[0001] The present invention is in the field of recombinant biotechnology, in particular in the field of protein expression. The invention generally relates to methods of increasing the expression level of a protein of interest of a host cell in a fermentation process. The invention relates particularly to improving the capacity of a host cell to express a protein of interest by employing a recombinant expression vector for the expression of the protein of interest, which facilitates the regulation of the antibiotic resistance gene encoded by said expression vector by using a riboswitch. Down-regulating the expression of the antibiotic resistance gene during the fermentation process reduces the metabolic burden caused by the expression of said gene to the host cell and thereby increases the capacity of a host cell to produce the protein of interest. The present invention also relates to uses of the host cell for protein expression, cell culture technology, and more specifically to culturing host cells to produce a protein of interest.

[0002] Successful production of proteins of interest (POI) has been accomplished both with prokaryotic and eukaryotic hosts. The most prominent examples are bacteria like Escherichia coli, Bacillus subtilis, Pseudomonas fluorescens, Streptomyces griseus, or Corneybacterium glutamicum, yeasts like Saccharomyces cerevisiae, Pichia pastoris or Hansenula polymorpha, filamentous fungi like Aspergillus awamori or Trichoderma reesei, or mammalian cells like CHO cells. While the yield of some proteins is readily achieved at high rates, many other proteins are only produced at comparatively low levels.

[0003] A great number of biological pharmaceuticals (e.g. antibodies or functional fragments thereof) have been produced in the last decade and an increasing number is nearing approval for use in humans but their efficient production remains a challenging task. Therapeutically active doses are often in the order of milligram (mg) per administration. Thus, considerable amounts of protein are needed as active ingredients, making an efficient and cost-effective production worthwhile. [0004] Bacterial, fungal or mammalian cell expression systems have long been, and still are, the major tool for production of these types of molecules. The key objective of process optimization is to achieve a high yield of product having the required quality at the lowest possible cost, which is often determined by the properties of a specific expression construct or system. For example, high-level recombinant protein expression may overwhelm the metabolic capacity of a host cell and consequently leads to plasmid loss and/or growth cessation which often impairs efficient protein production. It is also known that sometimes high expression of an mRNA encoding a protein of interest does not necessarily lead to high amounts of the protein. Different approaches have been taken by scientists to deal with these problems.

[0005] For example, the expression of a recombinant protein can be further increased by optimizing the gene dosage encoding the protein of interest, by using a suitable promoter or by optimizing the codon usage of the gene encoding the protein of interest according to the employed host cell. Several other parameters have been shown to affect the expression level of a recombinant protein in a host cell, such as expression vector design, media composition, growth temperature, chaperone co-expression, mRNA stability, translation initiation and epigenetic processes.

[0006] However, high level of protein yield in host cells may be limited at one or more different steps, like folding, disulfide bond formation, glycosylation, transport within the cell, or release from the cell. Many of the mechanisms involved are still not fully understood and cannot be predicted on the basis of the current knowledge of the state- of-the-art, even when the DNA sequence of the entire genome of a host organism is available.

[0007] Antibiotic resistance genes on vector backbones, used for the expression of recombinant genes, are required to discriminate between plasmid and plasmid-free cells prior to cultivation. These resistance genes are usually under the control of strong constitutive promoters that allow for selection of plasmid bearing cells containing the corresponding antibiotic. However, constitutive promoters have the effect that the antibiotic resistance gene is still transcribed and translated during the production phase. In the interest of keeping the copy number of plasmids as high as possible, while aiming at a reduced expression of the antibiotic resistance gene, scientists thus tried to reduce the expression level of promoters that drive antibiotic resistance gene expression by introducing point mutations that attenuate the otherwise strong promoter (Panayotatos (1988), Gene 74(2): 357-363, US 5256568). However, in accordance with the teaching of Panayotatos, the host cells still produce a considerable amount of the antibiotic resistance protein, which is not highly desirable because of the metabolic burden caused by the expression of the antibiotic resistance gene. US 5256568 aims on an attenuated but still active regulatory promoter that controls the antibiotic resistance gene so that the copy-number of the gene encoding the protein of interest has to be increased in order to raise the yield of recombinant protein produced by a host cell. Thus, high copy-numbers of the gene encoding the recombinant protein are highly requested in US 5256568.

[0008] As reported in WO 2013/178674, riboswitches can be operably linked to selection markers. However, the expression vectors disclosed therein merely comprise an antibiotic resistance gene that permits an easy selection of transformed, transfected, transduced, or the like cells. WO 2013/178674 is instead silent with respect to expression vectors comprising a riboswitch-driven antibiotic resistance sequence and a further sequence encoding a protein of interest. Further, riboswitches operably linked to antibiotic resistance genes have been described in Desai and Gallivan (2004), J. AM. CHEM. SOC. 126: 13247-13254 and Jia et al. (2013), Cell 152: 68-81 , without disclosing or predicting expression vectors comprising a nucleotide sequence encoding a protein of interest and a riboswitch operably linked to said antibiotic resistance genes. Moreover, genetic constructs comprising a riboswitch operatively linked to a regulatory sequence controlling the expression of an antibiotic resistance gene have been described in WO 2012/153142, wherein the riboswitch acts only indirectly on the antibiotic resistance gene by regulating the expression of a component which effects the expression of said sequence. Instead, WO 2012/153142 does not disclose or suggest a recombinant expression vectors comprising a nucleotide sequence encoding a protein of interest and a riboswitch operably linked to an antibiotic resistance gene.

[0009] Although antibiotic-free selection systems are available, the problem of unwanted metabolic load by the expression of a gene encoding a protein mediating the selection mechanism is not circumvented. In fact, most antibiotic-free systems are based on the additional expression of a chosen complementing protein in a feasible deletion mutant, thus again the overexpression of an additional protein drains metabolic resources of the host cell and thereby impairs the system. Other antibiotic-free selection systems have the disadvantage that host cells have to be modified which thus restricts a broad application of such systems.

[0010] Given the various issues in the prior art with respect to the production of proteins in host cells, despite many advantages that have been made throughout the past years, there is still a need for identifying and developing additional/alternative methods to improve the capacity of a host cell to produce considerable amounts of recombinant proteins. Accordingly, the technical problem underlying the present invention is to comply with this need.

[0011] The present invention provides as a solution to the technical problem new means and methods to increase the yield of recombinant proteins in host cells which are simple and efficient and suitable for use in industrial methods. These means and methods are described herein, illustrated in the Examples, and reflected in the claims.

[0012] In particular, the present inventors uncovered a novel molecular mechanism that restricts the yield of a protein of interest obtained in a fermentation process. In fact, the expression of an antibiotic resistance gene consumes to some extent the cells metabolic capacity at the expense of the expression of the protein of interest. The present inventors have unravelled this mechanism and have concomitantly overcome it by turning OFF the over-production of antibiotic resistance genes or other selection markers and have much to their surprise observed that the overall production of a protein of interest by a host cell can be markedly increased during a fermentation process, thereby also lowering the production costs.

[0013] More particularly, the present inventors have prevented the expression of the antibiotic resistance gene during fermentation by modifying the 5'-UTR upstream of the coding sequence of an antibiotic resistance gene, such as a beta-lactamase gene. This modified 5'-UTR contains a riboswitch that is operably linked to an antibiotic resistance gene. Riboswitches are usually divided into two parts: an aptamer (sensing domain) and an expression platform (regulating domain). The aptamer directly binds a ligand, typically a small molecule, and upon binding of said ligand the expression platform undergoes conformational changes, most likely, in response to conformational changes in the aptamer. The structural changes, typically changes in the secondary structure of RNA, may affect the expression of the gene(s) operably linked to the riboswitch. [0014] In most cases, riboswitches operate by interfering with translation initiation or attenuating transcription termination (Roth and Breaker (2009), Annu. Rev. Biochem.;78: 305-334). For example, due to structural changes upon binding a ligand by the aptamer part of the riboswitch, the ribosome binding site of the antibiotic resistance gene may become inaccessible when the ligand is absent from the growth medium. However, in general, riboswitches can turn OFF gene expression in response to a ligand, but some can turn it ON.

[0015] The present inventors used, exemplarily, a riboswitch that binds theophylline (see Desai and Gallivan (2004), J Am Chem Soc. Vol.126: 13247-13254; Suess et al. (2004), NAR Vol.32, No.4: 1610-1614) and that is operably linked to an antibiotic resistance gene, such as beta-lactamase. Without being bound by theory, addition of theophylline results in structural changes of the riboswitch as explained above and results in turning ON the expression of the antibiotic resistance gene. This is beneficial when the antibiotic resistance gene is required, e.g. during selection processes. Yet, in the absence of theophylline, expression of the antibiotic resistance gene is turned OFF. In case of the theophylline riboswitch applied by the present inventors, turning OFF expression is due to inaccessibility of the ribosome binding site (being an integral part of the riboswitch) due to conformational changes of the riboswitch, thereby translation of the antibiotic resistance gene will be prevented and, in case of the present invention, but also generally, no energy is wasted on the production of the antibiotic resistance protein. This is beneficial during the production phase of the protein of interest as elucidated by the present inventors. As a result, the host cell seems to have less metabolic load which translates into an increase of the amount of a protein of interest. In fact, this was observed by the present inventors for the model protein superoxide dismutase (SOD); see Examples 2 and 4 and Fig. 6..

[0016] Although riboswitches operably linked to antibiotic resistance genes have been described before (WO 2013/178674; Desai and Gallivan (2004), J. AM. CHEM. SOC. 126: 13247-13254; Jia et al. (2013), Cell 152: 68-81 ), the state of the art does not predict that a host cell comprising a recombinant expression vector comprising a riboswitch operably linked to an antibiotic resistance gene allows for a selective turn OFF of the antibiotic resistance gene during protein expression, thereby significantly reducing the metabolic burden of said cell caused by the expression of said antibiotic resistance gene (as was observed by the present inventors for the model protein superoxide dismutase (SOD); see Examples 2 and 4 and Fig. 6). Further, the state of the art does not disclose or suggest that the use of a riboswitch operably linked to an antibiotic resistance gene allows for a reduction of the copy number of the gene encoding the protein of interest. Instead, it could be firstly exemplified by the present invention in host cells comprising only medium copy numbers of the gene encoding the protein of interest, that cell growth and capacity of the host cell to produce the protein of interest can be significantly increased by turning OFF the over-production of antibiotic resistance protein during fermentation as compared to cells not comprising a riboswitch (see Examples 2 and 4 and Fig. 5). In contrary thereto, US 5256568 aimed at a decreased activity of the promoter driving the antibiotic resistance gene expression and a simultaneous highest possible copy number of the gene encoding the protein of interest for achieving the supreme yield of biomass and protein.

