Field of the invention

The present invention relates to the field of agriculture, and more particularly the present invention concerns parasitic weed control and a method for providing resistance to tomato plants against the parasitic weed P. aegyptiaca upon mutation of the strigolactone-biosynthesis gene CCD8 using the CRISPR/Cas9 technique.

Background of the invention

The genera of parasitic weeds, Orobanche and Phelipanche (Orobanchaceae), also known as broomrapes, consist of over 100 species and represent one of the most destructive problems and great challenges in agricultural production. These are obligate plant parasites that attack through the host roots of almost all economically important crops in the Solanaceae, Fabaceae, Asteraceae, Brassicaceae and Apiaceae plant families. The life cycle of P. aegyptiaca is divided into two stages, pre-parasitic and parasitic. The pre- parasitic stage consists of seed preconditioning followed by germination. The germination of parasite seeds is triggered by a highly specialized detection system for strigolactones which are exuded by the host’s roots. The parasitic stage initiates with the parasite developing a special intrusive organ, i.e. the haustorium, that connects directly to the vascular system of the host. Following successful attachment and invasion of the host root, the broomrape seedling grows into a structure known as tubercle and after 4-5 weeks of tubercle growth, a floral meristem is produced, which emerges above the ground to produce flowers and seeds.

Strigolactones are plant hormone required for shoot branching and used as signaling molecules for the rhizosphere microflora. Strigolactones are produced in all green lineages of the plant kingdom and their synthesis starts with the all trans b-carotene, a carotenoid molecule which produces 9-cis^-carotene by the activity of D27, after that carotenoid cleavage dioxygenases 7 ( CCDT) converts it into 9 cis b-apo 10’- carotenal and finally carotenoid cleavage dioxygenases 8 ( CCD8 ), leading to the production of carlactone, which is then converted by cytochrome P450 enzymes {MAXI) into various strigolactones . Existence of homologs CCD7 and CCD8 have been reported in P. ramosa and P. aegyptiaca. In the rhizosphere, strigolactone acts as a host-detection cue for symbiotic arbuscular mycorrhizal fungi and stimulates seed germination of parasitic plants. Different types of strigolactone, such as strigol, 5-deoxystrigol, sorgolactone, solonacol, dideoxyorobanchol, orobanchol and others, are known as germination stimulants for root parasites. Host resistance to the Orobanchaceae root parasite Striga has been observed in crops with altered strigolactone production. The altered strigolactone production conferred resistance in the host by reducing the germination of parasite seeds. In addition, previous studies found that the tomato SL-ORT1 mutagenized by fast-neutron displays a high resistance to Phelipanche and Orobanche spp, which results from its inability to produce and secrete strigolactones regarded as natural germination stimulants to the rhizosphere.

Different methods of parasitic weed-control (chemical, biological, cultural and resistant crops) have been applied in an attempt to control broomrape, but difficulties are encountered in targeting specific plant-plant systems. Moreover, most control strategies are less effective and have considerable limitations. In recent years, there has been a growing interest in employing the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system. This system has emerged as a powerful genome-engineering technology with success in diverse organisms. Cas9-mediated genome editing technology provides enormous advantages over other classical methods in crop improvement and plant research by generating desired modifications at a specific target sequence. In some cases, CRISPR/Cas9 permits the direct introduction of mutations conferring resistance in crop plants, without traditional backcrosses or plant breeding. Cas9-DNA scissors makes site-specific double-strand cut in the genome, while Cas9 base editor have ability to alter a specific nucleotide into another, inducing modifications at targeted locus through homologous recombination or non-homologous end-joining repair mechanisms. The most frequently used CRISPR/Cas9 system, type II, has three components: Cas9 endonuclease, CRISPR RNA (crRNA) and trans activating crRNA (tracrRNA). Cas9-mediated DNA cleavage is guided by a tracrRNA:crRNA duplex that is complementary to the crRNA. The tracrRNA: crRNA complex is fused into a chimeric single guide RNA (sgRNA) containing an 18 to 20-nucleotide (nt) sequence which determines the target DNA sequence. The NGG protospacer adjacent motif (PAM) that is present at 3 '-end of the target sequence is recognized by the CRISPR/Cas9 system. Use of CRISPR/Cas9 has been reported as the most effective tool for nucleotide sequence modification or editing in numerous crop species, including tomato, rice, cotton, maize, soybean, and tobacco.

