or function of the SCN10A gene by inserting into the SCN10A gene a non-functional or irrelevant sequence. This can be achieved by inducing one single stranded break or double stranded break in the gene of interest with one or more CRISPR endonucleases and a gRNA {e.g., crRNA + tracrRNA, or sgRNA), or two or more single stranded breaks or double stranded breaks in the gene of interest with one or more CRISPR endonucleases and two or more gRNAs, in the presence of a donor DNA template introduced exogenously to direct the cellular DSB response to Homology-Directed Repair (the donor DNA template can be a short single stranded oligonucleotide, a short double stranded oligonucleotide, a long single or double stranded DNA molecule). This approach can require development and optimization of gRNAs and donor DNA molecules for the SCN10A gene.

[000246] Homology directed repair (HDR) is essentially an error-free mechanism that uses a supplied homologous DNA sequence as a template during DSB repair. The rate of HDR is a function of the distance between the mutation and the cut site so choosing overlapping or nearest target sites is important. Templates can include extra sequences flanked by the homologous regions or can contain a sequence that differs from the genomic sequence, thus allowing sequence editing.

[000247] The most common form of HDR is homologous recombination. There are additional pathways for HDR, including single-strand annealing and alternative-HDR. Genome engineering tools allow researchers to manipulate the cellular homologous recombination pathways to create site-specific modifications to the genome. It has been found that cells can repair a double-stranded break using a synthetic donor molecule provided in trans. Therefore, by introducing a double-stranded break near a specific mutation and providing a suitable donor, targeted changes can be made in the genome. Specific cleavage increases the rate of HDR more than 1,000 fold above the rate of 1 in 10 ⁶ cells receiving a homologous donor alone. The rate of homology directed repair (HDR) at a particular nucleotide is a function of the distance to the cut site, so choosing overlapping or nearest target sites is important. Gene editing offers the advantage over gene addition, as editing in situ leaves the rest of the genome unperturbed.

[000248] Supplied donors for editing by HDR vary markedly but can contain the intended sequence with small or large flanking homology arms to allow annealing to the genomic DNA. The homology regions flanking the introduced genetic changes can be 30 bp or smaller, or as large as a multi-kilobase cassette that can contain promoters, cDNAs, etc. Both single-stranded and double-stranded oligonucleotide donors have been used. These oligonucleotides range in size from less than 100 nt to over many kb, though longer ssDNA can also be generated and used. Double-stranded donors can be used, including PCR amplicons, plasmids, and mini- circles. In general, it has been found that an AAV vector can be a very effective means of delivery of a donor template, though the packaging limits for individual donors is <5kb. Active transcription of the donor increased HDR three-fold, indicating the inclusion of promoter may increase conversion. Conversely, CpG methylation of the donor decreased gene expression and HDR.

[000249] In addition to wild-type endonucleases, such as Cas9, nickase variants exist that have one or the other nuclease domain inactivated resulting in cutting of only one DNA strand. HDR can be directed from individual Cas nickases or using pairs of nickases that flank the target area. Donors can be single-stranded, nicked, or dsDNA.

[000250] The donor DNA can be supplied with the nuclease or independently by a variety of different methods, for example by transfection, nano-particle, micro-injection, or viral transduction. A range of tethering options has been proposed to increase the availability of the donors for HDR. Examples include attaching the donor to the nuclease, attaching to DNA binding proteins that bind nearby, or attaching to proteins that are involved in DNA end binding or repair.

[000251] The repair pathway choice can be guided by a number of culture conditions, such as those that influence cell cycling, or by targeting of DNA repair and associated proteins. For example, to increase HDR, key NHEJ molecules can be suppressed, such as KU70, KU80 or DNA ligase IV.

[000252] In addition to genome editing by NHEJ or HDR, site-specific gene insertions have been conducted that use both the NHEJ pathway and HDR. A combination approach may be applicable in certain settings, possibly including intron/exon borders. NHEJ may prove effective for ligation in the intron, while the error-free HDR may be better suited in the coding region.

[000253] The SCN10A gene contains a number of exons as shown in Table 3. Any one or more of these exons or nearby introns can be targeted in order to create one or more indels that disrupt the reading frame and eventually eliminate the abnormal SCN10A protein activity.

[000254] In some aspects, the methods can provide gRNA pairs that make a deletion by cutting the gene twice at locations flanking an unwanted sequence. This sequence may include one or more exons, introns, intron:exon junctions, other DNA sequences encoding regulatory elements of the SCN10A gene or combinations thereof. The cutting can be accomplished by a pair of DNA endonucleases that each makes a DSB in the genome, or by multiple nickases that together make a DSB in the genome.

[000255] Alternatively, the methods can provide one gRNA to make one double-strand cut within a coding or splicing sequence. The double-strand cut can be made by a single DNA endonuclease or multiple nickases that together make a DSB in the genome.

[000256] Splicing donor and acceptors are generally within 100 base pairs of the neighboring intron. In some examples, methods can provide gRNAs that cut approximately +/- 100-3100 bp with respect to each exon/intron junction of interest.

[000257] For any of the genome editing strategies, gene editing can be confirmed by sequencing or PCR analysis.

Target Sequence Selection

[000258] Shifts in the location of the 5' boundary and/or the 3' boundary relative to particular reference loci can be used to facilitate or enhance particular applications of gene editing, which depend in part on the endonuclease system selected for the editing, as further described and illustrated herein. [000259] In a first non-limiting example of such target sequence selection, many endonuclease systems have rules or criteria that can guide the initial selection of potential target sites for cleavage, such as the requirement of a PAM sequence motif in a particular position adjacent to the DNA cleavage sites in the case of CRISPR Type II or Type V endonucleases.

[000260] In another non-limiting example of target sequence selection or optimization, the frequency of off-target activity for a particular combination of target sequence and gene editing endonuclease (i.e. the frequency of DSBs occurring at sites other than the selected target sequence) can be assessed relative to the frequency of on-target activity. In some cases, cells that have been correctly edited at the desired locus can have a selective advantage relative to other cells. Illustrative, but non-limiting, examples of a selective advantage include the acquisition of attributes such as enhanced rates of replication, persistence, resistance to certain conditions, enhanced rates of successful engraftment or persistence in vivo following

introduction into a patient, and other attributes associated with the maintenance or increased numbers or viability of such cells. In other cases, cells that have been correctly edited at the desired locus can be positively selected for by one or more screening methods used to identify, sort or otherwise select for cells that have been correctly edited. Both selective advantage and directed selection methods can take advantage of the phenotype associated with the alteration. In some cases, cells can be edited two or more times in order to create a second modification that creates a new phenotype that is used to select or purify the intended population of cells. Such a second modification could be created by adding a second gRNA enabling expresssion of a selectable or screenable marker. In some cases, cells can be correctly edited at the desired locus using a DNA fragment that contains the cDNA and also a selectable marker.

[000261] Whether any selective advantage is applicable or any directed selection is to be applied in a particular case, target sequence selection can also be guided by consideration of off- target frequencies in order to enhance the effectiveness of the application and/or reduce the potential for undesired alterations at sites other than the desired target. As described further and illustrated herein and in the art, the occurrence of off-target activity can be influenced by a number of factors including similarities and dissimilarities between the target site and various off-target sites, as well as the particular endonuclease used. Bioinformatics tools are available that assist in the prediction of off-target activity, and frequently such tools can also be used to identify the most likely sites of off-target activity, which can then be assessed in experimental settings to evaluate relative frequencies of off-target to on-target activity, thereby allowing the selection of sequences that have higher relative on-target activities. Illustrative examples of such techniques are provided herein, and others are known in the art.

[000262] Another aspect of target sequence selection relates to homologous recombination events. Sequences sharing regions of homology can serve as focal points for homologous recombination events that result in deletion of intervening sequences. Such recombination events occur during the normal course of replication of chromosomes and other DNA sequences, and also at other times when DNA sequences are being synthesized, such as in the case of repairs of double-strand breaks (DSBs), which occur on a regular basis during the normal cell replication cycle but can also be enhanced by the occurrence of various events (such as UV light and other inducers of DNA breakage) or the presence of certain agents (such as various chemical inducers). Many such inducers cause DSBs to occur indiscriminately in the genome, and DSBs can be regularly induced and repaired in normal cells. During repair, the original sequence can be reconstructed with complete fidelity, however, in some cases, small insertions or deletions (referred to as "indels") are introduced at the DSB site.

[000263] DSBs can also be specifically induced at particular locations, as in the case of the endonucleases systems described herein, which can be used to cause directed or preferential gene modification events at selected chromosomal locations. The tendency for homologous sequences to be subject to recombination in the context of DNA repair (as well as replication) can be taken advantage of in a number of circumstances, and is the basis for one application of gene editing systems, such as CRISPR, in which homology directed repair is used to insert a sequence of interest, provided through use of a "donor" polynucleotide, into a desired

chromosomal location.

[000264] Regions of homology between particular sequences, which can be small regions of "microhomology" that can comprise as few as ten base pairs or less, can also be used to bring about desired deletions. For example, a single DSB can be introduced at a site that exhibits microhomology with a nearby sequence. During the normal course of repair of such DSB, a result that occurs with high frequency is the deletion of the intervening sequence as a result of recombination being facilitated by the DSB and concomitant cellular repair process.

[000265] In some circumstances, however, selecting target sequences within regions of homology can also give rise to much larger deletions, including gene fusions (when the deletions are in coding regions), which may or may not be desired given the particular circumstances.

[000266] The examples provided herein further illustrate the selection of various target regions for the creation of DSBs designed to induce insertions, deletions or mutations that result in reduction or elimination of SCN10A protein activity, as well as the selection of specific target sequences within such regions that are designed to minimize off-target events relative to on- target events.

Human Cells

[000267] For ameliorating pain or any disorder associated with SCN10A, as described and illustrated herein, the principal targets for gene editing are human cells. For example, in the ex vivo methods, the human cells can be somatic cells, which after being modified using the techniques as described, can give rise to differentiated cells, e.g., neurons of the peripheral nervous system or progenitor cells. For example, in the in vivo methods, the human cells may be neurons of the peripheral nervous system, or cells from other affected organs.

[000268] By performing gene editing in autologous cells that are derived from and therefore already completely matched with the patient in need, it is possible to generate cells that can be safely re-introduced into the patient, and effectively give rise to a population of cells that will be effective in ameliorating one or more clinical conditions associated with the patient's disease.

[000269] Stem cells are capable of both proliferation and giving rise to more progenitor cells, these in turn having the ability to generate a large number of mother cells that can in turn give rise to differentiated or differentiable daughter cells. The daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential. The term "stem cell" refers then, to a cell with the capacity or potential, under particular circumstances, to differentiate to a more specialized or differentiated phenotype, and which retains the capacity, under certain circumstances, to proliferate without substantially

differentiating. In one aspect, the term progenitor or stem cell refers to a generalized mother cell whose descendants (progeny) specialize, often in different directions, by differentiation, e.g., by acquiring completely individual characters, as occurs in progressive diversification of embryonic cells and tissues. Cellular differentiation is a complex process typically occurring through many cell divisions. A differentiated cell may derive from a multipotent cell that itself is derived from a multipotent cell, and so on. While each of these multipotent cells may be considered stem cells, the range of cell types that each can give rise to may vary considerably. Some

differentiated cells also have the capacity to give rise to cells of greater developmental potential. Such capacity may be natural or may be induced artificially upon treatment with various factors. In many biological instances, stem cells can also be "multipotent" because they can produce progeny of more than one distinct cell type, but this is not required for "stem-ness." [000270] Self-renewal can be another important aspect of the stem cell. In theory, self-renewal can occur by either of two major mechanisms. Stem cells can divide asymmetrically, with one daughter retaining the stem state and the other daughter expressing some distinct other specific function and phenotype. Alternatively, some of the stem cells in a population can divide symmetrically into two stems, thus maintaining some stem cells in the population as a whole, while other cells in the population give rise to differentiated progeny only. Generally,

"progenitor cells" have a cellular phenotype that is more primitive (i.e., is at an earlier step along a developmental pathway or progression than is a fully differentiated cell). Often, progenitor cells also have significant or very high-proliferative potential. Progenitor cells can give rise to multiple distinct differentiated cell types or to a single differentiated cell type, depending on the developmental pathway and on the environment in which the cells develop and differentiate.

[000271] In the context of cell ontogeny, the adjective "differentiated," or "differentiating" is a relative term. A "differentiated cell" is a cell that has progressed further down the developmental pathway than the cell to which it is being compared. Thus, stem cells can differentiate into lineage-restricted precursor cells (such as a neural progenitor cell), which in turn can

differentiate into other types of precursor cells further down the pathway (such as a neural precursor), and then to an end-stage differentiated cell, such as a neural, which plays a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further.

Induced Pluripotent Stem Cells

[000272] The genetically engineered human cells described herein can be induced pluripotent stem cells (iPSCs). An advantage of using iPSCs is that the cells can be derived from the same subject to which the progenitor cells are to be administered. That is, a somatic cell can be obtained from a subject, reprogrammed to an induced pluripotent stem cell, and then re- differentiated into a progenitor cell to be administered to the subject {e.g., autologous cells). Because the progenitors are essentially derived from an autologous source, the risk of engraftment rejection or allergic response can be reduced compared to the use of cells from another subject or group of subjects. In addition, the use of iPSCs negates the need for cells obtained from an embryonic source. Thus, in one aspect, the stem cells used in the disclosed methods are not embryonic stem cells.

[000273] Although differentiation is generally irreversible under physiological contexts, several methods have been recently developed to reprogram somatic cells to iPSCs. Exemplary methods are known to those of skill in the art and are described briefly herein below. [000274] The term "reprogramming" refers to a process that alters or reverses the differentiation state of a differentiated cell (e.g., a somatic cell). Stated another way, reprogramming refers to a process of driving the differentiation of a cell backwards to a more undifferentiated or more primitive type of cell. It should be noted that placing many primary cells in culture can lead to some loss of fully differentiated characteristics. Thus, simply culturing such cells included in the term differentiated cells does not render these cells non- differentiated cells (e.g., undifferentiated cells) or pluripotent cells. The transition of a differentiated cell to pluripotency requires a reprogramming stimulus beyond the stimuli that lead to partial loss of differentiated character in culture. Reprogrammed cells also have the characteristic of the capacity of extended passaging without loss of growth potential, relative to primary cell parents, which generally have capacity for only a limited number of divisions in culture.

[000275] The cell to be reprogrammed can be either partially or terminally differentiated prior to reprogramming. Reprogramming can encompass complete reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to a pluripotent state or a multipotent state. Reprogramming can encompass complete or partial reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to an undifferentiated cell (e.g., an embryonic-like cell). Reprogramming can result in expression of particular genes by the cells, the expression of which further contributes to reprogramming. In certain examples described herein, reprogramming of a differentiated cell (e.g., a somatic cell) can cause the differentiated cell to assume an

undifferentiated state (e.g., is an undifferentiated cell). The resulting cells are referred to as "reprogrammed cells," or "induced pluripotent stem cells (iPSCs or iPS cells)."

[000276] Reprogramming can involve alteration, e.g., reversal, of at least some of the heritable patterns of nucleic acid modification (e.g., methylation), chromatin condensation, epigenetic changes, genomic imprinting, etc., that occur during cellular differentiation. Reprogramming is distinct from simply maintaining the existing undifferentiated state of a cell that is already pluripotent or maintaining the existing less than fully differentiated state of a cell that is already a multipotent cell (e.g., a myogenic stem cell). Reprogramming is also distinct from promoting the self-renewal or proliferation of cells that are already pluripotent or multipotent, although the compositions and methods described herein can also be of use for such purposes, in some examples. [000277] Many methods are known in the art that can be used to generate pluripotent stem cells from somatic cells. Any such method that reprograms a somatic cell to the pluripotent phenotype would be appropriate for use in the methods described herein.

[000278] Reprogramming methodologies for generating pluripotent cells using defined combinations of transcription factors have been described. Mouse somatic cells can be converted to ES cell-like cells with expanded developmental potential by the direct transduction of Oct4, Sox2, Klf4, and c-Myc; see, e.g., Takahashi and Yamanaka, Cell 126(4): 663-76 (2006). iPSCs resemble ES cells, as they restore the pluripotency-associated transcriptional circuitry and much of the epigenetic landscape. In addition, mouse iPSCs satisfy all the standard assays for pluripotency: specifically, in vitro differentiation into cell types of the three germ layers, teratoma formation, contribution to chimeras, germline transmission [see, e.g., Maherali and Hochedlinger, Cell Stem Cell. 3(6):595-605 (2008)], and tetraploid complementation.

[000279] Human iPSCs can be obtained using similar transduction methods, and the transcription factor trio, OCT4, SOX2, and NANOG, has been established as the core set of transcription factors that govern pluripotency; see, e.g., Budniatzky and Gepstein, Stem Cells Transl Med. 3(4):448-57 (2014); Barrett et al, Stem Cells Trans Med 3 : 1-6 sctm.2014-0121 (2014); Focosi et al., Blood Cancer Journal 4: e211 (2014); and references cited therein. The production of iPSCs can be achieved by the introduction of nucleic acid sequences encoding stem cell-associated genes into an adult, somatic cell, historically using viral vectors.

[000280] iPSCs can be generated or derived from terminally differentiated somatic cells, as well as from adult stem cells, or somatic stem cells. That is, a non-pluripotent progenitor cell can be rendered pluripotent or multipotent by reprogramming. In such instances, it may not be necessary to include as many reprogramming factors as required to reprogram a terminally differentiated cell. Further, reprogramming can be induced by the non-viral introduction of reprogramming factors, e.g., by introducing the proteins themselves, or by introducing nucleic acids that encode the reprogramming factors, or by introducing messenger RNAs that upon translation produce the reprogramming factors (see e.g., Warren et al., Cell Stem Cell, 7(5):618- 30 (2010). Reprogramming can be achieved by introducing a combination of nucleic acids encoding stem cell-associated genes, including, for example, Oct-4 (also known as Oct-3/4 or Pouf51), Soxl, Sox2, Sox3, Sox 15, Sox 18, NANOG, KM, Klf2, Klf4, Klf5, NR5A2, c-Myc, 1- Myc, n-Myc, Rem2, Tert, and LIN28. Reprogramming using the methods and compositions described herein can further comprise introducing one or more of Oct-3/4, a member of the Sox family, a member of the Klf family, and a member of the Myc family to a somatic cell. The methods and compositions described herein can further comprise introducing one or more of each of Oct-4, Sox2, Nanog, c-MYC and Klf4 for reprogramming. As noted above, the exact method used for reprogramming is not necessarily critical to the methods and compositions described herein. However, where cells differentiated from the reprogrammed cells are to be used in, e.g., human therapy, in one aspect the reprogramming is not effected by a method that alters the genome. Thus, in such examples, reprogramming can be achieved, e.g., without the use of viral or plasmid vectors.

[000281] The efficiency of reprogramming (i.e., the number of reprogrammed cells) derived from a population of starting cells can be enhanced by the addition of various agents, e.g., small molecules, as shown by Shi et al, Cell-Stem Cell 2:525-528 (2008); Huangfu et al, Nature Biotechnology 26(7):795-797 (2008) and Marson et al, Cell-Stem Cell 3 : 132-135 (2008).

Thus, an agent or combination of agents that enhance the efficiency or rate of induced pluripotent stem cell production can be used in the production of patient-specific or disease- specific iPSCs. Some non-limiting examples of agents that enhance reprogramming efficiency include soluble Wnt, Wnt conditioned media, BIX-01294 (a G9a histone methyltransferase),

PD0325901 (a MEK inhibitor), DNA methyltransferase inhibitors, histone deacetylase (HDAC) inhibitors, valproic acid, 5'-azacytidine, dexamethasone, suberoylanilide, hydroxamic acid (SAHA), vitamin C, and trichostatin (TSA), among others.

[000282] Other non-limiting examples of reprogramming enhancing agents include:

Suberoylanilide Hydroxamic Acid (SAHA (e.g., MK0683, vorinostat) and other hydroxamic acids), BML-210, Depudecin (e.g., (-)-Depudecin), HC Toxin, Nullscript (4-(l,3-Dioxo-lH,3H- benzo[de]isoquinolin-2-yl)-N-hydroxybutanamide), Phenylbutyrate (e.g., sodium

phenylbutyrate) and Valproic Acid ((VP A) and other short chain fatty acids), Scriptaid, Suramin Sodium, Trichostatin A (TSA), APHA Compound 8, Apicidin, Sodium Butyrate,

pivaloyloxymethyl butyrate (Pivanex, AN-9), Trapoxin B, Chlamydocin, Depsipeptide (also known as FR901228 or FK228), benzamides (e.g., CI-994 (e.g., N-acetyl dinaline) and MS-27- 275), MGCD0103, NVP-LAQ-824, CBHA (m-carboxycinnaminic acid bishydroxamic acid), JNJ16241199, Tubacin, A-161906, proxamide, oxamflatin, 3-Cl-UCHA (e.g., 6-(3- chlorophenylureido) caproic hydroxamic acid), AOE (2-amino-8-oxo-9, 10-epoxydecanoic acid), CHAP31 and CHAP 50. Other reprogramming enhancing agents include, for example, dominant negative forms of the HDACs (e.g., catalytically inactive forms), siRNA inhibitors of the HDACs, and antibodies that specifically bind to the HDACs. Such inhibitors are available, e.g., from BIOMOL International, Fukasawa, Merck Biosciences, Novartis, Gloucester Pharmaceuticals, Titan Pharmaceuticals, MethylGene, and Sigma Aldrich.

[000283] To confirm the induction of pluripotent stem cells for use with the methods described herein, isolated clones can be tested for the expression of a stem cell marker. Such expression in a cell derived from a somatic cell identifies the cells as induced pluripotent stem cells. Stem cell markers can be selected from the non-limiting group including SSEA3, SSEA4, CD9, Nanog, Fbxl5, Ecatl, Esgl, Eras, Gdf3, Fgf4, Cripto, Daxl, Zpf296, Slc2a3, Rexl, Utfl, and Natl. In one case, for example, a cell that expresses Oct4 or Nanog is identified as pluripotent. Methods for detecting the expression of such markers can include, for example, RT-PCR and immunological methods that detect the presence of the encoded polypeptides, such as Western blots or flow cytometric analyses. Detection can involve not only RT-PCR, but can also include detection of protein markers. Intracellular markers may be best identified via RT-PCR, or protein detection methods such as immunocytochemistry, while cell surface markers are readily identified, e.g., by immunocytochemi stry .

[000284] The pluripotent stem cell character of isolated cells can be confirmed by tests evaluating the ability of the iPSCs to differentiate into cells of each of the three germ layers. As one example, teratoma formation in nude mice can be used to evaluate the pluripotent character of the isolated clones. The cells can be introduced into nude mice and histology and/or immunohistochemistry can be performed on a tumor arising from the cells. The growth of a tumor comprising cells from all three germ layers, for example, further indicates that the cells are pluripotent stem cells.

Cells of the Peripheral Nervous System

[000285] In some aspects, the genetically engineered human cells described herein are neurons and nerves outside of the brain and spinal cord. Neurons, which process information, and glial cells, which provide mechanical and metabolic support to the nervous system, are the two main classes of cells of the peripheral nervous system. Non-limiting examples of neurons include sensory neurons (collect impulses from the sensory receptors in areas such as skin, muscles, and organs and carries those impulses through the nerves to the CNS) and motor neurons (collect outgoing messages from the CNS and delivers them to the appropriate body organs, instructing them what action needs to be taken). Non-limiting examples of glial cells include Schwann cells in nerves or satellite cells in ganglia.

Creating patient specific iPSCs [000286] One step of the ex vivo methods of the present disclosure can involve creating a patient specific iPS cell, patient specific iPS cells, or a patient specific iPS cell line. There are many established methods in the art for creating patient specific iPS cells, as described in Takahashi and Yamanaka 2006; Takahashi, Tanabe et al. 2007. For example, the creating step can comprise: a) isolating a somatic cell, such as a skin cell or fibroblast, from the patient; and b) introducing a set of pluripotency-associated genes into the somatic cell in order to induce the cell to become a pluripotent stem cell. The set of pluripotency-associated genes can be one or more of the genes selected from the group consisting of OCT4, SOX1, SOX2, SOX3, SOX15, SOX18, NANOG, KLF1, KLF2, KLF4, KLF5, c-MYC, n-MYC, REM2, TERT and LIN28.

Performing a biopsy or aspirate of the patient's tissue

[000287] A biopsy or aspirate is a sample of tissue or fluid taken from the body. There are many different kinds of biopsies or aspirates. Nearly all of them involve using a sharp tool to remove a small amount of tissue. If the biopsy will be on the skin or other sensitive area, numbing medicine can be applied first. A biopsy or aspirate may be performed according to any of the known methods in the art. For example, in a bone marrow aspirate, a large needle is used to enter the pelvis bone to collect bone marrow. For example, in the case of a nerve biopsy from skin or leg to isolate neurons of the peripheral nervous system, the nerve segment is excised inflicting minimal mechanical injury. Squeezing or stretching the nerve is avoided and excessive removal of fat or connective tissue is not attempted.

Isolating a neuron of the peripheral nervous system

[000288] Neurons of the peripheral nervous system may be isolated according to any known method in the art. For example, the nerve segment is excised inflicting minimal mechanical injury under aseptic conditions. Squeezing or stretching the nerve is strictly avoided and excessive removal of fat or connective tissue is not attempted. Since, nerve fibers are very sensitive to mechanical injury, the proximal nerve cut is performed first. Following the isolation, the outermost connective tissue layer, the epineurium, is removed and collected for enzymatic digestion. The fibers are teased with the help of fine forceps until all fascicles are separated into individual fibers. The epineurium and teased fibers are then subjected to enzymatic digestion overnight with dispase II and type I collagenase. The digested products are filtered and collected by centrifugation. The resulting cell suspensions are plated onto adhesive PLL/laminin substrate. The adherent cells are cultured for analysis (Andersen et al., Scientific Reports- Nature, 2016, 6:31781).

Isolating a mesenchymal stem cell [000289] Mesenchymal stem cells can be isolated according to any method known in the art, such as from a patient's bone marrow or peripheral blood. For example, marrow aspirate can be collected into a syringe with heparin. Cells can be washed and centrifuged on a Percoll. The cells can be cultured in Dulbecco's modified Eagle's medium (DMEM) (low glucose) containing 10% fetal bovine serum (FBS) (Pittinger MF, Mackay AM, Beck SC et al, Science 1999;

284: 143-147).

Genetically Modified Cells

[000290] The term "genetically modified cell" refers to a cell that comprises at least one genetic modification introduced by genome editing {e.g., using the CRISPR/Cas9 or

CRISPR/Cpfl system). In some ex vivo examples herein, the genetically modified cell can be genetically modified progenitor cell. In some in vivo examples herein, the genetically modified cell can be a genetically modified neuron of the peripheral nervous system. A genetically modified cell comprising an exogenous genome-targeting nucleic acid and/or an exogenous nucleic acid encoding a genome-targeting nucleic acid is contemplated herein.

[000291] The term "control treated population" describes a population of cells that has been treated with identical media, viral induction, nucleic acid sequences, temperature, confluency, flask size, pH, etc., with the exception of the addition of the genome editing components. Any method known in the art can be used to measure transcription of SCN10A gene or protein expression or activity, for example Western Blot analysis of the SCN10A protein or real time PCR for quantifying SCN1 OA mRNA.

[000292] The term "isolated cell" refers to a cell that has been removed from an organism in which it was originally found, or a descendant of such a cell. Optionally, the cell can be cultured in vitro, e.g., under defined conditions or in the presence of other cells. Optionally, the cell can be later introduced into a second organism or re-introduced into the organism from which it (or the cell from which it is descended) was isolated.