[0017] Specifically, the present inventors compared the performance of a conventional plasmid encoding superoxide dismutase (SOD) with a modified plasmid, encoding a theophylline riboswitch upstream of the ampicillin resistance gene. They have found significant influence on cell growth and total protein yield. Indeed, when turning OFF the over-production of antibiotic resistance proteins or other selection markers during the production phase of the protein of interest by omitting the ligand, theophylline, of the riboswitch used by the present inventors, the overall production of said protein of interest can be markedly increased, thereby also lowering the production costs in pharmaceutical and industrial biotechnology. In fact, the final cell dry mass was at least 15% higher and the total amount of SOD protein was more than 10% higher when using the modified plasmid (see Figures 1 and 2).

[0018] It must be noted that as used herein, the singular forms "a", "an", and "the", include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "an expression cassette" includes one or more of the expression cassettes disclosed herein and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein. [0019] All publications and patents cited in this disclosure are incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material. Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0020] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term "comprising" can be substituted with the term "containing" or sometimes when used herein with the term "having".

When used herein "consisting of" excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. In each instance herein any of the terms "comprising", "consisting essentially of and "consisting of may be replaced with either of the other two terms.

[0021] The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. It includes also the concrete number, e.g., about 20 includes 20.

[0022] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The methods and techniques of the present invention are generally performed according to conventional methods well-known in the art. Generally, nomenclatures used in connection with techniques of biochemistry, enzymology, molecular and cellular biology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. [0023] The methods and techniques of the present invention are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e. g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (2001 ); Ausubel et al., Current Protocols in Molecular Biology, J, Greene Publishing Associates (1992, and Supplements to 2002); Handbook of Biochemistry: Section A Proteins, Vol I 1976 CRC Press; Handbook of Biochemistry: Section A Proteins, Vol II 1976 CRC Press. The nomenclatures used in connection with, and the laboratory procedures and techniques of, molecular and cellular biology, protein biochemistry, enzymology and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art.

[0024] Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

***

[0025] The invention generally relates to a method of increasing the expression level of a protein of interest from a host cell in a fermentation process. The invention relates particularly to improving a host cell's capacity to express a protein of interest by employing a recombinant expression vector for the expression of the protein of interest, which facilitates the regulation of an antibiotic resistance gene encoded by said expression vector using a riboswitch. Down-regulating the expression of the antibiotic resistance gene during the fermentation process reduces the metabolic burden caused by the expression of said gene to the host cell and thereby increases the host cell's capacity to produce the protein of interest. The present invention also relates to uses of the host cell for protein expression, cell culture technology, and more specifically to culturing host cells to produce a protein of interest.

[0026] Accordingly, it is an object of the present invention to provide a host cell comprising a vector which comprises a nucleotide sequence encoding a protein of interest and an antibiotic resistance gene, the expression of the latter is regulated by a riboswitch which is operably linked to said antibiotic resistance gene.

[0027] The present invention also provides for a vector comprising a nucleotide sequence encoding a protein of interest and an antibiotic resistance gene, the expression of the latter is regulated by a riboswitch which is operably linked to said antibiotic resistance gene. Said vector is preferably comprised by a host cell as described herein.

[0028] The vector can be a high copy number, medium copy number or low copy number vector, with a medium copy number vector being preferred.

[0029] The term "medium copy vector" refers to a vector comprising a pBR322 origin of replication or a derivative thereof.

[0030] Also, the invention provides in a preferred aspect a method for increasing the yield of a protein of interest in a host cell, in a fermentation process during manufacturing of said protein of interest, comprising down-regulating the expression of said antibiotic resistance gene of said host cell, wherein in said method the induction of said protein of interest is a full induction or a limited induction in contrast to a full induction as known in the art for a fermentation process. Furthermore, the incorporation of the riboswitch in the 5'UTR of the antibiotic resistance gene encoding sequence may result in an attenuated expression of the encoded antibiotic resistance protein upon turning the expression ON, compared to an antibiotic resistance gene lacking the riboswitch in the 5'UTR. This may be caused, without being bound by theory, by a secondary structure of the modified 5'UTR reducing the transcription and/or translation of said antibiotic resistance gene. Thus, it may be necessary to reduce the concentration of the antibiotic during the selection process in comparison to the selection of host cells comprising a vector which lacks the riboswitch in the 5'UTR of the antibiotic resistance gene.

[0031] The term full induction as known in the art refers to the induced expression of a protein of interest in a fermentation process by supplementing the full amount of inducer at once. A typical inducer may be IPTG. The full amount of inducer at once may be a concentration of the inducer of e.g. about 20 μηιοΙ / g cell dry mass in case of IPTG calculated for the expected cell dry mass at the end of fermentation. The term limited induction, as used herein, refers to the induced expression of a protein of interest in a fermentation process, wherein the amount of the inducer / g cell dry mass is reduced compared to a full induction and wherein the inducer may be further supplemented during the fermentation process. A reduction of the inducer is in the range of a remaining inducer amount of 1 % to 50% of the inducer amount of a full induction, e.g., 1 % to 40%, 1 % to 30%, 1 % to 20%, 1 % to 10%, 1 % to 5%, such as 1 %, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% of the amount of inductor per g cell dry mass which is normally used, i.e. under full induction. For example, if normally 20 μηιοΙ of an inducer per g cell dry mass will be used, then the expression will, for example, be induced by 0.9 μηιοΙ / g cell dry mass (which is 4,5 %) throughout the whole induction period. In that case induction is started by pulse induction to establish an initial IPTG concentration of 0.9 μηιοΙ IPTG / g cell dry mass. To maintain said constant concentration of 0.9 μηιοΙ IPTG / g cell dry mass the corresponding amount of inducer is continuously added to the fermentation broth (e.g. together with a feed medium) until the fermentation end or the end of the induction period. .

[0032] Furthermore, the invention relates to a method for the production of the host cell, said method comprising transforming a cell with the expression cassette or the vector described herein. Likewise, the expression cassette or the vector described herein can be used for the production of a recombinant host cell. Preferably, the medium used in the fermentation process does not contain antibiotics.

[0033] Moreover, the invention provides for the use of the host cell or the vector for increasing in a fermentation process the yield of a protein of interest in a host cell.

[0034] The term "recombinant host cell" (or simply "host cell"), as used herein, is intended to refer to any host cell, including, but not limited to a prokaryotic or eukaryotic cell into which a nucleic acid comprising an expression cassette or vector has been introduced. A prokaryotic host cell is preferred in the context of the present invention. A preferred example of a prokaryotic host cell is E. coli. Preferred E. coli host cells are E. coli host cells comprising a T7 RNA polymerase gene, e.g.: E. coli HMS174(DE3), E. coli BL21 (DE3) and E. coli T7express (New England Biolabs Inc., catalog number: C2566I with the genotype, fhuA2 lacZ::T7 genel [Ion] ompT gal sulA 11 R(mcr-73::miniTn10- TetS)2 [dcm] R(zgb-210::Tn10-TetS) endA 1 A(mcrC-mrr) 114::IS10) and E. coli HMS174(DE3) and E. coli BL21 (DE3), both genetically modified for prevention of formation of phages. However, also Pseudomonas species, Salmonella species, Bacillus species, Lactobacillus species, Corynebacterium species, Microbacterium species or Actinomycetes species are envisaged Examples of eukaryotic species are Saccharomyes species, Pichia species, Ustilago species, Schizosaccharomyces species, Hansenula species, Aspergillus species, Trichoderma species, Fusarium species, Aspergillus species . Other examples of eukaryotic cells are CHO, PerC6, HEK, Vero, HELA, Hi5, Tnao or Sf-9 insect cells. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein. A recombinant host cell may be an isolated cell, preferably grown in culture.

[0035] The expression cassette or vector according to the invention which is present in the host may either be integrated into the genome of the host or it may be maintained in some form extrachromosomally. The expression cassette may thus comprise a gene encoding the protein of interest and an antibiotic resistance gene, the expression of which is regulated via a riboswitch operably linked to said antibiotic resistance gene. Of course, as said, an expression cassette may not only be integrated into the genome, but also a vector may comprise the expression cassette.

[0036] The term "vector" as used herein refers to a nucleic acid sequence into which the expression cassette or gene encoding the protein of interest may be inserted or cloned. Furthermore, the vector encodes an antibiotic resistance gene, the expression of which is regulated via a riboswitch operably linked to said antibiotic resistance gene. Preferably, the vector is an expression vector and is capable of replicating in a host cell. The vector may be a vector derived from pET1 1 a vector comprising the gene for expressing beta-lactamase (resistance against ampicillin) or a vector derived from pET30a vector comprising the gene for expressing neomycin phosphotransferase (resistance against kanamycin).

[0037] Vectors used herein for expressing the expression cassette including the nucleotide sequence coding for the protein of interest usually contain transcriptional control elements suitable to drive transcription such as e.g. promoters, enhancers, polyadenylation signals, transcription pausing or termination signals as elements of an expression cassette. For proper expression of the polypeptides, suitable translational control elements are preferably included in the vector, such as e.g. 5' untranslated regions leading to 5' cap structures suitable for recruiting ribosomes and stop codons to terminate the translation process. In particular, the nucleotide sequence serving as the selectable marker genes as well as the nucleotide sequence encoding the protein of interest can be transcribed under the control of transcription elements present in appropriate promoters. The resultant transcripts of the selectable marker genes and that of the protein of interest harbour functional translation elements that facilitate substantial levels of protein expression (i.e. translation) and proper translation termination.

[0038] The vector may be capable of autonomous replication in a host cell (e. g., vectors having an origin of replication which functions in the host cell). The vector may have a linear, circular, or supercoiled configuration and may be complexed with other vectors or other material for certain purposes.

[0039] The vector may comprise a polylinker (multiple cloning site), i.e. a short segment of DNA that contains many restriction sites, a standard feature on many plasmids used for molecular cloning. Multiple cloning sites typically contain more than 5, 10, 15, 20, 25, or more than 25 restrictions sites. Restriction sites within an MCS are typically unique (i.e., they occur only once within that particular plasmid). MCSs are commonly used during procedures involving molecular cloning or subcloning.

[0040] One type of vector is a plasmid, which refers to a circular double stranded DNA loop into which additional DNA segments may be introduced via ligation or by means of restriction-free cloning. Other vectors include cosmids, bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC) or mini-chromosomes. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome.

[0041] The invention further relates to a vector that can be integrated into the host cells genome and thereby replicates along with the host cells genome. The expression vector may comprise a predefined restriction site, which can be used for linearization of the vector nucleic acid prior to transfection. The skilled person knows how to integrate into the genome. For example, it is important how to place the linearization restriction site, because said restriction site determines where the vector nucleic acid is opened/linearized and thus determines the order/arrangement of the expression cassettes when the construct is integrated into the genome of the host cell. [0042] The expression cassette or gene encoding the protein of interest is inserted into the expression vector as a DNA construct. This DNA construct can be recombinantly made from a synthetic DNA molecule, a genomic DNA molecule, a cDNA molecule or a combination thereof. The DNA construct is preferably made by ligating the different fragments to one another according to standard techniques known in the art.