Mahfouz, M. et al managed to engineer the rice plant’s architecture through genomic editing of OsCCD7 gene using the CRISPR/Cas9 technique, and thus, generated plants with decreased strigolactone content and reduced Striga hermonthica germination (See Butt, H., Jamil, M., Wang, J. Y., Al-Babili, S., & Mahfouz, M. “Engineering plant architecture via CRISPR/Cas9-mediated alteration of strigolactone biosynthesis”. BMC plant biology, 18(1), 174, 2018).

Hershenhorn, J. et al showed that the roots of the fast-neutron-mutagenized tomato mutant SL-ORT1, which is resistant to broomrape, lacks strigolactones orobanchol, solanacol, and didehydro-orobanchol isomer. However, the researchers did not use molecular tools to generate resistant plants (See “Strigolactone Deficiency Confers Resistance in Tomato Line SL-ORT1 to the Parasitic Weeds Phelipanche and Orobanche spp”. Phytopathology 101, 213-222, 2011).

To date, effective means to control parasitic weeds in tomato plants are scarce and the lack of novel sources of resistance limits the ability to manage newly developed, more virulent broomrape races.

In view of the destructive impact of plant parasitic weeds on agriculture and the difficulties to constitute efficient control methods, there is a long-felt and unmet need to develop a new and efficient method that confers resistance to agricultural crops and is combined with various collections of resistant tomato rootstocks. Brief description of the figures

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention.

Fig.l depicting a schematic presentation of the binary plant expression construct used for Cas9 and CCD8sgRNA expression;

Fig.2 depicting a restriction analysis and sequence alignment of ^CCD8 Cas9-edited tomato lines of the present invention;

Fig.3 depicting a restriction analysis and sequence alignment of ^CCD8 Cas9-edited tomato lines of the present invention;

Fig.4 graphically depicting different comparative traits of ^CCD8 Cas9-edited tomato lines of the present invention;

Fig.5 graphically depicting different comparative traits of ^CCD8 Cas9-edited tomato lines of the present invention;

Fig.6 depicting a graphical presentation of the weed resistance trait of the ^CCD8 Cas9-edited tomato lines of the present invention;

Fig.7 graphically depicting the relative orobanchol content of ^CCD8 Cas9 -edited tomato lines of the present invention;

Fig.8 graphically depicting sequences of the ^CCD8 Cas9 mediated mutated T1 plants of the present invention;

Fig.9 depicting the carotenoid contents in ^CCD8 Cas9 mutants and relative transcript expression of three candidate genes in ^CCD8 Cas9 mutated lines of the present invention;

Fig.10 depicting a schematic presentation of the mutation presence in TO-generation of ^ccos Cas9 edited lines of the present invention; Fig.ll depicting a schematic presentation of identification of transgene (Cas9) free plants in T1 generation using different ^CCDS Cas9 mutants of the present invention;

Fig.12 depicting a schematic presentation of sequence chromatogram of potential off-target of the ^CCDS sgRNA; and

Fig.13 depicting a graphical presentation of phenotypical characterization of ^ccos Cas9 mutants of the present invention.

Summary of the invention:

The present invention provides a transgenic tomato plant with increased resistance to the parasitic weed P. aegyptiaca. In addition, the present invention provides a method of generating resistant tomato plants by disrupting the strigolactone -biosynthesis gene CCD8 using the genome-editing CRISPR/Cas9 technique.

Hence, it is thus one object of the present invention to disclose a tomato plant exhibiting resistance to parasitic weeds, wherein said resistance is conferred by the disruption of the carotenoid cleavage dioxygenases 8 (CCD8) gene via the CRISPR/Cas9 genome editing technique.

It is another object of the present invention to disclose the tomato plant as defined in any one of the above, wherein the parasitic weeds are selected from a group consisting of: the Balanophoraceae family, the Orobanchaceae family, the Rafflesiaceae family, the Loranthaceae family, the Hydnoroideae family, the Mystropetalaceae family, the Santalaceae family, the Lauraceae family, the Convolvulaceae family, the Viscaceae family, the Misodendraceae family, the Olacaceae family, the Opiliaceae family, the Schoepfiaceae family and any combination thereof.

It is another object of the present invention to disclose the tomato plant as defined in any one of the above, wherein the parasitic weed is Phelipanche aegyptiaca.

It is another object of the present invention to disclose the rootstock of the tomato plant as defined in any one of the above. It is another object of the present invention to disclose the pollen of the tomato plant as defined in any one of the above.

It is another object of the present invention to disclose the ovule of the tomato plant as defined in any one of the above.