[000293] The term "isolated population" with respect to an isolated population of cells refers to a population of cells that has been removed and separated from a mixed or heterogeneous population of cells. In some cases, the isolated population can be a substantially pure population of cells, as compared to the heterogeneous population from which the cells were isolated or enriched. In some cases, the isolated population can be an isolated population of human progenitor cells, e.g., a substantially pure population of human progenitor cells, as compared to a heterogeneous population of cells comprising human progenitor cells and cells from which the human progenitor cells were derived. [000294] The term "substantially enhanced," with respect to a particular cell population, refers to a population of cells in which the occurrence of a particular type of cell is increased relative to pre-existing or reference levels, by at least 2-fold, at least 3-, at least 4-, at least 5-, at least 6-, at least 7-, at least 8-, at least 9, at least 10-, at least 20-, at least 50-, at least 100-, at least 400-, at least 1000-, at least 5000-, at least 20000-, at least 100000- or more fold depending, e.g., on the desired levels of such cells for ameliorating pain.

[000295] The term "substantially enriched" with respect to a particular cell population, refers to a population of cells that is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%), about 70% or more with respect to the cells making up a total cell population.

[000296] The term "substantially pure" with respect to a particular cell population, refers to a population of cells that is at least about 75%, at least about 85%, at least about 90%, or at least about 95%) pure, with respect to the cells making up a total cell population. That is, the terms "substantially pure" or "essentially purified," with regard to a population of progenitor cells, refers to a population of cells that contain fewer than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, or less than 1%), of cells that are not progenitor cells as defined by the terms herein.

Differentiation of genome-edited iPSCs into cells of the peripheral nervous system

[000297] Another step of the ex vivo methods of the present disclosure can comprise differentiating the genome-edited iPSCs into cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia). The differentiating step may be performed according to any method known in the art. For example, neuronal differentiation of iPSCs is induced using a combination of brain-derived neurotrophic factor (BDNF), glial cell-derived neurotrophic factor (GDNF), nerve growth factor (NGF) and dibutyryl cyclic AMP (dbcAMP). Then, the iPSCs-derived neural cells are further differentiated into Schwann cells using ciliary neurotrophic factor (CNTF), neuregulin 1β and dbcAMP (Wang et al., Biomaterials. 2011; 32(22): 5023-5032).

Differentiation of genome-edited mesenchymal stem cells into cells of the peripheral nervous system

[000298] Another step of the ex vivo methods of the present disclosure can comprise differentiating the genome-edited mesenchymal stem cells into cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia). The differentiating step may be performed according to any method known in the art. For example, MSC are treated with various factors and hormones, including basic fibroblast growth factor, human recombinant platelet derived growth factor, forskolin, and glial growth factor-2 (Ladak et al., Experimental Neurology 228 (2011) 242-252).

Implanting cells into patients

[000299] Another step of the ex vivo methods of the present disclosure can comprise implanting the genome-edited neurons of the peripheral nervous system into patients. This implanting step may be accomplished using any method of implantation known in the art. For example, the genetically modified cells may be injected directly in the patient's blood or otherwise administered to the patient. III. FORMULATIONS AND DELIVERY

Pharmaceutically Acceptable Carriers

[000300] The ex vivo methods of administering progenitor cells to a subject contemplated herein involve the use of therapeutic compositions comprising progenitor cells.

[000301] Therapeutic compositions can contain a physiologically tolerable carrier together with the cell composition, and optionally at least one additional bioactive agent as described herein, dissolved or dispersed therein as an active ingredient. In some cases, the therapeutic

composition is not substantially immunogenic when administered to a mammal or human patient for therapeutic purposes, unless so desired.

[000302] In general, the progenitor cells described herein can be administered as a suspension with a pharmaceutically acceptable carrier. One of skill in the art will recognize that a pharmaceutically acceptable carrier to be used in a cell composition will not include buffers, compounds, cryopreservation agents, preservatives, or other agents in amounts that substantially interfere with the viability of the cells to be delivered to the subject. A formulation comprising cells can include e.g., osmotic buffers that permit cell membrane integrity to be maintained, and optionally, nutrients to maintain cell viability or enhance engraftment upon administration. Such formulations and suspensions are known to those of skill in the art and/or can be adapted for use with the progenitor cells, as described herein, using routine experimentation.

[000303] A cell composition can also be emulsified or presented as a liposome composition, provided that the emulsification procedure does not adversely affect cell viability. The cells and any other active ingredient can be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient, and in amounts suitable for use in the therapeutic methods described herein. [000304] Additional agents included in a cell composition can include pharmaceutically acceptable salts of the components therein. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases, such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.

[000305] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Exemplary of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of an active compound used in the cell compositions that is effective in the treatment of a particular disorder or condition can depend on the nature of the disorder or condition, and can be determined by standard clinical techniques.

Guide RNA Formulation

[000306] Guide RNAs of the present disclosure can be formulated with pharmaceutically acceptable excipients such as carriers, solvents, stabilizers, adjuvants, diluents, etc., depending upon the particular mode of administration and dosage form. Guide RNA compositions can be formulated to achieve a physiologically compatible pH, and range from a pH of about 3 to a pH of about 11, about pH 3 to about pH 7, depending on the formulation and route of administration. In some cases, the pH can be adjusted to a range from about pH 5.0 to about pH 8. In some cases, the compositions can comprise a therapeutically effective amount of at least one compound as described herein, together with one or more pharmaceutically acceptable excipients. Optionally, the compositions can comprise a combination of the compounds described herein, or can include a second active ingredient useful in the treatment or prevention of bacterial growth (for example and without limitation, anti -bacterial or anti -microbial agents), or can include a combination of reagents of the present disclosure. [000307] Suitable excipients include, for example, carrier molecules that include large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Other exemplary excipients can include antioxidants (for example and without limitation, ascorbic acid), chelating agents (for example and without limitation, EDTA), carbohydrates (for example and without limitation, dextrin, hydroxyalkylcellulose, and hydroxyalkylmethylcellulose), stearic acid, liquids (for example and without limitation, oils, water, saline, glycerol and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

Delivery

[000308] Guide RNA polynucleotides (RNA or DNA) and/or endonuclease polynucleotide(s) (RNA or DNA) can be delivered by viral or non-viral delivery vehicles known in the art.

Alternatively, endonuclease polypeptide(s) can be delivered by viral or non-viral delivery vehicles known in the art, such as electroporation or lipid nanoparticles. In further alternative aspects, the DNA endonuclease can be delivered as one or more polypeptides, either alone or pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA.

[000309] Polynucleotides can be delivered by non-viral delivery vehicles including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA-conjugates, aptamer-RNA chimeras, and RNA-fusion protein complexes. Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, Gene Therapy, 18: 1127-1133 (2011) (which focuses on non-viral delivery vehicles for siRNA that are also useful for delivery of other polynucleotides).

[000310] For polynucleotides of the present disclosure, the formulation may be selected from any of those taught, for example, in International Application PCT/US2012/069610.

[000311] Polynucleotides, such as guide RNA, sgRNA, and mRNA encoding an endonuclease, may be delivered to a cell or a patient by a lipid nanoparticle (LNP).

[000312] A LNP refers to any particle having a diameter of less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, a nanoparticle may range in size from 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm.

[000313] LNPs may be made from cationic, anionic, or neutral lipids. Neutral lipids, such as the fusogenic phospholipid DOPE or the membrane component cholesterol, may be included in LNPs as 'helper lipids' to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids include low efficacy owing to poor stability and rapid clearance, as well as the generation of inflammatory or anti-inflammatory responses. [000314] LNPs may also be comprised of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.

[000315] Any lipid or combination of lipids that are known in the art can be used to produce a L P. Examples of lipids used to produce LNPs are: DOTMA, DOSPA, DOTAP, DMRIE, DC- cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE, and GL67A-DOPE-DMPE- polyethylene glycol (PEG). Examples of cationic lipids are: 98N12-5, C 12-200, DLin-KC2- DMA (KC2), DLin-MC3 -DMA (MC3), XTC, MD1, and 7C1. Examples of neutral lipids are: DPSC, DPPC, POPC, DOPE, and SM. Examples of PEG-modified lipids are: PEG-DMG, PEG- CerC14, and PEG-CerC20.

[000316] The lipids can be combined in any number of molar ratios to produce a LNP. In addition, the polynucleotide(s) can be combined with lipid(s) in a wide range of molar ratios to produce a LNP.

[000317] As stated previously, the site-directed polypeptide and genome-targeting nucleic acid can each be administered separately to a cell or a patient. On the other hand, the site-directed polypeptide can be pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA. The pre-complexed material can then be administered to a cell or a patient. Such pre-complexed material is known as a ribonucleoprotein particle (RNP).

[000318] RNA is capable of forming specific interactions with RNA or DNA. While this property is exploited in many biological processes, it also comes with the risk of promiscuous interactions in a nucleic acid-rich cellular environment. One solution to this problem is the formation of ribonucleoprotein particles (RNPs), in which the RNA is pre-complexed with an endonuclease. Another benefit of the RNP is protection of the RNA from degradation.

[000319] The endonuclease in the RNP can be modified or unmodified. Likewise, the gRNA, crRNA, tracrRNA, or sgRNA can be modified or unmodified. Numerous modifications are known in the art and can be used.

[000320] The endonuclease and sgRNA can be generally combined in a 1 : 1 molar ratio.

Alternatively, the endonuclease, crRNA and tracrRNA can be generally combined in a 1 : 1 : 1 molar ratio. However, a wide range of molar ratios can be used to produce a RNP.

1 1 V (adeno associated virus)

[000321] A recombinant adeno-associated virus (AAV) vector can be used for delivery.

Techniques to produce rAAV particles, in which an AAV genome to be packaged that includes the polynucleotide to be delivered, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV typically requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be from any AAV serotype for which recombinant virus can be derived, and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes described herein. Production of pseudotyped rAAV is disclosed in, for example, international patent application publication number WO

01/83692.

AA V Serotypes

[000322] AAV particles packaging polynucleotides encoding compositions of the present disclosure, e.g., endonucleases, donor sequences, or RNA guide molecules, of the present disclosure may comprise or be derived from any natural or recombinant AAV serotype.

According to the present disclosure, the AAV particles may utilize or be based on a serotype selected from any of the following serotypes, and variants thereof including but not limited to AAV1, AAV10, AAV106.1/hu.37, AAV11, AAV114.3/hu.40, AAV 12, AAV127.2/hu.41, AAV127.5/hu.42, AAV128.1/hu.43, AAV128.3/hu.44, AAV130.4/hu.48, AAV145.1/hu.53, AAV145.5/hu.54, AAV145.6/hu.55, AAV16.12/hu. l l, AAV16.3, AAV16.8/hu. lO,

AAV161.10/hu.60, AAV161.6/hu.61, AAVl-7/rh.48, AAVl-8/rh.49, AAV2, AAV2.5T, AAV2- 15/rh.62, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV2- 3/rh.61, AAV24.1, AAV2-4/rh.50, AAV2-5/rh.51, AAV27.3, AAV29.3/bb. l, AAV29.5/bb.2, AAV2G9, AAV-2-pre-miRNA-lOl, AAV3, AAV3.1/hu.6, AAV3.1/hu.9, AAV3-1 l/rh.53,

AAV3-3, AAV33.12/hu. l7, AAV33.4/hu. l5, AAV33.8/hu. l6, AAV3-9/rh.52, AAV3a, AAV3b, AAV4, AAV4-19/rh.55, AAV42.12, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42- 15, AAV42-lb, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42- 6b, AAV42-8, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43- 25, AAV43-5, AAV4-4, AAV44.1, AAV44.2, AAV44.5, AAV46.2/hu.28, AAV46.6/hu.29,

AAV4-8/rl l.64, AAV4-8/rh.64, AAV4-9/rh.54, AAV5, AAV52.1/hu.20, AAV52/hu. l9, AAV5- 22/rh.58, AAV5-3/rh.57, AAV54.1/hu.21, AAV54.2/hu.22, AAV54.4R/hu.27, AAV54.5/hu.23, AAV54.7/hu.24, AAV58.2/hu.25, AAV6, AAV6.1, AAV6.1.2, AAV6.2, AAV7, AAV7.2, AAV7.3/hu.7, AAV8, AAV-8b, AAV-8h, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV A3.3, AAV A3.4,

AAVA3.5, AAV A3.7, AAV-b, AAVCl, AAVC2, AAVC5, AAVCh.5, AAVCh.5Rl, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVCy.5Rl, AAVCy.5R2, AAVCy.5R3, AAVCy.5R4, AAVcy.6, AAV-DJ, AAV-DJ8, AAVF3, AAVF5, AAV-h, AAVH-l/hu. l, AAVH2, AAVH- 5/hu.3, AAVH6, AAVhEl . l, AAVhER1.14, AAVhErl .16, AAVhErl .18, AAVhER1.23, AAVhErl .35, AAVhErl .36, AAVhErl .5, AAVhErl .7, AAVhErl .8, AAVhEr2.16,

AAVhEr2.29, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhEr2.4, AAVhEr3.1, AAVhu. l, AAVhu. lO, AAVhu. l l, AAVhu. l l, AAVhu.12, AAVhu.13, AAVhu.14/9, AAVhu.15,

AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.19, AAVhu.2, AAVhu.20, AAVhu.21 , AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.3, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39, AAVhu.4, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44, AAVhu.44Rl, AAVhu.44R2, AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47, AAVhu.48, AAVhu.48Rl, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.5, AAVhu.51, AAVhu.52, AAVhu.53, AAVhu.54,

AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.6, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.7, AAVhu.8, AAVhu.9, AAVhu.t 19, AAVLG- 10/rh.40, AAVLG-4/rh.38, AAVLG-9/hu.39, AAVLG-9/hu.39, AAV-LK01, AAV-LK02, AAVLK03, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15,

AAV-LK17, AAV-LK18, AAV-LK19, AAVN721-8/rh.43, AAV-PAEC, AAV-PAECl l, AAV- PAEC12, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC 8, AAVpi. l, AAVpi.2, AAVpi.3, AAVrh. lO, AAVrh.12, AAVrh.13, AAVrh. l3R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.2, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.2R, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.43, AAVrh.44, AAVrh.45, AAVrh.46, AAVrh.47, AAVrh.48, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.50, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.55, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.59, AAVrh.60, AAVrh.61, AAVrh.62, AAVrh.64, AAVrh.64Rl, AAVrh.64R2, AAVrh.65, AAVrh.67, AAVrh.68, AAVrh.69, AAVrh.70, AAVrh.72, AAVrh.73, AAVrh.74, AAVrh.8, AAVrh.8R, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, BAAV, B P61 AAV, B P62 AAV, B P63 AAV, bovine AAV, caprine AAV, Japanese AAV 10, true type AAV (ttAAV), UPENN AAV 10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10- 2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, and/or AAV SM 10-8.

[000323] In some aspects, the AAV serotype may be, or have, a mutation in the AAV9 sequence as described by N Pulicherla et al. (Molecular Therapy 19(6): 1070-1078 (2011)), such as but not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.

[000324] In some aspects, the AAV serotype may be, or have, a sequence as described in U.S. Patent No. 6156303, such as, but not limited to, AAV3B (SEQ ID NO: 1 and 10 of U.S.

6156303), AAV6 (SEQ ID NO: 2, 7 and 11 of U.S. 6156303), AAV2 (SEQ ID NO: 3 and 8 of U.S. 6156303), AAV3A (SEQ ID NO: 4 and 9, of U.S. 6156303), or derivatives thereof.

[000325] In some aspects, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008)). The amino acid sequence of AAVDJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described as SEQ ID NO: 1 in U.S. Patent No. 7,588,772: (1) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gin) and (2) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, may comprise three mutations: (1) K406R where lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg), (2) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gin) and (3) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).

[000326] In some examples, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015121501, such as, but not limited to, true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015121501), "UPenn AAV10" (SEQ ID NO: 8 of

WO2015121501), "Japanese AAV10" (SEQ ID NO: 9 of WO2015121501), or variants thereof.

[000327] According to the present disclosure, AAV capsid serotype selection or use may be from a variety of species. In one example, the AAV may be an avian AAV (AAAV). The AAAV serotype may be, or have, a sequence as described in U.S. Patent No. US 9238800, such as, but not limited to, AAAV (SEQ ID NO: 1, 2, 4, 6, 8, 10, 12, and 14 of U.S. 9,238,800), or variants thereof.

[000328] In one example, the AAV may be a bovine AAV (BAAV). The BAAV serotype may be, or have, a sequence as described in U.S. Patent No. 9, 193,769, such as, but not limited to, BAAV (SEQ ID NO: 1 and 6 of U.S. 9193769), or variants thereof. The BAAV serotype may be or have a sequence as described in U.S. Patent No. 7427396, such as, but not limited to, BAAV (SEQ ID NO: 5 and 6 of U.S. Patent No. 7427396), or variants thereof. [000329] In one example, the AAV may be a caprine AAV. The caprine AAV serotype may be, or have, a sequence as described in U.S. Patent No. 7427396, such as, but not limited to, caprine AAV (SEQ ID NO: 3 of U.S. Patent No. 7427396), or variants thereof.

[000330] In other examples the AAV may be engineered as a hybrid AAV from two or more parental serotypes. In one example, the AAV may be AAV2G9 which comprises sequences from AAV2 and AAV9. The AAV2G9 AAV serotype may be, or have, a sequence as described in U.S. Patent Publication No. US20160017005.

[000331] In one example, the AAV may be a serotype generated by the AAV9 capsid library with mutations in amino acids 390-627 (VPl numbering) as described by Pulicherla et al.

(Molecular Therapy 19(6): 1070-1078 (2011). The serotype and corresponding nucleotide and amino acid substitutions may be, but is not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T,

A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T;

S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1301A, A1405C, C1664T, G1811T; R134Q, S469R, A555V, G604V), AAV9.54 (C1531A, T1609A; L511I, L537M), AAV9.55

(T1605A; F535L), AAV9.58 (C1475T, C1579A; T492I, H527N), AAV.59 (T1336C; Y446H), AAV9.61 (A1493T; N498I), AAV9.64 (C1531A, A1617T; L511I), AAV9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510A; P504T), AAV9.80 (G1441A,;G481R), AAV9.83 (C1402A, A1500T; P468T, E500D), AAV9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806C; L439R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L) and AAV9.95 (T1605A; F535L). [000332] In one example, the AAV may be a serotype comprising at least one AAV capsid CD8+ T-cell epitope. As a non-limiting example, the serotype may be AAV1, AAV2 or AAV8.

[000333] In one example, the AAV may be a variant, such as PHP. A or PHP.B as described in Deverman. 2016. Nature Biotechnology. 34(2): 204-209.

[000334] In one example, the AAV may be a serotype selected from any of those found in SEQ ID NOs: 4734-5302 and Table 2.

[000335] In one example, the AAV may be encoded by a sequence, fragment or variant as described in SEQ ID NOs: 4734-5302 and Table 2.

[000336] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbial, and Immunol., 158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al, Proc. Natl. Acad. Sci. USA, 81 :6466 (1984); Tratschin et al, Mol . Cell. Biol. 5:3251 (1985); McLaughlin et al, J. Virol., 62: 1963 (1988); and Lebkowski et al, 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al (1989, J. Virol., 63 :3822-3828); U.S. Patent No. 5,173,414; WO 95/13365 and corresponding U.S. Patent No. 5,658.776 ; WO

95/13392; WO 96/17947; PCT/US98/18600; WO 97/09441 (PCT/US96/14423); WO 97/08298 (PCT/US96/13872); WO 97/21825 (PCT/US96/20777); WO 97/06243 (PCT/FR96/01064); WO 99/11764; Perrin et al. (1995) Vaccine 13 : 1244-1250; Paul et al. (1993) Human Gene Therapy 4:609-615; Clark et al. (1996) Gene Therapy 3 : 1124-1132; U.S. Patent. No. 5,786,211; U.S. Patent No. 5,871,982; and U.S. Patent. No. 6,258,595.

[000337] AAV vector serotypes can be matched to target cell types. For example, the following exemplary cell types can be transduced by the indicated AAV serotypes among others.

Table 2. Tissue/Cell Types and Serotypes

[000338] In addition to adeno-associated viral vectors, other viral vectors can be used. Such viral vectors include, but are not limited to, lentivirus, alphavirus, enterovirus, pestivirus, baculovirus, herpesvirus, Epstein Barr virus, papovavirus, poxvirus, vaccinia virus, and herpes simplex virus.

[000339] In some aspects, Cas9 mRNA, sgRNA targeting one or two sites in SCN10A gene, and donor DNA can each be separately formulated into lipid nanoparticles, or are all co- formulated into one lipid nanoparticle.

[000340] In some aspects, Cas9 mRNA can be formulated in a lipid nanoparticle, while sgRNA and donor DNA can be delivered in an AAV vector.

[000341] Options are available to deliver the Cas9 nuclease as a DNA plasmid, as mRNA or as a protein. The guide RNA can be expressed from the same DNA, or can also be delivered as an RNA. The RNA can be chemically modified to alter or improve its half-life, or decrease the likelihood or degree of immune response. The endonuclease protein can be complexed with the gRNA prior to delivery. Viral vectors allow efficient delivery; split versions of Cas9 and smaller orthologs of Cas9 can be packaged in AAV, as can donors for HDR. A range of non-viral delivery methods also exist that can deliver each of these components, or non-viral and viral methods can be employed in tandem. For example, nano-particles can be used to deliver the protein and guide RNA, while AAV can be used to deliver a donor DNA.

[000342] In some aspects of the in vivo based therapy described herein, the viral vector(s) encoding the endonuclease, guide RNA and/or donor DNA may be delivered to the neurons of the peripheral neural system, such as primary sensory and motor neurons, via direct

intraganglionic or intraspinal injection, or intrathecal delivery (Hoyng et al., Front Mol Neurosci. 2015 Jul 15;8:32). IV. DOSING AND ADMINISTRATION

[000343] The terms "administering," "introducing" and "transplanting" are used

interchangeably in the context of the placement of cells, e.g., progenitor cells, into a subject, by a method or route that results in at least partial localization of the introduced cells at a desired site, such as a site of injury or repair, such that a desired effect(s) is produced. The cells e.g., progenitor cells, or their differentiated progeny can be administered by any appropriate route that results in delivery to a desired location in the subject where at least a portion of the implanted cells or components of the cells remain viable. The period of viability of the cells after administration to a subject can be as short as a few hours, e.g., twenty-four hours, to a few days, to as long as several years, or even the life time of the patient, i.e., long-term engraftment. For example, in some aspects described herein, an effective amount of progenitor cells is

administered via a systemic route of administration, such as an intraperitoneal or intravenous route.

[000344] The terms "individual," "subject," "host" and "patient" are used interchangeably herein and refer to any subject for whom diagnosis, treatment or therapy is desired. In some aspects, the subject is a mammal. In some aspects, the subject is a human being.

[000345] When provided prophylactically, progenitor cells described herein can be

administered to a subject in advance of any symptom of pain. Accordingly, the prophylactic administration of a progenitor cell population serves to prevent pain.

[000346] A progenitor cell population being administered according to the methods described herein can comprise allogeneic progenitor cells obtained from one or more donors. Such progenitors may be of any cellular or tissue origin, e.g., liver, muscle, cardiac, etc. "Allogeneic" refers to a progenitor cell or biological samples comprising progenitor cells obtained from one or more different donors of the same species, where the genes at one or more loci are not identical. For example, a liver progenitor cell population being administered to a subject can be derived from one more unrelated donor subjects, or from one or more non-identical siblings. In some cases, syngeneic progenitor cell populations can be used, such as those obtained from genetically identical animals, or from identical twins. The progenitor cells can be autologous cells; that is, the progenitor cells are obtained or isolated from a subject and administered to the same subject, i.e., the donor and recipient are the same.

[000347] The term "effective amount" refers to the amount of a population of progenitor cells or their progeny needed to prevent or alleviate at least one or more signs or symptoms of pain, and relates to a sufficient amount of a composition to provide the desired effect, e.g., to treat a subject having pain. The term "therapeutically effective amount" therefore refers to an amount of progenitor cells or a composition comprising progenitor cells that is sufficient to promote a particular effect when administered to a typical subject, such as one who has or is at risk for pain. An effective amount would also include an amount sufficient to prevent or delay the

development of a symptom of the disease, alter the course of a symptom of the disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using routine experimentation. [000348] For use in the various aspects described herein, an effective amount of progenitor cells comprises at least 10 ² progenitor cells, at least 5 X 10 ² progenitor cells, at least 10 ³ progenitor cells, at least 5 X 10 ³ progenitor cells, at least 10 ⁴ progenitor cells, at least 5 X 10 ⁴ progenitor cells, at least 10 ⁵ progenitor cells, at least 2 X 10 ⁵ progenitor cells, at least 3 X 10 ⁵ progenitor cells, at least 4 X 10 ⁵ progenitor cells, at least 5 X 10 ⁵ progenitor cells, at least 6 X 10 ⁵ progenitor cells, at least 7 X 10 ⁵ progenitor cells, at least 8 X 10 ⁵ progenitor cells, at least 9 X 10 ⁵ progenitor cells, at least 1 X 10 ⁶ progenitor cells, at least 2 X 10 ⁶ progenitor cells, at least 3 X 10 ⁶ progenitor cells, at least 4 X 10 ⁶ progenitor cells, at least 5 X 10 ⁶ progenitor cells, at least 6 X 10 ⁶ progenitor cells, at least 7 X 10 ⁶ progenitor cells, at least 8 X 10 ⁶ progenitor cells, at least 9 X 10 ⁶ progenitor cells, or multiples thereof. The progenitor cells can be derived from one or more donors, or can be obtained from an autologous source. In some examples described herein, the progenitor cells can be expanded in culture prior to administration to a subject in need thereof.

[000349] Modest and incremental decreases in the levels of SCNIOA expressed in cells of patients having pain can be beneficial for ameliorating one or more symptoms of the disease, for increasing long-term survival, and/or for reducing side effects associated with other treatments. Upon administration of such cells to human patients, the presence of progenitors that are producing decreased levels of SCNIOA is beneficial. In some cases, effective treatment of a subject gives rise to at least about 3%, 5% or 7% reduction in SCNIOA relative to total SCNIOA in the treated subject. In some examples, the reduction in SCNIOA will be at least about 10% of total SCNIOA. In some examples, the reduction in SCNIOA will be at least about 20% to 30% of total SCNIOA. Similarly, the introduction of even relatively limited subpopulations of cells having significantly reduced levels of SCNIOA can be beneficial in various patients because in some situations normalized cells will have a selective advantage relative to diseased cells.

However, even modest levels of progenitors with reduced levels of SCNIOA can be beneficial for ameliorating one or more aspects of pain in patients. In some examples, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more of the neural progenitors in patients to whom such cells are administered are producing decreased levels of SCNIOA.

[000350] "Administered" refers to the delivery of a progenitor cell composition into a subject by a method or route that results in at least partial localization of the cell composition at a desired site. A cell composition can be administered by any appropriate route that results in effective treatment in the subject, i.e. administration results in delivery to a desired location in the subject where at least a portion of the composition delivered, i.e. at least 1 x 10 ⁴ cells are delivered to the desired site for a period of time.