[0043] The expression cassette or gene coding for the protein of interest may be part of the expression vector. Preferably, the expression vector is a DNA vector. The vector conveniently comprises sequences that facilitate the proper expression of the gene encoding the protein of interest and the antibiotic resistance gene. These sequences typically comprise but are not limited to promoter sequences, transcription initiation sites, transcription termination sites, and polyadenylation functions as described herein.

[0044] Furthermore, the expression cassettes may comprise an appropriate transcription termination site. This, as continued transcription from an upstream promoter through a second transcription unit may inhibit the function of the downstream promoter, a phenomenon known as promoter occlusion or transcriptional interference. This event has been described in both prokaryotes and eukaryotes. The proper placement of transcriptional termination signals between two transcription units can prevent promoter occlusion. Transcription termination sites are well characterized and their incorporation in expression vectors has been shown to have multiple beneficial effects on gene expression.

[0045] The expression cassettes may comprise an enhancer and/or an intron. Usually, introns are placed at the 5' end of the open reading frame. Accordingly, an intron may be comprised in the expression cassette for expressing the polypeptide of interest in order to increase the expression rate. Said intron may be located between the promoter and or promoter/enhancer element and the 5' end of the open reading frame of the polypeptide to be expressed. Several suitable introns are known in the state of the art that can be used in conjunction with the present invention.

[0046] The term "nucleotide sequence" or" nucleic acid molecule" as used herein refers to a polymeric form of nucleotides (i.e. polynucleotide) which are usually linked from one deoxyribose or ribose to another. The term "nucleotide sequence" preferably includes single and double stranded forms of DNA or RNA. A nucleic acid molecule of this invention may include both sense and antisense strands of RNA (containing ribonucleotides), cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. They may be modified chemically or biochemically or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.) Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.

[0047] In this regard, a nucleic acid being an expression product is preferably an RNA, whereas a nucleic acid to be introduced into a cell is preferably DNA.

[0048] The nucleic acid can be in any topological conformation. For instance, the nucleic acid can be single-stranded, double-stranded, triple-stranded, quadruplexed, partially double-stranded, branched, hairpinned, circular, or in a padlocked conformation.

[0049] A "polypeptide" refers to a molecule comprising a polymer of amino acids linked together by peptide bonds. Said term is not meant herein to refer to a specific length of the molecule and is therefore herein interchangeably used with the term "protein". When used herein, the term "polypeptide" or "protein" also includes a "polypeptide of interest" or "protein of interest" which is expressed by the expression cassettes or vectors or can be isolated from the host cells of the invention. Examples of a protein of interest are enzymes more preferably an amylolytic enzyme, a lipolytic enzyme, a proteolytic enzyme, a cellulytic enzyme, an oxidoreductase or a plant cell-wall degrading enzyme; and most preferably an enzyme having an activity selected from the group consisting of aminopeptidase, amylase, amyloglucosidase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta-galactosidase, glucoamylase, glucose oxidase, glucosidase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinase, peroxidase, phytase, phenoloxidase, polyphenoloxidase, protease, ribonuclease, transferase, transglutaminase, and xylanase. Furthermore, a protein of interest may also be a growth factor, cytokine, receptors, receptor ligands, therapeutic proteins such as interferons, BMPs, GDF proteins, fibroblast growth factors, peptides such as protein inhibitors, membrane proteins, membrane-associated proteins, peptide/protein hormones, peptidic toxins, peptidic antitoxins, antibody or functional fragments thereof such as Fab or F(ab) ₂ or derivatives of an antibody such as bispecific antibodies (for example, scFvs), chimeric antibodies, humanized antibodies, single domain antibodies such as V _H H antibodies (also known as Nanobodies) or domain antibodies (dAbs) or lipocalin muteins (also known as anticalins) and others.

[0050] A "polypeptide" as used herein encompasses both naturally-occurring and non- naturally-occurring proteins, and fragments, mutants, derivatives and analogs thereof. Polypeptides may be a polypeptide homologous (native) or heterologous to the host cell. The polypeptide of interest may also encompass a polypeptide native to the host cell, which is encoded by a nucleic acid sequence, which expression is controlled by one or more control sequences foreign to the nucleic acid sequence encoding the polypeptide. Polypeptides may be of any length. Polypeptides include proteins and/or peptides of any activity or bioactivity. A "peptide" encompasses analogs and mimetics that mimic structural and thus biological function.

[0051] Polypeptides may further form dimers, trimers and higher oligomers, i.e. consisting of more than one polypeptide molecule. Polypeptide molecules forming such dimers, trimers etc. may be identical or non-identical. The corresponding higher order structures are consequently termed homo- or heterodimers, homo- or heterotrimers etc.

[0052] Further, a polypeptide may comprise a number of different domains each of which has one or more distinct activities.

[0053] The nucleic acid sequence encoding a protein of interest may be obtained from any prokaryotic, eukaryotic, or other source. [0054] An antibiotic resistance gene, in accordance with the invention, means one or more genes which provide the transformed cells with a selection advantage (e.g. resistance against an antibiotic) by expressing the corresponding gene product. The gene product confers a characteristic to the cell expressing the antibiotic resistance gene that allows it to be distinguished from cells that do not express the antibiotic resistance gene (i.e. selection of cells) if the antibiotic, to which the gene product confers resistance to, is applied to the cell culture medium. Resistance by the gene product to the cell may be conferred via different molecular mechanisms (e.g. inactivation of the drug, increased efflux). An antibiotic resistance gene may even be split into two or more genes, i.e. two or more genes confer resistance to an antibiotic.

[0055] Preferred antibiotic resistance genes applied in the context of the present invention confer resistance against ampicillin, kanamycin, spectinomycin, streptomycin, carbenicilin, bleomycin, erythromycin, polymyxin B, tetracyclin, vancomycin, or chloramphenicol, the resistance against kanamycin is particularly preferred.

[0056] Antibiotic resistance genes encoded by the vector may be but are not limited to beta-lactamase (resistance against ampicillin), neomycin phosphotransferase (resistance against kanamycin), hygromycin phosphotransferase, Nouresothricin N- acetyltransferase, dihydropteroate synthase, dihydrofolate reductase, Chloramphenicol acetyltransferase, tetracycline efflux systems (tetA, tetM, or tetQ), with neomycin phopsphotransferase being particularly preferred.

[0057] However, antibiotic resistance genes applied in the context of the present invention may preferably also confer resistance against blasticidin, puromycin, G418, hygromycin, phleomycin, nourseothricin, or the bleomycin family.

[0058] The term "expression" as used herein means the transcription of a nucleotide sequence. Said nucleotide sequence encodes preferably a protein. Accordingly, said term also includes the production of mRNA (as transcription product from a nucleotide sequence) and translation of this mRNA to produce the corresponding gene product, such as a polypeptide, or protein.

[0059] "Operably linked" expression control sequences refers to a linkage in which the expression control sequence is contiguous with the expression cassette, as well as expression control sequences that act in trans or at a distance to control expression of the expression cassette.

[0060] A "riboswitch", as used in the present invention is an expression control element (or regulatory segment) of a messenger RNA molecule that changes state when bound by a trigger molecule. A riboswitch is, for example, able to bind a ligand (trigger molecule), such as a small molecule, resulting in a conformational change and thus in turn in a change of the production of the proteins encoded by the mRNA. As such, a riboswitch is part of an RNA molecule transcribed from a nucleotide sequence to be expressed. Thus, an mRNA that contains a riboswitch is directly involved in regulating its own activity, in response to the presence or absence of its ligand (triggering molecule or effector molecule). Accordingly, a riboswitch is usually located in the 5'-UTR of a nucleotide sequence that may encode a protein. However, it can also be located in the 3'-UTR. Riboswitches are usually divided into two parts: an aptamer (sensing domain) and an expression platform (regulating domain), both of these domains are linked to each other, i.e. one domain follows the other on nucleotide level. In order for a riboswitch to exert its regulatory function, it is the dynamic interplay between these two domains that results in control of gene expression. Specifically, in riboswitches the state or structure of the expression platform domain linked to the aptamer domain changes when a trigger molecule binds to or is sensed by the aptamer domain.

[0061] The aptamer domain may be a naturally occurring aptamer domain, or may be derived, or re-engineered therefrom or artificially created or selected by SELEX (Sinha et al. (201 1 ); Methods in Enzymology; Vol. 497: 207-220). It may be isolated, purified or recombinant. Alternatively, it may not be derived from a native riboswitch, but may be a ligand binding domain of an RNA molecule, which when operably linked to an expression platform is capable of acting as an aptamer domain of a riboswitch.

[0062] The aptamer domain may have dual functionality, meaning that it is able to bind a ligand which mediates an effect on the conformational change in the expression platform (i.e. an activation or an inhibition or a blocking thereof), and also upon binding is able to mediate other downstream/upstream effects, such as control of other RNA molecules, stabilisation of mRNA, protection from mRNA degradation nuclease or chemical, or other genetic switches. [0063] The aptamer domain may comprise a consensus sequence, which is a motif or common sequence shared by a particular type or class of riboswitches or aptamer domains, for example dictated by the class or type of ligands bound by the aptamer domain.

[0064] The aptamer domain of a riboswitch of the invention may be chimeric, for example comprising a portion of an aptamer domain of one riboswitch, and a portion of an aptamer domain of one or more different riboswitches. In this way, different functionalities such as preference for ligand binding and effect on the expression platform can be engineered into a particular aptamer domain. Preferably, such aptamer domains will comprise at least a consensus sequence for a ligand binding portion of the aptamer domain.

[0065] As said, the aptamer directly binds a ligand (trigger molecule), typically a small molecule, and upon binding of said ligand the expression platform undergoes conformational changes, most likely, in response to conformational changes in the aptamer. However, the aptamer may also sense temperature and may then undergo a conformational change. The structural changes, typically changes in the secondary structure of RNA, may affect the expression of the gene(s) operably linked to the riboswitch.

[0066] The expression platform is a nucleic acid sequence, preferably an RNA sequence. It is part of a riboswitch that affects expression of the mRNA molecule that contains the riboswitch. Expression platform domains preferably have at least a portion that can interact, such as by forming a stem structure, with a portion of the linked aptamer domain. This stem structure will either form or be disrupted upon binding or sensing a trigger molecule. The stem structure preferably either is, or prevents formation of, an expression regulatory sequence. An expression regulatory sequence structure is a structure that allows, prevents, enhances or inhibits expression of an RNA molecule containing the structure. Examples include Shine-Dalgarno sequences, initiation codons, transcription terminators, and stability and processing signals.

[0067] The expression platform may be a naturally occurring expression platform, or may be derived, re-engineered therefrom or artificially created. It may be isolated, purified or recombinant. It may not be derived from a native riboswitch, but may be a regulatory molecule which is able to adopt at least two different configurations, each of which being able to mediate a different (either inhibitory or activating) effect on expression of a nucleic acid sequence to which it is linked. Preferably, it is able to change configuration upon binding of a ligand to an aptamer domain, to which the expression platform is operably, and preferably structurally, linked.