It is another object of the present invention to disclose the seed of the tomato plant as defined in any one of the above.

It is another object of the present invention to disclose the fruit of the tomato plant as defined in any one of the above.

It is another object of the present invention to disclose a method of producing parasitic weed-resistant tomato plants via the CRISPR/Cas9 genome editing technique, comprising steps of:

(a) designing a vector comprising:

(i) a single guide RNA sequence configured to target the carotenoid cleavage dioxygenases 8 (CCD8) gene;

(ii) a protospacer adjacent motif at the 3’ end of said single guide RNA sequence;

(iii) a restriction site located next to said protospacer adjacent motif;

(b) obtaing tomato plants;

(c) transforming said tomato plants with said vector;

(d) genetically assessing the mutations caused by said vector in said tomato plants;

(e) growing said tomato lines to maturity;

(f) allowing self-pollination of said tomato lines to generate progeny;

(g) testing said progeny to ensure genome editing events in said carotenoid cleavage dioxygenases 8 (CCD8) gene; and

(h) obtaining independent mutated lines of tomato plants. It is another object of the present invention to disclose the method as defined in any one of the above, wherein the parasitic weeds are selected from a group consisting of: the Balanophoraceae family, the Orobanchaceae family, the Rafflesiaceae family, the Loranthaceae family, the Hydnoroideae family, the Mystropetalaceae family, the Santalaceae family, the Lauraceae family, the Convolvulaceae family, the Viscaceae family, the Misodendraceae family, the Olacaceae family, the Opiliaceae family, the Schoepfiaceae family and any combination thereof.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the parasitic weed is Phelipanche aegyptiaca.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the vector is a Gateway Cloning vector.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the single guide RNA sequence comprises the nucleic acid sequence TTCATTCAGCTCATCCAG.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the protospacer adjacent motif comprises the nucleic acid sequence TGG.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the transforming step is selected from a group consisting of: the Agrobacterium- mediated transformation method, particle bombardment, injection, viral transformation, in planta transformation, electroporation, lipofection, sonication, silicon carbide fiber mediated gene transfer, laser microbeam (UV) induced gene-transfer, co-cultivation with the explants tissue and any combination thereof.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the restriction site is a Bsrl restriction site. It is another object of the present invention to disclose the method as defined in any one of the above, wherein the testing is a genetic or molecular testing.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the testing is selected from a group consisting of: PCR amplifications, restriction assays, Sanger sequencing, pyrosequencing, sequencing by synthesis (Ilumina), Ion Torrent sequencing and any combination thereof.

It is another object of the present invention to disclose a method for verifying a resistance to parasitic weeds conferred to ^ccos Cas9 -edited tomato plants comprising steps of:

(a) obtaining ^CCDS Cas9-edited tomato plants;

(b) triggering said ^CCDS Cas9-edited tomato plants exhibiting the ^CCDS Cas9 knockout phenotype with seeds of said parasitic weed;

(c) randomly selecting T1 progeny from each line of said ^CCDS Cas9-edited tomato plants, irrespective of their zygosity;

(d) transplanting said selected T1 tomato plants in pots containing soil infested with said parasitic weed seeds;

(e) growing said selected T1 tomato plants for about 3 months; and

(f) measuring the resistance of said ^CCDS Cas9 -edited tomato lines by counting tubercles of said parasitic weed.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the parasitic weeds are selected from a group consisting of: the Balanophoraceae family, the Orobanchaceae family, the Rafflesiaceae family, the Loranthaceae family, the Hydnoroideae family, the Mystropetalaceae family, the Santalaceae family, the Lauraceae family, the Convolvulaceae family, the Viscaceae family, the Misodendraceae family, the Olacaceae family, the Opiliaceae family, the Schoepfiaceae family and any combination thereof. It is another object of the present invention to disclose the method as defined in any one of the above, wherein the parasitic weed is Phelipanche aegyptiaca.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the soil comprises about 20 mg of said parasitic weed seeds per about 1 kilogram of soil.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the tubercles of said parasitic weed are larger than 2 mm in diameter.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the tubercles of said parasitic weed are fresh and viable.

It is another object of the present invention to disclose the method as defined in any one of the above, wherein the ^ccos Cas9 knockout phenotype is selected from a group consisting of: dwarfing, excessive shoot branching, adventitious root formation, increase in lateral roots, reduced fruit sizes, reduced orobanchol content, increase in total carotenoids level and any combination thereof.