[000351] In one aspect of the method, the pharmaceutical composition may be administered via a route such as, but not limited to, enteral (into the intestine), gastroenteral, epidural (into the dura matter), oral (by way of the mouth), transdermal, peridural, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye), intracavernous injection (into a pathologic cavity) intracavitary (into the base of the penis), intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), transvaginal, insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), in ear drops, auricular (in or by way of the ear), buccal (directed toward the cheek), conjunctival, cutaneous, dental (to a tooth or teeth), electro-osmosis, endocervical, endosinusial, endotracheal, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra- amniotic, intra-articular, intrabiliary, intrabronchial, intrabursal, intracartilaginous (within a cartilage), intracaudal (within the cauda equine), intraci sternal (within the cisterna magna cerebellomedularis), intracorneal (within the cornea), dental intracornal, intracoronary (within the coronary arteries), intracorporus cavernosum (within the dilatable spaces of the corporus cavernosa of the penis), intradiscal (within a disc), intraductal (within a duct of a gland), intraduodenal (within the duodenum), intradural (within or beneath the dura), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (within the stomach),

intragingival (within the gingivae), intraileal (within the distal portion of the small intestine), intralesional (within or introduced directly to a localized lesion), intraluminal (within a lumen of a tube), intralymphatic (within the lymph), intramedullary (within the marrow cavity of a bone), intrameningeal (within the meninges), intramyocardial (within the myocardium), intraocular (within the eye), intraovarian (within the ovary), intrapericardial (within the pericardium), intrapleural (within the pleura), intraprostatic (within the prostate gland), intrapulmonary (within the lungs or its bronchi), intrasinal (within the nasal or periorbital sinuses), intraspinal (within the vertebral column), intrasynovial (within the synovial cavity of a joint), intratendinous (within a tendon), intratesticular (within the testicle), intrathecal (within the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (within the thorax), intratubular (within the tubules of an organ), intratumor (within a tumor), intratympanic (within the aurus media), intravascular (within a vessel or vessels), intraventricular (within a ventricle), iontophoresis (by means of electric current where ions of soluble salts migrate into the tissues of the body), irrigation (to bathe or flush open wounds or body cavities), laryngeal (directly upon the larynx), nasogastric (through the nose and into the stomach), occlusive dressing technique (topical route

administration, which is then covered by a dressing that occludes the area), ophthalmic (to the external eye), oropharyngeal (directly to the mouth and pharynx), parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (within the respiratory tract by inhaling orally or nasally for local or systemic effect), retrobulbar (behind the pons or behind the eyeball), intramyocardial (entering the myocardium), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (across or through the tympanic cavity), ureteral (to the ureter), urethral (to the urethra), vaginal, caudal block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photopheresis and spinal.

[000352] Modes of administration include injection, infusion, instillation, and/or ingestion. "Injection" includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal,

transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion. In some examples, the route is intravenous. For the delivery of cells, administration by injection or infusion can be made.

[000353] The cells can be administered systemically. The phrases "systemic administration," "administered systemically", "peripheral administration" and "administered peripherally" refer to the administration of a population of progenitor cells other than directly into a target site, tissue, or organ, such that it enters, instead, the subject's circulatory system and, thus, is subject to metabolism and other like processes.

[000354] The efficacy of a treatment comprising a composition for the treatment of pain can be determined by the skilled clinician. However, a treatment is considered "effective treatment," if any one or all of the signs or symptoms of, as but one example, levels of SCN10A are altered in a beneficial manner (e.g., decreased by at least 10%), or other clinically accepted symptoms or markers of disease are improved or ameliorated. Efficacy can also be measured by failure of an individual to worsen as assessed by hospitalization or need for medical interventions (e.g., progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and/or described herein. Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human, or a mammal) and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms.

[000355] The treatment according to the present disclosure can ameliorate one or more symptoms associated with pain by decreasing or altering the amount of the SCN10A protein in the individual.

V. FEATURES AND PROPERTIES OF THE SODIUM CHANNEL, VOLTAGE

GATED, TYPE X ALPHA SUBUNIT (SCN10A) GENE

[000356] SCN10A has been associated with diseases and disorders such as, but not limited to, Congenital Pain Insensitivity, Asthma, Ataxia, Atrial Fibrillation, Malignant neoplasm of breast, Hypertrophic Cardiomyopathy, Cardiovascular Diseases, Cerebellar Diseases, Dyspepsia,

Experimental Autoimmune Encephalomyelitis, Primary Erythermalgia, Heart Block, Hereditary Sensory Autonomic Neuropathy Type 5, Hyperalgesia, Acute Myelocytic Leukemia, Multiple Sclerosis, Neuralgia, Neuroblastoma, Pain, Postherpetic neuralgia, Tobacco Use Disorder, Trigeminal Neuralgia, Ventricular Fibrillation, Synovial Cyst, Sciatic Neuropathy, Chronic pain, Fibrillation, Hematologic Neoplasms, Electrocardiogram: P-R interval, Neuropathy, Breast Carcinoma, Central neuroblastoma, Varicella zoster, Brugada Syndrome (disorder), Myxoid cyst, Channelopathies, Compressive Neuropathies, Paroxysmal Extreme Pain Disorder, High grade atrioventricular block, Small Fiber Neuropathy, and Familial Episodic Pain Syndrome 2. Editing the SCN10A gene using any of the methods described herein may be used to treat, prevent and/or mitigate the symptoms of the diseases and disorders described herein.

[000357] The gene SCN10A encodes the alpha subunit of a voltage-gated sodium channel named NaV1.8. NaV1.8 is primarily expressed in the sensory neurons of the dorsal root ganglion and plays an important role in neuropathic pain mechanisms. Mutations in the

SCN10A gene have been found in patients with familial episodic pain syndrome type 2.

Familial episodic pain syndrome type 2 is a rare autosomal dominant neurologic disorder characterized by adult-onset of paroxysmal pain in the feet region. The episodes are generally triggered by heat, cold, chemicals and certain surfaces. Patients may also develop

hypersensitivity to touch and elevated response to pain stimulus. Currently no treatment is available for this disease. Warmth has been shown to relieve the pain episodes. SCNIOA gene mutations are also responsible for about 5 percent of the cases of small fiber neuropathy. Small fiber neuropathy is a condition characterized by severe pain attacks and insensitivity to pain. The pain attacks are usually described as numbness, stabbing or burning, or abnormal skin sensations such as tingling or itchiness. Currently, there is no cure for small fiber peripheral neuropathy. Treatment options include intravenous immunoglobulin (IVIG) and plasmapheresis.

[000358] In one example, the gene is Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCNIOA) which may also be referred to Sodium Voltage-Gated Channel Alpha Subunit 10, Sodium Channel Voltage-Gated Type X Alpha Polypeptide, Voltage-Gated Sodium Channel Subunit Alpha Navl .8, Sodium Channel Protein Type X Subunit Alpha, Peripheral Nerve

Sodium Channel 3, HPN3, PN3, Navl .8, FEPS2, and SNS. SCNIOA has a cytogenetic location of 3p22.2 and the genomic coordinate are on Chromosome 3 on the reserve strand at position 38,696,802-38,794,010. The nucleotide sequence of SCNIOA is shown as SEQ ID NO: 5303. AC116038.1 is the gene upstream of SCNIOA on the reverse strand and SCN5A is the gene downstream of SCNIOA on the reverse strand. SCNIOA has a NCBI gene ID of 6336, Uniprot ID of Q9Y5Y9 and Ensembl Gene ID of ENSG00000185313. SCNIOA has 6380 SNPs, 26 introns and 27 exons. The exon identifier from Ensembl and the start/stop sites of the introns and exons are shown in Table 3. Table 3. Introns and Exons for SCNIOA

[000359] Table 4 provides information on all of the transcripts for the SCNIOA gene based the Ensembl database. Provided in Table 4 are the transcript ID from Ensembl and corresponding NCBI RefSeq ID for the transcript, the translation ID from Ensembl and the corresponding NCBI RefSeq ID for the protein, the biotype of the transcript sequence as classified by Ensembl and the exons and introns in the transcript based on the information in Table 3.

Table 4. Transcript Information for SCNIOA

ENST0000 Retained EX15, EX16, INT13, INT14, 0472436.1 intron EX17, EX18, INT15, INT16

EX19

ENST0000 - - - Retained EX20, EX21, INT17, INT18, 0476698.1 intron EX22, EX23 INT19

[000360] SCN1 OA has 6380 S Ps and the NCBI rs number and/or UniProt VAR number for this SCN10A gene are rs7630989, rs6795970, rsl2632942, rs6599241, rs35332705,

VAR_064748, rsl38404783, VAR_070879, VAR_070880, VAR_070881, VAR_070882, rsl42217269, rsl51090729, rs4076737, rs4426623, rs4622847, rs5848486, rs4676596, rs4676597, rs4676598, rs6422143, rs6767948, rs6776034, rs6763628, rs6783110, rs6777775, rs6764493, rs6794914, rs6784303, rs6795880, rs6799038, rs6781740, rs6803189, rs6599243, rs6599244, rs6599245, rs6599246, rs6599247, rs6599248, rs6599249, rs6599252, rs6599253, rs6599256, rs6599260, rs6599261, rs6800541, rs6790396, rs6797763, rs6798087, rs6775197, rs6790627, rs6798015, rs7430323, rs7430438, rs6599259, rs7430451, rs6802294, rs6791171, rs6793226, rs6599257, rs6599255, rs7430726, rs6599254, rs6599251, rs6599250, rs7431144, rs7373595, rs7374030, rs6599242, rs7374804, rs7375034, rs7375036, rs6599240, rs6599239, rs6796459, rs6796336, rs7428167, rs6799257, rs7428538, rs6780103, rs7432787, rs7432804, rs6763876, rs7429946, rs7433306, rs6771157, rs7433430, rs6767699, rs7628873, rs6763282, rs6767287, rs6767286, rs7617547, rs4676595, rs4676594, rs7650384, rs7635221 , rs4676479, rs4629274, rs4426622, rs7610489, rs9825762, rs4420805, rs4420804, rs7651106, rs7641844, rs4417808, rs9827941, rs4414778, rs4390861, rs9311198, rs9828268, rs9847662, rs9811498, rs9836531, rs4369974, rs7644127, rs3923697, rs7644332, rs9836859, rs3923696, rs9637536, rs9844265, rs4072090, rs9844577, rs4072089, rs9861456, rs9862441, rs9875610, rs9846774, rs9884052, rs6801957, rs9851471, rs9990137, rs7430283, rsl 1129800, rsl 1129801, rsl 1129802, rsl 1129803, rs7430439, rsl 1129805, rsl 1129806, rs7430477, rs7611456, rsl0212338, rs9878604, rs7430861, rsl0212535, rs7372672, rs7373373, rs6805187, rsl l710462, rs7374599, rs9879472, rs7426951, rs7431703, rsl l711860, rsl l711936, rsl 1711941, rs9874436, rs6809264, rsl 1712354, rs7428232, rsl 1927856, rs7432727, rsl2487090, rsl2494065, rs7615140, rsl l707331, rsl2631918, rsl l928905, rs7433352, rsl 1707961, rsl2487551, rsl 1929645, rsl2495205, rs7433723, rs7433958, rs7639104, rs9815458, rsl2054245, rsl 1721285, rs9815891, rsl 1922082, rs7617919, rsl2634001, rs7635325, rsl 1716493, rsl2489221, rsl 1915567, rsl2496750, rsl 1709828, rs7618620, rsl 1710161, rsl2497173, rsl2497868, rsl2497918, rs9816817, rs9809798, rsl2635859, rsl2635869, rsl2490478, rs7641702, rs9818087, rsl2636153, rsl 1925007, rsl2491593, rsl3315383, rsl 1917835, rs9311196, rs9311197, rs9828737, rs9828912, rs9820042, rs9848976, rs9830687, rsl3071311, rs28535395, rs9876564, rsl l l29799, rsl3087440, rs35164567, rsl 1129804, rs34758568, rs34292044, rs34292377, rsl 1129807, rs34314583, rsl 1129808, rs9872482, rsl0428132, rs34804756, rs28706149, rsl0428168, rs35395591, rs35396916, rsl l710461, rs35301534, rs34392360, rs9866540, rs34397514, rs28448349, rsl0637333, rsl 1711062, rs9874633, rs35463820, rs35464547, rsl 1705730, rs34455861, rsl 1719241, rs35486880, rsl l344113, rs34478094, rs35496543, rs34919067, rsl 1714394, rsl 1928917, rsl 1396392, rs34929296, rs56654680, rs34930893, rs56661472, rsl l715513, rs34515439, rs34516179, rs56704765, rs34074715, rsl 1708587, rsl2633214, rs35993937, rs56824318, rsl l921917, rs34987014, rsl 1922415, rs34105543, rs59468016, rs34152407, rsl 1716467, rsl 1710006, rsl 2172962, rs35652104, rs35048311, rs 12172966, rs57122706, rs36085822, rs35052238, rsl 1924846, rsl2636123, rs34667147, rs58410551, rsl 1926158, rsl2630795, rs59640942, rs57203624, rsl2638536, rsl2638572, rs35710839, rs60847476, rs34700431, rsl3085808, rs56128837, rs62242398, rs62242399, rsl3319504, rs28523323, rs62242432, rs34260359, rs28570344, rs62242435, rs34756581, rs62242438, rs62242443, rs62242444, rs35212276, rs62242446, rs62242447, rs62242448, rs62242450, rs62242453, rs57326399, rs59733668, rs34777803, rs57346275, rsl3325628, rs34786326, rs35389751, rs60969309, rs62244065, rs62244070, rs62244071, rs62244072, rs62244073, rs62244074, rs62244075, rs62244076, rs34846255, rs28435458, rs62244079, rs34422505, rs34890249, rs55791366, rs35466104, rsl3095477, rs35904829, rs62244107, rs62244108, rs55849713, rs62244110, rs62244111, rs56406440, rsl3096893, rs35523546, rs61014925, rs59856101, rs59858965, rsl3098827, rs59914178, rs35993330, rs58792349, rs58802016, rs35998249, rs58883392, rs58915895, rs35847006, rs58141279, rs36057862, rs56040630, rs60218401, rs55742609, rs34177393, rs56051560, rs71635876, rs60240656, rs34204621, rs34205252, rs55779957, rs60773084, rs71085335, rs71085336, rs59639785, rs60349808, rs35094360, rs35095264, rs60874265, rs58025631, rs62242429, rs62242430, rs71323673, rs71323674, rs71323675, rs71323676, rs62242433, rs72864370, rs72864377, rs62242434, rs72864392, rs72866235, rs72866253, rs62242436, rs72866260, rs72866265, rs72866266, rs72866267, rs62242445, rs72866278, rs35734463, rs62243860, rs73825863, rs62243861, rs62243862, rs73825866, rs73825867, rs73825878, rs73825880, rs62244077, rs72867808, rs72869618, rs72867855, rs73825864, rs73825865, rs73825883, rs62244078, rs73826323, rs73826324, rs62244080, rs62244081, rs73826357, rs73826358, rs62244103, rs74848784, rs66689339, rs74341073, rs62244104, rs62244105, rs75859611, rs62244106, rs74928884, rs62244109, rs62244112, rs59790671, rs74445516, rs58684946, rs56206213, rs58760012, rs35818440, rs60118537, rs68001863, rs77019133, rs57803396, rs55749331, rs71635874, rs61349119, rs60278090, rs71085334, rs57905522, rs73064529, rs61487238, rs73064536, rs57989962, rs73064548, rs73064557, rs73064559, rs61533375, rs77049337, rs71301300, rs60554541, rs74548823, rs74551923, rs74792924, rs77084265, rs76017498, rs75497516, rs72864380, rs72866259, rs72866270, rs72869620, rs73825887, rs75508287, rs76535930, rs74587293, rs73826305, rs73826306, rs73826310, rs75088937, rs73826321, rs77136813, rs73826327, rs75562946, rs77539009, rs73826334, rs75161427, rs73826359, rs76096312, rs74348091, rs76104711, rs74675938, rs75615812, rs78095083, rs74363987, rs77216806, rs75864725, rs74419042, rs74423849, rs75223091, rs79217981, rs75888476, rs76984993, rs75660637, rs77261744, rs79228310, rs76987412, rs76424950, rs76187325, rs76724272, rs76724601, rs75927671, rs77297345, rs76728612, rs77304538, rs73060441, rs73060459, rs73062575, rs75284873, rs79267898, rs79269945, rs73062578, rs75310964, rs78768858, rs73062597, rs76462455, rs76786776, rs79773522, rsl 11682647, rs74498991, rs79793362, rs75012427, rs73064510, rs76290694, rs73064534, rs78824521, rs73064540, rs76846477, rs76849067, rs78837622, rs76853317, rs76853763, rs73064564, rs75990457, rs79839232, rsl 11749776, rs75991777, rs75062405, rs77787358, rs78326800, rs76523292, rs76354991, rs78881985, rs75498327, rs77804526, rsl l3295398, rsl l3298187, rsl l3298850, rsl l l771510, rs75070682, rsl l4949831, rs76534052, rs78911227, rs75074341, rs78916443, rs76542202, rs75085393, rs74598043, rs77499968, rs79868348, rs75108240, rs77833542, rs75559840, rs79414348, rsl 14963216, rs78376096, rs76600452, rs75165224, rs76104186, rs79432320, rs74687684, rsl38792429, rs79919374, rs76656205, rs76666162, rs74717885, rsl38808791, rsl38809523, rsl 16592903, rs77614747, rs78136603, rs78430219, rs77279149, rsl 13442317, rsl38832868, rs77639339, rs76202479, rs75273348, rsl 15053604, rsl 15070820, rsl 15079583, rs75276273, rsl38887070, rs77666771, rsl 13510244, rsl38906518, rsl 13517900, rs78764004, rs79065817, rsl 15145298, rsl 13546895, rs76784957, rs76250276, rs79788213, rsl 15174567, rs78268156, rs75788951, rs80059486, rsl 11706092, rsl38982168, rs78533485, rsl 16747483, rsl 16757635, rs77400992, rs77429609, rs78555408, rs77430470, rsl 16775165, rs78572037, rsl 11749887, rs78030662, rsl 15278916, rs77447156, rsl 12096867, rs77792382, rsl 11763460, rsl39073590, rsl39077552, rsl 13641258, rsl 15304862, rs79637588, rsl 13307245, rs78072216, rsl 15322672, rsl39127319, rs79657050, rsl 16839902, rsl 12167921, rs78911172, rsl39145771, rs77494117, rs77498602, rsl40584680, rs77832548, rsl40586646, rsl40586837, rsl 12208946, rsl42285029,

rsl39183312, rs78925986, rsl42291710, rsl 15398609, rs79696334, rs79699948, rsl 11788645, rs78375070, rsl 16978510, rsl39202682, rsl40609990, rsl39209095, rsl 13702854, rsl42290902, rsl40612029, rsl 11791003, rsl44011676, rsl39234051, rsl 13349048, rsl 17054214, rsl 15461401, rsl 15463830, rsl 13350292, rsl 17127921, rsl44037687, rsl38786127, rsl 17172096, rs80226178, rsl45641317, rsl 1 1818369, rs78408010, rsl45646766, rs80231475, rs78972291, rsl45653270, rsl40705012, rsl44060047, rs78425180, rs78425552, rs79952096, rsl42379529, rsl 15041752, rsl 17290569, rsl 13822182, rsl38839539,

rsl 16628149, rsl 17326062, rsl39332101, rs80255330, rs80002357, rs80006519, rsl 11929446, rsl40747561, rsl 13846326, rsl39342389, rsl38953921, rs78517441, rsl 17410794,

rsl39355449, rsl45712124, rsl44106464, rsl 15540622, rsl40780000, rs78521824,

rsl 12412281, rsl45756648, rsl40797187, rsl44141505, rsl 13905052, rsl 13906876, rsl45763796, rsl 1 1987089, rsl42452408, rsl 15578032, rsl42456544, rsl 12438902, rsl 15176845, rsl 16740463, rsl 15210980, rsl 12448598, rsl39015515, rsl 13939511, rsl39026574, rsl 15253440, rs80325317, rsl 15279590, rsl 12098638, rsl 13636288, rs80128036, rs79171423, rsl40566252, rsl 13990917, rsl45847820, rsl40870671, rsl42520904,

rsl42531478, rsl42537392, rsl3916431 1, rs80353453, rsl40620366, rsl44258322,

rsl 17971941, rsl44270136, rsl 13721356, rsl44280576, rsl45900411, rsl 12241763, rsl45909172, rsl39221219, rsl42577858, rs80189337, rsl39497781, rsl44304164,

rsl40924179, rsl 13743626, rsl42607973, rsl42609868, rsl45623369, rsl45638853, _rs 145644439, rsl40694303, rsl 13795932, rsl44060105, rsl45966245, rsl44343627, rsl44350950, rsl39303119, rsl37858823, rsl l3815422, rsl40718301, rsl42653846, rsl40967053, rsl 14121783, rsl l3823503, rsl46002710, rsl39318118, rsl46012997, rsl45694222, rsl44397305, rsl40744190, rsl45695788, rsl 12374164, rsl46030335, rsl37906740, rsl37907619, rsl39590561, rsl39347661, rsl 15758563, rsl39603863, rsl l5776862, rsl42731973, rsl l4191117, rsl40788096, rsl l3913395, rsl37938197, rsl39621796, rsl40816989, rsl 14202728, rsl 12442677, rsl41030398, rsl45791541, rsl39638446, rsl40825889, rsl42773696, rsl41044126, rsl 15823268, rsl 12451 159, rsl39655085, rsl 15824540, rsl37972593, rsl39436496, rs80330106, rsl 15837249,

rsl 17781194, rsl42804903, rsl44220322, rsl 17804016, rsl39453999, rsl 17826090, rsl38013199, rsl46136000, rs80353358, rsl42540598, rsl 18031740, rsl 18048890,