[0068] The expression platform may comprise a consensus sequence, which is a motif or common sequence shared by a particular type or class of riboswitches or expression platforms, for example dictated by the class or type of ligands bound by the expression platforms. Consensus sequences for expression platforms of particular riboswitches are known in the art for example, pbuE (ydhL), xptG, preQ and addA (see, for example, US20120244601 , WO2006042143, WO2012153142, WO2011088076, WO2009134322).

[0069] The expression platform of a riboswitch of the invention may be chimeric, for example comprising a portion of an expression platform of one riboswitch, and a portion of an expression platform of one or more different riboswitches. In this way, different functionalities such as manner of regulating gene expression and folding, may be achieved. The expression platform may comprise RNA elements that are involved in gene expression, such as Shine-Dalgarno elements (ribosome binding site), transcription terminator stems, and the like.

[0070] A riboswitch that is applied in the context of the present invention is advantageously a regulatory element for use in regulating expression of an operably linked antibiotic resistance gene on the level of transcription or translation. As said, the riboswitch is advantageously located in the 5'-untranslated region upstream of the protein coding region of the regulated gene, upstream to the start codon of said gene. Advantageously, a riboswitch comprises (i) a sensing domain also referred to herein as "aptamer", which specifically binds a trigger molecule or senses a temperature change and thereby undergoes a conformational change; and (ii) a regulating domain, also referred to herein as "expression platform" or "expression platform domain", which may comprise intrinsic (i.e. within the regulating domain) RNA elements that are involved in gene expression for regulating the level of transcription or translation, respectively. Without being bound by theory, binding of the trigger molecule to the aptamer induces a conformational change of the riboswitch resulting in presentation or sequestration of said intrinsic RNA elements (e.g. ribosome binding site, terminator stem-loop or others) comprised by the expression platform domain.

[0071] Riboswitches can turn OFF gene expression in response to a ligand, but some can turn it ON. Accordingly, riboswitches may, for example, operate by interfering with translation initiation or attenuating transcription termination (Roth and Breaker (2009), Annu. Rev. Biochem.,78: 305-334). Furthermore, expression can be controlled by a riboswitch by mRNA self-cleavage, alteration of splicing and others. A riboswitch may also have multiple aptamer domains and/or expression platform domains. Therefore, riboswitches used herein may be chimeric riboswitches comprising aptamer domains from one source and expression platform domains from another source. Based on the modular organization, riboswitches can be designed de novo synthetically using standard recombinant DNA techniques, or can be chemically synthesized using well- established methods. Of course, also naturally occurring riboswitches are envisaged to be applied by the present invention.

[0072] The term "turn OFF" regarding gene expression as used herein can be interchangeably used with the term "downregulation". Ideally, turning OFF gene expression means a complete shutting off. However, as is commonly known for biological systems, sometimes a basal activity remains left. Accordingly, when used herein, turn OFF includes a residual activity of 0% to 49%., preferably 0% to 30%, 0% to 20% or 0% to 10%. The degree of downregulation can be determined by measuring the expression level of the antibiotic resistance gene, using methods known in the art.

[0073] The term "turn ON" regarding gene expression as used herein can be interchangeably used with the term "upregulation". Turning ON gene expression means that a gene is expressed to its full extent. However, sometimes, as is known for biological systems, expression may not be 100%, but somewhat less, such as 99, 98, 97, 96, 95, 90, 80, 75, 70, 60 or 51 %. "turn ON" can thus be understood as expression of the antibiotic resistance gene to an extent sufficient for selection of plasmid carrying cells on agar plates with antibiotic.

[0074] Riboswitches can be categorized by the bound trigger molecules. Riboswitches that can be used in line with the present invention are: cobalamin riboswitch binding adenosylcobalamin, cyclic di-GMP riboswitch binding cyclic di-GMP, FMN riboswitch binding flavin mononucleotide, glmS riboswitch binding glucosamine-6-phosphate, glutamine riboswitch binding glutamine, glycine riboswitch binding glycine, lysine riboswitch binding lysine, PreQ1 riboswitch binding pre-queuosine, purine riboswitch binding purines, SAH riboswitch binding S-adenosylhomocysteine, SAM riboswitch binding S-adenosyl methionine, SAM-SAH riboswitch binding S-adenosylhomocysteine and/or S-adenosyl methionine, tetrahydrofolate riboswitch binding tetrahydrofolate, TPP riboswitch binding thiamine pyrophosphate, moco riboswitch binding molybdenum cofactor and others. Further riboswitches that are envisaged to be applied in the context of the present invention are disclosed in US20120244601 , WO2006042143, WO2012153142, WO201 1088076, WO2009134322. However, riboswitches can also be designed de novo; see Wachsmuth et al. (2013), NAR Vol.41 , No.4: 2541 -2551 or Dixon et al. (2010), PNAS Vol.107, No.7: 2830-2835. Furthermore, riboswitches that may be useful in the context of the present invention as, e.g., basis for being further modified are described in Topp et al. (2010), Appl. Envir. Microbiol. Vol.76, No.23: 7881-7884; Desai and Gallivan (2004), J Am Chem Soc. Vol.126: 13247-13254; Suess et al. (2004), NAR Vol.32, No.4: 1610-1614; Lynch and Gallivan (2009), NAR Vol.37, No.1 : 184-192 or Edwards et al. (2010), Nature Education 3(9):9.

[0075] The nucleic acid molecule encoding the antibiotic resistance gene may comprise one or more riboswitches operably linked to said antibiotic resistance gene.

[0076] It is further envisioned that the riboswitch comprises, in order from 5' to 3': i) an aptamer binding domain which is capable of binding a trigger molecule or sensing temperature changes; ii) an expression platform domain which influences genetic control of the antibiotic resistance gene or other selection marker. The expression platform domain may preferably comprise i) a first linker nucleotide sequence of from 0 to 20 nucleotides (e.g. the linker may have a length of 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides); ii) a ribosome binding site; and iii) a second linker nucleotide sequence of from 0 to 20 nucleotides (e.g. the linker may have a length of 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides).

[0077] It is also envisioned that the riboswitch is preferably located upstream of the antibiotic resistance gene coding sequence (CDS) or the sequence encoding another selection marker, replacing a proportion of 10 nt to 35 nt of the native 5'UTR upstream of the ATG start codon of the selection marker encoding sequence. In case of the vector pET1 1 a a proportion of 35 nt of the native 5'UTR upstream of the ATG start codon of the selection marker encoding sequence is replaced with the artificial riboswitch sequence. In case of the vector pET30a a proportion of 10 nt of the native 5'UTR upstream of the ATG start codon of the selection marker encoding sequence is replaced with the artificial riboswitch sequence.

[0078] The riboswitch may also be preceded by a spacer, wherein the spacer ensures that the binding-competent aptamer structure is formed and has sufficient time during transcription to sense the target molecule. The spacer of may have the sequence 5'- ATACGACTCACTATA GGTACC -3' (SEQ ID NO: 5).

[0079] The term "aptamer" or "aptamer domain" as used in the context of riboswitch, relates to a nucleic acid fragment of a riboswitch that selectively binds to a trigger molecule or that can sense temperature changes. Binding of the aptamer to its corresponding trigger molecule or sensing a temperature change causes a conformational change within the aptamer and influences the nucleic acids adjacent to the aptamer.

[0080] Trigger molecules are molecules and compounds that can bind to a riboswitch, in particular it binds to the aptamer domain. They can either activate or de-activate the riboswitch. This includes the natural or normal trigger molecule for the riboswitch and other compounds that can activate the riboswitch. Natural or normal trigger molecules are the trigger molecule for a given riboswitch in nature or, in the case of some non- natural riboswitches, the trigger molecule for which the riboswitch was designed or with which the riboswitch was selected (as in, for example, in vitro selection or in vitro evolution techniques). Binding of the trigger molecule to the riboswitch induces a conformational change of the riboswitch, thereby it regulates, including activation or repression of the expression of the nucleotide sequence, which is operably linked to the riboswitch. Accordingly, a trigger molecule which causes an activation is an inducer while a trigger molecule which causes a repression is a repressor. An example of a trigger molecule can be a small molecule. The term "trigger molecule" and "ligand" can be interchangeably used herein. Also included by the term "trigger molecule" is temperature or, to be more precise, a change in temperature. [0081] Preferably, the trigger molecule of the present invention is a small molecule which is capable of passing the membrane of the host cell and/or is transported through the membrane of the host cell.

[0082] The riboswitch used in the present invention may comprise the nucleotide sequence

5'-ATACGACTCACTATAGGTACCGGTGATACCAGCATCGTCTTGATGCCCTTGGCAG CACCCCGCTGCAGGACAACAAG-3' (SEQ ID NO: 1 ) as disclosed by Lynch et al. (2008, NAR Vol.37, No.1 : 184-192). The riboswitch may also comprise i) a sequence which is at least 70% identical with the sequence of SEQ ID NO: 1 or ii) the sequence of SEQ ID NO: 1 wherein said sequence encompasses 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions whereupon the function of the riboswitch remains unchanged.

[0083] The riboswitch used in the present invention may also comprise the nucleotide sequence

ATTGGAGATGGCATTCCTCCATTAACAAACCGCTGCGCCCGTAGCAGCTGATGATG CCTACAGA (SEQ ID NO: 6, Fluoride riboswitch (Pseudomonas syringae)),

GGATCGCGACTGGCGAGAGCCAGGTAACGAATCGATCC (SEQ ID NO: 7,

Tetramethyl-rhodamine (TMR) riboswitch),

TCCAGCTCGGTACCATAACACAAGTGGTAGACTATTCTCTGGTACGTGCGCCCCCG GCCGTATTACGGGAGCACGCCGGCTAAGGG (SEQ ID NO: 8, 2,4-dinitrotoluene (DNT) riboswitch), or

TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGTTTCTACCAAGAGCCTTAA ACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGACTATG

(SEQ ID NO: 9, addA riboswitch (Vibrio vulnificus)), but also other RNA aptamer sequences known in the art can be used. Automated physics-based design of synthetic riboswitches from diverse RNA aptamers has been described in Borujeni et al. (2015), Nucl. Acids Res. 44(1 ): 1 -13.

[0084] It is further envisioned that the aptamer domain binds specifically to the trigger molecule theophylline.

[0085] The terms " 5' " and " 3' " used herein refer to a convention used to describe features of a nucleotide sequence related to either the position of genetic elements and/or the direction of events (5' to 3'), such as e.g. transcription by RNA polymerase or translation by the ribosome which proceeds in 5' to 3' direction. Synonyms are upstream (5') and downstream (3'). Conventionally, nucleotide sequences, gene maps, vector cards and RNA sequences are drawn with 5' to 3' from left to right or the 5' to 3' direction is indicated with arrows, wherein the arrowhead points in the 3' direction. Accordingly, 5' (upstream) indicates genetic elements positioned towards the left hand side, and 3' (downstream) indicates genetic elements positioned towards the right hand side, when following this convention.