It is another object of the present invention to disclose a vector comprising the nucleic acid sequence TTCATTCAGCTCATCCAGTGG for use as a mean to generate plants exhibiting resistance to parasitic weeds.

Detailed description of the preferred embodiments

The following description is provided, alongside all chapters of the present invention, so as to enable any person skilled in the art to make use of the invention and sets forth the best modes contemplated by the inventor of carrying out this invention. Various modifications, however, are adapted to remain apparent to those skilled in the art, since the generic principles of the present invention have been defined specifically to provide CRISPR/Cas9 edited tomato plants with increased resistance to the parasitic weed P. aegyptiaca.

As used herein, the term “about” refers to any value being up to 25% lower or greater the defined measure. As used herein, the term “parasitic weeds” refers to any plant which derives some or all of its nutritional requirement from another living plant.

As used herein, the term “CRISPR/Cas9” refers to a genome-editing technique, wherein a synthetic guide RNA sequence complexed with the CAS9 nuclease is delivered to a gene of interest, aiming to specifically modify its sequence.

As used herein, the term “ ^CCD8 Cas9-edited tomato plants” refers to any tomato plant, whose genome was edited via the CRISPR/CAS9 technique. More specifically, a single guide RNA sequence targets the carotenoid cleavage dioxygenases 8 (CCD8) gene of the tomato plants, and disrupts its translation.

As used herein, the term “ ^CCB8 sgRNA” refers to any guide RNA sequence configured to target the tomato carotenoid cleavage dioxygenases 8 (CCD8) gene. The ^CCDS sgRNA of the present invention is a component in a CRISPR/CAS9 system, specifically designed to disrupt the activity of the carotenoid cleavage dioxygenases 8 (CCD8) gene, and create plants with enhanced resistance to parasitic weeds.

As used herein, the term “ ^CCB8 Cas9 knockout phenotype” refers to any phenotype exhibited by the ^CCD8 Cas9-edited tomato plants. This phenotype may manifest as dwarfing, excessive shoot branching, adventitious root formation, increase in lateral roots, reduced fruit sizes, reduced orobanchol content, increase in total carotenoids level or any combination thereof.

As used herein, the term “protospacer adjacent motif (PAM)” refers to a short (several base pairs) nucleic acid sequence, which immediately follows the DNA sequence targeted by the Cas9 nuclease in the CRISPR/CAS system.

As used herein, the term "rootstock" refers to part of a plant comprising the stem and/or underground part or rooting system of that plant and onto which a scion, cutting or bud is intended to be grafted.

As used herein, the term "progeny" refers in a non-limiting manner to offspring or descendant plants of the genome-edited tomato plants of the present invention.

As used herein, the term “tomato plant” refers to a plant of the genus Solanum, preferably to plants of the species Solanum lycopersicum.

As used herein, the term "locus" (loci plural) refers to a specific place or places or region or a site on a chromosome where for example a gene or genetic marker element or factor is found. In specific embodiments, such a genetic element is contributing to a trait.

As used herein, the term “trait” refers to a characteristic or phenotype. A phenotypic trait may refer to the appearance or other detectable characteristic of an individual, resulting from the interaction of its genome, proteome and/or metabolome with the environment. For example, in the context of the present invention a branching shoot trait relates a disruption in the CCD8 gene. A trait may be inherited in a dominant or recessive manner, or in a partial or incomplete-dominant manner. A trait may be monogenic (i.e. determined by a single locus) or polygenic (i.e. determined by more than one locus) or may also result from the interaction of one or more genes with the environment. A dominant trait results in a complete phenotypic manifestation at heterozygous or homozygous state; conventionally, a recessive trait manifests itself only when present at homozygous state.

As used herein, the phrase "resistance" refers to the ability of a plant to restrict the growth of a parasitic weed growing next to it, or to develop normally unaffected and uninterrupted by the presence of the parasitic weed.

It is in the scope of the present invention to disclose transgenic tomato plants (Solanum lycopersicum L.) having host resistance to parasitic weeds by disrupting the strigolactone -biosynthesis gene CCD8 (, Solyc08g066650 ) using the CRISPR/Cas9 technique.