rsl 1588781 1, rsl 14058400, rsl 1 1335090, rsl 14268288, rsl46147517, rsl 12776922, rsl41 120303, rsl42884499, rsl45916303, rsl 12795612, rsl39778465, rsl38063699, rsl 15938712, rsl 12807185, rsl46151670, rsl 15945867, rsl41 158867, rsl 12814239, rsl 18142546, rsl 12557765, rsl 12821664, rsl42619328, rsl46217391, rsl44632769, rsll8176556 _: rsl 11393144 _: rsl41202753 _: rsll4348777 _: rsll4088444 _: rsl42954440, rsl42621106 _: rsl42629016 _: rsl42644472 _: rsll4107846 _: rsl39874134 _: rsl37859898, rsll6018808 _: rsl39885935 _: rsl46254874 _: rsl44379693 _: rsl39911346 _: rsl39914498, rsll4130638 _: rsll4138805 _: rsll2604496 _: rsl42698764 _: rsl46028829 _: rsl41278729, rsl41281250 _: rsl41283962 _: rsll5757457 _: rsl38164487 _: rsl41296602 _: rsl 11280947, rsll6076958 _: rsll4191901 _: rsl 16083182 rsll2666781 _: rsl41313658 _: rsl39628764, rsl44482572 _: rsl39988577 _: rsl39643125 _: rsll5823858 _: rsl44508177 _: rsl41368548, rsl 12711636 _: rsl46336567 _: rsl44763796 _: rsl38262927 _: rsl46347267 _: rsll2718371, rsll2992581 _: rsll6160784 _: rsl43101885 _: rsl43105432 _: rsl38286254 _: rsl 37991764, rsl42813340 _: rsl39687189 _: rsl41072660 _: rsl38298994 _: rsl38299054 _: rsl 14266972, rslll535759 _: rsl44546246 _: rsll5880750 _: rsll2774699 _: rsl 46386441 _: rsl 38329907, rsl46388287 _: rsl38332359 _: rslll558766 _: rsl43138384 _: rsl44583356 _: rsl46410320, rsl39793167 _: rslll560636 _: rsl41493524 _: rsl44831552 _: rsll5954335 _: rsl 15961894, rsl44618012 _: rsll4346323 _: rsl41207048 _: rsl39861061 _: rsl39868704 _: rslll608351, rsl38413438 _: rsl39869028 _: rsl39871010 _: rsl44872087 _: rsl44663135 _: rsl44682166, rsl46266397 _: rsl38441634 _: rsl38140385 _: rsl46504454 _: rsl38446432 _: rsl 14675199, rsll6283332 _: rsl41265556 _: rsl46269698 _: rsl46536985 _: rsl38147559 _: rsl44701286, rsl38479208 _: rsll4406379 _: rsl 43024212 _: rsl43264613 _: rsl 44944369 _: rsl43031301, rsl 40226239. rsll4730273 _: rsl44953866 _: rsl40231835 _: rsl43277276 _: rsl43033805, rsl44962987 _: rsl44965407 _: rsll3228724 _: rsll2947752 _: rsl43061067 _: rsl38522956, rsll2962289 _: rsl43067587 _: rsl38244837 _: rsl38532656 _: rsl43092568 _: rsl 13004353, rsl 44993642 _: rsl41622599 _: rsl38290893 _: rsl44788268 _: rsl40288103 _: rsl45032037, rsl48912801 _: rsl38584614 _: rsll6371612 _: rsl 14527316 _: rslll535651 _: rsl40292361, rsll6186275 _: rsl47344305 _: rsl40083486 _: rsll6378536 _: rsl47345366 _: rsl46662148, rsl46665502 _: rsll4543527 _: rsl43150064 _: rsl40129291 _: rsl40123977 _: rsl47360518, rsl47376215 _: rsl48963942 _: rsl 40304433 _: rslll582470 _: rsll4596106 _: rsl46704349, rslll588318 _: rsl46438705 _: rsl48975124 _: rsl41514848 _: rsl40158387 _: rsl 46474062, rsl43418279 _: rsl43423796 _: rsl38416003 _: rsl43185270 _: rsl45106473 _: rs 141703064, rsl43438557 _: rsl46479108 _: rsl47445259 _: rslll620886 _: rsl43208505 _: rsl40203445, rsl44919534 _: rsl41575712 _: rsl43491160 _: rsl38477203 _: rsl49052241 _: rsl41738882, rsl43496663 _: rsl46542549 _: rsl38702864 _: rsl38489639 _: rsl40226131 _: rsl47482520, rsll6317277 _: rsl45182287 _: rsl43523403 _: rsl46582696 _: rsl40453378 _: rsl 16529743, rsl41763377. rsl40239113. rsl41767849. rsl49102632. rsl49103805. rsl46593371, rsl46596599 _: rsl38739418 _: rsl38739984 _: rsl49123514 _: rsl47289725 _: rsl45238729, rsl43303688 _: rsl 40490223 _: rsl45243270 _: rsl45245086 _: rsl38540340 _: rsl40273297, rsl38751097 _: rsl l6353929 _: rsl47549873 _: rsl41801022 _: rsl45034515 _: rsl41808591, rsl38760782 _: rsl40292358 _: rsl41648641 _: rsl l6378521 _: rsl 38769910 _: rsl 47354941, rsl49167436 _: rsl45051453 _: rsl43399681 _: rsl46689576 _: rsl83565671 _: rsl83561912, rsl50686487 _: rsl83573402 _: rsl83577345 _: rsl83580604 _: rsl83581155 _: rsl48965675, rsl83569836 _: rsl41869733 _: rsl45298386 _: rsl46901495 _: rsl46699775 _: rsl40330685, rsl49229532 _: rsl43668889 _: rsl43411470 _: rs 147622431 _: rsl45313578 _: rsl83615396, rsl45092172 _: rsl50729991 _: rsl48979438 _: rsl46711476 _: rsl43687224 _: rsl41906309, rsl l6437284 _: rsl47636922 _: rsl47640811 _: rsl43427574 _: rsl43451118 _: rsl43708033, rs 149027411 _: rsl81865293 _: rsl43709643 _: rsl45340027 _: rsl41723935 _: rsl85522622, rsl85522810 _: rsl81869465 _: rsl85525142 _: rsl41930243 _: rsl81871003 _: rsl85526823, rsl47660344 _: rsl46769210 _: rsl43478744 _: rsl46775048 _: rsl85539195 _: rsl 40413972, rsl47468252 _: rsl47477938 _: rsl46955434 _: rsl41953246 _: rsl40434227 _: rsl 40436497, rsl43744796 _: rsl45364412 _: rsl38718091 _: rsl49301359 _: rsl46965005 _: rsl50817162, rsl46985578 _: rsl85593694 _: rsl85602718 _: rsl46811771 _: rsl 40473643 _: rsl46999807, rsl38738471 _: rsl46832752 _: rsl47748936 _: rsl43816790 _: rsl83768930 _: rsl 38746965, rsl83788942 _: rsl49399848 _: rsl83791427 _: rsl50923753 _: rsl83799730 _: rsl43575643, rsl83805939 _: rsl42093923 _: rsl83818018 _: rsl49136109 _: rsl83822564 _: rsl83831195, rsl85711973 _: rsl50636831 _: rsl41806774 _: rsl47803028 _: rsl45481788 _: rsl50972147, rsl41810266 _: rsl49155352 _: rsl47080011 _: rsl85745985 _: rsl43601316 _: rsl47089455, rsl41828577 _: rsl43610297 _: rsl85754710 _: rsl42163092 _: rsl85756108 _: rsl50671251, rsl41861200 _: rsl42173735 _: rsl51025175 _: rsl47835034 _: rsl42177791 _: rsl47836380, rsl85779729 _: rsl47844607 _: rsl83584046 _: rs 149496163 _: rsl41878212 _: rsl83921174, rsl85796360 _: rsl50711867 _: rsl45311098 _: rsl47627083 _: rsl49504103 _: rsl81850230, rsl47130891 _: rsl82065304 _: rsl47150438 _: rsl47150831 _: rsl41902986 _: rsl43688921, rsl45334310 _: rsl49263149 _: rsl51102881 _: rsl45337110 _: rsl45555974 _: rsl42235256, rsl45340685 _: rsl85534939 _: rsl50773437 _: rsl82099780 _: rsl43727515 _: rsl51122253, rsl49543388 _: rsl45568435 _: rsl82114202 _: rsl42254865 _: rsl82116133 _: rsl45585399, rsl49284340 _: rsl50781655 _: rsl45589241 _: rsl51153639 _: rsl81883390 _: rsl85892805, rsl81886540 _: rsl81887848 _: rsl42276689 _: rsl 50794611 _: rsl51164057 _: rsl43785361, rsl47726233 _: rsl82150399 _: rsl50869539 _: rsl89087246 _: rsl47245558 _: rsl47246725, rsl85913998. rsl47248202. rsl82159310. rsl87294988. rsl85622522. rsl43836137, rsl82164162 _: rsl89095754 _: rsl83802558 _: rsl82172558 _: rs 182172623 _: rsl85925201, rsl49423420 _: rsl90751314 _: rsl49438235 _: rsl84067623 _: rsl82182858 _: rsl87321885, rsl42124216 _: rsl42130662 _: rsl47961692 _: rsl87344188 _: rsl87345429 _: rsl 87347944, rsl50977149 _: rsl51236225 _: rsl42153580 _: rsl45498582 _: rsl49618725 _: rsl47093541, rsl47989553 _: rsl85763094 _: rsl49628162 _: rsl92543709 _: rsl43920053 _: rsl49491608, rsl90819062 _: rsl86001967 _: rsl43937123 _: rsl47127695 _: rs 143944251 _: rsl 86018447, rsl90838007 _: rsl42203398 _: rsl42203439 _: rsl51303346 _: rsl48044382 _: rsl 82070940, rsl48046286 _: rsl86037221 _: rsl90856768 _: rsl89166554 _: rsl49673049 _: rsl49682089, rsl82084800 _: rsl51100738 _: rsl49685953 _: rsl43975030 _: rsl86083535 _: rsl86088932, rsl86097291 _: rsl45560590 _: rsl42241210 _: rsl892086K rsl48118014 _: rsl80693528, rsl89211409 _: rsl42241842 _: rsl89220337 _: rsl 42243747 _: rsl49734017 _: rsl84015310, rsl82369811 _: rsl49558965 _: rsl89232400 _: rsl48138968 _: rsl80715583 _: rsl84021595, rsl82136867 _: rsl84024677 _: rsl49567375 _: rsl47235762 _: rsl89244893 _: rsl84253074, rsl80722746 _: rsl89247011 _: rsl84253923 _: rsl 47238494 _: rsl42283415 _: rsl 92680745, rsl92684234 _: rsl80743233 _: rsl82411879 _: rsl47248566 _: rsl48181348 _: rsl 82418286, rsl82421319 _: rsl51182542 _: rsl80758590 _: rsl87566637 _: rsl87568429 _: rsl 82435282, rsl89097686 _: rsl87577232 _: rsl47942405 _: rsl82180325 _: rsl89321138 _: rsl87593401, rsl47952331 _: rsl84074681 _: rsl92761449 _: rsl 90781749 _: rsl87355509 _: rsl48255093, rsl48256707 _: rsl47979545 _: rsl92532318 _: rsl49883899 _: rsl91074489 _: rsl87364105, rsl90809335 _: rsl91083658 _: rsl90810052 _: rsl92819009 _: rsl86301583 _: rsl 92827045, rsl91110084 _: rsl49931081 _: rsl82549545 _: rsl48330433 _: rsl82555158 _: rsl49642957, rsl82562114 _: rsl90832282 _: rsl49954509 _: rsl86334861 _: rsl51291523 _: rsl 86351725, rsl92569261 _: rsl86353077 _: rsl48364832 _: rsl86355136 _: rsl48041371 _: rsl86031413, rsl86360219 _: rsl89460985 _: rsl89463163 _: rsl84183338 _: rsl51330784 _: rsl89182365, rsl86079267 _: rsl86099028 _: rsl84218959 _: rsl89216600 _: rsl48129688 _: rsl80706783, rsl84236774 _: rsl929019K rsl87765626 _: rsl84495331 _: rs 189487117 rsl 50018770, rsl89494075 _: rsl80717173 _: rsl89504269 _: rsl 92670717 _: rsl48429438 _: rsl 87511640, rsl84249898 _: rsl91234485 _: rsl82387080 _: rsl87808137 _: rsl82673367 _: rsl84545297, rsl48450274 _: rsl91246407 _: rsl86138216 _: rsl91250432 _: rsl82390557 _: rsl87841420, rsl86473085 _: rsl87855541 _: rsl50111722 _: rsl50112735 _: rsl92704694 _: rsl80755356, rsl86194268 _: rs 192741793 _: rsl50127567 _: rsl80993353 _: rsl49825659 _: rsl48504955, rsl87603966 _: rsl84344137 _: rsl91041515 _: rsl81012760 _: rsl91050433 _: rsl91056911, rsl48527743. rsl81028945. rsl 82782223. rsl93068892. rsl49879183. rsl49892218, rsl84393798 _: rsl92814896 _: rsl48339462 _: rsl89651151 _: rsl91141552 _: rsl91367686, rsl91368319 _: rsl91370507 _: rsl93092710 _: rsl91371907 _: rsl91378981 _: rsl87722586, rsl89676945 _: rsl91397139 _: rsl89453271 _: rsl91399247 _: rsl91157471 _: rsl48577011, rsl84460575 _: rsl87992932 _: rsl48586849 _: rsl 84707511 _: rsl86364625 _: rsl 50247775, rsl89468147 _: rsl88008774 _: rsl84718295 _: rsl84472270 _: rsl50260693 _: rsl89723257, rsl88022604 _: rsl50270652 _: rsl87741942 _: rsl88026845 _: rsl89736165 _: rsl93171154, rsl84474289 _: rsl93176707 _: rsl86659213 _: rsl48619598 _: rsl 89471696 _: rsl 86665407, rsl89758917 _: rsl84480031 _: rsl89475537 _: rsl48392780 _: rsl50006666 _: rsl87780686, rsl84521520 _: rsl50041813 _: rsl86699158 _: rsl93230387 _: rsl93235425 _: rsl92941210, rsl92946276 _: rsl84550594 _: rsl82690100 _: rsl82726729 _: rsl82731407 _: rsl 88104502, rsl48663098 _: rsl88122503 _: rsl83001463 _: rsl93013326 _: rsl50123110 _: rsl81263201, rsl48504740 _: rsl93028715 _: rsl81265856 _: rsl83011735 _: rsl84835712 _: rsl 93035864, rsl81010831 _: rsl84837674 _: rsl81014358 _: rsl81275300 _: rsl83022993 _: rsl81278078, rsl81280574 _: rsl83030743 _: rsl48691494 _: rsl48525974 _: rsl50385277 _: rsl 86779968, rsl50392923 _: rsl91590117 _: rsl89885172 _: rsl81035483 _: rsl88175436 _: rsl88177089, rsl82787957 _: rsl50404802 _: rsl48537653 _: rsl82790885 _: rsl99503439 _: rsl 88190842, rsl82796893 _: rsl89902292 _: rsl81048561 _: rsl99518078 _: rsl91389107 _: rsl84687608, rsl84692730 _: rsl91630392 _: rsl89929388 _: rsl50427788 _: rsl93136857 _: rsl87998850, rsl99535863 _: rsl99537685 _: rsl88002678 _: rsl 84720281 _: rsl99542685 _: rsl 50442007, rsl91651308 _: rsl84937383 _: rsl48748248 _: rsl91661504 _: rsl84733410 _: rsl 84946896, rsl84955143 _: rsl84961423 _: rsl89981811 _: rsl91624001 _: rsl88281457 _: rsl91625632, rsl48734327 _: rsl91639316 _: rsl84925249 _: rsl89741283 _: rsl89753266 _: rsl48785001, rsl90003294 _: rsl48626845 _: rsl50301002 _: rsl86674163 _: rsl99618633 _: rsl81191577, rsl83204453 _: rsl90032565 _: rsl81470229 _: rsl48639634 _: rsl88068490 _: rsl81478384, rsl86694207 _: rsl50333337 _: rsl93244433 _: rsl 50522419 _: rsl81490761 _: rsl88102848, rsl48657856 _: rsl50532132 _: rsl50342209 _: rsl88358961 _: rsl 82981064 _: rsl88367936, rsl86940666 _: rsl81514587 _: rsl81524665 _: rsl86740589 _: rsl83006080 _: rsl85089440, rsl88134250 _: rsl84831220 _: rsl88400109 _: rsl83283744 _: rsl86753079 _: rsl 99700318, rsl99703203 _: rsl83015228 _: rsl83290427 _: rsl83290817 _: rsl48905110 _: rsl88413410, rsl83019891 _: rsl88418456 _: rsl99715855 _: rsl90126408 _: rsl86981332 _: rsl50584170, rsl50383700 _: rsl86988319 _: rsl99734710 _: rsl81307118 _: rsl91600920 _: rsl91610642, rsl48715852 _: rsl91869263 _: rsl89901931 _: rsl99517448 _: rsl89916807 _: rsl89985920, rsl50476713. rsl90178542. rsl99541482. rsl99556289. rsl85184782. rsl91894457, rsl50480773 _: rs202040659 _: rsl48778612 _: rsl91925752 _: rsl48780220 _: rsl86885716, rsl90176472 _: rsl99593898 _: rsl81665883 _: rsl83406464 _: rs202063632 _: rsl83412380, rsl90240971 _: rsl90014395 _: rsl50501065 _: rsl83417225 _: rsl81460611 _: rsl91958854, rsl81462461 _: rsl90272533 _: rsl85281319 _: rs202094206 _: rsl99865446 _: rsl 85287024, rsl88582091 _: rsl85299050 _: rsl85024438 _: rsl81475638 _: rsl88338964 _: rsl81483923, rsl99641736 _: rsl99645904 _: rsl86929314 _: rsl90308492 _: rs202117012 _: rsl99892190, rsl48851890 _: rsl88365902 _: rsl48875365 _: rsl85086938 _: rsl87137475 _: rsl 86966076, rsl88399816 _: rsl88630630 _: rsl87147755 _: rs202131976 _: rsl87154278 _: rs202134330, rsl50565310 _: rsl87164654 _: rs202143516 _: rsl 99704443 _: rsl88656041 _: rsl83295052, rsl83539858 _: rs369390668 _: rsl87193759 _: rs369399424 _: rsl99727999 _: rsl86993303, rs202174472 _: rsl99973777 _: rsl90147347 _: rsl92095965 _: rsl88444642 _: rsl90158143, rsl90162168 _: rs371446733 _: rsl99758845 _: rs371452205 _: rs202189258 _: rs200584416, rsl91878936 _: rs371463277 _: rs373492703 _: rsl83344898 _: rs202197776 _: rs202029201, rs202199966 _: rs373504863 _: rs375572917 _: rsl92146782 _: rsl99787775 _: rs369471212, rs200601591 _: rs202025197 _: rsl92162577 _: rs375588154 _: rs200046448 _: rsl91920966, rs375598820 _: rsl81660507 _: rs369497131 _: rsl81663245 _: rs200063383 _: rs371531127, rsl99812598 _: rs200597401 _: rsl81665495 _: rsl88826311 _: rs 192219936. rsl88832627, rs200108785 _: rs200645452 _: rsl88541589 _: rsl81682865 _: rs375655711 _: rsl81688711, rs369562725 _: rsl90265437 _: rsl90293501 _: rsl90298288 _: rsl87111894 _: rsl85309002, rsl90301922 _: rsl99882603 _: rs267599803 _: rs267599804 _: rsl87118004 _: rs267599806, rsl90315816 _: rsl90317291 _: rs369570716 _: rs200138840 _: rsl88856233 _: rsl 90498981, rsl88860567 _: rsl88616319 _: rs200539683 _: rsl87140106 _: rsl88622649 _: rsl 99927297, rs367555222 _: rs371606581 _: rsl99931920 _: rs367566025 _: rs200163378 _: rsl88660331, rs369399641 _: rs367571651 _: rs367571807 _: rs371613636 _: rs369608086 _: rs371423872, rsl88884870 _: rs202176279 _: rs200577751 _: rs375711571 _: rs369417568 _: rs369423609, rs200583405 _: rs202192818 _: rs200737144 _: rsl88912723 _: rs369449920 _: rs369642696, rsl88914048 _: rsl92134065 _: rs200610228 _: rs 192166263 _: rs369658549 _: rs200761212, rs369656358 _: rs375765886 _: rs367661413 _: rs375766727 _: rs369495152 _: rsl90535962, rs371527903 _: rs200249016 _: rsl90540941 _: rs375799332 _: rsl90546528 _: rs200798617, rs369509292 _: rs373709275 _: rsl88806060 _: rsl90531276 _: rs200087066 _: rsl88836606, rs200111928 _: rs373589491 _: rs267599796 _: rsl92385827 _: rs367751260 _: rs373745889, rs267599797 _: rs267599798 _: rs267599799 _: rs267599800 _: rs200304117 _: rs267599801, rs367769201. rs267599802. rs375886082. rs200324539. rs373781396. rs200332178, rs267599805, rs200870389, rs375904859, rs267599807, rs267599808, rsl 92414996, rs375913659, rs373801645, rs375924387, rs373809612, rsl 92265142, rs367548480, rs375935709, rs371600996, rs200901459, rs371602570, rs369774732, rs375940680, rsl92268894, rs373828290, rs371808910, rs371609091, rs373851282, rs369602237, rs371834340, rs371834396, rs200699649, rs200174644, rs200713724, rs200714519, rsl92467232, rsl 89079827, rs373642730, rs373910122, rs369827785, rs369629253, rs367612792, rs371904852, rs200443068, rs367618914, rsl92487302, rs367955173, rs200448110, rs375735101, rs367960285, rsl92493052, rsl88918938, rsl88923501, rs200237524, rs371924465, rs200993949, rsl92495980, rs377606777, rs376067342, rs369668580, rs376077436, rs376077984, rs371945432, rs200267333, rs377618865, rs373714409, rsl90555109, rs201024779, rs201025253, rs368004835, rs367725043, rs528335161, rs200815649, rs200823247, rs367743519, rsl 90564167, rs371995171, rs374029324, rs375858081, rs201053512, rs201054824, rs528370535, rs372009758, rs373750985, rs369923291, rs367760568, rsl90568652, rs376148432, rs532092884, rs532095679, rs375874475, rs372025323, rsl92396596, rs373784889, rs201068959, rs373795368, rs374060366, rs200879597, rs200889952, rs369945036, rs374066106, rs530311911, rs375926577, rs200361632, rs375940201, rs377716847, rs371803816, rs201091432, rs200918296, rsl89057351, rs376193439, rs374093540, rs369978695, rs373876714, rs369984227, rs371863409, rs373893549, rs377757205, rs373895507, rsl92475064, rs367943464, rs376226677, rsl92482373, rs371909817, rs386396393, rs532177433, rsl92488609, rs376251291, rs373947111, rs368159955, rs376057050, rs376057473, rsl92504766, rs532196313, rs530398209, rs376266826, rs532199869, rs376080236, rs376090722, rs376099070, rs372137132, rs201026317, rs372138097, rs377649113, rs372142892, rs372146969, rs201041635, rs528506058, rs368186964, rs371987028, rs530423836, rs368191733, rs369906031, rs370084146, rs374033766, rs528371544, rs376146289, rs386660286, rs368207036, rs532090835, rs376153813, rs369935924, rs530301579, rs528540075, rs372191342, rs368065439, rs376163268, rs528393007, rs377708853, rs528549934, rs377708955, rs370131320, rs376343695, rs374242803, rs376346970, rs377714367, rs532274257, rs369959721, rs369970181, rs376355408, rs377731348, rs530501593, rs530503299, rs368271861, rs528426085, rs201106879, rs532149322, rs372256771, rs376220561, rs372090047, rs372268339, rs370200847, rs370202955, rs368312678, rs370208223, rs377766905, rs370009920, rs532339395, rs368326176, rs528637794, rs376432760, rs201126911, rs368335170, rs376437999, rs532353167, rs368148239, rs368338265, rs368154191, rs376439863, rs374341474, rs530392612, rs372316396, rs201148315, rs201149530, rs372131801, rs374363082, rs530585904, rs532389161, rs376480649, rs530401954, rs370279521, rs372134830, rs368394544, rs530404498, rs201158753, rs376505122, rs201330370, rs368408162, rs370311310, rs201342036, rs201342332, rs532426034, rs532431716, rs368183774, rs370321547, rs530422724, rs370324099, rs376528831, rs370332130, rs532442522, rs201170821, rs530663455, rs528738403, rs201174558, rs374447261, rs376547262, rs532229141, rs528745360, rs376306161, rs528749741, rs374458684, rs370362441, rs368212766, rs370096923, rs201397469, rs376590413, rs530450174, rs532492937, rs532497883, rs201412394, rs532246999, rs528793833, rs530718233, rs201417933, rs201191510, rs376615330, rs201427366, rs368530024, rs372497560, rs530735828, rs372199281, rs368232949, rs372203138, rs528820774, rs530467294, rs201443063, rs528563285, rs368548643, rs376640157, rs528834599, rs372527026, rs530760750, rs368250071, rs374566362, rs370465585, rs370467140, rs372539263, rs372540950, rs368582725, rs201474854, rs374252851, rs530493685, rs201234101, rs376680141, rs376686011, rs528588768, rs376688035, rs372250251, rs370505237, rs530798879, rs368613923, rs532310183, rs368287697, rs374319143, rs374319726, rs372593412, rs201511271, rs368334638, rs201279997, rs201280426, rs530569146, rs374352107, rs374355638, rs372606098, rs374357474, rs368652459, rs370545434, rs368655741, rs397989266, rs530838760, rs370553488, rs376743851, rs397725667, rs528925445, rs532630465, rs372625886, rs374658847, rs374381704, rs372368062, rs532653015, rs372368914, rs532659414, rs530879729, rs528718885, rs374422986, rs201574155, rs201575317, rs370610736, rs376542161, rs376810032, rs374444864, rs397781638, rs370354229, rs372702302, rs368468072, rs376825175, rs532682987, rs398091423, rs376830369, rs376830959, rs370373215, rs372714131, rs530924737, rs372716583, rs376837810, rs372462555, rs201415200, rs397823933, rs368768407, rs529018314, rs532696447, rs530737082, rs372731104, rs370435340, rs368776882, rs530946608, rs530738355, rs368783421, rs368784330, rs376864885, rs532708277, rs527245666, rs368793970, rs530969195, rs368807551, rs530740152, rs368548450, rs201645018, rs374811115, rs374813241, rs374813942, rs201461161, rs370483003, rs370722965, rs532571006, rs527290934, rs532741358, rs368833802, rs374832092, rs374834768, rs529092927, rs370747628, rs527308424, rs529096752, rs532577670, rs397940263, rs370757130, rs370779258, rs368882064, rs532774213, rs201698323, rs531051960, rs527343838, rs532587981, rs528880554, rs530805325, rs201706560, rs376710013, rs201715075, rs370528120, rs368637625, rs376719832, rs530821160, rs531087683, rs368641131, rs368641356, rs527386555, rs527386649, rs528905838, rs370542880, rs374943538, rs370554884, rs368680871, rs370576142, rs372907454, rs370880796, rs532837881, rs201753955, rs368972137, rs376780249, rs527426975, rs527429406, rs370603046, rs368988162, rs532852883, rs372674279, rs368994663, rs374712004, rs529232924, rs370912250, rs532677120, rs201789970, rs370916238, rs370917734, rs376815753, rs369008282, rs531149183, rs375012793, rs531153501, rs529249887, rs201588811, rs528992131, rs201815569, rs376833295, rs532889539, rs529010473, rs532891533, rs376840011, rs201827217, rs398105784, rs527496324, rs374757251, rs531187706, rs532903401, rs530941689, rs368781697, rs375092799, rs530977123, rs369107357, rs201871493, rs373062032, rs369118138, rs375110584, rs530980304, rs532943940, rs529077212, rs201659685, rs201660983, rs373083732, rs373085099, rs369137515, rs375130652, rs373090976, rs373090978, rs527567934, rs527577666, rs369175449, rs369177599, rs529364243, rs372804021, rs377243610, rs527612542, rs369198406, rs531287695, rs531288030, rs201680315, rs532780338, rs201703460, rs529136771, rs375206783, rs370805147, rs201955990, rs529406007, rs373178280, rs373180523, rs377000636, rs375226637, rs532793715, rs532795095, rs370823133, rs371155753, rs371161866, rs531091887, rs529430738, rs377023962, rs373209450, rs532821156, rs201748424, rs529186479, rs201985536, rs527401897, rs532839682, rs377064303, rs529449733, rs531352324, rs527429750, rs368992843, rs368997757, rs371207458, rs373246821, rs531141746, rs529242846, rs529251876, rs377340092, rs377121469, rs527726784, rs531378087, rs531378148, rs377351542, rs377136135, rs527529994, rs527741146, rs371256706, rs371258438, rs371261235, rs371262603, rs529501356, rs533085687, rs531398994, rs371190261, rs529508826, rs373289508, rs373289770, rs371276636, rs373294325, rs531174002, rs533101173, rs373312464, rs527779170, rs529536286, rs371319837, rs371324921, rs370960686, rs370965011, rs371331011, rs373340363, rs537561639, rs371337228, rs371339739, rs371341956, rs533123408, rs373347787, rs371344658, rs375383218, rs533996130, rs373351802, rs529287701, rs531193598, rs527814504, rs537585716, rs529297933, rs377191016, rs375119710, rs377197892, rs533136525, rs373370616, rs527556006, rs534025340, rs534034285, rs531476633, rs373128353, rs377467259, rs527838045, rs371378512, rs533152242, rs373391820, rs375425965, rs373153845, rs373411320, rs375444748, rs537640516, rs375445266, rs537640883, rs377492327, rs373160617, rs537644424, rs527869814, rs533005675, rs529608147, rs375206276, rs377268502, rs375460544, rs527889225, rs529415423, rs373186045, rs527896905, rs534112672, rs527898450, rs531534134, rs377285775, rs527659306, rs527667182, rs541087152, rs375493653, rs375495589, rs373207903, rs373470651, rs541104437, rs533035283, rs534145207, rs373216811, rs371174915, rs537719396, rs527925946, rs371182579, rs373484435, rs533222318, rs533224721, rs527689419, rs375274122, rs534170958, rs375533691, rs527945373, rs534180924, rs534182984, rs373239972, rs373299553, rs527706401, rs529465857, rs544723760, rs373253430, rs371221408, rs527975518, rs377342185, rs533267440, rs548630441, rs527981727, rs541186547, rs369341391, rs531615941, rs533980472, rs552363373, rs537817433, rs541210169, rs533293722, rs534248589, rs529741154, rs537826926, rs529486277, rs373337849, rs533089192, rs529562840, rs548605926, rs548693615, rs548695367, rs534270052, rs533335356, rs548710273, rs528036607, rs531580640, rs541269701, rs375561969, rs529780064, rs375393229, rs528043716, rs527816139, rs531668087, rs528048587, rs533362361, rs537873404, rs528054745, rs533371459, rs375397639, rs537589520, rs375401531, rs537596005, rs548758031, rs552474728, rs552475236, rs548766538, rs534320104, rs529831406, rs533149362, rs527845696, rs375446335, rs548776154, rs531709513, rs541336587, rs534336374, rs529845623, rs537647764, rs531719725, rs531726594, rs529856627, rs529861077, rs529610244, rs537935929, rs544900253, rs529879143, rs375458594, rs541064909, rs377518708, rs541077292, rs537693173, rs548839995, rs548840715, rs531765618, rs552561226, rs552564806, rs531537455, rs373466551, rs534395258, rs537715922, rs373480698, rs531799424, rs528148307, rs537718192, rs537988553, rs533495341, rs533221803, rs541438339, rs531817090, rs531827263, rs548903231, rs548903941, rs533229786, rs552625227, rs544986234, rs534163838, rs541470385, rs548928131, rs541266364, rs529978453, rs548606038, rs545005755, rs541495996, rs552676116, rs537784098, rs552331272, rs533569467, rs538053655, rs544731403, rs545041202, rs548635836, rs534483515, rs534483979, rs531616533, rs552697740, rs552697972, rs531637327, rs552701019, rs528207959, rs548997227, rs534255473, rs541528275, rs531919864, rs541246661, rs549012584, rs544786609, rs549028107, rs534512754, rs531950539, rs528235662, rs531961820, rs528025263, rs552652367, rs538109523, rs552432767, rs528040799, rs552783622, rs552786924, rs533352974, rs537878584, rs549093627, rs528274909, rs541595468, rs528292089, rs549117810, rs534302559 rs534576907 rs528065454 rs549122638 rs528301097, rs532025611 rs544845391 rs532031683 rs534586191 rs544855532 rs545175018, rs545176630 rs533719310 rs549145751 rs530167608 rs529833633 rs552864534, rs556555939 rs541325272 rs530179501 rs545200437 rs538184714 rs533745851, rs533414998 rs541664626 rs560631745 rs541681008 rs560651179 rs541686252, rs552926060 rs556599635 rs556603094 rs549191107 rs534651601 rs533788730, rs564642885 rs552946000 rs538224121 rs533799439 rs537932874 rs531749825, rs560686621 rs541710974 rs560689703 rs545286195 rs560701216 rs564675504, rs533447134 rs533453573 rs549218933 rs552994545 rs529890639 rs552551109, rs544929875 rs541747884 rs553018502 rs534391364 rs560762028 rs548866389, rs553033988 rs560772996 rs552586846 rs548883242 rs548890238 rs552623477, rs528166781 rs541475904 rs538289254 rs534725275 rs560799904 rs530007804, rs556708490 rs553079982 rs538305462 rs568929429 rs538045341 rs541806054, rs538109678 rs541813611 rs533576361 rs560847027 rs568953105 rs548983995, rs533583465 rs538064426 rs530038819 rs568962634 rs552720521 rs538332029, rs564864074 rs549015878 rs545100883 rs538359152 rs541858070 rs534529524, rs549324716 rs564901373 rs564904479 rs564812162 rs553188541 rs538116333, rs552795944 rs556798151 rs541804553 rs545511554 rs560838702 rs545513037, rs549087044 rs538152809 rs533697506 rs560969762 rs545168308 rs552848228, rs564957486 rs538413808 rs549151040 rs564959023 rs549358948 rs549359376, rs545194304 rs538419177 rs541899935 rs532080737 rs533800261 rs534661314, rs564683716 rs564684092 rs561004333 rs552998607 rs549229157 rs534870324, rs541923723 rs553291751 rs538474463 rs569104556 rs569111728 rs564712470, rs569113870 rs541945980 rs545338176 rs538498693 rs533862692 rs560778802, rs533876575 rs534925255 rs545634400 rs565081842 rs541967141 rs538280482, rs553047061 rs538547128 rs553383175 rs560786134 rs541983082 rs569168744, rs569173187 rs534720210 rs549264025 rs553198970 rs545684846 rs569187768, rs569033866 rs565154037 rs556959343 rs549341906 rs565159780 rs565160041, rs561179339 rs549343940 rs556968079 rs535005346 rs553109931 rs553110152, rs549473092 rs541819382 rs556986297 rs553112654 rs545433120 rs569217647, rs545463713 rs542028713 rs557011350 rs549492178 rs538356389 rs569020006, rs553188228 rs560964601 rs557031273 rs565151632 rs545695796 rs545513830, rs564941540 rs553505777 rs564943632 rs545530625 rs535073221 rs553241209, rs534829443, rs569261408, rs542077418, rs538424833, rs549363739, rs553522655, rs553256315, rs565252693, rs561002322, rs545792078, rs545793355, rs553541087, rs557089187, rs538432148, rs553260454, rs553274082, rs541943675, rs565043664, rs542114408, rs545818948, rs557116983, rs535135021, rs545834669, rs561303200, rs561076996, rs553345031, rs542150774, rs557149576, rs549417348, rs561114332, rs553381404, rs534955920, rs542162046, rs549576562, rs549458141, rs561323138, rs561166361, rs561168246, rs557034954, rs557178092, rs538779705, rs553629979, rs565360656, rs569337654, rs561222929, rs535193986, rs569343615, rs553641547, rs569196602, rs569199529, rs557037295, rs553438803, rs553445383, rs553659120, rs565389275, rs553450279, rs557214946, rs542211065, rs553671274, rs557220292, rs535228630, rs535019900, rs538621149, rs557015322, rs538826221, rs549496498, rs545929782, rs565418897, rs542041294, rs538837620, rs549505560, rs561388615, rs553508395, rs565433973, rs542063894, rs542042787, rs553513535, rs542243991, rs538849156, rs542071129, rs569264903, rs565450907, rs553722145, rs561249795, rs557072486, rs553533907, rs565457429, rs565458714, rs535276217, rs549697762, rs549699376, rs542269135, rs557296011, rs561426585, rs535106728, rs538890121, rs542182004, rs557317287, rs538902148, rs535312761, rs557095386, rs557327045, rs565278706, rs542108994, rs535326832, rs565518840, rs549751601, rs535115766, rs535344588, rs569316735, rs549767442, rs565536879, rs561469411, rs557363840, rs569449017, rs549776383, rs565548682, rs565551040, rs553823792, rs557383939, rs538750257, rs549795936, rs553599466, rs549797185, rs553599560, rs535162313, rs546079854, rs549816209, rs557157259, rs557160502, rs538986722, rs553618576, rs535183488, rs557440160, rs538775892, rs535200883, rs546004301, rs569347355, rs565385729, rs549621186, rs557209188, rs557472446, rs542438681, rs545907456, rs539041435, rs553913580, rs557226717, rs557229007, rs557231872, rs542226063, rs542456890, rs535242654, rs553928700, rs549894343, rs557504772, rs549658115, rs542237413, rs557511994, rs549908911, rs535253686, rs546175363, rs535484821, rs549919467, rs545944280, rs565704817, rs542243936, rs561399032, rs561405092, rs557547731, rs549685862, rs542509395, rs546214652, rs565453934, rs546215663, rs561408063, rs545991022, rs557314075, rs553982941, rs539124418, rs561606670, rs557574984, rs538914388, rs535427130, rs549981864, rs565625383, rs546124690, rs546130204, rs565766555, rs539034735, rs539040773, rs553913825, rs557602335, rs542554745, rs542558524, rs553914657, rs554017366, rs550011049, rs565790219, rs553784643, rs539173833, rs561645651, rs539179209, rs539183118, rs557352376, rs561655654, rs550047175, rs561665122, rs565533505, rs565567431, rs546311890, rs539215014, rs546066782, rs557396705, rs569465856, rs569471272, rs565843348, rs549823502, rs565601743, rs542632013, rs542632865, rs539229154, rs538998631, rs565855338, rs561521580, rs549850091, rs542643176, rs539249630, rs554097921, rs569716586, rs565660414, rs535550332, rs549879065, rs550122039, rs546156126, rs539267572, rs549902035, rs550131740, rs561726036, rs557734517, rs535478504, rs565916645, rs569751087, rs539295491, rs539299029, rs561756896, rs557761142, rs557513728, rs535496347, rs565940670, rs569543941, rs542719049, rs542496759, rs549942024, rs554169478, rs557550820, rs561806415, rs539118922, rs569815835, rs546216545, rs539352777, rs546218384, rs546219353, rs561825066, rs569832699, rs557578610, rs535766593, rs535767766, rs561838356, rs539382432, rs561614357, rs561860619, rs539386649, rs539386852, rs549987875, rs565767073, rs566036762, rs546478774, rs542801831, rs565890648, rs569877978, rs561620672, rs561627139, rs554012126, rs535566301, rs539406222, rs565793009, rs546491492, rs554244349, rs535671384, rs542588820, rs550292008, rs550056630, rs550294226, rs554062977, rs554252787, rs542832809, rs569904203, rs569669996, rs546316704, rs539436179, rs550070310, rs566088937, rs569674985, rs539452689, rs550335201, rs565844486, rs554284141, rs542875735, rs557955529, rs546540133, rs557960582, rs569678808, rs542896410, rs569978717, rs539487614, rs535901586, rs539489539, rs539489876, rs542637647, rs550386068, rs542914501, rs535644932, rs546568309, rs546336229, rs539260152, rs535913192, rs565893128, rs542672440, rs566044822, rs535925070, rs561969220, rs546589893, rs566046950, rs550260345, rs542806189, rs539531796, rs546484939, rs535808196, rs569888576, rs565908359, rs557762342, rs558048852, rs565935036, rs570058097, rs554372535, rs558081471, rs542713151, rs539575481, rs554154472, rs566232416, rs569798035, rs565967558, rs542748350, rs566247081, rs557819130, rs557823984, rs557824244, rs565998770, rs566023334, rs550518697, rs539387247, rs557891070, rs535932779, rs558143874, rs535817837, rs561959910, rs550538024, rs561960357, rs539415464, rs542830028, rs562091717, rs570137634, rs562095289, rs570145386, rs539428695, rs539434769, rs570161889, rs566303521, rs566306563, rs550317300, rs566098822, rs569941115, rs546713439, rs562153386, rs554298287, rs554314288, rs557994738, rs561948453, rs566339153, rs557999097, rs546576407, rs566190328, rs543047549, rs550639468, rs542950459, rs558037918, rs535937573, rs570033000, rs570037688, rs539613616, rs570133513, rs562227978, rs562083952, rs550684795, rs566389371, rs558303567, rs558303944, rs554419150, rs570040996, rs550697745, rs550453096, rs558082557, rs536134669, rs562029428, rs570305967, rs539737713, rs535981759, rs550720126, rs570093154, rs550500385, rs535988775, rs570100791, rs550742780, rs562312310, rs558365277, rs566436397, rs543259254, rs562323901, rs536169328, rs558120108, rs562064826, rs546833887, rs550515527, rs536187108, rs535998323, rs550791035, rs562091549, rs562083950, rs539627192, rs554436808, rs543300903, rs562145285, rs543104450, rs539654093, rs539807168, rs562161170, rs546720431, rs566481881, rs539672749, rs558435701, rs570218617, rs562183661, rs562196559, rs543133113, rs546745005, rs543132839, rs550843290, rs550845895, rs562417776, rs539838432, rs558475731, rs543368282, rs543374005, rs562395121, rs558255957, rs543381042, rs536248326, rs539693867, rs539875539, rs566535038, rs554701659, rs570495212, rs562220425, rs570262409, rs566372781, rs539704919, rs543179493, rs539891892, rs558544036, rs558305325, rs558316454, rs562263006, rs554733806, rs570297775, rs550705817, rs566562404, rs558563868, rs543446158, rs562516908, rs570545452, rs543219384, rs554772874, rs554530019, rs554774669, rs554531018, rs562286761, rs543469924, rs546954387, rs570320602, rs536169927, rs558384946, rs546965918, rs539942232, rs539944659, rs566604715, rs570590018, rs546972113, rs536314608, rs570591366, rs562577196, rs566459394, rs558632233, rs546978504, rs562584140, rs550788909, rs558639346, rs543296358, rs536191389, rs543520479, rs570387360, rs554841206, rs566626931, rs566628711, rs543297536, rs558662033, rs539801579, rs554859167, rs554597273, rs554598088, rs554867521, rs570644854, rs558679007, rs543559797, rs551073147, rs536360171, rs554896245, rs570662964, rs543574832, rs566476097, rs543314471, rs536373517, rs547040703, rs570409419, rs566667607, rs550825845, rs550829115, rs566494492, rs543590133, rs546866780, rs562683151, rs554674005, rs540009230, rs566676845, rs551120006, rs570697807, rs570470232, rs562460418, rs566512376, rs543604520, rs554953151, rs550902759, rs562729444, rs554710753, rs558531553, rs566545229, rs554713839, rs550920542, rs566553725, rs543646551, rs540046777, rs543651491, rs550925190, rs550927979, rs550932310, rs562534202, rs562539996, rs562543136, rs555016660, rs555017817, rs543469607, rs562777298, rs558826084, rs570566948, rs554790599, rs555040790, rs546962950, rs546974447, rs547174324, rs558638155, rs558640467, rs570608672, rs570611176, rs554852805, rs566773145, rs536515480, rs558857800, rs562615672, rs566780115, rs536518560, rs558667707, rs551054474, rs562659842, rs558870171, rs558879829, rs562662746, rs570850004, rs536378937, rs554917970, rs566819640, rs566819747, rs570682027, rs570682325, rs536556466, rs547242462, rs551106826, rs540127066, rs554927360, rs543771540, rs566839490, rs540017210, rs555144412, rs570878620, rs562900499, rs547091370, rs566851258, rs540145101, rs547072501, rs547277814, rs562916365, rs540151196, rs551346309, rs547290831, rs551352401, rs551352507, rs555184897, rs547298150, rs547078962, rs543793996, rs555189413, rs558903351, rs558930737, rs562739851, rs547312685, rs566709145, rs555210681, rs558786750, rs566913539, rs562972646, rs558791009, rs551405814, rs558791264, rs536446347, rs547350742, rs566717656, rs543868401, rs558965887, rs566945486, rs555257971, rs555007276, rs563027295, rs536686009, rs536690468, rs566722601, rs543659591, rs551469899, rs547139370, rs547139778, rs551200168, rs570775612, rs536474508, rs543690232, rs551487809, rs555050939, rs567026450, rs543929158, rs536499919, rs536739568, rs543701791, rs562816924, rs551523372, rs540088548, rs547186946, rs551252968, rs567055420, rs571087292, rs563110484, rs563117996, rs571099335, rs567076510, rs571107837, rs551258407, rs559051242, rs536789092, rs567101152, rs551577522, rs555098760, rs559063321, rs555427556, rs563165056, rs562852262, rs567125783, rs547231436, rs563172047, rs536546848, rs558883300, rs540357371, rs543998510, rs570853808, rs566823128, rs551625796, rs540375049, rs540381696, rs540384823, rs551638849, rs547245439, rs555489730, rs570871621, rs536849628, rs571202836, rs562944602, rs540134025, rs540401578, rs540408526, rs536616422, rs547597464, rs551665285, rs536872363, rs555523932, rs555526169, rs567208157, rs547303217, rs540435213, rs540440718, rs563281935, rs555566484, rs571277896, rs558937636, rs543834085, rs536633848, rs536649755, rs567269429, rs544103213, rs555592459, rs547339606, rs551407725, rs567279252, rs555249303, rs570980957, rs555294563, rs547395011, rs547403253, rs563356861, rs555641156, rs536979545, rs555646896, rs551738284, rs555649722, rs571023678, rs551741701, rs571353333, rs555656668, rs543906030, rs540247915, rs563063023, rs536719675, rs547739724, rs547434765, rs563398907, rs571374544, rs563088270, rs551512256, rs555697633, rs555355386, rs567050922, rs540289986, rs563427850, rs547789572, rs540292319, rs571416972, rs540593967, rs563444595, rs571422766, rs571433209, rs567086181, rs567109885, rs555436937, rs536812861, rs547827972, rs536813836, rs540357212, rs551613713, rs555453515, rs537091263, rs536846404, rs567169368, rs536856876, rs571482337, rs551816827, rs536859847, rs563514624, rs551664025, rs555538871, rs537119698, rs544090516, rs563300599, rs537121501, rs540673857, rs555827256, rs536929970, rs571508089, rs571508668, rs536935483, rs555592945, rs547679346, rs555836866, rs559166014, rs571323007, rs551724326, rs555635702, rs567506502, rs567507724, rs536971399, rs563566970, rs571352583, rs563568347, rs551844242, rs559340497, rs551846278, rs551846743, rs559341841, rs547931286, rs544151150, rs563577745, rs563382713, rs547737303, rs536996846, rs559363106, rs571364152, rs571558410, rs563595280, rs571567928, rs567350465, rs540563293, rs555899416, rs555902023, rs540753264, rs547970431, rs567363248, rs563415295, rs547983951, rs544173340, rs537043752, rs537214406, rs547812246, rs551879480, rs547993868, rs548000107, rs571435808, rs567420353, rs559424092, rs547823486, rs563483716, rs540629441, rs540629515, rs555976770, rs555777449, rs551809589, rs567446716, rs567641815, rs567646528, rs571660279, rs559261006, rs544349356, rs548065850, rs540840346, rs559276331, rs559278483, rs551928440, rs567689357, rs551929310, rs559279810, rs571504242, rs537318827, rs547895473, rs551940292, rs559532875, rs547878540, rs556065157, rs537345532, rs544388762, rs544393130, rs540895241, rs540866519, rs544257311, rs559556837, rs559309453, rs547899913, rs571753726, rs563746387, rs567761568, rs563757457, rs537379654, rs567498471, rs544427671, rs544262353, rs556121669, rs540690647, rs556127297, rs559598698, rs559606541, rs537405489, rs559321279, rs540706169, rs551987834, rs559337010, rs559347626, rs544465965, rs571550179, rs563806842, rs548230137, rs540986538, rs544487528, rs540728015, rs571850223, rs556197881, rs555884132, rs547949414, rs541001709, rs567863701, rs559372796, rs559680959, rs552019644, rs567869203, rs567870454, rs547961099, rs541016855, rs567879125, rs541021339, rs571586522, rs544522476, rs540767323, rs555921135, rs537482386, rs571594220, rs548285643, rs547989866, rs556253885, rs563871364, rs577033710, rs567599038, rs544321880, rs571620138, rs572884688, rs537243271, rs540808581, rs571637853, rs548036815, rs559451854, rs567936071, rs572895474, rs577054727, rs571650383, rs559767097, rs548336215, rs563896028, rs556305053, rs577068480, rs555995534, rs556309001, rs577070742, rs548344372, rs540844595, rs567959669, rs567961754, rs571688001, rs537313785, rs548095617, rs559791432, rs551946194, rs571988542, rs577105076, rs577106997, rs571995770, rs567730925, rs559814837, rs548390003, rs563934615, rs548396932, rs544640074, rs556079236, rs559560231, rs571750965, rs577128601, rs544426243, rs568011120, rs568013209, rs540928678, rs572034102, rs552131496, rs556122502, rs568022195, rs556145294, rs537412583, rs563794521, rs548206366, rs572052337, rs568041807, rs571831052, rs568049189, rs568058428, rs573030624, rs544489108, rs552170259, rs548247489, rs563828707, rs568078114, rs556212440, rs572088894, rs552021815, rs548274362, rs544523548, rs563990413, rs556235464, rs544529883, rs571903551, rs548309130, rs573077502, rs572106664, rs568110435, rs559955686, rs567924525, rs572112442, rs567926424, rs577045354, rs552234790, rs573113401, rs552058068, rs568148811, rs573121367, rs548550253, rs559998638, rs556287145, rs571938005, rs548558872, rs572890684, rs577290955, rs577292261, rs572150714, rs559765216, rs572155672, rs572158471, rs544586948, rs572913959, rs573160601, rs747712985, rs560043632, rs573167200, rs563907502, rs571973015, rs556526024, rs556327353, rs567975949, rs760198840, rs760210419, rs573205862, rs560088419, rs544623102, rs755845974, rs760222861, rs747770564, rs544640954, rs560106879, rs568266593, rs755863114, rs573235194, rs568274876, rs544640966, rs564101462, rs560103717, rs747793551, rs760248036, rs751663294, rs751664345, rs577362467, rs577369950, rs573248764, rs560125265, rs560139002, rs747803001, rs755887904, rs564110432, rs556367826, rs563942887, rs572985335, rs760269028, rs760270839, rs573269726, rs573274989, rs755911728, rs568318953, rs568021757, rs552135679, rs751707408, rs548426846, rs548434418, rs564139342, rs572051591, rs552153259, rs572072274, rs751715959, rs577188062, rs564146980, rs747848559, rs568341536, rs559908081, rs552188124, rs755939021, rs577206764, rs760317521, rs755948736, rs751743006, rs548476386, rs747872827, rs568369197, rs755960815, rs751754553, rs560223974, rs548479685, rs755974168, rs556435037, rs552196596, rs747896126, rs560244168, rs747652031, rs577224235, rs560258646, rs564222571, rs747919920, rs747920698, rs751799865, rs564232803, rs559961814, rs573094174, rs568132972, rs556477565, rs573125212, rs760392111, rs751811657, rs747935767, rs564034713, rs747687632, rs573403776, rs568440721, rs573407011, rs568443175, rs756030608, rs756033415, rs760408414, rs568181862, rs577306835, rs756041910, rs756046052, rs760422077, rs751843738, rs556510801, rs560051435, rs564286021, rs572378208, rs747984594, rs747722134, rs560069352, rs760197604, rs560342878, rs747758544, rs755880912, rs564315556, rs747802842, rs564319674, rs748001649, rs756097705, rs756101883, rs747806350, rs564327126, rs751895172, rs560367843, rs573263034, rs760268052, rs568526655, rs748023590, rs755919537, rs572260364, rs577555445, rs573294722, rs560394921, rs573510446, rs756133876, rs747839312, rs760511521, rs564370775, rs564376248, rs564376364, rs564139682, rs568563556, rs756152385, rs747840172, rs748066260, rs755927850, rs568572679, rs756164092, rs760534890, rs573300647, rs755934945, rs577592262, rs564406770, rs572457547, rs760552076, rs568591083, rs756188538, rs573308926, rs760562998, rs760563121, rs760570118, rs748111999, rs560198805, rs760579685, rs756216388, rs747872225, rs564189021, rs560233324, rs752008994, rs760354089, rs751778116, rs573361908, rs564233597, rs760385297, rs756235256, rs573614189, rs564467006, rs560275772, rs756017969, rs751810656, rs756253735, rs752039226, rs760396460, rs748161647, rs573639338, rs752049714, rs564246741, rs756283462, rs756036768, rs752075001, rs751831496, rs568467023, rs560552869, rs564283486, rs573454368, rs751868849, rs573456185, rs756083960, rs573680167, rs760664319, rs751875406, rs752090289, rs572396332, rs568710098, rs573691588, rs756314691, rs568714294, rs560573477, rs573699383, rs756323206, rs760471899, rs760479501, rs751898764, rs568534435, rs752116103, rs748034773, rs760504745, rs560600463, rs760708481, rs760714819, rs573514386, rs572557414, rs572557958, rs748254868, rs564377275, rs568762604, rs568763194, rs564589023, rs748061016, rs756162245, rs756166577, rs568771006, rs572446618, rs751979729, rs764601912, rs764605517, rs760741465, rs748114059, rs568620077, rs756383690, rs756384871, rs756391400, rs568788881, rs756217888, rs760588798, rs573602750, rs752180138, rs564623778, rs764627821, rs748299503, rs764629910, rs748130651, rs573784861, rs756408393, rs760595864, rs756232724, rs760773412, rs564463915, rs572496260, rs568653598, rs756251559, rs760779022, rs760781539, rs573635982, rs573652549, rs764654464, rs764654987, rs752068753, rs769305453, rs568692918, rs572619991, rs573832704, rs577665160, rs577761370, rs756466412, rs577665609, rs764690747, rs769329264, rs573852888, rs573675286, rs748196037, rs748367875, rs756300662, rs748197749, rs769359391, rs748203432, rs760863009, rs752091198, rs748223187, rs773898368, rs773899834, rs760887512, rs769397943, rs572545263, rs748230012, rs560591096, rs760702095, rs756547221, rs769403605, rs573916611, rs769405373, rs577691821, rs760899135, rs760714916, rs764778710, rs568759555, rs560626809, rs577708424, rs760913893, rs760731022, rs769428087, rs752151307, rs573942940, rs756582059, rs760926092, rs748456913, rs773957562, rs756374806, rs752355335, rs752164940, rs773961853, rs764816927, rs769453577, rs748280577, rs752176014, rs748472979, rs748292693, rs773973849, rs756396678, rs748477123, rs764831522, rs773986296, rs769475897, rs773989494, rs748488874, rs760962529, rs573989260, rs764630000, rs577731358, rs764860091, rs760978530, rs764864844, rs774010599, rs760982318, rs756646387, rs752189483, rs752410640, rs774021506, rs764642317, rs756660471, rs752418450, rs756665161, rs760775128, rs752425890, rs573795407, rs769274495, rs748536445, rs774042540, rs774048085, rs748545555, rs764904906, rs769280972, rs764652287, rs756440425, rs760811102, rs752447253, rs752235456, rs761032088, rs769555239, rs572796375, rs574058322, rs774068807, rs756705591, rs748349778, rs769336373, rs769338143, rs572806703, rs577774022, rs764939256, rs756720374, rs764945437, rs748582085, rs764945982, rs752476251, rs760841353, rs756513893, rs764950876, rs752287839, rs756729306, rs752297787, rs572669937, rs748598416, rs774106005, rs769399952, rs764965507, rs752311316, rs752497016, rs756746876, rs773911266, rs756751094, rs577975798, rs769406266, rs574113216, rs756760486, rs773923447, rs764988719, rs774134060, rs577817761, rs574123608, rs577819850, rs756774376, rs748441157, rs769427963, rs769635948, rs577828656, rs773960161, rs572703392, rs774161475, rs774166363, rs769655303, rs573964931, rs752360938, rs756801766, rs765030112, rs756607238, rs773975660, rs769663323, rs769485808, rs765038582, rs769489930, rs752404557, rs760993327, rs577891615, rs752570519, rs756669277, rs769526833, rs752577872, rs756686221, rs752579270, rs765055750, rs774053639, rs774056463, rs769547374, rs765060451, rs756834336, rs769697350, rs748688074, rs769552330, rs761176538, rs748569277, rs764931376, rs752602102, rs748570604, rs577938233, rs765079537, rs572821828, rs769714725, rs769715263, rs748702455, rs778946702, rs761194066, rs769584093, rs769728383, rs769584739, rs574226258, rs756733895, rs752623537, rs572831835, rs769737839, rs748724583, rs769751821, rs764963646, rs574251268, rs756744372, rs574252861, rs778985925, rs572843309, rs572847858, rs765130065, rs778995848, rs748620885, rs774135156, rs761102708, rs748634639, rs778858396, rs769640361, rs748638838, rs756924729, rs769789991, rs774160058, rs765025378, rs778880075, rs748774375, rs765030749, rs752560435, rs748779730, rs761272117, rs574168108, rs761275474, rs774331029, rs748665185, rs752569189, rs761285678, rs774336593, rs774337248, rs774186159, rs769825005, rs774186312, rs765046340, rs765197037, rs748804697, rs774192739, rs774347834, rs752719194, rs765053376, rs774353243, rs769686936, rs752584469, rs769689165, rs761175735, rs748821446, rs774216408, rs779085566, rs756992674, rs752600325, rs779091257, rs756848600, rs774223726, rs769864516, rs757002620, rs578072520, rs752618492, rs778955408, rs748715760, rs756876862, rs578225050, rs761341190, rs774391562, rs757014692, rs761222522, rs779115346, rs574371001, rs761349593, rs748854017, rs774405519, rs774414609, rs769756282, rs769900279, rs765269419, rs578248325, rs757039020, rs779142152, rs765273810, rs761368462, rs752647546, rs752648254, rs748747222, rs578129064, rs761376071, rs752793643, rs779155954, rs756912570, rs761242853, rs578133960, rs779008588, rs765147928, rs765157924, rs761387896, rs765298863, rs574289184, rs748900042, rs748900359, rs748903647, rs765161179, rs779182285, rs774457893, rs779184623, rs774462243, rs769947455, rs761268185, rs774315933, rs769807467, rs757082613, rs779198432, rs574313122, rs574313734, rs774474141, rs756962592, rs769962695, rs765336626, rs578179995, rs752711411, rs574458913, rs769976728, rs774491733, rs769977897, rs774492634, rs774493534, rs779222384, rs774495164, rs752715110, rs761443956, rs765353110, rs761448083, rs745307800, rs756977771, rs761309525, rs779077329, rs578196436, rs774519441, rs770004970, rs761315687, rs761316770, rs574495530, rs774529527, rs761321050, rs774530252, rs765386986, rs748973626, rs748973627, rs757133463, rs748828225, rs765230695, rs779266099, rs752748793, rs757136675, rs774383876, rs574508392, rs779272569, rs774384874, rs769871282, rs770029029, rs774547298, rs769874133, rs765247065, rs774550874, rs574389937, rs779283236, rs779147250, rs757155404, rs578257388, rs761502544, rs757050845, rs770047247, rs765419083, rs761505273, rs774567217, rs749011196, rs749015876, rs752793109, rs748883560, rs574552014, rs757176136, rs745369385, rs748885768, rs770070419, rs761530507, rs765451793, rs757058117, rs757058373, rs761536633, rs765295464, rs774442218, rs745390122, rs757067340, rs765311703, rs765322398, rs761415711, rs779195227, rs779200595, rs779345846, rs752825541, rs769960587, rs765475427, rs769967116, rs748927605, rs779225765, rs574586398, rs752941011, rs770122720, rs574596795, rs574597445, rs761455103, rs757118229, rs779382905, rs779383112, rs745429338, rs745312595, rs761462940, rs574491673, rs761597194, rs761599494, rs757243333, rs779410370, rs779412843, rs761466880, rs752975240, rs765539315, rs745457404, rs765540362, rs774686210, rs765546386, rs770179183, rs761616081, rs748971093, rs765389948, rs749126779, rs757269251, rs770197217, rs770020418, rs774536578, rs749134108, rs770210545, rs770023198, rs774545314, rs749138801, rs779274547, rs574677268, rs770030745, rs765586176, rs753012958, rs761655939, rs753017550, rs757294772, rs574515837, rs745506408, rs745343181, rs757302657, rs753027988, rs757155232, rs770251203, rs749000689, rs774760378, rs765623505, rs745532972, rs770046573, rs770060375, rs761698317, rs749020551, rs761700759, rs745542495, rs749193663, rs779316495, rs770276976, rs745545483, rs774783309, rs752912874, rs757338538, rs752914303, rs745550587, rs745552413, rs745555704, rs752918908, rs770088715, rs749044361, rs749045543, rs779538718, rs774803610, rs757355631, rs749045802, rs761730085, rs749046670, rs765670414, rs753086820, rs770097595, rs745578485, rs774820137, rs761742228, rs757371555, rs774611591, rs761743865, rs745582743, rs770320994, rs765684724, rs770101312, rs779349603, rs761751891, rs774830324, rs761752275, rs779575384, rs574752911, rs757382094, rs765477377, rs752933949, rs749250622, rs745599005, rs753105639, rs761559688, rs779590735, rs745420346, rs770135265, rs770141285, rs770360889, rs761592302, rs765724186, rs753121973, rs749095875, rs752973981, rs757410960, rs749117765, rs745472367, rs761787288, rs765731405, rs779616180, rs765736652, rs574663613, rs770200336, rs574785603, rs770210577, rs745491835, rs745633219, rs753004431, rs774726498, rs779471280, rs765746165, rs779477877, rs761678822, rs770389881, rs765749735, rs774758781, rs774892364, rs761691614, rs749308980, rs774895449, rs574710974, rs749314067, rs765634312, rs745659019, rs779519063, rs574808625, rs765772575, rs779524550, rs779527264, rs770288343, rs765652414, rs761835406, rs770429425, rs770429498, rs749207703, rs757347565, rs774806601, rs779551067, rs745681042, rs779688634, rs779692735, rs770450864, rs770453628, rs779560080, rs765682141, rs574840762, rs779569968, rs757487913, rs779570073, rs745700374, rs765697384, rs757496015, rs774835951, rs757389590, rs765826592, rs753204125, rs745608356, rs761883445, rs774853006, rs774855939, rs779605405, rs779733116, rs749391786, rs774983974, rs774861680, rs753221656, rs765853804, rs774988933, rs770504391, rs574776736, rs761786138, rs765871927, rs749413567, rs761787151, rs779771044, rs749417123, rs749420331, rs757549090, rs574892965, rs745630620, rs774876702, rs753137535, rs749292402, rs770384951, rs753142305, rs757424866, rs770559204, rs749296741, rs757582827, rs770389041, rs574921751, rs775055950, rs779823900, rs745797756, rs761976295, rs779830823, rs779636717, rs765936472, rs574932883, rs774893568, rs770596799, rs779646839, rs765947401, rs745658149, rs749321856, rs765953951, rs765958206, rs765958383, rs770416224, rs749492905, rs765775433, rs770614031, rs775094954, rs745835571, rs779872969, rs765776366, rs749328659, rs775106546, rs761840011, rs779676546, rs749342215, rs745850175, rs770635323, rs749513977, rs574967040, rs757470309, rs749515018, rs753321711, rs757647411, rs757486010, rs574972566, rs775119800, rs765812732, rs574842120, rs779901678, rs745698392, rs757655001, rs779905648, rs770653074, rs762043644, rs761871771, rs745868315, rs779715334, rs745708008, rs779913231, rs753205323, rs762052761, rs779723844, rs574987020, rs766017851, rs753205934, rs779924149, rs770669912, rs766021133, rs745881008, rs757672460, rs779931477, rs757675244, rs745891504, rs745720580, rs749394350, rs770506883, rs761916613, rs753238988, rs766044564, rs745762687, rs749549443, rs770540650, rs766047928, rs770543896, rs766050222, rs779958907, rs753367594, rs753367750, rs770546945, rs775031885, rs749436136, rs775181872, rs757572498, rs753266326, rs770710528, rs779820760, rs775064110, rs762101797, rs765937462, rs775188334, rs745921364, rs762105442, rs779844461, rs757713821, rs779981593, rs762112528, rs775198435, rs766078662, rs757721860, rs762119038, rs753292241, rs745939820, rs761996873, rs575031922, rs753297701, rs753300339, rs780011851, rs762017425, rs780018527, rs749507043, rs780019769, rs765983788, rs775233897, rs749598140, rs766117144, rs765984332, rs757641675, rs770636887, rs753407034, rs770767590, rs757762973, rs757647835, rs745974735, rs762173213, rs775212916, rs762173683, rs766143542, rs766143752, rs757649900, rs766145406, rs753427557, rs770795008, rs765997845, rs745993374, rs766001573, rs749524029, rs775273379, rs779911081, rs745999522, rs753434251, rs779911858, rs746006325, rs766166455, rs766168053, rs757803577, rs745875354, rs749633081, rs770814654, rs757805145, rs766015302, rs753445557, rs749638814, rs766019743, rs775298771, rs766188571, rs766037522, rs779945160, rs779949952, rs766044301, rs745900932, rs749655279, rs575095661, rs762083371, rs762085792, rs746046381, rs575100124, rs757846947, rs746054703, rs749673345, rs762086376, rs766057731, rs770705124, rs757869091, rs775181164, rs757704367, rs749695349, rs746081425, rs762099447, rs775185585, rs749702419, rs775186985, rs749562570, rs780172964, rs745922042, rs749707385, rs766263293, rs746096974, rs753384202, rs770791590, rs749714011, rs770918284, rs775401705, rs746107172, rs780003258, rs766280872, rs753519453, rs780008142, rs745954161, rs762315463, rs757752502, rs770939500, rs749597155, rs757929982, rs746128576, rs762152102, rs770947399, rs745964149, rs749743958, rs762335489, rs770766600, rs775245150, rs762338672, rs780228898, rs749614271, rs753552486, rs775449793, rs766319359, rs766323563, rs780245371, rs746154682, rs762181334, rs775472222, rs766280701, rs775475182, rs757977555, rs757978975, rs770931151, rs780267296, rs770997764, rs757916036, rs780205945, rs575157657, rs757992394, rs771005418, rs746180135, rs762183067, rs766362780, rs771009038, rs780061636, rs771009307, rs762387126, rs766367727, rs766368581, rs757792173, rs780073349, rs766168331, rs780082796, rs775297492, rs775308110, rs757826438, rs780315709, rs758035498, rs762422669, rs770839574, rs749652481, rs762425469, rs746218660, rs780326732, rs775552644, rs746031362, rs771057618, rs762437124, rs770850567, rs775563265, rs749835090, rs757838799, rs753474398, rs762450422, rs762451403, rs758068950, rs753662928, rs770871086, rs771079501, rs770875574, rs753673609, rs762466666, rs766449347, rs762473664, rs775363269, rs746269664, rs746270782, rs746076834, rs771101017, rs746273137, rs758100507, rs753696139, rs780164986, rs780387548, rs775617305, rs780390487, rs758105444, rs757884371, rs762493123, rs766475288, rs746092299, rs746281706, rs775383486, rs757893141, rs758115802, rs749713541, rs753714258, rs766488010, rs753719223, rs749713677, rs753720414, rs766492868, rs771125854, rs762511001, rs780231784, rs758127073, rs771127702, rs749766209, rs746169464, rs575274775, rs762376230, rs775491720, rs753731740, rs775657564, rs775428073, rs775658964, rs749742970, rs762335602, rs762541504, rs771150797, rs746322011, rs758157003, rs749749377, rs762362270, rs771157610, rs758162211, rs762517868, rs766357122, rs749788807, rs749911248, rs771128445, rs575274484, rs746333565, rs753596686, rs775704461, rs771173856, rs746341917, rs746186643, rs780475560, rs746193804, rs775516663, rs753780938, rs771029510, rs766560991, rs771189138, rs758197140, rs780302599, rs775728693, rs746361329, rs775527212, rs762415812, rs753803834, rs762600386, rs746374330, rs753631651, rs780320948, rs780518212, rs575221910, rs746232012, rs758224718, rs775568883, rs766428601, rs746384549, rs758230618, rs762616423, rs753826066, rs766603395, rs780534207, rs762621610, rs775580341, rs753832717, rs749958831, rs766443908, rs758090555, rs749960657, rs766627036, rs749963613, rs775788526, rs746408560, rs762644135, rs775609117, rs575400838, rs766468653, rs780569370, rs758269206, rs753878572, rs746441956, rs766667358, rs780601275, rs749990021, rs780602857, rs766670853, rs575437081, rs766674528, rs766682646, rs780617288, rs749868817, rs746281239, rs775624502, rs753912194, rs766696780, rs758110703, rs746471952, rs749875280, rs762508511, rs758126114, rs758333653, rs753735005, rs771145743, rs753759590, rs753730859, rs780649338, rs766723996, rs575311491, rs746490599, rs775672433, rs762546488, rs750026382, rs766734425, rs766531730, rs771158339, rs575476915, rs771335500, rs766747934, rs753923061, rs766753318, rs771361606, rs780692388, rs771339289, rs775930399, rs750047913, rs762554421, rs780641886, rs746531650, rs780663065, rs780709751, rs758359046, rs758401577, rs575498348, rs575538498, rs780717013, rs771165869, rs758177964, rs758362118, rs762568013, rs753995270, rs575546172, rs754000384, rs775967011, rs780475811, rs750073618, rs758184076, rs766560373, rs771404139, rs780740066, rs758424092, rs775723799, rs775980483, rs766574301, rs746365474, rs775982060, rs780743261, rs775748778, rs775986548, rs775986905, rs575362555, rs575363802, rs762610159, rs771215180, rs754025046, rs771423403, rs771215781, rs762819950, rs780535184, rs771434272, rs746403296, rs753841483, rs749967206, rs753855829, rs575598081, rs766831850, rs750002472, rs780784061, rs750002879, rs758466985, rs771302766, rs750107407, rs746469766, rs758473504, rs771319793, rs750014529, rs758333222, rs775875097, rs780797534, rs746507836, rs775929381, rs746606580, rs746608262, rs766854459, rs776039606, rs780804421, rs762855694, rs771473590, rs766751199, rs754088416, rs575521978, rs758499272, rs753976053, rs766770334, rs766872709, rs753990717, rs750148431, rs771385490, rs754113248, rs746653389, rs758402469, rs753992475, rs575539306, rs762783481, rs762795708, rs754010144, rs762798134, rs775979839, rs746559821, rs754016875, rs766804365, rs762808748, rs771524228, rs750178119, rs758433908, rs780751943, rs758434866, rs771423880, rs758554451, rs575698436, rs750188485, rs776134843, rs762920542, rs758449196, rs771434449, rs746690639, rs776012316, rs771435919, rs776013782, rs758459277, rs780784333, rs575719667, rs754171794, rs750213847, rs766952453, rs758590686, rs766837720, rs780924547, rs754187409, rs758470618, rs762843583, rs762945483, rs766966889, rs754065137, rs766846969, rs766975773, rs771583859, rs766847092, rs758621159, rs754210541, rs575763004, rs746745673, rs762847850, rs776046182, rs575769280, rs771476914, rs575770408, rs766867806, rs750130001, rs758503519, rs780977957, rs750273256, rs754234000, rs762987248, rs746766606, rs780828772, rs754113034, rs750278291, rs780990971, rs767019803, rs762994113, rs762995346, rs758532401, rs771603133, rs767026353, rs750286697, rs758662550, rs776247771, rs780966765, rs754123422, rs754254854, rs575674713, rs754260453, rs781015534, rs776265470, rs776101575, rs746799288, rs781027767, rs776275747, rs780859151, rs750166682, rs776278401, rs754277291, rs746661487, rs763023634, rs780861535, rs575828647, rs758698366, rs771515339, rs771671647, rs746817534, rs754130748, rs758706192, rs776296970, rs781058660, rs762905000, rs767087921, rs781073957, rs750176719, rs766913758, rs763057284, rs762907750, rs746840181, rs754138099, rs776123078, rs750196811, rs781090887, rs750196938, rs776332744, rs781094408, rs776335691, rs776339969, rs754159937, rs754163459, rs750374458, rs771555935, rs746701844, rs763084100, rs754170644, rs781118074, rs771744938, rs750392389, rs762942133, rs762944719, rs758771328, rs575738479, rs758608464, rs746727958, rs780945258, rs771599013, rs750400627, rs776209381, rs776384816, rs780974867, rs771766533, rs776389291, rs758638925, rs750288334, rs758791887, rs780987748, rs575929383, rs771620501, rs746879575, rs767161420, rs750283733, rs767025015, rs754392803, rs771771881, rs763111072, rs767168384, rs750289902, rs771771293, rs776395377, rs776408436, rs763004187, rs781167842, rs746795885, rs767177596, rs767179565, rs763130803, rs767182627, rs746803551, rs754414288, rs781030516, rs754277304, rs758693649, rs754423728, rs750452203, rs575833682, rs763148676, rs754292067, rs750340252, rs776442345, rs754437136, rs776321471, rs781206011, rs758843257, rs781207680, rs776449588, rs758848166, rs776454881, rs771703842, rs758859852, rs771844291, rs575996626, rs776328434, rs763172665, rs781086455, rs776331034, rs781089009, rs767234541, rs771715327, rs767236606, rs758877832, rs767110682, rs575881882, rs771867178, rs750506837, rs776341567, rs776343691, rs754351607, rs746947857, rs781266351, rs750518410, rs781273186, rs576039139, rs754361671, rs758899405, rs575903723, rs767267531, rs767270878, rs767274571, rs781289127, rs576055087, rs763221534, rs771903251, rs776529322, rs750395451, rs771909114, rs746970730, rs767293664, rs754365087, rs750554318, rs767296018, rs758774462, rs781131021, rs781315161, rs758775915, rs750404570, rs763241368, rs771928708, rs758936629, rs776552739, rs781329345, rs771942011, rs754380358, rs750420726, rs771946379, rs754563130, rs776571904, rs576102011, rs758798171, rs781354223, rs758799589, rs746883877, rs747009227, rs763118413, rs758803250, rs776405690, rs758806756, rs776593982, rs771960223, rs781354273, rs576108786, rs758811128, rs763134030, rs781392093, rs772000148, rs754610376, rs754612029, rs754418161, rs776429606, rs767192897, rs763318541, rs763148029, rs758836437, rs767391545, rs754432361, rs576154990, rs758842113, rs747044382, rs776458960, rs781231591, rs754632333, rs747051634, rs763174985, rs772030273, rs776649512, rs750655728, rs781427492, rs776654856, rs750492945,