[0086] Preferably, the riboswitch down-regulates the expression of the antibiotic resistance gene in the absence of a trigger molecule and up-regulates the expression of said antibiotic resistance gene in the presence of said trigger molecule.

[0087] Preferably, the riboswitch up-regulates the expression of the antibiotic resistance gene in the absence of a trigger molecule and down-regulates the expression of said antibiotic resistance gene in the presence of said trigger molecule.

[0088] The present invention also relates to a riboswitch that is regulated by temperature. Such a riboswitch is also referred to herein as RNA thermosensor (Chowdhury et al., 2003, J Biol Chem, 278(48):47915-21 ; Chowdhury et al., 2006, EMBO J, 25(1 1 ):2487-97) or RNA thermometer. These are RNA structural elements that affect expression of the operably linked nucleotide sequence, for example by sequestration of the Shine-Dalgarno (SD) sequence. The regulatory response occurs in response to a change in temperature rather than binding of a triggering molecule. In most cases, the RNA is in an inactive state (e.g., with the SD inaccessible to ribosome binding) under normal growth conditions, but an increase in temperature results in the melting of the RNA helix and release of the SD sequence into a single-stranded state. RNA thermosensors differ from other riboswitches in that no aptamer domain is required, with the regulatory response instead tuned to the melting temperature of the inhibitory helix. Small changes in the stability of the helix can therefore result in major changes in gene expression and in temperature response. RNA thermometer sequences to be preferably used within the scope of the invention comprise the nucleotide sequences ATGACTTACTTGCTGAATCTCAGGAGTTTATG (SEQ ID NO: 10, short ROSE-like RNA thermometer in the 5'-UTR of ibpA in Pseudomonas putida), ATTCAAGGGTAATCAATTCCTTCCACACATCAGGAGTTAACATTATG SEQ ID NO: 1 1 , RNA thermometer in the 5 -UTR of hsp17 in Synechocystis sp. PCC 6803) or GGACAAGCAATGCTTGCCTTGATGTTGAACTTTTGAATAGTGATTCAGGAGGTTAAT GATG (SEQ ID NO: 12, RNA thermometer in the 5'-UTR of agsA in Salmonella enterica), but also other RNA thermometer sequence known in the art can be used.

[0089] A riboswitch that is regulated by temperature may preferably comprise a ribosomal binding site which is sequestered by base pairing at temperatures of about 37°C and presented after melting of the structure at higher temperatures so that expression of the regulated gene can occur. The riboswitch may also sequester the ribosomal binding site at around 37°C so that expression is restricted and present the ribosomal binding site at temperatures lower than 37°C thereby inducing gene expression.

[0090] Preferably, the present invention relates to a temperature-regulated riboswitch that up-regulates the expression of said antibiotic resistance gene at a temperature above 37°C and down-regulates the expression of said antibiotic resistance gene at a temperature of 37°C or less. It is also envisioned in the present invention, that said temperature above 37°C is about 42°C.

[0091] Furthermore it is envisioned that the host cell of the present invention, when said antibiotic resistance gene is down-regulated, is capable of (i) increasing the yield of the model protein superoxide dismutase (SOD) expressed as total SOD in g

by at least 15%, if said antibiotic resistance gene is beta-lactamase, or

(ii) increasing the yield of the model protein BIWA4scFv expressed as total BIWA4scFv in g by at least 19%, if said antibiotic resistance gene is neomycin phosphotransferase, compared to said host cell encompassing a conventional vector lacking said riboswitch.

[0092] The term "yield" as used herein refers to the amount of protein of interest or model protein as described herein, in particular superoxide dismutase (nucleotide sequence shown in SEQ ID NO: 4), which is for example harvested from the recombinant host cell, and increased yields can be due to increased amounts of production or secretion of the protein of interest or model protein by the host cell or by increased formation of total cell dry mass (CDM). Yield may be presented by total protein of interest amount in g, volumetric yield of protein of interest in g/L or mg protein of interest / g biomass (measured as dry cell weight or wet cell weight) of a host cell. The term "titer" when used herein refers similarly to the amount of produced protein of interest or model protein, presented as g protein/L fermentation broth (including the cells). An increase in yield can be determined when the yield obtained from a recombinant host cell in which the antibiotic resistance gene is down-regulated in the fermentation process is compared to the yield obtained from a host cell in which the antibiotic resistance gene is expressed in the fermentation process.

[0093] As described herein, a nucleotide sequence encoding a protein of interest is preferably regulated by a promoter. Said promoter is preferably an inducible promoter. However, said promoter may also be a constitutive promoter.

[0094] A promoter sequence as used herein is a non-coding expression control sequence preferably inserted nearby the start of the coding sequence of the expression cassette and regulates its expression. Put into a simplistic yet basically correct way, it is the interplay of the promoter with various specialized proteins called transcription factors that determine whether or not a given coding sequence may be transcribed and eventually translated into the actual protein encoded by the gene. It will be recognized by a person skilled in the art that any compatible promoter can be used for recombinant expression in host cells. The promoter itself may be preceded by an upstream activating sequence, an enhancer sequence or combination thereof. These sequences are known in the art as being any DNA sequence exhibiting a strong transcriptional activity in a cell and being derived from a gene encoding an extracellular or intracellular protein. It will also be recognized by a person skilled in the art that termination and polyadenylation sequences may suitably be derived from the same sources as the promoter.

[0095] The term "inducible promoter" as used herein refers to a promoter that regulates the expression of a operably linked gene or functional RNA in response to the presence or absence of an endogenous or exogenous stimulus. Such stimuli can be but are not limited to chemical compounds or environmental signals. An inducible promoter is for example the T7 promoter, whereas the transcription of said operably linked gene by the T7 RNA polymerase can be induced for example by addition of the inducer lsopropyl-β- D-thiogalactopyranosid (IPTG).

[0096] Furthermore, the present invention provides a method for the production of a protein of interest, comprising culturing a host cell of the present invention under appropriate conditions, such that the expression of said antibiotic resistance gene is down-regulated in the fermentation process during manufacturing of said protein of interest. The term "appropriate conditions" equally means in this context that the culturing conditions allow for an increased expression of a protein of interest from a host cell in a fermentation process by reducing the metabolic burden caused by the expression of an antibiotic resistance gene carried by said host cell. Thus, "appropriate conditions" are understood as conditions that increase the capacity of the host cell to produce the protein of interest by decreasing the expression of the antibiotic resistance gene.

[0097] The term "fermentation process" as used herein refers to a process for growing cells and/or expressing a protein from those cells in a fermenter including continuous batch, fed-batch or solid state fermentations in laboratory or industrial fermenters, performed in a suitable medium and under suitable conditions allowing the expression and/or isolation of the polypeptide of interest. Cultivation of cells takes place in a suitable medium comprising at least carbon and nitrogen sources and inorganic salts, using procedures known in the art. The polypeptide of interest may be recovered from the nutrient medium by methods known in the art. Secreted polypeptides may be recovered directly from the medium. If the polypeptide is not secreted, it may be recovered from cell lysates. The recovery may comprise further isolation and purification steps by conventional means.

[0098] A large number of suitable methods exist in the art to produce polypeptides in host cells of the invention. Conveniently, the produced protein is harvested from the culture medium, lysates of the cultured host cell or from isolated (biological) membranes by established techniques. For example, an expression cassette comprising, inter alia, the nucleotide sequence encoding the protein of interest can be synthesized by PCR and inserted into the expression vector. Subsequently, a cell may be transformed with the expression vector. Thereafter, the cell is cultured to produce/express the desired protein(s), which is/are isolated and purified. For example, the product may be recovered from the host cell and/or culture medium by conventional procedures including, but not limited to, cell lysis, breaking up host cells, centrifugation, filtration, ultra-filtration, extraction, evaporation, spray drying or precipitation. Purification may be performed by a variety of procedures known in the art including, but not limited to, chromatography (e.g. ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g. ammonium sulfate precipitation) or extraction.

[0099] "Isolating the protein of interest" refers to the separation of the protein of interest produced during or after expression of the vector introduced. In the case of proteins or peptides as expression products, said proteins or peptides, apart from the sequence necessary and sufficient for the protein to be functional, may comprise additional N- or C- terminal amino acid sequences. Such proteins are referred to as fusion proteins.

[0100] When a polypeptide of interest is expressed in a host cell of the invention, it may be necessary to modify the nucleotide sequence encoding said polypeptide by adapting the codon usage of said nucleotide sequence to meet the frequency of the preferred codon usage of said host cell. As used herein, "frequency of preferred codon usage" refers to the preference exhibited by the host cell of the invention in usage of nucleotide codons to specify a given amino acid. To determine the frequency of usage of a particular codon in a gene, the number of occurrences of that codon in the gene is divided by the total number of occurrences of all codons specifying the same amino acid in the gene. Similarly, the frequency of preferred codon usage exhibited by a host cell can be calculated by averaging frequency of preferred codon usage in a large number of genes expressed by the host cell. It is preferable that this analysis be limited to genes that are highly expressed by the host cell. The percent deviation of the frequency of preferred codon usage for a synthetic gene from that employed by a host cell is calculated first by determining the percent deviation of the frequency of usage of a single codon from that of the host cell followed by obtaining the average deviation over all codons. As defined herein, this calculation includes unique codons (i.e., ATG and TGG).

[0101] A tag may be used to allow identification and/or purification of the protein of interest. Examples of affinity tags that may be used in accordance with the invention include, but are not limited to, HAT, FLAG, c-myc, hemagglutinin antigen, His (e.g., 6xHis) tags, flag-tag, strep-tag, strepll-tag, TAP-tag, chitin binding domain (CBD), maltose-binding protein, immunoglobulin A (IgA), His-6-tag, glutathione-S-transferase (GST) tag, intein and streptavidie binding protein (SBP) tag. ] The invention may also be characterized by the following items: A host cell comprising a vector which comprises a nucleotide sequence encoding a protein of interest and an antibiotic resistance gene, the expression of which is regulated by a riboswitch which is operably linked to said antibiotic resistance gene.

The host cell of item 1 , wherein said host cell, when said antibiotic resistance gene is down-regulated, is capable of (i) increasing the yield of the model protein superoxide dismutase (SOD) expressed as total SOD in g by at least 15%, if said antibiotic resistance gene is beta-lactamase, or (ii) increasing the yield of the model protein BIWA4scFv expressed as total BIWA4scFv in g by at least 19%, if said antibiotic resistance gene is neomycin phosphotransferase, compared to said host cell encompassing a conventional vector lacking said riboswitch.

The host cell of item 1 or 2, wherein said riboswitch comprises in order/direction from 5' to 3': (i) an aptamer domain which is capable of binding a trigger molecule and (ii) an expression platform domain which regulates control of said antibiotic resistance gene.