It is also in the scope of the present invention to disclose a method of producing weed-resistant tomato lines using the CRISPR/Cas9 technique. This method comprises the following steps: (a) designing a ^CCDS sgRNA construct using the chimeric single guide RNA (sgRNA) cassette in the pENTR vector; (b) recombining the pENTR vector into the pDest vector to target the second exon of CCD8 (position 716- 733bp in the coding region) with a Bsrl restriction site located next to the protospacer adjacent motif (PAM); (c) transforming the tomato plants using the Agrobacterium-mediated transformation method; (d) genetically assessing the mutations caused by the genome editing in the different lines showing different kinds of genome editing events in the TO generation for the ^CCDS Cas9 locus; (e) growing TO transgenic tomato lines to maturity; (f) allowing self-pollination of the TO tomato lines to generate T1 progeny and to avoid somatic mutations; (g) genetically testing the T1 lines by PCR and Sanger sequencing techniques to ensure that their genomes have been edited by the CRISPR/Cas9 method.

It is also in the scope of the present invention to disclose a method of verifying the resistance conferred to the tomato plants using the CRISPR/Cas9 technique. This method comprises the following steps: (a) triggering independent transgenic tomato plants from T1 lines representing the ^ccos Cas9 knockout phenotypes with P. aegyptiaca seeds; (b) randomly selecting T1 progeny of each line, irrespective of their zygosity (homozygous or biallele); (c) transplanting the selected T1 tomato plants in small pots containing soil infested with P. aegyptiaca seeds (20 mg/kg soil); (d) growing the selected T1 tomato plants for about 3 months in a greenhouse; (e) measuring the resistance of the ^CCDS Cas9 mutated lines by counting only fresh and viable parasite tubercles which are larger than 2 mm in diameter from each plant.

EXAMPLE 1

To investigate the efficacy of using CRISPR/Cas9 to create host resistance in tomato plants against parasitic weeds, the strigolactone -biosynthesis gene CCD8 (Solyc08g066650) was disrupted in tomato strigolactones are synthesized from plant carotenoids via a pathway involving CCD7 and CCD8. The ^CCD8 sgRNA construct was designed using the single sgRNA cassette in the pENTR vector, which was then recombined into the pDest vector to target the second exon of CCD8 (position 716-733bp in the coding region) with a Bsrl restriction site located next to the protospacer adjacent motif (PAM).

Reference is now made to Fig. 1 depicting a schematic presentation of the binary plant expression construct used for Cas9 and ^CCD8 sgRNA expression. In Fig. 1A the strong constitutive 2X35SQ promoter (CaMV- 2x35S promoter with the omega enhancer sequence) was used to express Arabidopsis codon-optimized Cas9 and the Arabidopsis U6-26 promoter was used to express ^CCDS sgRNA. In Fig. IB a schematic representation of the tomato SICCD8 genomic map and location of the ^CCDS sgRNA target site are shown. The target sequence of ^CCDS sgRNA is depicted, the PAM is marked at the right end of the sequence (dashed grey line), the Bsrl restriction site and the sequence are marked by a black triangle and underlined, black arrows indicate the primer positions (S1CCD8-Int-F and S1CCD8-Int-R) used for PCR amplification, and the white arrow indicates location of ^CCDS sgRNA target site.

EXAMPLE 2

To detect mutations induced by the Cas9 nuclease in TO plants, the loss of the Bsrl restriction enzyme site that might arise due to imprecise non-homologous end-joining repair was evaluated. For each of the TO plants, the ^CCDS Cas9 target region was PCR-amplified using genomic DNA from the TO lines (individual transformants) and then digested with Bsrl (a site that would be disrupted if Cas9-mediated genome editing occurred in this location) and products on a 2% agarose gel were assessed. Digestion of the wild-type PCR fragment (452 bp) with Bsrl results in three products of 147bp, 298bp and 7bp, while Cas9 editing of the target site will generally eliminate the Bsrl site that is adjacent to the PAM (protospacer adjacent motif), leading to a 445-bp fragment. Restriction digestion of the target region-specific PCR product from lines 1, 2, 5 and 11 revealed that lines 1 and 5 were fully resistant to Bsrl digestion, whereas line 11 showed partial digestion. However, line 2 showed complete digestion of the PCR product, similar to the wild type.