- I l l - rs746932296, rs781437757, rs759031742, rs763182916, rs772046878, rs750674693, rs576018668, rs750676187, rs759042231, rs759046460, rs776680396, rs750505680, rs576021476, rs776692770, rs772072696, rs767245856, rs576031277, rs759060934, rs776696997, rs758898721, rs781280482, rs758916739, rs746975981, rs772082757, rs754689622, rs763393390, rs767298025, rs771922320, rs754536091, rs763240132, rs781334318, rs758948313, rs754711370, rs750599889, rs781360926, rs747108606, rs776744339, rs747114420, rs781522333, rs767498321, rs754728500, rs781527310, rs754576613, rs576118666, rs763291307, rs781379123, rs576133520, rs750760393, rs763303269, rs767522254, rs763455818, rs759129745, rs781553622, rs750771811, rs759136534, rs771997067, rs754612627, rs750782749, rs750637603, rs750637916, rs759150971, rs776804111, rs763484389, rs772012841, rs750640718, rs767563344, rs759012413, rs747164471, rs754623438, rs763328099, rs763332642, rs776648911, rs767411176, rs750810963, rs763504898, rs750662267, rs747174454, rs576175413, rs747178697, rs750822746, rs772052667, rs747072299, rs750691811, rs781619317, rs781470413, rs767602286, rs772074431, rs576343392, rs747084510, rs776699270, rs776705318, rs763390654, rs750849384, rs576210690, rs763542745, rs576221019, rs747102578, rs750859796, rs772241396, rs767635284, rs759084930, rs772104715, rs772249614, rs772104719, rs763415127, rs759227621, rs772121042, rs776897115, rs763436339, rs776762727, rs772259945, rs747129870, rs750759174, rs576265608, rs767519344, rs747230718, rs781565727, rs763470456, rs776924295, rs781701921, rs767547476, rs772170435, rs776808849, rs576303348, rs772182443, rs763611276, rs750803674, rs747254617, rs759164988, rs750925394, rs772187879, rs767716042, rs759286277, rs772316620, rs767720034, rs747265713, rs576441486, rs576442593, rs576317168, rs767579929, rs576447789, rs781742545, rs781602929, rs776838045, rs750944515, rs754939557, rs750823852, rs759184414, rs772337925, rs781755935, rs754944624, rs747182076, rs772342034, rs754948723, rs776994087, rs772347276, rs781764568, rs776996732, rs750830318, rs772218330, rs754959762, rs767609550, rs759198338, rs763674067, rs747296872, rs763674655, rs776861032, rs777013080, rs747194917, rs772232639, rs767767715, rs750853186, rs747204704, rs576493632, rs759342224, rs763692492, rs747208899, rs754988399, rs759348920, rs576503650, rs763559997, rs772250879, rs772397018, rs576372722, rs763709961, rs772258370, rs767657096, rs751007056, rs767657762, rs747321219, rs759236402, rs763721335, rs759373663, rs767813915, rs767815241, rs767805536, rs772406653, rs781681456, rs776912238, rs759383943, rs751026757, rs767670989, rs781688312, rs751028661, rs759386121, rs772430907, rs772282168, rs767836512, rs781705809, rs747245817, rs750913756, rs576560375, rs747348729, rs767699386, rs747250221, rs754901587, rs755057019, rs777112698, rs781720615, rs759422250, rs759422516, rs781730421, rs772321918, rs763780033, rs763635896, rs751076013, rs747368499, rs772328426, rs754932586, rs755086147, rs776983342, rs576596271, rs759456830, rs772336808, rs777159266, rs772498793, rs755100226, rs576609411, rs767906427, rs759308804, rs763814663, rs763817509, rs755110001, rs750960477, rs763821142, rs759472994, rs759319080, rs754960592, rs777005707, rs763674675, rs576626275, rs772520972, rs767925497, rs754969861, rs747298935, rs777190579, rs759332513, rs777191601, rs763835764, rs777200066, rs777204274, rs763850479, rs576646549, rs763681979, rs767957891, rs767960115, rs777033750, rs747309536, rs767793827, rs772563699, rs767798619, rs772401890, rs777053793, rs777240104, rs772571344, rs747429212, rs576677862, rs772414988, rs751166640, rs759378061, rs759533284, rs751023155, rs777254106, rs767987787, rs777075020, rs755026641, rs767826811, rs751167068, rs777264933, rs755191658, rs777084010, rs755192243, rs772436481, rs772437430, rs759403389, rs747350875, rs751191760, rs768010524, rs777110111, rs763764330, rs755059022, rs777121485, rs772613599, rs755067126, rs576719685, rs576722503, rs777299593, rs759578019, rs777303311, rs759579892, rs755075016, rs576587762, rs759445364, rs772484960, rs796089470, rs751224909, rs759458296, rs772637938, rs759596143, rs751101455, rs755244424, rs755244545, rs763819415, rs759473985, rs763963972, rs751243180, rs777336791, rs777336835, rs763969514, rs759474253, rs767919206, rs755254955, rs772515740, rs759611310, rs772524427, rs576760756, rs576630960, rs576632316, rs751252199, rs777347844, rs777353402, rs747486328, rs772552344, rs755279767, rs763868327, rs772557957, rs772562566, rs764007884, rs751281512, rs755296842, rs763878639, rs796192020, rs777237438, rs751162345, rs759528801, rs755192222, rs759672954, rs759682828, rs764055874, rs796227008, rs764061799, rs755339494, rs767984404, rs751324932, rs777258179, rs751326575, rs755185309, rs576840353, rs767994360, rs772590811, rs751330443, rs755345820, rs576845470, rs772757323, rs777430556, rs768168022, rs759693337, rs751327608, rs777269612, rs755363786, rs796277063, rs796278245, rs764095900, rs772779126, rs796294894, rs763911156, rs576875910, rs768006927, rs759735617, rs777275948, rs768205617, rs759744820, rs768207163, rs763916801, rs763919951, rs751196812, rs759562845, rs777291191, rs796076372, rs764133033, rs751218362, rs777507730, rs759581950, rs772821624, rs751220371, rs755419349, rs576914536, rs751404091, rs751404377, rs764154554, rs755426294, rs751410337, rs768244583, rs755234769, rs755435149, rs768253809, rs772645482, rs751237565, rs772850179, rs747474998, rs759799166, rs777337458, rs747478059, rs777551972, rs755448967, rs796121812, rs777556622, rs751438322, rs772865443, rs759810657, rs759811932, rs772663640, rs772869110, rs777345301, rs796405217, rs576958615, rs772878006, rs751252167, rs777359688, rs768093278, rs751271372, rs777368805, rs759655903, rs759831926, rs747508932, rs576969601, rs772891496, rs777591347, rs751464268, rs777599790, rs755311800, rs777604789, rs768314082, rs768128277, rs777606824, rs747613024, rs764233083, rs764038861, rs751484106, rs576996766, rs755344373, rs755345260, rs576999040, rs772917999, rs755510163, rs772926214, rs755515271, rs777633592, rs777634572, rs796478901, rs768167768, rs751340142, rs764260671, rs777642089, rs768347496, rs751514125, rs759880550, rs764081453, rs777661319, rs777667084, rs751344454, rs777670484, rs576996944, rs777638368, rs755553717, rs577018765, rs777474412, rs796298037, rs764298538, rs796544253, rs777691463, rs777483324, rs777698381, rs772798048, rs751558593, rs755392832, rs764316581, rs759930945, rs759751843, rs751383252, rs759934734, rs764327465, rs751384151, rs751574392, rs796329030, rs772810661, rs751394310, rs777516552, rs796368194, rs764168768, rs764349805, rs751593824, rs755609430, rs764170812, rs796620506, rs777546671, rs759989589, rs755645351, rs772854933, rs796383620, rs777787015, rs796661192, rs764401492, rs768495538, rs759804091, rs768500142, rs764191883, rs768502292, rs768502791, rs768278218, rs796412093, rs772881421, rs755469501, rs777579309, rs764208467, rs755474416, rs764212354, rs759842238, rs576987267, rs777611685, rs768531741, rs768541787, rs796744438, rs764239305, rs755530255, rs768556721, rs768368073, rs759900839, rs773155259, rs796529169, rs773159968, rs760073097, rs796533460, rs772974795, rs768566944, rs764298098, rs755570717, rs759921753, rs751558751, rs777896190, rs777904932, rs796576438, rs777905744, rs764325028, rs760106760, rs760114670, rs773008809, rs796835517, rs764330725, rs755591769, rs751577582, rs796845806, rs764543219, rs773224139, rs777950383, rs777731699, rs759953813, rs764550997, rs760141969, rs759955803, rs777740480, rs777774052, rs773070471, rs768476929, rs768496766, rs764414043, rs777815787, rs796694081, rs796694101, rs760026563, rs796700180, rs773281939, rs755688608, rs764437535, rs768521742, rs777835811, rs768526554, rs773290901, rs764448482, rs764470746, rs773149634, rs773296210, rs764476034, rs755728923, rs768563062, rs778052433, rs773319945, rs773324319, rs778042620, rs768733994, rs778044205, rs796997004, rs777881741, rs796770436, rs773363279, rs760077726, rs768571080, rs755743161, rs755746264, rs778131383, rs768785644, rs796800104, rs755764082, rs773399478, rs778148727, rs773404082, rs773407415, rs796831631, rs773409661, rs778156878, rs778169470, rs773434635, rs768614341, rs760124796, rs768620339, rs768630061, rs796861842, rs768896216, rs768635377, rs764555780, rs777963398, rs768925741, rs796872491, rs773243150, rs773548355, rs768950086, rs777977216, rs773579566, rs773584404, rs778340398, rs768979263, rs777980971, rs778342059, rs760165295, rs796906115, rs778353317, rs796911608, rs773605150, rs773607669, rs773612358, rs778370172, rs773267272, rs778010263, rs796934830, rs773630002, rs778389269, rs773638118, rs778399130, rs778018364, rs760193524, rs769050524, rs769051766, rs773660515, rs773662455, rs773289430, rs778020847, rs796950423, rs778026525, rs796952236, rs768707927, rs797021864, rs773694181, rs797021885, rs778095154, rs778101444, rs778112566, rs778116360, rs778511180, rs778520180, rs778131235, rs769153572, rs768784571, rs778135942, rs778544716, rs773394234, rs778570842, rs769103536, rs773808340, rs778583925, rs768805863, rs778204738, rs773825993, rs778619776, rs778206648, rs773484114, rs769253996, rs778233737, rs773495523, rs778719114, rs768908878, rs778754301, rs778264419, rs773524240, rs778772059, rs778798631, rs768926509, rs768929143, rs778810623, rs778814075, rs778842299, rs768965165, rs778340868, rs768981921, rs778351672, rs778360453, rs769013651, rs773623537, rs769023489, rs773645974, rs778416357, rs773667417, rs773667774, rs773676018, rs769071290, rs769071361, rs769076003, rs778449285, rs778498254, rs773812695, rs769108171, rs769128763, rs778511014, rs773757900, rs778532226, rs769157145, rs769187039, rs769200257, rs778601005, rs778620135, rs769245631, rs773877069, rs778704122, rs778720482, rs778756741, rs778760038, rs778806841, and rs778810425.