The host cell of item 3, wherein said expression platform comprises (i) a first linker nucleotide sequence of from 0 to 20 nucleotides, (ii) a ribosome binding site, and (iii) a second linker nucleotide sequence of from 0 to 20 nucleotides.

The host cell of any of the preceding items, wherein said riboswitch is located upstream of the antibiotic resistance gene coding sequence (CDS) or the sequence encoding another selection marker, replacing a proportion of 10 nt to 35 nt of the native 5'UTR upstream of the ATG start codon of the selection marker encoding sequence.

The host cell of any one of items 1 to 5, wherein said riboswitch down-regulates the expression of said antibiotic resistance gene in the absence of a trigger molecule and up-regulates the expression of said antibiotic resistance gene in the presence of said trigger molecule.

The host cell of any one of items 1 to 5, wherein said riboswitch up-regulates the expression of said antibiotic resistance gene in the absence of a trigger molecule and down-regulates the expression of said antibiotic resistance gene in the presence of said trigger molecule. The host cell of item 6 or 7, wherein said trigger molecule is a small molecule which is capable of passing the membrane of the host cell and/or is transported through the membrane of the host cell.

The host cell of any one of items 6 to 8, wherein said riboswitch is a theophylline riboswitch and said trigger molecule is theophylline.

The host cell of any one of items 1 to 5, wherein said riboswitch is regulated by temperature.

The host cell of item 10, wherein said riboswitch, regulated by temperature, up- regulates the expression of said antibiotic resistance gene at a temperature above 37°C and down-regulates the expression of said antibiotic resistance gene at a temperature of 37°C or less.

The host cell of item 1 1 , wherein said temperature above 37°C is about 42°C. The host cell of any of the preceding items, wherein said nucleotide sequence encoding said protein of interest is regulated by an inducible promoter.

The host cell of any of the preceding items, wherein said vector is a medium copy vector.

The host cell of any of the preceding items, wherein said host cell is a prokaryotic host cell.

The host cell of item 15, wherein said prokaryotic host cell is E. coli.

The host cell of item 16, wherein said E. coli host cell comprises a T7 RNA polymerase gene.

The host cell of item 17 wherein said E. coli host cell is E. coli HMS174(DE3), E. coli T7express, E. coli BL21 (DE3) or genetically modified E. coli HMS174(DE3) or E. coli BL21 (DE3).

The host cell of any one of items 15 to 18, wherein said antibiotic resistance gene confers resistance against ampicillin, kanamycin, spectinomycin, streptomycin, carbenicilin, bleomycin, erythromycin, polymyxin B, tetracyclin, vancomycin, or chloramphenicol.

The host cell of item 19, wherein said antibiotic resistance gene is neomycin phosphotransferase or beta-lactamase.

The host cell of any of the items 1 -14, wherein said host cell is a eukaryotic host cell. The host cell of item 21 , wherein said antibiotic resistance gene confers resistance against blasticidin, zeocin, puromycin, G418, hygromycin, phleomycin, or nourseothricin.

The host cell of any one of items 1 to 22, wherein the riboswitch comprises the nucleotide sequence:

5'-

ATACGACTCACTATAGGTACCGGTGATACCAGCATCGTCTTGATGCCCTTGGC AG

CACCCCGCTGCAGGACAACAAG-3' (SEQ ID NO: 1 ),

ATTGGAGATGGCATTCCTCCATTAACAAACCGCTGCGCCCGTAGCAGCTGAT GATGCCTACAGA (SEQ ID NO: 6),

GGATCGCGACTGGCGAGAGCCAGGTAACGAATCGATCC (SEQ ID NO: 7), TCCAGCTCGGTACCATAACACAAGTGGTAGACTATTCTCTGGTACGTGCGCC CCCGGCCGTATTACGGGAGCACGCCGGCTAAGGG (SEQ ID NO: 8),

TCAACGCTTCATATAATCCTAATGATATGGTTTGGGAGTTTCTACCAAGAGCCT TAAACTCTTGATTATGAAGTCTGTCGCTTTATCCGAAATTTTATAAAGAGAAGA CTATG (SEQ ID NO: 9),

ATGACTTACTTGCTGAATCTCAGGAGTTTATG (SEQ ID NO: 10),

ATTCAAGGGTAATCAATTCCTTCCACACATCAGGAGTTAACATTATG (SEQ ID NO: 1 1 ) or

GGACAAGCAATGCTTGCCTTGATGTTGAACTTTTGAATAGTGATTCAGGAGGT TAATGATG (SEQ ID NO: 12).

The host cell of item 23, wherein the riboswitch may also comprise i) a sequence which is at least 70% identical with the sequence of SEQ ID NO: 1 , SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 or SEQ ID NO: 12 or ii) the sequence of SEQ ID NO: 1 , SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 or SEQ ID NO: 12, wherein said sequence encompasses 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acid substitutions whereupon the function of the riboswitch remains unchanged.

A method for the production of a protein of interest, comprising culturing the host cell of any one of items 1 to 24 under appropriate conditions, such that the expression of said antibiotic resistance gene is down-regulated in the fermentation process during manufacturing of said protein of interest and preferably additionally comprising the steps of recovering, purifying, and further optionally formulating the protein of interest.

26. A method for increasing the yield of a protein of interest in a host cell, in a fermentation process during manufacturing of said protein of interest, comprising down-regulating the expression of said antibiotic resistance gene of a host cell of anyone of claims 1 to 24.

27. A vector, preferably an expression vector, which comprises a nucleotide sequence encoding a protein of interest and an antibiotic resistance gene, the expression of which is regulated by the riboswitch defined in any one of item 1 to 24.

28. Use of the host cell of any one of item 1 to 24 or the vector of item 27 for increasing in a fermentation process the yield of a protein of interest in a host cell.

FIGURES

[0103] Figure 1 : Results of fermentations using either HMS174(DE3)pET11 a<SOD> (♦) induced with 0.9 μηιοΙ IPTG/g cell dry mass (CDM) (limited induction) 7h after starting feed mode, HMS174(DE3)pET(PR)1 1 a<SOD> ( ) induced with 0.9 μηιοΙ IPTG/g CDM 7h after starting feed mode or HMS174(DE3)pET(PR)1 1 a<SOD> (■) induced with 0.9 μηιοΙ IPTG/g CDM when feed mode was initiated (0 h). A) Specific soluble SOD expressed in mg/g CDM, B) specific insoluble SOD expressed in mg/g CDM, C) total soluble SOD expressed in g, D) total insoluble SOD expressed in g, E) specific total SOD (soluble+insoluble) expressed in mg/g CDM and F) total SOD expressed in g.

[0104] Figure 2: Comparison of total biomass yield shown for HMS174(DE3)pET1 1 a<SOD> (♦) induced with 0.9 μηποΙ IPTG/g CDM (limited induction) 7h after starting feed mode, HMS174(DE3)pET(PR)1 1 a<SOD> ( ? ) induced with 0.9 μηιοΙ IPTG/g CDM 7h after starting feed mode or HMS174(DE3)pET(PR)1 1 a<SOD> ( ) induced with 0.9 μηιοΙ IPTG/g CDM when feed mode was initiated (0 h). Total cell dry mass (CDM) is expressed in g.

[0105] Figure 3: Preferred nucleotide sequences of the present invention. [0106] Figure 4 A) Specific protein content, expressed in mg BIWA4 scFv inclusion bodies (IBs) per g cell dry mass (CDM), B) Volumetric yield of BIWA4 scFv IBs expressed in g/L, C) total amount of BIWA4 scFV IBs, D) total cell dry mass, expressed in g, shown for Ribo 8 (T7expresspET30a<BIWA4scFv>cer / reference plasmid, induced at timepoint 16 h), Ribo 12 (T7expresspET(PR)30a<BIWA4scFv>cer / riboswitch plasmid, induced at timepoint 16 h) and Ribo 19

(T7expresspET(PR)30a<BIWA4scFv>cer / riboswitch plasmid induced at feedstart

[timepoint 0 h]).

E) Specific protein content, expressed in mg lnterferon-γ inclusion bodies (IBs) per g cell dry mass (CDM), F) Volumetric yield of lnterferon-γ IBs expressed in g/L, G) total amount of lnterferon-γ inclusion bodies, H) total cell dry mass, expressed in g, shown for Ribo 18 (T7expresspET30a<INFY>cer / reference plasmid, induced at timepoint 16 h), Ribo 20 (T7expresspET(PR)30a<INFY>cer / riboswitch plasmid, induced at timepoint 16 h).

[0107] Figure 5: Plasmid copy number (PCN), expressed in number of recombinant plasmids per host genome, shown for A) Ribo 1 (HMS174(DE3)pET1 1 a<SOD> / reference plasmid, induced at timepoint 7 h)m Ribo 3

(HMS174(DE3)pET(PR)1 1 a<SOD> / theophylline-riboswitch plasmid, induced at timepoint 7h) and Ribo 1 1 (HMS174(DE3)pET(PR)1 1a<SOD> / theophylline-riboswitch plasmid, induced at feedstart [timepoint 0 h]), and B) Ribo 8

(T7expresspET30a<BIWA4scFv>cer / reference plasmid, induced at timepoint 16 h), Ribo 12 (T7expresspET(PR)30a<BIWA4scFv>cer / riboswitch plasmid, induced at timepoint 16 h) and Ribo 14 (T7expresspET(PR)30a<BIWA4scFv>cer / riboswitch plasmid induced at feedstart [timepoint 0 h]).

[0108] Figure 6: ppGpp (Guanosin-3' ,5' -bispyrophosphat)-levels, expressed in μηιοΙ ppGpp/g CDM, shown for Ribo 1 (HMS174(DE3)pET11 a<SOD> / reference plasmid, induced at timepoint 7 h)m Ribo 3 (HMS174(DE3)pET(PR)11 a<SOD> / theophylline- riboswitch plasmid, induced at timepoint 7h).

[0109] Figure 7: Different log-fold dilutions (10 ^~2 , 10 ^~3 , 1(T* and 10 ^~5 , indicated by -2, -3, -4 and -5, diluted in sterile PBS) of an overnight culture of NEB5- alphapET(PR)30a<SOD> (indicated by N1 and N3, representing two independent clones) and HMS174(DE3)pET(PR)30a<SOD> (indicated by H3) were spotted on (3 μΙ_ each) on LB agar plates with different concentrations of kanamycin sulfate (50/25/12,5/6,25 g/mL) either with (2 mM) or without (0 mM) theophylline. Figure 7/A shows the concentrations of 50 and 25 μg/mL kanamycin sulfate and figure 7/B shows the concentrations of 12.5 and 6.25 μg/mL.

EXAMPLES

The following Examples illustrate the invention, but are not to be construed as limiting the scope of the invention.