Reference is now made to Fig. 2-Fig.3 depicting a restriction analysis and sequence alignment of ^CCD8 Cas9- edited tomato lines of the present invention. In Fig. 2A, a restriction digestion assay using PCR fragments of ^CCDS Cas9 targeted region in TO lines is presented. The amplified PCR fragments from genomic DNA of independent transgenic plants were subjected to /i.vrl-restriction digestion. Lines 1, 2, 5 and 11 represent independent TO transgenic plants; + : Bsrl added; without Bsrl. In Fig. 2B, PCR product sequence alignments of the selected TO lines with the wild-type genome sequences (WT) are depicted. PAM (protospacer adjacent motif) is shown in red; Bsrl site is shown in bold underlined, black triangle indicates the digestion site for Bsrl; DNA deletions are presented by black dots and deletion sizes (nt) are marked on the right side of the sequences. In Fig. 2C, ^ccos Cas9 target regions from TO lines 5 and 11 were amplified by PCR and cloned into the TA cloning vector. Sanger sequencing of positive clones aligned with wild- type sequence, and type of mutation (indels) detected are presented on the right side of the sequences. Nucleotide sequence inside the red box encodes for stop codon. Reference is now made to Fig. 3A, where a restriction digestion assay using PCR fragments of ^CCDS Cas9 targeted region in T1 generation is depicted. The amplified PCR fragment from genomic DNA of independent transgenic plants was subjected to Bsrl restriction digestion; +, Bsrl added; -, without Bsrl. In Fig. 3B, PCR product sequence alignments of the selected T1 lines is depicted. PAM is shown in red; Bsrl site is shown in bold underlined, black triangle indicates digestion site for Bsrl; DNA deletions are shown in black dots and deletion sizes (nt) are marked on the right side of the sequences; Nucleotide sequence inside the red box encodes for stop codon.

EXAMPLE 3

Previous studies on strigolactone biosynthesis have reported that strigolactones regulate plant growth and morphological architecture. Strigolactone-deficient mutants are known to exhibit an increase in shoot branching, lateral roots and overall dwarfing.

A similar phenotypic profile in ^CCDS Cas9 mutated lines was observed, such as highly branched shoots, increased lateral roots, decreased shoot heights and reduced fruit sizes as compared to the wild type plants.

Reference is now made to Figs. 4-5 graphically illustrating differences between The ^ccos Cas9 edited tomato plants and WT plants. Fig. 4A depicts a quantitative estimate of secondary branches in one month old ^ccos Cas9 mutated tomato plants (lines 1,2,5 and 11) compared to a WT plant, wherein in all edited lines the number of secondary branches is higher in comparison with WT { error bars indicate +SD n(7) } . Fig. 4B depicts plants’ height of the ^CCDS Cas9 mutated tomato plants (lines 1,2,5 and 11) compared to a WT plant after 3 month of growth {error bars indicate +SD, n(ll)}. The results indicated that the edited tomato lines are shorter than WT plants. Fig. 5A depicts the size of mature fruits of ^CCDS Cas9 mutated tomato plants (lines 1,2,5 and 11) compared to a WT plant {error bars indicate +SD n(22)}. Fig. 5B graphically depicts the number of fruit produced by ^ccos Cas9 mutated lines compared to WT tomato plant {error bars indicate +SD n(ll)}. The different small letters not connected by same letter on each bar indicate statistically significant differences compared to wild-type plants (p-value < 0.05; Student’s t-test using JPM-14 software).

EXAMPLE 4

To analyze whether the CRISPR/Cas9-generated mutations in the CCD8 gene confer resistance to P.aegyptiaca, independent transgenic tomato plants from T1 lines representing the ^ccos Cas9 knockout phenotypes, were triggered with P. aegyptiaca seeds. Randomly chosen T1 progeny of each line, irrespective of their zygosity (homozygous or biallele) were transplanted into small pots containing soil infested with P. aegyptiaca seeds (20 mg/kg soil) and grown for 3 months in a greenhouse. Two separate experiments with four replicates per treatment were conducted. To measure the resistance of the ^ccos Cas9 mutated lines, only fresh and viable parasite tubercles which are larger than 2 mm in diameter from each plant were counted. The numbers of attached parasitic tubercles and shoots are significantly reduced in the ^CCDS Cas9 mutated lines (1, 2, 5 and 11) relative to the wild-type plants. However, the decrease in P. aegyptiaca in some of the line 11 mutants is less pronounced relative to the wild-type plants than that observed for lines 1, 2 and 5.