[000361] In one example, the guide RNA used in the present disclosure may comprise at least one 20 nucleotide (nt) target nucleic acid sequence listed in Table 5. Provided in Table 5 are the gene symbol and the sequence identifier of the gene (Gene SEQ ID NO), the gene sequence including 1-5 kilobase pairs upstream and/or downstream of the target gene (Extended Gene SEQ ID NO), and the 20 nt target nucleic acid sequence (20 nt Target Sequence SEQ ID NO). In the sequence listing the respective target gene, the strand for targeting the gene (noted by a (+) strand or (-) strand in the sequence listing), the associated PAM type and the PAM sequence are described for each of the 20 nt target nucleic acid sequences (SEQ ID NO: 5305-76012). It is understood in the art that the spacer sequence, where "T" is "U," may be an RNA sequence corresponding to the 20 nt sequences listed in Table 5.

Table 5. Nucleic Acid Sequences

[000362] In one example, the guide RNA used in the present disclosure may comprise at least one spacer sequence that, where "T" is "U", may be an RNA sequence corresponding to a 20 nucleotide (nt) target sequence such as, but not limited to, any of SEQ ID NO: 5305-76012.

[000363] In one example, the guide RNA used in the present disclosure may comprise at least one spacer sequence which, where "T" is "U," is an RNA sequence corresponding to the 20 nt sequences such as, but not limited to, any of SEQ ID NO: 5305-76012.

[000364] In one example, a guide RNA may comprise a 20 nucleotide (nt) target nucleic acid sequence associated with the PAM type such as, but not limited to, NAAAAC, NNAGAAW, NNGRRT, NNNNGHTT, NRG, or YTN. As a non-limiting example, the 20 nt target nucleic acid sequence for a specific target gene and a specific PAM type may be, where "T" is "U," the RNA sequence corresponding to any one of the 20 nt nucleic acid sequences in Table 6.

Table 6. Nucleic Acid Sequences by PAM Type

[000365] In one example, a guide RNA may comprise a 20 nucleotide (nt) target nucleic acid sequence associated with the YTN PAM type. As a non-limiting example, the 20 nt target nucleic acid sequence for a specific target gene may comprise a 20 nt core sequence where the 20 nt core sequence, where "T" is "U," may be the RNA sequence corresponding to SEQ ID NO: 40531-76012. As another non-limiting example, the 20 nt target nucleic acid sequence for a specific target gene may comprise a core sequence where the core sequence, where "T" is "U," may be a fragment, segment or region of the RNA sequence corresponding to any of SEQ ID NO: 40531-76012.

VI. OTHER THERAPEUTIC APPROACHES

[000366] Gene editing can be conducted using nucleases engineered to target specific sequences. To date there are four major types of nucleases: meganucleases and their derivatives, zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), and CRISPR-Cas9 nuclease systems. The nuclease platforms vary in difficulty of design, targeting density and mode of action, particularly as the specificity of ZFNs and TALENs is through protein-DNA interactions, while RNA-DNA interactions primarily guide Cas9.