Example 1 : Molecular cloning of pET(PR)11a<SOD>

A theophylline riboswitch sequence (SEQ I D NO 1 ) was inserted into the 5'-UTR region of pET1 1 a<SOD>, a plasmid encoding the gene for superoxide dismutase (SOD) (sod; SEQ ID NO 4) under the control of the T7 promoter and comprising the gene for expressing beta-lactamase (resistance against ampicillin), finally yielding pET(PR)1 1 a<SOD>. The sequence was inserted using overlap extension PCR (polymerase chain reaction) (OEP) cloning as described by Bryksin AV and Matsumuru I (2010, Biotechniques Vol.48: 463-465). The following primers have been used:

TPR_primerDB:

5'-GAATAAGGGCGACACGGAAATGTTGAATACTCATcttgttgtcttgcagcgg-3' (SEQ ID NO: 2)

TPR_primerAC_back:

5'-ATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTggtgataccagcatcgt ctt-3' (SEQ ID NO: 3).

The megaprimer was amplified by PCR from a plasmid containing the standard biological part BBa_K41 1001 sequence. Positive clones were selected on LB agar plates containing 2 mM theophylline and 50 μg/mL ampicillin.

Positive clones have been verified by sequencing. The sequence verified pET(PR)1 1 a<SOD> was transformed into E. coli HMS174(DE3), to finally yield HMS174(DE3)pET(PR)1 1 a<SOD>. A master- and working cell bank was prepared and the novel plasmid was tested and benchmarked with the conventional pET1 1 a<SOD> plasmid in a standard fermentation process. The verification of the selection mechanism was shown by different log-fold dilutions (10- 2, 10-3, 10-4 and 10-5, indicated by -2, -3, -4 and -5, diluted in sterile PBS) of an overnight culture of NEB5-alphapET(PR)30a<SOD>, E. coli NEB5-alpha (New England Biologigs Inc.) transformed with pET(PR)30a<SOD> (indicated by N1 and N3, representing two independent clones) and HMS174(DE3)pET(PR)30a<SOD> (indicated by H3) were spotted on (3 μΙ_ each) on LB agar plates with different concentrations of kanamycin sulfate (50/25/12,5/6,25 μg/mL) either with (2 mM) or without (0 mM) theophylline. Figure 7/A shows the concentrations of 50 and 25 μg/mL kanamycin sulfate and figure 7/B shows the concentrations of 12.5 and 6.25 μg/mL.

Example 2: Standard Fermentation process

In order to benchmark the plasmid pET(PR)1 1 a<SOD> containing the theophyillin riboswitch, with a standard pET1 1 a<SOD> plasmid lab scale fermentations have been performed. In the fermentation process shown in this example limited induction was performed, however this is not a prerequisite, but merely an alternative to full induction. A minimal media described by Marisch et al. (2013) Microb Cell Fact 12: 58 calculated to produce 22.5 g CDM in the batch phase and another 237 g CDM during feed phase was used for cultivation in a 20 L (14 L net volume, 4 L batch volume) computer controlled bioreactor (MBR; Wetzikon, Switzerland) equipped with standard control units (Siemens PS7, Intellution iFIX). The pH was maintained at a set-point of 7.0 +/- 0.05 by addition of 25% ammonia solution (MERCK), the temperature was set to 37 ° C +/- 0.5 ° C. In order to avoid oxygen limitation the dissolved oxygen level was stabilized above 30% saturation by stirrer speed and aeration rate control. Foaming was suppressed by addition of 0.5 mL antifoam (PPG 2000) per liter media. For inoculation, a deep frozen (-80 ° C) working cell bank vial, was thawed and 1 mL (optical density OD600= 1 ) was transferred aseptically with 30 mL 0.9% NaCI solution to the bioreactor. The fed-batch regime with an exponential substrate feed was used to provide a constant growth rate of 0.1 h-1 over 4 doubling times. One doubling time past feed start (induction time point = 7h) the culture was induced with continuous supply of physiology tolerable amounts of the inducer lsopropyl-3-D-thiogalactopyranosid (IPTG) (GERBU Biotechnik, Germany) in a constant ratio to CDM (0^mol/g CDM, for details see Striedner et al. (2003) Biotechnol Prog 19(5): 1427-1432. A constant IPTG/CDM ratio is achieved by addition of IPTG to the feed medium in relation to the planned amount of CDM and into the fermenter in relation to the CDM, which was already produced.

Product analytics for the quantification of SOD were performed by ELSIA according to Porstmann et al. (1988) Clin Chim Acta 171 (1 ): 1 -10.

Hence, full induction may be used as well. Results of fermentations using either HMS174(DE3)pET11 a<SOD> (E. coli HMS174(DE3) transformed with pET1 1 a<SOD> (♦) induced with 0.9 μηιοΙ IPTG/g CDM (limited induction) 7h after starting feed mode, HMS174(DE3)pET(PR)1 1 a<SOD> ( ? ) induced with 0.9 μπιοΙ IPTG/g CDM 7h after starting feed mode or HMS174(DE3)pET(PR)11 a<SOD> ( ) induced with 0.9 μηιοΙ IPTG/g CDM when feed mode was initiated (0 h) are shown in Fig. 1 and Fig. 2. Conducted fermentations, independent on the induction scheme, reveal that the riboswitch system (HMS174(DE3)pET(PR)1 1 a<SOD>) shows higher soluble, insoluble and total yields (Fig. 1 C, D and F) compared to the conventional system lacking the riboswitch.

Product formation kinetics showed different profiles for total soluble SOD, total insoluble SOD and total SOD especially in the late phase of the fermentations for HMS174(DE3)pET(PR)1 1 a<SOD> and HMS174(DE3)pET1 1 a<SOD> cultivations (Fig 1 C, D and F): Stagnation of SOD production or only slight decrease for HMS174(DE3)pET1 1 a<SOD> versus strong increase of SOD production at the end of the cultivation for HMS174(DE3)pET(PR)1 1 a<SOD>. This finding suggests that there is further potential for increasing the yield of recombinant protein by modification of the induction scheme..

Determination of total cell dry mass for HMS174(DE3)pET11 a<SOD> (♦) induced with 0.9 μηιοΙ IPTG/g CDM (limited induction) 7h after starting feed mode, HMS174(DE3)pET(PR)1 1 a<SOD> ( ) induced with 0.9 μπιοΙ IPTG/g CDM 7h after starting feed mode or HMS174(DE3)pET(PR)11 a<SOD> ( ) induced with 0.9 μηιοΙ IPTG/g CDM when feed mode was initiated (0 h) (Fig. 2) was performed. Total cell dry mass (CDM) is expressed in g. Comparing the total cell dry mass of the riboswitch system and the conventional system reveals the reduced metabolic burden of the cell, achieved by the riboswitch system via down-regulating the expression of the antibiotic resistance gene, resulting in an increased biomass formation. Example 3: Molecular cloning of pET(PR)30a<BIWA4scFv>cer and pET(PR)30a<IFNy>cer

A theophylline riboswitch sequence (SEQ ID NO 1 ) was inserted into the 5'-UTR region of pET30a<BIWA4scFv>cer, a plasmid encoding the gene for the single chain variable fragment (scFv) BIWA4 (SEQ ID NO 17) under the control of the T7 promoter and comprising the gene for expressing neomycin phosphotransferase (resistance against kanamycin) and comprising cer, a gene sequence resultion in plasmid dimer resolution.finally yielding pET(PR)30a<BIWA4scFv>cer. The sequence was inserted by using the type lis restriction enzyme Bsal. Therefore, the following primers have been used to generate two PCR products that were digested with Bsal and subsequently ligated:

AggtctctATACGACTCACTATAGGTACCGGTGATACCAGCATCGTC (SEQ ID NO: 13, >Bsal_TPR_back)

CggtctctCatcttgttgtcctgcagcggGGTGCTGCCAAGGG (SEQ ID NO: 14,

>Bsal_TPR_8.1 *_for)

AggtctctgATGAGCCATATTCAACGG (SEQ ID NO: 15, >Bsal_pET_KanR_back) AggtctctGTATTACTGTTTATGTAAGCAGACAG (SEQ ID NO: 16,

>Bsal_pET_KanR_for).

The primers Bsal_TPR_back and Bsal_TPR_8.1 *_for were used to amplify a modified (comprising the spacer with the SEQ NO ID 5) theophylline riboswitch sequence using pET(PR)11 a<SOD> as a DNA template. The primers Bsal_pET_KanR_back and Bsal_pET_KanR_for were used to amplify a compatible pET30a backbone using pET30a as a DNA template. Both PCR products were gel purified, digested with Bsal at 37°C >2h, followed by spin column purification and subsequent ligation of the two purified DNA fragments. Ligation was performed at room temperature for 1 h using T4 DNA ligase. After ligation an aliquot of 5 microliter was transformed into chemically competent NEB 5-alpha cells. The cells were recovered in 900 μί SOC media supplemented with 2 mM theophylline and subsequently 450 μί were plated on LB agar plates containing 12.5 μg/mL kanamycin sulfate supplemented with and without 2 mM theophylline. The vector pET(PR)30a<IFNy>cer, with Interferon - gamma (IFNy, SEQ ID NO 18) as a protein of interest, was constructed analogous to the construction of pET(PR)30a<BIWA4scFv>cer.

Example 4: High cell density fermentation process induced with 1 mM IPTG

The cells were grown in a 30 I (23 I net volume, 5 I batch volume) computer controlled bioreactor (Bioengineering; Wald, CH) equipped with standard control units (Siemens PS7, Intellution iFIX). The pH was maintained at a set-point of 7.0 ± 0.05 by addition of 25 % ammonia solution (MERCK), the temperature was set to 37 °C ± 0.5 °C in batch, and linear feed phase. In order to avoid oxygen limitation, the dissolved oxygen level was stabilized above 30 % saturation by stirrer speed and aeration rate control of process air with a maximum overpressure in the head space of 1.0 bar. Foaming in the batch phase was suppressed by addition of 0.5 ml/l antifoam (PPG 2000 Sigma Aldrich) whereas in the feeding phase antifoam was added pulse wise when foam reached the maximum level in the reactor.

For inoculation, approx. 200 ml of a pre-culture (OD -3.5, ~ 700 OD-units) of the working cell bank grown in LB medium were transferred aseptically into the bioreactor.

Feeding was started when the culture, grown to a bacterial dry matter of 80 g in 10 I batch medium, entered stationary phase (evident by a peak in dissolved oxygen). Fed- batch regime started with an exponential substrate feed to provide a constant growth rate of 0.17 h ^" . 1 1 hours after feed start the exponential feed regime was switched to a linear feed regime with a constant pump rate of 4.9 g glucose /min. Induction of the culture was in linear feed-phase using 1 mM IPTG. Time of induction was 12 h prior to the end of fermentation. Results are depicted in Fig. 4A-H.

The content of BIWA4scFv and IFNy in the fermentation broth was determined by SDS- Page against a standard of BIWA4scFv and IFNy respectively.