Reference is now made to Fig. 6, where a graphical presentation of the resistance trait of ^CCD8 Cas9 edited tomato lines of the present invention are depicted, respectively. To evaluate host resistance to the parasite, host roots of the tomato wild-type (WT) and ^ccos Cas9 mutated T1 lines were rinsed after 3 months of infestation with P. aegyptiaca seeds. Tubercles larger than 2 mm in diameter were considered for analysis. Fig. 6 graphically depicts the average number of P. aegyptiaca tubercles and shoots attached to the mutant and non-mutant tomato plants in the pot assay. Bars represent average of four independent plants from the same T1 line (irrespective of type of mutation, either homozygous or biallelic within the lines) and vertical lines indicate + SD values (n=4). Bars represent the average of two separate experiments. The experiment above indicate that the ^ccos Cas9 tomato lines have reduced parasite infection compared to WT plants. EXAMPLE 5

The tomato host plant produces different kinds of strigolactones, mainly orobanchol, didehydroorobanchol isomer 1 and 2, and the aromatic strigolactone solanacols, including the recently identified orobanchyl acetate, 7-hydroxyorobanchol isomers 1 and 2, and 7-oxoorobanchol. Several studies have shown that strigolactones (a family of chemical molecules) play a critical role in the germination of parasitic weeds. However, Orobanche preferentially utilize orobanchol as the most active germination stimulant (>80% germination), whereas solanocol and 7-oxoorobanchol are weak stimulants. To explore the connection between strigolactone biosynthesis in the ^CCDS Cas9 mutants and their resistance to P. aegyptiaca infection, the total orobanchol content in the roots of wild-type and ^ccos Cas9 mutated T1 lines was analyzed by LC- MS/MS. Orobanchol levels were significantly decreased in the ^CCDS Cas9 mutated lines lb, 2a, and lib compared to the wild type, whereas orobanchol was not detectable in lines la, 2b, 5a, or 5c (see Table 1). This is consistent with line 5 showing the highest resistance to P. aegyptiaca. In addition, although CCD8 was modified in line 11a (see Table 1), and the plant exhibited the typical dwarfing and shoot-branching phenotypes of reduced strigolactone, its orobanchol content was higher than in the other modified lines. The higher orobanchol content was consistent with its lower resistance to P. aegyptiaca.

Table 1: Orobanchol content in the roots of host plants using different CCD8Cas9 edited tomato Tl-lines

To assess the higher orobanchol content in line 11a, the DNA mutations and resulting amino acid sequences were analyzed in all ^CCDS Cas9 mutated lines that were sampled for LC-MS/MS analysis after PCR products ligated to the TA cloning vector. The type of DNA mutation and the amino acid sequence in line 11a demonstrated that only 2 amino acids, His-243 and Pro-244, were deleted due to Cas9 editing in the target CCD8 gene, while the rest of the coding sequence was similar to the wild-type protein.

Reference is now made to Fig. 7 and Fig. 8 depicting a graphical presentation of traits and sequences of the ^CCD8 Cas9 mediated mutated T1 plants of the present invention, respectively. Fig. 7 graphically shows an analysis of orobanchol content in the WT roots as compared to tomato ^CCDS Cas9 edited lines (1, 2, 5 and 11) carried out by LC-MS/MS analysis {+SD n(2)}. Fig. 8A presents a PCR product sequence alignment of ^CCDS Cas9 edited lines (1, 2, 5 and 11) used for the above LC-MS/MS analysis. PAM (protospacer adjacent motif) is shown in red; Bsrl site marked by a black triangle and shown in bold underlined; DNA deletions are shown in black dots and deletion sizes (nt) are marked on the right side of the sequences; Nucleotide sequence inside the red box encodes for stop codon. Reference is now made to Fig. 8B schematically depicting the amino acid sequences of line 2a (His-243 deletion) and line 11a (His-243 and Pro-244 deletion) of the present invention compared to wild-type (WT) CCD8 proteins.

EXAMPLE 6

The biosynthetic pathway of the carotenoid derivatives all trans b- carotenoids leads to the production of strigolactone. Since CCD8 catalyze a key step in strigolactone biosynthesis from carotenoids, the effect of ^CCDS Cas9 mutation on carotenoid content and its upstream biosynthetic pathway were investigated. First, to explore whether ^ccos Cas9 mutants are affected in their carotenoid content, the content and type of carotenoid present in the root of wild type and ^ccos Cas9 mutated lines were analyzed by HPLC method. Interestingly, ^CCDS Cas9 mutation altered the profile of different types of carotenoids and its derivative, such as total carotenoids (lutein; b-carotene were substantially altered from the wild type). In addition, the expression of the prominent gene Phytoene desaturase-1 (Solyc03g 123760) and Lycopene cyclase l-b ( Solyc04g040190 ), involved in the carotenoid biosynthetic pathway which act upstream of CCD8 ³⁹ ’ ⁴⁰ were analyzed. Results obtained using quantitative real-time PCR demonstrated that expression of PDS1, LCY-b and CCD8 was upregulated in ^CCDS Cas9 edited T1 lines as compared to the wild type plants. These results demonstrate that a decrease in strigolactone content in the root of ^ccos Cas9 mutants, affect the carotenoid profile by modulating expression of the gene involved in carotenoid pathway.