[000367] CRISPR endonucleases, such as Cas9, can be used in the methods of the present disclosure. However, the teachings described herein, such as therapeutic target sites, could be applied to other forms of endonucleases, such as ZFNs, TALENs, HEs, or MegaTALs, or using combinations of nucleases. However, in order to apply the teachings of the present disclosure to such endonucleases, one would need to, among other things, engineer proteins directed to the specific target sites.

[000368] Additional binding domains can be fused to the Cas9 protein to increase specificity. The target sites of these constructs would map to the identified gRNA specified site, but would require additional binding motifs, such as for a zinc finger domain. In the case of Mega-TAL, a meganuclease can be fused to a TALE DNA-binding domain. The meganuclease domain can increase specificity and provide the cleavage. Similarly, inactivated or dead Cas9 (dCas9) can be fused to a cleavage domain and require the sgRNA/Cas9 target site and adjacent binding site for the fused DNA-binding domain. This likely would require some protein engineering of the dCas9, in addition to the catalytic inactivation, to decrease binding without the additional binding site.

Zinc Finger Nucleases

[000369] Zinc finger nucleases (ZFNs) are modular proteins comprised of an engineered zinc finger DNA binding domain linked to the catalytic domain of the type II endonuclease Fokl. Because Fokl functions only as a dimer, a pair of ZFNs must be engineered to bind to cognate target "half-site" sequences on opposite DNA strands and with precise spacing between them to enable the catalytically active Fokl dimer to form. Upon dimerization of the Fokl domain, which itself has no sequence specificity per se, a DNA double-strand break is generated between the ZFN half-sites as the initiating step in genome editing. [000370] The DNA binding domain of each ZFN is typically comprised of 3-6 zinc fingers of the abundant Cys2-His2 architecture, with each finger primarily recognizing a triplet of nucleotides on one strand of the target DNA sequence, although cross-strand interaction with a fourth nucleotide also can be important. Alteration of the amino acids of a finger in positions that make key contacts with the DNA alters the sequence specificity of a given finger. Thus, a four-finger zinc finger protein will selectively recognize a 12 bp target sequence, where the target sequence is a composite of the triplet preferences contributed by each finger, although triplet preference can be influenced to varying degrees by neighboring fingers. An important aspect of ZFNs is that they can be readily re-targeted to almost any genomic address simply by modifying individual fingers, although considerable expertise is required to do this well. In most applications of ZFNs, proteins of 4-6 fingers are used, recognizing 12-18 bp respectively.

Hence, a pair of ZFNs will typically recognize a combined target sequence of 24-36 bp, not including the typical 5-7 bp spacer between half-sites. The binding sites can be separated further with larger spacers, including 15-17 bp. A target sequence of this length is likely to be unique in the human genome, assuming repetitive sequences or gene homologs are excluded during the design process. Nevertheless, the ZFN protein-DNA interactions are not absolute in their specificity so off-target binding and cleavage events do occur, either as a heterodimer between the two ZFNs, or as a homodimer of one or the other of the ZFNs. The latter possibility has been effectively eliminated by engineering the dimerization interface of the Fokl domain to create "plus" and "minus" variants, also known as obligate heterodimer variants, which can only dimerize with each other, and not with themselves. Forcing the obligate heterodimer prevents formation of the homodimer. This has greatly enhanced specificity of ZFNs, as well as any other nuclease that adopts these Fokl variants.

[000371] A variety of ZFN-based systems have been described in the art, modifications thereof are regularly reported, and numerous references describe rules and parameters that are used to guide the design of ZFNs; see, e.g., Segal et al., Proc Natl Acad Sci USA 96(6):2758-63 (1999); Dreier B et al., J Mol Biol. 303(4):489-502 (2000); Liu Q et al., J Biol Chem. 277(6):3850-6 (2002); Dreier et al., J Biol Chem 280(42):35588-97 (2005); and Dreier et al., J Biol Chem. 276(31):29466-78 (2001).

Transcription Activator-Like Effector Nucleases (TALENs)

[000372] TALENs represent another format of modular nucleases whereby, as with ZFNs, an engineered DNA binding domain is linked to the Fokl nuclease domain, and a pair of TALENs operates in tandem to achieve targeted DNA cleavage. The major difference from ZFNs is the nature of the DNA binding domain and the associated target DNA sequence recognition properties. The TALEN DNA binding domain derives from TALE proteins, which were originally described in the plant bacterial pathogen Xanthomonas sp. TALEs are comprised of tandem arrays of 33-35 amino acid repeats, with each repeat recognizing a single basepair in the target DNA sequence that is typically up to 20 bp in length, giving a total target sequence length of up to 40 bp. Nucleotide specificity of each repeat is determined by the repeat variable diresidue (RVD), which includes just two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine and thymine are predominantly recognized by the four RVDs: Asn- Asn, Asn-Ile, His-Asp and Asn-Gly, respectively. This constitutes a much simpler recognition code than for zinc fingers, and thus represents an advantage over the latter for nuclease design. Nevertheless, as with ZFNs, the protein-DNA interactions of TALENs are not absolute in their specificity, and TALENs have also benefitted from the use of obligate heterodimer variants of the Fokl domain to reduce off-target activity.

[000373] Additional variants of the Fokl domain have been created that are deactivated in their catalytic function. If one half of either a TALEN or a ZFN pair contains an inactive Fokl domain, then only single-strand DNA cleavage (nicking) will occur at the target site, rather than a DSB. The outcome is comparable to the use of CRISPR/Cas9 or CRISPR/Cpfl "nickase" mutants in which one of the Cas9 cleavage domains has been deactivated. DNA nicks can be used to drive genome editing by FIDR, but at lower efficiency than with a DSB. The main benefit is that off-target nicks are quickly and accurately repaired, unlike the DSB, which is prone to NHEJ-mediated mis-repair.

[000374] A variety of TALEN-based systems have been described in the art, and modifications thereof are regularly reported; see, e.g., Boch, Science 326(5959): 1509-12 (2009); Mak et al., Science 335(6069):716-9 (2012); and Moscou et al., Science 326(5959): 1501 (2009). The use of TALENs based on the "Golden Gate" platform, or cloning scheme, has been described by multiple groups; see, e.g., Cermak et al., Nucleic Acids Res. 39(12):e82 (2011); Li et al., Nucleic Acids Res. 39(14):6315-25(2011); Weber et al., PLoS One. 6(2):el6765 (2011); Wang et al., J Genet Genomics 41(6):339-47, Epub 2014 May 17 (2014); and Cermak T et al., Methods Mol Biol. 1239: 133-59 (2015).

Homing Endonucleases

[000375] Homing endonucleases (EEs) are sequence-specific endonucleases that have long recognition sequences (14-44 base pairs) and cleave DNA with high specificity - often at sites unique in the genome. There are at least six known families of HEs as classified by their structure, including GIY-YIG, His-Cis box, H-N-H, PD-(D/E)xK, and Vsr-like that are derived from a broad range of hosts, including eukarya, protists, bacteria, archaea, cyanobacteria and phage. As with ZFNs and TALENs, HEs can be used to create a DSB at a target locus as the initial step in genome editing. In addition, some natural and engineered HEs cut only a single strand of DNA, thereby functioning as site-specific nickases. The large target sequence of HEs and the specificity that they offer have made them attractive candidates to create site-specific DSBs.

[000376] A variety of HE-based systems have been described in the art, and modifications thereof are regularly reported; see, e.g., the reviews by Steentoft et al., Glycobiology 24(8):663- 80 (2014); Belfort and Bonocora, Methods Mol Biol. 1123 : 1-26 (2014); Hafez and Hausner, Genome 55(8):553-69 (2012); and references cited therein.

MegaTAL / Tev-mTALEN / MegaTev

[000377] As further examples of hybrid nucleases, the MegaTAL platform and Tev-mTALEN platform use a fusion of TALE DNA binding domains and catalytically active HEs, taking advantage of both the tunable DNA binding and specificity of the TALE, as well as the cleavage sequence specificity of the HE; see, e.g., Boissel et al., NAR 42: 2591-2601 (2014); Kleinstiver et al., G3 4: 1155-65 (2014); and Boissel and Scharenberg, Methods Mol. Biol. 1239: 171-96 (2015).

[000378] In a further variation, the MegaTev architecture is the fusion of a meganuclease

(Mega) with the nuclease domain derived from the GIY-YIG homing endonuclease I-Tevl (Tev). The two active sites are positioned ~30 bp apart on a DNA substrate and generate two DSBs with non-compatible cohesive ends; see, e.g., Wolfs et al., NAR 42, 8816-29 (2014). It is anticipated that other combinations of existing nuclease-based approaches will evolve and be useful in achieving the targeted genome modifications described herein.

dCas9-FokI or dCpfl-Fokl and Other Nucleases

[000379] Combining the structural and functional properties of the nuclease platforms described above offers a further approach to genome editing that can potentially overcome some of the inherent deficiencies. As an example, the CRISPR genome editing system typically uses a single Cas9 endonuclease to create a DSB. The specificity of targeting is driven by a 20 or 24 nucleotide sequence in the guide RNA that undergoes Watson-Crick base-pairing with the target DNA (plus an additional 2 bases in the adjacent NAG or NGG PAM sequence in the case of Cas9 from S. pyogenes). Such a sequence is long enough to be unique in the human genome, however, the specificity of the RNA/DNA interaction is not absolute, with significant promiscuity sometimes tolerated, particularly in the 5' half of the target sequence, effectively reducing the number of bases that drive specificity. One solution to this has been to completely deactivate the Cas9 or Cpfl catalytic function - retaining only the RNA-guided DNA binding function - and instead fusing a Fokl domain to the deactivated Cas9; see, e.g., Tsai et al., Nature Biotech 32: 569-76 (2014); and Guilinger et al., Nature Biotech. 32: 577-82 (2014). Because Fokl must dimerize to become catalytically active, two guide RNAs are required to tether two Fokl fusions in close proximity to form the dimer and cleave DNA. This essentially doubles the number of bases in the combined target sites, thereby increasing the stringency of targeting by CRISPR-based systems.

[000380] As further example, fusion of the TALE DNA binding domain to a catalytically active FIE, such as I-Tevl, takes advantage of both the tunable DNA binding and specificity of the TALE, as well as the cleavage sequence specificity of I-Tevl, with the expectation that off- target cleavage can be further reduced.

VII. KITS

[000381] The present disclosure provides kits for carrying out the methods described herein. A kit can include one or more of a genome-targeting nucleic acid, a polynucleotide encoding a genome-targeting nucleic acid, a site-directed polypeptide, a polynucleotide encoding a site- directed polypeptide, and/or any nucleic acid or proteinaceous molecule necessary to carry out the aspects of the methods described herein, or any combination thereof.

[000382] A kit can comprise: (1) a vector comprising a nucleotide sequence encoding a genome-targeting nucleic acid, (2) the site-directed polypeptide or a vector comprising a nucleotide sequence encoding the site-directed polypeptide, and (3) a reagent for reconstitution and/or dilution of the vector(s) and or polypeptide.

[000383] A kit can comprise: (1) a vector comprising (i) a nucleotide sequence encoding a genome-targeting nucleic acid, and (ii) a nucleotide sequence encoding the site-directed polypeptide; and (2) a reagent for reconstitution and/or dilution of the vector.

[000384] In any of the above kits, the kit can comprise a single-molecule guide genome- targeting nucleic acid. In any of the above kits, the kit can comprise a double-molecule genome- targeting nucleic acid. In any of the above kits, the kit can comprise two or more double- molecule guides or single-molecule guides. The kits can comprise a vector that encodes the nucleic acid targeting nucleic acid. [000385] In any of the above kits, the kit can further comprise a polynucleotide to be inserted to effect the desired genetic modification.

[000386] Components of a kit can be in separate containers, or combined in a single container.

[000387] Any kit described above can further comprise one or more additional reagents, where such additional reagents are selected from a buffer, a buffer for introducing a polypeptide or polynucleotide into a cell, a wash buffer, a control reagent, a control vector, a control RNA polynucleotide, a reagent for in vitro production of the polypeptide from DNA, adaptors for sequencing and the like. A buffer can be a stabilization buffer, a reconstituting buffer, a diluting buffer, or the like. A kit can also comprise one or more components that can be used to facilitate or enhance the on-target binding or the cleavage of DNA by the endonuclease, or improve the specificity of targeting.

[000388] In addition to the above-mentioned components, a kit can further comprise instructions for using the components of the kit to practice the methods. The instructions for practicing the methods can be recorded on a suitable recording medium. For example, the instructions can be printed on a substrate, such as paper or plastic, etc. The instructions can be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging), etc. The instructions can be present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, flash drive, etc. In some instances, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source (e.g. via the Internet), can be provided. An example of this case is a kit that comprises a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate. VIII. SPECIFIC METHODS AND COMPOSITIONS OF THE INVENTION

[000389] Accordingly, the present disclosure relates in particular to the following non-limiting methods according to the present disclosure: In a first method, Method 1, the present disclosure provides a method for editing a Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCN10A) gene in a cell by genome editing comprising: introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the SCN10A gene or SCN10A regulatory elements that results in one or more permanent insertions, deletions or mutations of at least one nucleotide within or near the SCN10A gene, thereby reducing or eliminating the expression or function of SCN10A gene products.

[000390] In another method, Method 2, the present disclosure provides an ex vivo method for treating a patient having an SCN10A related condition or disorder comprising: editing a patient specific induced pluripotent stem cell (iPSC) within or near a Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCN10A) gene or other DNA sequences that encode regulatory elements of the SCN10A gene; differentiating the edited iPSC into a neuron of the peripheral nervous system; and adminsitering the neuron of the peripheral nervous system to the patient.

[000391] In another method, Method 3, the present disclosure provides an ex vivo method for treating a patient having an SCN10A related condition or disorder comprising: obtaining a patient specific induced pluripotent stem cell (iPSC); editing the iPSC within or near a Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCN10A) gene or other DNA sequences that encode regulatory elements of the SCN10A gene; differentiating the edited iPSC into a neuron of the peripheral nervous system; and administering the neuron of the peripheral nervous system to the patient.

[000392] In another method, Method 4, the present disclosure provides the method of Methods 2 or 3, wherein the editing step comprises: introducing into the iPSC one or more

deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the SCN10A gene or SCN10A regulatory elements that results in one or more permanent insertions, deletions or mutations of at least one nucleotide within or near the SCN10A gene, thereby reducing or eliminating the expression or function of SCN10A gene products.

[000393] In another method, Method 5, the present disclosure provides an ex vivo method for treating a patient having an SCN10A related condition or disorder comprising: editing a mesenchymal stem cell within or near a Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCN10A) gene or other DNA sequences that encode regulatory elements of the SCN10A gene; differentiating the edited mesenchymal stem cell into a neuron of the peripheral nervous system; and adminstering the neuron of the peripheral nervous system to the patient.

[000394] In another method, Method 6, the present disclosure provides an ex vivo method for treating a patient having an SCN10A related condition or disorder comprising: obtaining a mesenchymal stem cell from the patient; editing the mesenchymal stem cell within or near a Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCN10A) gene or other DNA sequences that encode regulatory elements of the SCN10A gene; differentiating the edited mesenchymal stem cell into a neuron of the peripheral nervous system; and administering the neuron of the peripheral nervous system to the patient.

[000395] In another method, Method 7, the present disclosure provides the method of Methods 5 or 6, wherein the editing step comprises: introducing into the mesenchymal stem cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the SCNIOA gene or SCNIOA regulatory elements that results in one or more permanent insertions, deletions or mutations of at least one nucleotide within or near the SCNIOA gene, thereby reducing or eliminating the expression or function of SCNIOA gene products.

[000396] In another method, Method 8, the present disclosure provides an in vivo method for treating a patient with an SCNIOA related disorder comprising: editing the Sodium Channel, Voltage Gated, Type X Alpha Subunit (SCNIOA) gene in a cell of the patient.

[000397] In another method, Method 9, the present disclosure provides the method of Method 8, wherein the editing step comprises: introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the SCNIOA gene or SCNIOA regulatory elements that results in one or more permanent insertions, deletions or mutations of at least one nucleotide within or near the SCNIOA gene, thereby reducing or eliminating the expression or function of SCNIOA gene products.

[000398] In another method, Method 10, the present disclosure provides the method of any one of Methods 8-9, wherein the cell is a neuron of the peripheral nervous system.

[000399] In another method, Method 11, the present disclosure provides the method of Method 10, wherein the one or more deoxyribonucleic acid (DNA) endonuclease is delivered to the neuron of the peripheral nervous system via direct intraganglionic or intraspinal injection, or intrathecal delivery.

[000400] In another method, Method 12, the present disclosure provides a method of altering the contiguous genomic sequence of an SCNIOA gene in a cell comprising: contacting the cell with one or more deoxyribonucleic acid (DNA) endonuclease to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs).

[000401] In another method, Method 13, the present disclosure provides the method of Method 12, wherein the alteration of the contiguous genomic sequence occurs in one or more exons of the SCNIOA gene. [000402] In another method, Method 14, the present disclosure provides the method of any one of Methods 1-13, wherein the one or more deoxyribonucleic acid (DNA) endonuclease is selected from any of those sequences in SEQ ID NOs: 1-620 and variants having at least 90% homology to any of those sequences disclosed in SEQ ID NOs: 1-620.

[000403] In another method, Method 15, the present disclosure provides the method of Method 14, wherein the one or more deoxyribonucleic acid (DNA) endonuclease is one or more protein or polypeptide.

[000404] In another method, Method 16, the present disclosure provides the method of Method 14, wherein the one or more deoxyribonucleic acid (DNA) endonuclease is one or more polynucleotide encoding the one or more DNA endonuclease.

[000405] In another method, Method 17, the present disclosure provides the method of Method 16, wherein the one or more deoxyribonucleic acid (DNA) endonuclease is one or more ribonucleic acid (RNA) encoding the one or more DNA endonuclease.

[000406] In another method, Method 18, the present disclosure provides the method of Method 17, wherein the one or more ribonucleic acid (RNA) is one or more chemically modified RNA.

[000407] In another method, Method 19, the present disclosure provides the method of Method 18, wherein the one or more ribonucleic acid (RNA) is chemically modified in the coding region.

[000408] In another method, Method 20, the present disclosure provides the method of any one of Methods 16-19, wherein the one or more polynucleotide or one or more ribonucleic acid (RNA) is codon optimized.

[000409] In another method, Method 21, the present disclosure provides the method of any one of Methods 1-20, wherein the method further comprises: introducing into the cell one or more gRNA or one or more sgRNA.

[000410] In another method, Method 22, the present disclosure provides the method of Method 21, wherein the one or more gRNA or one or more sgRNA comprises a spacer sequence that is complementary to a DNA sequence within or near the SCN10A gene.

[000411] In another method, Method 23, the present disclosure provides the method of any of the Methods 21-22, wherein the one or more gRNA or one or more sgRNA is chemically modified.

[000412] In another method, Method 24, the present disclosure provides the method of any one of Methods 21-23, wherein the one or more gRNA or one or more sgRNA is pre-complexed with the one or more deoxyribonucleic acid (DNA) endonuclease. [000413] In another method, Method 25, the present disclosure provides the method of Method 24, wherein the pre-complexing involves a covalent attachment of the one or more gRNA or one or more sgRNA to the one or more deoxyribonucleic acid (DNA) endonuclease.

[000414] In another method, Method 26, the present disclosure provides the method of any one of Methods 14-25, wherein the one or more deoxyribonucleic acid (DNA) endonuclease is formulated in a liposome or lipid nanoparticle.

[000415] In another method, Method 27, the present disclosure provides the method of any one of Methods 21-25, wherein the one or more deoxyribonucleic acid (DNA) endonuclease is formulated in a liposome or lipid nanoparticle which also comprises the one or more gRNA or one or more sgRNA.

[000416] In another method, Method 28, the present disclosure provides the method of any one of Methods 12, or 21-22, wherein the one or more deoxyribonucleic acid (DNA) endonuclease is encoded in an AAV vector particle.

[000417] In another method, Method 29, the present disclosure provides the method of any of the Methods 21-22, wherein the one or more gRNA or one or more sgRNA is encoded in an AAV vector particle.

[000418] In another method, Method 30, the present disclosure provides the method of any of the Methods 21-22, wherein the one or more deoxyribonucleic acid (DNA) endonuclease is encoded in an AAV vector particle which also encodes the one or more gRNA or one or more sgRNA.

[000419] In another method, Method 31, the present disclosure provides the method of any of the Methods 28-30, where the AAV vector particle is selected from the group consisting of any of those disclosed in SEQ ID NOs: 4734-5302 and Table 2.

[000420] The present disclosure also provides a composition, Composition 1, comprising a single-molecule guide RNA comprising: at least a spacer sequence that is an RNA sequence corresponding to any of SEQ ID NOs: 5305-76012.

[000421] In another composition, Composition 2, the present disclosure provides the single- molecule guide RNA of Composition 1, wherein the single-molecule guide RNA further comprises a spacer extension region.

[000422] In another composition, Composition 3, the present disclosure provides the single- molecule guide RNA of Composition 1, wherein the single-molecule guide RNA further comprises a tracrRNA extension region. [000423] In another composition, Composition 4, the present disclosure provides the single- molecule guide RNA of Compositions 1-3, wherein the single-molecule guide RNA is chemically modified.

[000424] In another composition, Composition 5, the present disclosure provides a single- molecule guide RNA of Compositions 1-4 pre-complexed with a site-directed polypeptide.

[000425] In another composition, Composition 6, the present disclosure provides a single- molecule guide RNA of Compositions 1-5 pre-complexed with a DNA endonuclease.

[000426] In another composition, Composition 7, the present disclosure provides the composition of Composition 6, wherein the DNA endonuclease is a Cas9 or Cpfl endonuclease.

[000427] In another composition, Composition 8, the present disclosure provides the composition of Composition 7, wherein the Cas9 or Cpfl endonuclease is selected from the group consisting of: S. pyogenes Cas9, S. aureus Cas9, N. meningitides Cas9, S. thermophilus CRISPRl Cas9, S. thermophilus CRISPR 3 Cas9, T. denticola Cas9, L. bacterium ND2006 Cpfl and Acidaminococcus sp. BV3L6 Cpfl, and variants having at least 90% homology to the endonucleases.

[000428] In another composition, Composition 9, the present disclosure provides the composition of Composition 8, wherein the Cas9 or Cpfl endonuclease comprises one or more nuclear localization signals (NLSs).

[000429] In another composition, Composition 10, the present disclosure provides the composition of Composition 9, wherein at least one NLS is at or within 50 amino acids of the amino-terminus of the Cas9 or Cpfl endonucelase and/or at least one NLS is at or within 50 amino acids of the carboxy -terminus of the Cas9 or Cpfl endonuclease.

[000430] In another compostion, Composition 11, the present disclosure provides a DNA encoding the single-molecule guide RNA of any of Compositions 1-4.

[000431] In another composition, Composition 12, the present disclosure provides a non- naturally occurring CRISPR/Cas system comprising a polynucleotide encoding a Cas9 or Cpfl endonuclease and at least one single-molecule guide RNA of Compositions 1-4.

[000432] In another composition, Composition 13, the present disclosure provides the

CRISPR/Cas system of Composition 12, wherein the polynucleotide encoding a Cas9 or Cpfl endonuclease is selected from the group consisting of: S. pyogenes Cas9, S. aureus Cas9, N. meningitides Cas9, S. thermophilus CRISPRl Cas9, S. thermophilus CRISPR 3 Cas9, T.

denticola Cas9, L. bacterium ND2006 Cpfl and Acidaminococcus sp. BV3L6 Cpfl, and variants having at least 90% homology to the endonucleases. [000433] In another composition, Composition 14, the present disclosure provides the

CRISPR/Cas system of Composition 13, wherein the polynucleotide encoding a Cas9 or Cpfl endonuclease comprises one or more nuclear localization signals ( LSs).

[000434] In another composition, Composition 15, the present disclosure provides the

CRISPR/Cas system of Composition 14, wherein at least one NLS is at or within 50 amino acids of the amino-terminus of the polynucleotide encoding a Cas9 or Cpfl endonuclease and/or at least one NLS is at or within 50 amino acids of the carboxy-terminus of the polynucleotide encoding a Cas9 or Cpfl endonuclease.

[000435] In another composition, Composition 16, the present disclosure provides the

CRISPR/Cas system of Composition 15, wherein the polynucleotide encoding a Cas9 or Cpfl endonuclease is codon optimized for expression in a eukaryotic cell.

[000436] In another composition, Composition 17, the present disclosure provides a DNA encoding the CRISPR/Cas system of any one of Compositions 12-16.

[000437] In another composition, Composition 18, the present disclosure provides a vector comprising the DNA of any one of Compositions 12-17.

[000438] In another composition, Composition 19, the present disclosure provides the vector of Composition 18, wherein the vector is a plasmid.

In another composition, Composition 20, the present disclosure provides the vector of

Composition 18, wherein the vector is an AAV vector particle, and the AAV vector particle is selected from the group consisting of those disclosed in SEQ ID NOs: 4734-5302 and Table 2.

IX. DEFINITIONS

[000439] The term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the present disclosure, yet open to the inclusion of unspecified elements, whether essential or not.

[000440] The term "consisting essentially of refers to those elements required for a given aspect. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that aspect of the present disclosure.

[000441] The term "consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the aspect.

[000442] The singular forms "a," "an," and "the" include plural references, unless the context clearly dictates otherwise. [000443] Any numerical range recited in this specification describes all sub-ranges of the same numerical precision (i.e., having the same number of specified digits) subsumed within the recited range. For example, a recited range of "1.0 to 10.0" describes all sub-ranges between (and including) the recited minimum value of 1.0 and the recited maximum value of 10.0, such as, for example, "2.4 to 7.6," even if the range of "2.4 to 7.6" is not expressly recited in the text of the specification. Accordingly, the Applicant reserves the right to amend this specification, including the claims, to expressly recite any sub-range of the same numerical precision subsumed within the ranges expressly recited in this specification. All such ranges are inherently described in this specification such that amending to expressly recite any such sub-ranges will comply with written description, sufficiency of description, and added matter requirements, including the requirements under 35 U.S.C. § 112(a) and Article 123(2) EPC. Also, unless expressly specified or otherwise required by context, all numerical parameters described in this specification (such as those expressing values, ranges, amounts, percentages, and the like) may be read as if prefaced by the word "about," even if the word "about" does not expressly appear before a number. Additionally, numerical parameters described in this specification should be construed in light of the number of reported significant digits, numerical precision, and by applying ordinary rounding techniques. It is also understood that numerical parameters described in this specification will necessarily possess the inherent variability characteristic of the underlying measurement techniques used to determine the numerical value of the parameter.

[000444] The details of one or more examples of the present disclosure are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred materials and methods are now described. Other features, objects and advantages of the present disclosure will be apparent from the description. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this present disclosure belongs. In the case of conflict, the present description will control.

[000445] The present disclosure is further illustrated by the following non-limiting examples.

X. EXAMPLES

[000446] The present disclosure will be more fully understood by reference to the following examples, which provide illustrative non-limiting aspects of the invention. [000447] The examples describe the use of the CRISPR system as an illustrative genome editing technique to create defined therapeutic genomic deletions, insertions, or replacements, termed "genomic modifications" herein, in the SCNIOA gene that lead to permanent deletion or mutation of the SCNIOA gene, that reduce or eliminate SCNIOA protein activity.

[000448] Various Cas orthologs are evaluated for cutting. gRNAs are delivered as RNA and expressed from the U6 promoter in plasmids. The corresponding Cas protein is either knocked into the cell line of interest and constitutively expressed, delivered as mRNA, or delivered as protein. The gRNA activity in all formats is evaluated using TIDE analysis in HEK293T cells.

[000449] Introduction of the defined therapeutic modifications represents a novel therapeutic strategy for the potential amelioration of Pain, as described and illustrated herein.