In order to benchmark the plasmid pET(PR)30a<BIWA4scFv>cer containing the theophyillin riboswitch, with a standard pET30a<BIWA4scFv>cer plasmid fermentations have been performed as described above:

Ribo 8 (T7expresspET30a<BIWA4scFv>cer (E. coli T7express transformed with pET30a<BIWA4scFv>cer) / reference plasmid, induced at timepoint 16 h), Ribo 12 (T7expresspET(PR)30a<BIWA4scFv>cer (E. coli T7express transformed with pET(PR)30a<BIWA4scFv>cer) / riboswitch plasmid, induced at timepoint 16 h) and Ribo 19 (T7expresspET(PR)30a<BIWA4scFv>cer / riboswitch plasmid induced at feedstart [timepoint 0 h]) are shown in Fig. 4 A-D. Conducted fermentations, independent on the induction scheme, reveal that the riboswitch system (T7expresspET(PR)30a<BIWA4scFv>cer) shows higher yields (Fig. 4 B and C) compared to the conventional system lacking the riboswitch.

Determination of total cell dry mass expressed in g for Ribo 8, 12 and 19 (Fig. 4 D) reveals the reduced metabolic burden of the cell, achieved by the riboswitch system via down-regulating the expression of the antibiotic resistance gene, resulting in an increased biomass formation.

In order to benchmark the plasmid pET(PR)30a<IFNy>cer containing the theophyillin riboswitch, with a standard pET30a<IFNy>cer plasmid fermentations have been performed as described above: Ribo 18 (T7expresspET30a<IFNy>cer (E. coli T7express transformed with pET30a<IFNy>cer) / reference plasmid, induced at timepoint 16 h), Ribo 20 (T7expresspET(PR)30a<IFNy>cer (E. coli T7express transformed with pET(PR)30a<IFNy>cer) / riboswitch plasmid, induced at timepoint 16 h) are shown in Fig. 4 E-H. Conducted fermentations reveal that the riboswitch system (T7expresspET(PR)30a<IFNy>cer) shows higher yields (Fig. 4 E-G) compared to the conventional system lacking the riboswitch.

Determination of total cell dry mass expressed in g for Ribo 1 and 20 (Fig. 4 H) reveals the reduced metabolic burden of the cell, achieved by the riboswitch system via down- regulating the expression of the antibiotic resistance gene, resulting in an increased biomass formation.

^■ Media composition

All of the components were added in relation to gram cell dry mass to be produced.

In Table 1 the concentrations of the components of the minimal media for high density culture are listed. Tabel 1 : List of media components for high density culture fermentations.

+) These components are in the fermenter from beginning of the cultivation; they are calculated for batch and feed-phase

++) The concentrations of these components were added only for the calculated CDM of the batch at the beginning of the cultivation, the remaining amount of the media components was added continuous by a defined feed regime

To accelerate initial growth of the population, the complex component yeast extract (150 mg/g calculated CDM of batch) was added to the batch medium. Furthermore, 45.3 mg/g CDM sodium sulfate were added to avoid N-limitation in batch phase. For the feeding phase 10.5 kg of minimal medium were prepared according to the amount of biological dry mass (2000 g) to be produced in the feeding phase. Nitrogen level was held by adding 25 % ammonia solution (MERCK) for pH control. Trace element solution, prepared in 5 N HCI (g*l ), contained the following components: FeS0 ₄ *7H ₂ 0 40.0, MnS0 ₄ *H ₂ 0 10.0, AICI ₃ *6H ₂ 0 10.0, ZnS0 ₄ *7H ₂ 0 2.0, Na ₂ Mo0 ₂ *2H ₂ 0 2.0, CuCI ₂ *2H ₂ 0 1.0, H ₃ BO ₃ O.5O, CoCI ₂ 4.0. ^■ Determination of plasmid copy number

Plasmid copy number (PCN) was calculated from plasmid and chromosomal DNA (Breuer et al. 1998). Plasmid DNA was isolated from the bacterial cells using a commercial miniprep kit (Promega SV Wizard) and quantified with the Agilent Bioanalyser DNA 7500 LabChip® Kit. To estimate the rate of plasmid loss during purification, samples were spiked with pUC-19 DNA. Total DNA was determined by fluorescence assay using HOECHST dye H33258 after cell disintegration with lysozyme and sodium dodecyl sulfate (Rymaszewski et al. 1990). Results are depicted in Fig. 5A and B, demonstrating that bacterial cells with a plasmid that comprises a theophylline riboswitch that regulates the expression of an ampicillin resistance gene (Fig. 5A) or a kanamycin resistance gene (Fig. 5B) comprise lower plasmid copy numbers per genome than bacterial cells containing a riboswitch-free standard plasmid.

^■ Determination of ppGpp

The sample-preparation procedure for ppGpp determination was performed according to (Cserjan-Puschmann et al. 1999): a disposable 10-ml syringe was filled with approx. 1.0 ml 35% perchloric acid (PCA) containing 80 mM EDTA pre-weighed and chilled to 0°C in an ice-water bath. Then a sample (approx. 4.0 ml) was collected and, after mixing, the syringe was re-weighed to allow sample volume calculation based on a density of 1 .0 g ml ^"1 . The mixture was transferred to an ice-cold test tube and mixed by vortexing at 5.0-min intervals for 15 min. Afterwards the samples were neu- tralised by the addition of 3.0 ml 2 M potassium phosphate buffer (pH 8.2). Following centrifugation at 3000 g for 10 min at 4 °C, to remove cell debris, precipitated protein and potassium perchlorate, the supernatant was transferred to an ice-cold test tube and frozen at ) 80°C. To ensure the effciency of the sample-preparation procedure the following reagents, chilled to 0 °C, were tested: TCA (20% trichloroacetic acid, 2 mM EDTA), PCA (35% perchloric acid, 80 mM EDTA), FA (2 M formic acid, 20 mM EDTA), ethanol (96% at -20 °C) and form + KOH (1.9% formaldehyde for stabilisation and then 0.2 M KOH). ppGpp and other stress-relevant nucleotides were separated and quantified by ion-pair reversed-phase high-performance liquid chromatography (HPLC). HPLC was performed using a Pharmacia LKB system consisting of two pumps, a high-pressure mixing valve, an LC controller, an HP 1 100 autosampler, an absorbance detector and a diode array (HP DAD 1 100). Ion-pair reversed-phase chromatography was carried out with a Supelcosil LC-18T column (150-mm ^' 4.6-mm i.d.,3 Im particle size) connected with a Supelguard LC-18T guard column (5 Im particle size) (Supeico). The temperature was set to 40 °C. A flow rate of 1.5 ml min ¹ and absorbance detection at 254 nm or a diode array were employed. The mobile phases consisted of two eluents: buffer A (100 mM KH2P04/K2HP04 pH 6, containing 5 mM tetrabutyl ammonium dihydrogen phosphate and 50 mM EDTA, ®nal pH 5.3) and buffer B (buffer A (82%) with acetonitrile (18%), final pH 5.9). All buffer solutions were filtered through a 0.2-μηι filter (Millipak 20; Millipore). Both buffers were stored under helium pressure during the period of use. The chromatographic conditions were as follows: the gradient was 5-40% buffer B for 36 min, 40-100% buffer B for 15 min, 100% buffer B for 5 min, 100-5% buffer B for 4 min, and then equilibration at 5% buffer B for 3 min to restore the initial conditions.

Prior to HPLC injection the sample was filtered through a 0.2-μηι syringe filter (Millex GV; Millipore). The samples are stable for at least 24 h at room temperature. The injected amount of sample was equivalent to approximately 0.3 mg BDM. Peaks were identified by comparison of retention times of spiked samples by UV absorbance at 254 nm, and in one particular case by on-line scanning with UV spectra (DAD). Quantification was carried out by integration of peak area. Each sample was analysed at least twice. All standard curves were achieved with nucleotide standards in the range 100±2500 pmol in which the peak area shows good correlation with the amount present. For the preparation of approx. 0.5 mM stock solutions of standard nucleotides the individual nucleotides were dissolved in 100 mM KH2P04/K2HP04 (pH 7) buffer and stored at -80 °C. The precise content was determined using specific UV absorption. The results are depicted in Fig. 6, indicating that the amount of the stress-relevant nucleotide ppGpp per gramm CDM is significantly decreased in cells containing a theophylline riboswitch plasmid (pET(PR)1 1 a<SOD>) as compared to cells containing a standard pET1 1 a<SOD> plasmid over a feed time up to 30 hours. The so called stringent response is signaled by ppGpp, and modulates transcription of up to 1/3 of all genes in the cell. This in turn causes the cell to divert resources away from growth and division and toward amino acid synthesis in order to promote survival until nutrient conditions improve. A decrease in the cellular ppGpp-level indicates that cells are less stressed by recombinant protein production. Results are depicted in Fig. 6, demonstrating that bacterial cells with a plasmid that comprises a theophylline riboswitch that regulates the expression of an ampicillin resistance gene produce less ppGpp indicating reduced metabolic burden of the cell. ^■ Determination of total DNA concentration

The total DNA content was determined by a fluorescence assay, using bisbenzimidazole (Hoechst dye 33258; Frankfurt, Germany). The DNA molecules were excited at 356 nm, showing their maximum at 492 nm. In the presence of bisbenzimidazole the excitement of DNA shifted to 365 nm and attained its maximum at 458 nm. The fluorometer was a TKO 100 Mini-Fluorometer (Hoefer Scientific Instruments, San Francisco, CA). The samples should contain about 1 mg bacteria dry substance (about 30-40 pg DNA). The cells were centrifuged at 15 000 g for 5 min and resuspended in 150 pL of the following solution: 50 mM glucose, 10 mM EDTA, 25 mM Tris-HCI, pH 8.9. Further, 50 WL of a lysozyme solution (10 mg/ml_) was added, mixed, and incubated at 37°C for a further 10 min. The obtained lysate was added to 9.6 mL of dilution buffer and mixed thoroughly. The fluorescence reagent was prepared by adding 10 pL of Hoechst dye 33288 (10 pg/mL) to 100 mL of buffer. The calibration standard was calf thymus DNA (10 μg/mL). For the fluorescence determination 1.9 mL reagent was mixed with 100 pL sample.

^■ Calculation of PCN

Plasmid pUC19 was used both as external and internal standard. As the content of the internal standard is known, the quantity of unknown plasmid species can be calculated as follows:

Plasmid DNA was purified from cell pellet using a commercial available Miniprep DNA Purification Kit. As internal standard 2 μΙ pUC19 (SOOng/μΙ New England Biolabs) were added after the cell lysis step. Plasmid DNA was quantified with the Agilent Bioanalyzer DNA 7500 LabChip® Kit.

The PCN was calculated according to

. , , plasmid DN A content , ,

Amount plasmid D A/sample = internal standard/ sample internal standard

Amount chromosomal DNA/ml = total DNA/ml - Plasmid DNA/ml

P _j _ basepairs chromosom *amount plasmid DNA/ml

basepairs plasmid* amount chromosomal DNA/ml

Base pairs chromosome = 4.75 ^* 10 ⁶