Reference is now made to Fig. 9 showing the carotenoid contents in ^CCD8 Cas9 mutants and relative transcript expression of three candidate genes in ^CCD8 Cas9 mutated lines of the present invention. In Fig. 9A graphically depicts the carotenoid content (total carotenoids, beta-carotene and lutein) in tomato roots of control and the ^ccos Cas9 mutant plants of the present invention. Values are based on the analysis of 3 months old plants grown in a greenhouse. Error bars indicate +SE (n=2). Statistical differences from the wild-type control were calculated with Student’s one-tailed t-test, assuming unequal variance. Different small letter on bar indicate a significant difference between the calculated (P<0.05) values for ^ccos Cas9 edited lines and the WT plants. Reference is now made to Fig. 9B, graphically quantifying the transcript levels of SICCD8, SIPDS1 (phytoene desaturase 1) and SlLCY-b (lycopene b-cyclase) in roots of ^ccos Cas9 edited lines and wild type (WT) plants using quantitative real-time PCR. Expression level of transcript is displayed after normalization with internal control tomato elongation factor- la (EFl-a). Bar with different letter are significantly different from each other (student t-test, p< 0.05 when compared with the controls). Results represent the average of three technical repeats + SE, showing fold increase in expression of transcripts relative to the control plants. Bars represent the average of pooled three plant roots from each line.

EXAMPLE 7

Mutants showing similar kind of mutations at genome level considered as one single line in the present invention. Only lines that show different kind of genome editing in the TO generation, such as line 1, 2, 5 and 11 were selected and the presence of transgene Npt-II was confirmed by PCR. In addition, lines 5 and 11 showed multiple peaks in the sequencing chromatogram, suggesting that they are either biallelic or chimeric mutants.

Reference is now made to Fig. 10 depicting a graphical presentation of the presence of the mutation, as DNA bands appearing on the agarose gel, where in the WT plant’s genome, this mutated sequence does not exist. EXAMPLE 8

The existence of the same mutations in sibling progeny suggests that the CRISPR mutation event occurred prior to meiosis in TO. Inheritance of the mutations in homozygous and biallelic TO plants by T1 plants suggests that most, if not all, of the mutations resulting from genome editing activity are highly stable in nature and can be inherited in subsequent generations. Reference is now made to Fig. 11 depicting agarose gels displaying the identification of transgene (Cas9) free plants in T1 generation of two ^ccos Cas9 mutated lines of the present invention (line 2 as depicted in Fig. 11A, and line 5 as depicted in Fig. 11B).

Moreover, examination of the mutated region in some of the T1 generation plants suggest that 35% (5/14) of line 2 and 25% (4/16) of line 5, T1 plants were detected to be mutation-free (marked in red and with an asterisks). The results indicate that ^CCDS Cas9 targeted mutations are inherited to next generations in transgene- free plants.

EXAMPLE 9

The putative off-target sites associated with ^CCDS sgRNA were evaluated by CRISPR-P program using the ^CCDS sgRNA sequence against the tomato genome. Three potential off-targets sites with high scores, which occurred in the intergenic and CDS regions of the tomato genome were analyzed. Two plants from each line were selected from the T1 generations of ^CCDS Cas9-edited tomato plants. Sequencing of PCR products from these regions revealed no changes in the putative off-target sites in the ^ccos Cas9 -mutant lines.

Reference is now made to Fig. 12 depicting a graphical presentation of PCR product sequence chromatogram of potential off-target of the ^CCDS sgRNA.

EXAMPLE 10

Morphologically, all ^CCDS Cas9 mutant lines show highly branched shoots irrespective to the type of mutation but no significant differences were found in the root mass between ^ccos Cas9 mutated and control tomato plants. Reference is now made to Fig. 13A depicting characteristic shoot branching phenotype of ^CCDS Cas9 mutants (lines 1,2,5 and 11) compared to wild type plants. It is evident from the results that the ^ccos Cas9 tomato lines exhibit highly branched shoots. Reference is now made to Fig. 13B graphically presenting that there are no significant differences in the root mass of ^CCDS Cas9 mutants (lines 1,2,5 and 11) compared to wild type plants.