Example 1 - CRISPR/SpCas9 target sites for the SCNIOA gene

[000450] Regions of the SCNIOA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NRG. gRNA 20 bp spacer sequences corresponding to the PAM were then identified, as shown in SEQ ID NOs: 12754 - 40530 of the Sequence Listing.

Example 2 - CRISPR/SaCas9 target sites for the SCNIOA gene

[000451] Regions of the SCNIOA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NNGRRT. gRNA 20 bp spacer sequences corresponding to the PAM were then identified, as shown in SEQ ID NOs: 6772 - 9983 of the Sequence Listing.

Example 3 - CRISPR/StCas9 target sites for the SCNIOA gene

[000452] Regions of the SCNIOA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NNAGAAW. gRNA 20 bp spacer sequences corresponding to the PAM were then identified, as shown in SEQ ID NOs: 5703 - 6771 of the Sequence Listing.

Example 4 - CRISPR/TdCas9 target sites for the SCNIOA gene

[000453] Regions of the SCNIOA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NAAAAC. gRNA 20 bp spacer sequences corresponding to the PAM were then identified, as shown in SEQ ID NOs: 5305 - 5702 of the Sequence Listing.

Example 5 - CRISPR/NmCas9 target sites for the SCNIOA gene

[000454] Regions of the SCNIOA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NNNNGHTT. gRNA 20 bp spacer sequences corresponding to the PAM were then identified, as shown in SEQ ID NOs: 9984 - 12753 of the Sequence Listing.

Example 6 - CRISPR/Cpfl target sites for the SCN10A gene

[000455] Regions of the SCN10A gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence YTN. gRNA 20 bp spacer sequences corresponding to the PAM were then identified, as shown in SEQ ID NOs: 40531 - 76012 of the Sequence Listing.

Example 7 - Bioinformatics analysis of the guide strands

[000456] Candidate guides will then be screened and selected in a single process or multi-step process that involves both theoretical binding and experimentally assessed activity at both on- target and off-target sites. By way of illustration, candidate guides having sequences that match a particular on-target site, such as a site within the SCN10A gene, with adjacent PAM can be assessed for their potential to cleave at off-target sites having similar sequences, using one or more of a variety of bioinformatics tools available for assessing off-target binding, as described and illustrated in more detail below, in order to assess the likelihood of effects at chromosomal positions other than those intended.

[000457] Candidates predicted to have relatively lower potential for off-target activity can then be assessed experimentally to measure their on-target activity, and then off-target activities at various sites. Preferred guides have sufficiently high on-target activity to achieve desired levels of gene editing at the selected locus, and relatively lower off-target activity to reduce the likelihood of alterations at other chromosomal loci. The ratio of on-target to off-target activity is often referred to as the "specificity" of a guide.

[000458] For initial screening of predicted off-target activities, there are a number of bioinformatics tools known and publicly available that can be used to predict the most likely off- target sites; and since binding to target sites in the CRISPR/Cas9 or CRISPR/Cpfl nuclease system is driven by Watson-Crick base pairing between complementary sequences, the degree of dissimilarity (and therefore reduced potential for off-target binding) is essentially related to primary sequence differences: mismatches and bulges, i.e. bases that are changed to a non- complementary base, and insertions or deletions of bases in the potential off-target site relative to the target site. An exemplary bioinformatics tool called COSMID (CRISPR Off-target Sites with Mismatches, Insertions and Deletions) (available on the web at crispr.bme.gatech.edu) compiles such similarities. Other bioinformatics tools include, but are not limited to

autoCOSMID and CCTop. [000459] Bioinformatics were used to minimize off-target cleavage in order to reduce the detrimental effects of mutations and chromosomal rearrangements. Studies on CRISPR/Cas9 systems suggested the possibility of off-target activity due to non-specific hybridization of the guide strand to DNA sequences with base pair mismatches and/or bulges, particularly at positions distal from the PAM region. Therefore, it is important to have a bioinformatics tool that can identify potential off-target sites that have insertions and/or deletions between the RNA guide strand and genomic sequences, in addition to base-pair mismatches. Bioinformatics tools based upon the off-target prediction algorithm CCTop were used to search genomes for potential CRISPR off-target sites (CCTop is available on the web at crispr.cos.uni-heidelberg.de/). The output ranked lists of the potential off-target sites based on the number and location of mismatches, allowing more informed choice of target sites, and avoiding the use of sites with more likely off-target cleavage.

[000460] Additional bioinformatics pipelines were employed that weigh the estimated on- and/or off-target activity of gRNA targeting sites in a region. Other features that may be used to predict activity include information about the cell type in question, DNA accessibility, chromatin state, transcription factor binding sites, transcription factor binding data, and other CHIP-seq data. Additional factors were weighed that predict editing efficiency, such as relative positions and directions of pairs of gRNAs, local sequence features and micro-homologies.

[000461] Initial evaluation and screening of CRISPR/Cas9 target sites focused on Exons 1-17 of the SCNIOA gene, Introns 1-16, sequences located 100-300 bp upstream of Exon 1, and 100- 300 bp of the flanking intronic sequences. These gRNAs can also be used to edit one or more nucleotides, exonic sequences and/or intronic sequences.

[000462] Initial bioninformatics analysis identified, 1095 gRNAs targeting Exons 1-17 of the SCNIOA gene, Introns 1-16, sequences located 100-300 bp upstream of Exon 1, and 100-300 bp sequences flanking the intronic sequences. Further analysis of predicted off-target sites and evaluation of the gRNA target site within the SCNIOA gene resulted in 192 gRNAs selected for screening. The prioritized list of 192 single gRNAs targeting Exons 1-9 of the SCNIOA gene was tested for cutting efficiencies using spCas9 (Table 7).

Table 7

40002

SCN10A_Up_Intl_T15 GCTCCCCGATCAGTTCTGCT

36723

SCN10A_Int4_Int5_T6 GGGGTATCATTAGCCTAGAA

26074

SCN10A_Up_Intl_T2 ACCGGGTAAGAGCTACTAGT

26190

SCN10A_Up_Intl_T47 GGAGCAAAGACATAACCCTG

26150

SCN10A_Up_Intl_T21 GCTGTTCTGACAATCAAGAT

36719

SCN 10A_Int4_Int5_T25 GCATAAATAAGGATAACCTG

39795

SCN10A_Intl_int2_T12 GAATAGCCACAGGGCCCGAG

26087

SCN10A_Up_Intl_T10 GCTCCCAGCAGAACTGATCG

36293

SCN 10A_Int5_Int7_T46 CATGGATGAGGTAGCACACA

40057

SCN10A_Up_Intl_T33 ATTCCCCTGCAAGGCATTCA

40058

SCN10A_Up_Intl_T53 TTCCCCTGCAAGGCATTCAG

39998

SCN10A_Up_Intl_T14 GAACGGATCTAGATCCTCCA

26180

SCN10A_Up_Intl_T36 CCTCCCCTGAATGCCTTGCA

39415

S CN 10 A_Int2_Int3_T 12 ATTTACTGAGTGCCTAAGCT

25533

SCN10A_Int2_Int3_T7 TTCCTTAACACAGGCCTTTC

39994

SCN10A_Up_Intl_T26 ACCCGGTGTGTGCTGTAGAA

36253

S CN 10 A_Int5_Int7_T 12 CAACCAGACCTTGGTCCCTA

40026

SCN10A_Up_Intl_T5 GTGACTCCGGAGTAAAGCGA

26063

SCN10A_Up_Intl_T45 CCAGCCCAGAAAGTCCTCCT

40023

SCN10A_Up_Intl_T34 TCTATCTCCACCAGTGACTC

39809

SCN 1 OAJnt l_int2_T20 AACATGAGAGGCATTATCTC

40006

SCN10A_Up_Intl_T19 GGGAGCTCACCATAGAACTT

39379

SCN10A_Int2_Int3_Tl l AGCATTACCCACATGAGGCA

26089

SCN10A_Up_Intl_T35 GAGCTCCCAGCAGAACTGAT

25882

SCN 1 OAJnt l_int2_T23 ACATTTATGGTGCTGAACAA 36249

SCN10A_Int5_Int7_T7 CCTGTCCCTATATGATACCA

39755

SCN10A_Intl_int2_T14 TGTGTCTTGGGACTGCTTTG

25878

SCN10A_Intl_int2_T19 ACAAAGGGAGGACCATTTCC

36716

SCN 10A_Int4_Int5_T21 GGATGCATGCAGCATAAATA

26189

SCN10A_Up_Intl_T40 AGACATAACCCTGAGGCACC

39797

SCN10A_Intl_int2_Tl GGCCCGAGTGGCACTAAACC

39973

SCN10A_Up_Intl_T37 GCAGACTGCCACATCACCCA

22560

S CN 10 A_Int5_Int7_T 16 GTGGGGCTGCAACTCTTCAA

21875

S CN 10 A_Int7_Int9_T 12 GGCCCTCGAGATGCTCCGGA

25520

SCN10A_Int2_Int3_T2 TATCCTGCCATGCCTCATGT

36713

SCN 10A_Int4_Int5_T26 CTCTGCAAGCAAGGGTCCTG

26080

SCN10A_Up_Intl_T43 ATCCGTTCTACAGCACACAC

39822

SCN 1 OAJnt l_int2_Tl 5 GGTCAATGAGAGTCAAATGC

22561

S CN 10 A_Int5_Int7_T 19 GGTGGGGCTGCAACTCTTCA

26079

SCN10A_Up_Intl_T20 TCCGTTCTACAGCACACACC

26128

SCN10A_Up_Intl_T3 CAACTTCCGTCGCTTTACTC

26187

SCN10A_Up_Intl_T55 CATAACCCTGAGGCACCTGG

22817

SCN10A_Int4_Int5_T2 GGCACAGCAATAGATCTCCG

39997

SCN10A_Up_Intl_Tl l AGAACGGATCTAGATCCTCC

26093

SCN10A_Up_Intl_T24 AACCAGCTGCCCAAGTTCTA

23800

SCN10A_Int3_Int4_T6 TCACGTACCTGAGAGATCCT

22542

SCN10A_Int5_Int7_T5 TGGACCCTTGGTATCATATA

25874

SCN10A_Intl_int2_Tl l TTAGTGCCACTCGGGCCCTG

22816

SCN10A_Int4_Int5_Tl GCACAGCAATAGATCTCCGT

40034

SCN10A_Up_Intl_T16 TAGTTTCGAGGGATCCAATG 26129

SCN10A_Up_Intl_T32 GAGAAGATGGAATTCCCCAT

39992

SCN10A_Up_Intl_T13 TCCTACTAGTAGCTCTTACC

22551

SCN 10A_Int5_Int7_T27 GTGAGTGGAGTCTCTTCCAT

21893

SCN10A_Int7_Int9_T9 TGTAGTCACCATGGCGTATG

39972

SCN10A_Up_Intl_T28 AGCAGACTGCCACATCACCC

36289

SCN 10A_Int5_Int7_T28 ATGACAGTGGTATGACCACA

37540

S CN 10 A_Int3_Int4_T 11 GCCAGTTCCAAGGATCTCTC

22778

S CN 10 A_Int4_Int5_T 16 TAGTAAGAGACAGTGTGACC

36693

SCN 10A_Int4_Int5_T23 CTGTGAATAAATGCTCACCT

22834

S CN 10 A_Int4_Int5_T 13 TGTCAGTGTCAGTCTATAGA

22806

SCN 10A_Int4_Int5_T29 AAAACAGTTTCTGTGATCCC

36718

S CN 10 A_Int4_Int5_T30 AGCATAAATAAGGATAACCT

22825

SCN 10A_Int4_Int5_T32 TTTATGCTGCATGCATCCCC

36717

S CN 10 A_Int4_Int5_T 15 CAGCATAAATAAGGATAACC

39399

SCN10A_Int2_Int3_T8 TTTCTCTGGAAGGTCAGTTC

22827

SCN10A_Int4_Int5_T4 TTCTAGGCTAATGATACCCC

35706

S CN 10 A_Int7_Int9_T 18 CTCCAACCAAGTCTGCGTGG

40033

SCN10A_Up_Intl_T7 TTAGTTTCGAGGGATCCAAT

39789

SCN10A_Intl_int2_T13 GTTCTTCTGATCAGGTTGAA

36710

SCN 10A_Int4_Int5_T31 GTCAGCATCTCTGCAAGCAA

35714

SCN 10A_Int7_Int9_T22 CTGCTGGTAGAGGCGTTCCC

39381

SCN10A_Int2_Int3_T4 TTACCCACATGAGGCATGGC

22579

SCN 10A_Int5_Int7_T38 TGTGTGCTACCTCATCCATG

39776

SCN10A_Intl_int2_T3 CAAGGTCTAATTGTAACACG

26085

SCN10A_Up_Intl_T18 AGAACTGATCGGGGAGCCCC 40056

SCN10A_Up_Intl_T38 CATTCCCCTGCAAGGCATTC

22512

SCN 10A_Int5_Int7_T34 GTGACTTTACAACTTCCATG

22543

SCN10A_Int5_Int7_T8 TTGGACCCTTGGTATCATAT

40046

SCN10A_Up_Intl_T29 AGAGGTGACAGCTTGCCCAC

22485

SCN 10A_Int5_Int7_T41 ACTTCTGACCCCTTACTGTG

23772

S CN 10 A_Int3_Int4_T 13 GGTCCCACTTGGACAGAGTG

25864

SCN 1 OAJnt l_int2_Tl 0 GTGTCCAGTACCTTCTTTAG

39792

SCN 1 OAJnt l_int2_T24 TGAAAGGACTGAATAGCCAC

39404

SCN10A_Int2_Int3_Tl CACCTGAAAGGCCTGTGTTA

22521

SCN 10A_Int5_Int7_T44 CAAGTCATTCTACCTCTGCT

25535

SCN10A_Int2_Int3_T9 TCTCAGCTTTTCCTTAACAC

25875

SCN10A_Intl_int2_T4 TTCCCGGTTTAGTGCCACTC

36291

S CN 10 A_Int5_Int7_T37 GTGGTATGACCACATGGATG

39787

SCN10A_Intl_int2_T6 TGATGGCCGTTCTTCTGATC

21849

SCN10A_Int7_Int9_T6 GGCACCGTTTAGGGAGCTAT

23776

SCN10A_Int3_Int4_T9 AGGAGACAGGGCTAACATGC

23799

SCN10A_Int3_Int4_T8 ACCTGAGAGATCCTTGGAAC

26083

SCN10A_Up_Intl_T50 ACTGATCGGGGAGCCCCTGG

37560

S CN 10 A_Int3_Int4_T 14 AAGGAGTGTCAACTGTGCCA

36680

SCN10A_Int4_Int5_T7 GGGGACAATAGTCTTTGCCC

37527

S CN 10 A_Int3_Int4_T 16 TCTCCACACTCTGTCCAAGT

39378

SCN10A_Int2_Int3_T3 GATTCAGCATTACCCACATG

26151

SCN10A_Up_Intl_T49 GGCTGTTCTGACAATCAAGA

25879

SCN 1 OAJnt l_int2_T29 TTATGGTGCTGAACAAAGGG

35705

S CN 1 OA Int7 Jnt9_T 13 CCTCCAACCAAGTCTGCGTG 26177

SCN10A_Up_Intl_T46 TGAATGCCTTGCAGGGGAAT

36683

SCN 10A_Int4_Int5_T28 CTTTGCCCTGGAACCTTACA

26181

SCN10A_Up_Intl_T25 GCCTCCCCTGAATGCCTTGC

26125

SCN10A_Up_Intl_T22 CTTTACTCCGGAGTCACTGG

40005

SCN10A_Up_Intl_T17 TGGGAGCTCACCATAGAACT

39759

SCN 1 OAJnt l_int2_Tl 6 TGGGGTGTGGGACACATTAA

22507

SCN 10A_Int5_Int7_T47 CACTGAGTACATGTAGCCAA

37563

SCN10A_Int3_Int4_T3 CTGTGCCATGGAGTGTACTC

36669

SCN10A_Int4_Int5_T9 ACTGTCTCTTACTAGTGAAG

39766

SCN 1 OAJnt l_int2_T27 TTTGGGATTCAATTGGATAA

37566

SCN10A_Int3_Int4_T4 TGCCATGGAGTGTACTCAGG

26168

SCN10A_Up_Intl_T51 GAGGAGCCAAGTGTGAGTTC

39798

SCN10A_Intl_int2_T9 AGTGGCACTAAACCGGGAAA

21853

SCN10A_Int7_Int9_T5 CTTCAATTAGGGCACCGTTT

36184

SCN 10A_Int5_Int7_T42 GATCCATTGCCACACAGTAA

22546

S CN 10 A_Int5_Int7_T 15 CATAGGGACCAAGGTCTGGT

40032

SCN10A_Up_Intl_T8 GTTAGTTTCGAGGGATCCAA

22481

SCN 10A_Int5_Int7_T25 GTGGCAATGGATCTGACTCA

37565

SCN10A_Int3_Int4_T7 GTGCCATGGAGTGTACTCAG

40010

SCN10A_Up_Intl_T39 GAACTTGGGCAGCTGGTTGC

39999

SCN10A_Up_Intl_T12 AACGGATCTAGATCCTCCAG

40031

SCN10A_Up_Intl_T4 ACGGAAGTTGTTAGTTTCGA

36711

S CN 10 A_Int4_Int5_T 18 ATCTCTGCAAGCAAGGGTCC

22498

SCN 10A_Int5_Int7_T21 GCATTCACCACACAAGGCTT

39818

SCN 1 OAJnt l_int2_T22 AGAAGGGCTCTGGGAACTAC 22822

S CN 10 A_Int4_Int5_T 11 CAGAGATGCTGACTAACTTC

26179

SCN10A_Up_Intl_T42 CTCCCCTGAATGCCTTGCAG

25521

SCN10A_Int2_Int3_T5 TTATCCTGCCATGCCTCATG

21856

SCN 10A_Int7_Int9_T20 CTGGACTAGCCACTTCAATT

39796

SCN10A_Intl_int2_T2 GGGCCCGAGTGGCACTAAAC

37564

S CN 10 A_Int3_Int4_T 10 TGTGCCATGGAGTGTACTCA

22528

S CN 10 A_Int5_Int7_T35 TGCTCAGCATCCCTCTTGCA

37583

S CN 10 A_Int3_Int4_T 17 ATATCACCAAGGTGATGAGG

22577

SCN10A_Int5_Int7_T4 TACCACTGTCATCTTCCCGC

21847

SCN10A_Int7_Int9_Tl l ACCGTTTAGGGAGCTATAGG

36168

SCN 10A_Int5_Int7_T31 TCTGTGCCCATAATATGCCA

36702

S CN 10 A_Int4_Int5_T 14 TGCTGTGCCAACATATCTGT

35704

SCN10A_Int7_Int9_T4 GCCTCCAACCAAGTCTGCGT

22795

S CN 10 A_Int4_Int5_T 10 AAGAACCCTGTAAGGTTCCA

21926

SCN10A_Int7_Int9_Tl TTCCCCCACGCAGACTTGGT

26097

SCN10A_Up_Intl_T44 AGAGAAGCCTCGGCCCCAGC

36692

S CN 10 A_Int4_Int5_T 17 TCTGTGAATAAATGCTCACC

22484

SCN 10A_Int5_Int7_T20 GACCCCTTACTGTGTGGCAA

39775

SCN10A_Intl_int2_T30 GGTACTGGACACAGTAGGCA

22538

S CN 10 A_Int5_Int7_T 18 TTGGTATCATATAGGGACAG

25529

SCN10A_Int2_Int3_T6 ATTTATTACGGTCACTATTT

22540

SCN10A_Int5_Int7_Tl CCTTGGTATCATATAGGGAC

36207

SCN 10A_Int5_Int7_T29 ATGTACTCAGTGGGCATGCT

26126

SCN10A_Up_Intl_T6 TCGCTTTACTCCGGAGTCAC

36671

S CN 10 A_Int4_Int5_T 12 CTTACTAGTGAAGAGGCCTT 39769

SCN10A_Intl_int2_T21 CTGTTGCTAACCTCTAAAGA

22539

S CN 10 A_Int5_Int7_T 17 CTTGGTATCATATAGGGACA

36712

S CN 10 A_Int4_Int5_T 19 TCTCTGCAAGCAAGGGTCCT

22814

SCN10A_Int4_Int5_T5 ATAGATCTCCGTGGGATCTC

36673

SCN 10A_Int4_Int5_T22 GTTTATGTTTCCTATACTCC

40030

SCN10A_Up_Intl_Tl GACGGAAGTTGTTAGTTTCG

35660

SCN10A_Int7_Int9_T7 CTCCTTCCGGAGCATCTCGA

39770

SCN 1 OAJnt l_int2_Tl 8 CTAACCTCTAAAGAAGGTAC

23812

SCN10A_Int3_Int4_T5 AACCCCCTGAGTACACTCCA

22575

SCN 10A_Int5_Int7_T26 TCATCTTCCCGCAGGCCTGA

22791

SCN 10A_Int4_Int5_T24 TGTCCCCACTTACAAGACAA

22547

S CN 10 A_Int5_Int7_T 10 CTTCCATAGGGACCAAGGTC

22820

SCN 10A_Int4_Int5_T27 TTCTGGTCCTACAGATATGT

39763

SCN 1 OAJnt l_int2_T25 TTGTACTTTTGGGATTCAAT

22796

SCN10A_Int4_Int5_T8 CAAGAACCCTGTAAGGTTCC

26118

SCN10A_Up_Intl_T30 GAAGCAAATTGCTGCCAAGC

36205

S CN 10 A_Int5_Int7_T33 TTTGGCTACATGTACTCAGT

26167

SCN10A_Up_Intl_T54 AGGAGCCAAGTGTGAGTTCA

39781

SCN10A_Intl_int2_T7 TGGAAGAGGCAATCGTGCAA

23796

SCN10A_Int3_Int4_Tl GGATTTTAGCGTCATTACCC

22574

SCN10A_Int5_Int7_Tl l CGCAGGCCTGAAGGTCATTG

37533

SCN10A_Int3_Int4_T2 CATAGAGATATACTCACGCC

36697

SCN10A_Int4_Int5_T3 TAAGAACTCTGAATGTCCGC

25876

SCN10A_Intl_int2_T5 TTTCCCGGTTTAGTGCCACT

39813

SCN 1 OAJnt l_int2_T26 TCTCAGGCTTATGAGCAAGA 21841

S CN 10 A_Int7_Int9_T 16 CTCAGGGACCATATTAGATC

40001

SCN10A_Up_Intl_T9 GGCTCCCCGATCAGTTCTGC

26176

SCN10A_Up_Intl_T27 CTTGCAGGGGAATGGGTTCC

26175

SCN10A_Up_Intl_T41 TTGCAGGGGAATGGGTTCCT

39779

SCN10A_Intl_int2_T8 CTAATTGTAACACGTGGAAG

39815

SCN 1 OAJnt l_int2_Tl 7 CTTATGAGCAAGAAGGGCTC

36177

S CN 10 A_Int5_Int7_T 14 ACTCGTGCTTTGTCATAAGT

23807

S CN 10 A_Int3_Int4_T 12 TGAAGCCTTGATAAAGATAC

36670

SCN 10A_Int4_Int5_T20 TCTTACTAGTGAAGAGGCCT

39814

SCN10A_Intl_int2_T31 CTCAGGCTTATGAGCAAGAA

21852

SCN10A_Int7_Int9_T3 TTCAATTAGGGCACCGTTTA

40008

SCN10A_Up_Intl_T23 CACCATAGAACTTGGGCAGC

36178

SCN10A_Int5_Int7_T3 CTCGTGCTTTGTCATAAGTT

40017

SCN10A_Up_Intl_T48 TTCAAGTCCAGCTGGGGCCG

39765

SCN 1 OAJnt l_int2_T28 TTTTGGGATTCAATTGGATA

40062

SCN10A_Up_Intl_T31 TGTTTATTCAACCCTCCTCC

[000463] Note that the SEQ ID NOs represent the DNA sequence of the genomic target, while the gRNA or sgRNA spacer sequence will be the RNA version of the DNA sequence.

Example 8 - Testing of preferred guides in in vitro transcribed (TVT) gRNA screen

[000464] To identify a large spectrum of pairs of gRNAs able to edit the cognate DNA target region, an in vitro transcribed (IVT) gRNA screen was conducted. The relevant genomic sequence was submitted for analysis using a gRNA design software. The resulting list of gRNAs were narrowed to a select list of gRNAs as described above based on uniqueness of sequence (only gRNAs without a perfect match somewhere else in the genome were screened) and minimal predicted off targets. This set of gRNAs was in vitro transcribed, and transfected using Lipofectamine MessengerMAX into HEK293T cells that constitutively express Cas9. Cells were harvested 48 hours post transfection, the genomic DNA was isolated, and cutting efficiency was evaluated using TIDE analysis. (Figures 2A-H; Figures 3 A-C).

[000465] The gRNA or pairs of gRNA with significant activity can then be followed up in cultured cells to measure SCNIOA protein expression. Off-target events can be followed again. A variety of cells can be transfected and the level of gene correction and possible off-target events measured. These experiments allow optimization of nuclease and donor design and delivery.

Example 9 - Testing of preferred guides in cells for off-target activity

[000466] The gRNAs having the best on-target activity from the IVT screen in the above example are tested for off-target activity using Hybrid capture assays, GUIDE Seq. and whole genome sequencing in addition to other methods.

Example 10 - In vivo testing in relevant animal model

[000467] After the CRISPR-Cas9/guide combinations have been assessed, the lead

formulations will be tested in vivo in an animal model.

[000468] Culture in human cells allows direct testing on the human target and the background human genome, as described above.

[000469] Preclinical efficacy and safety evaluations can be observed through engraftment of modified mouse or human neurons of the peripheral nervous system in a mouse model. The modified cells can be observed in the months after engraftment.

XI. Equivalents and Scope

[000470] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific examples in accordance with the invention described herein. The scope of the present disclosure is not intended to be limited to the above Description, but rather is as set forth in the appended claims.

[000471] Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The present disclosure includes examples in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The present disclosure includes examples in which more than one, or the entire group members are present in, employed in, or otherwise relevant to a given product or process. [000472] In addition, it is to be understood that any particular example of the present disclosure that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such examples are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular example of the compositions of the present disclosure (e.g., any antibiotic, therapeutic or active ingredient; any method of production; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.

[000473] It is to be understood that the words which have been used are words of description rather than limitation, and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the present disclosure in its broader aspects.

[000474] While the present invention has been described at some length and with some particularity with respect to the several described examples, it is not intended that it should be limited to any such particulars or examples or any particular example, but it is to be construed with references to the appended claims so as to provide the broadest possible interpretation of such claims in view of the prior art and, therefore, to effectively encompass the intended scope of the invention.

Note Regarding Illustrative Examples

[000475] While the present disclosure provides descriptions of various specific aspects for the purpose of illustrating various aspects of the present disclsosure and/or its potential applications, it is understood that variations and modifications will occur to those skilled in the art.

[000476] Accordingly, the invention or inventions described herein should be understood to be at least as broad as they are claimed, and not as more narrowly defined by particular illustrative aspects provided herein.

[000477] Any patent, publication, or other disclosure material identified herein is incorporated by reference into this specification in its entirety unless otherwise indicated, but only to the extent that the incorporated material does not conflict with existing descriptions, definitions, statements, or other disclosure material expressly set forth in this specification. As such, and to the extent necessary, the express disclosure as set forth in this specification supersedes any conflicting material incorporated by reference. Any material, or portion thereof, that is said to be incorporated by reference into this specification, but which conflicts with existing definitions, statements, or other disclosure material set forth herein, is only incorporated to the extent that no conflict arises between that incorporated material and the existing disclosure material. Applicants reserve the right to amend this specification to expressly recite any subject matter, or portion thereof, incorporated by reference herein.