EVALUATION

TECHNICAL FIELD

Drug screening for different diseases is an always expanding field. In particular, drugs directed to Alzheimer's disease are difficult to evaluate given the difficulty in finding a proper disease model, for early screening of different treatments and/or drugs. In particular, Octogon degus are the only rodents known to spontaneously develop an Alzheimer's disease (AD)-like neuropathology, turning them in a good animal model of the disease. Nevertheless, it is still difficult to discriminate between healthy individuals and the ones that will eventually develop the AD-like neuropathology. The present invention is directed to a drug screening method for evaluating effectiveness of potential drugs in the treatment of Alzheimer disease, which comprises a method for discriminating healthy individuals from the ones developing the AD-like neuropathology; the method can further be used to search for specific biomarkers, when a control group of normal individuals is needed; and also the use of markers for early diagnostic of AD.

BACKGROUND AND PRIOR ART

Alzheimer's disease (AD) is the most common age-dependent neurodegenerative disorder associated with progressive decline in cognitive function and hallmark pathological markers. Its incidence is rising as the average age of the population increases, since age is the biggest risk factor for AD. In its early stages AD is characterized by the progressive loss of the ability to perform activities of daily living (ADL), such as making a meal and shopping. So far, the development of transgenic models of AD could provide tools to achieve an understanding of pathogenic mechanisms and develop new therapies. However, the validity of these models is overwhelmingly based on the ability of over-expression of amyloid precursor protein (APP) and tau mutations to cause the pathological plaques and neurofibrillary tangles (NFTs) observed in the AD brain. It is important to find an animal model that develops a comprehensive set of events associated with the AD pathology. The search for a good animal model of AD, preferably rodent, is one of the most imperative in present medical research.

Octodon degus, a South American rodent endemic to Chile, has been recently found to naturally develop histopathological signs of AD with age: accumulation of soluble Αβ oligomers and tau protein phosphorylation, as well as cognitive decline in spatial memory (T-maze) and object recognition memory (ORM). O. degus can live approximately 9-10 years in captivity, and from 3 years of age O. degus has been found to spontaneously develop an AD-like neuropathology. The natural onset and development of neurodegeneration, without the need of genetic manipulation, validate O. degus as a suitable animal model for studying AD.

The present invention is directed to characterize, through gene expression profile of O. degus at the onset of the AD-like neuropathology.

From the behavioral point of view, the present invention addresses the impairment of a species-typical behavior in O. degus. So far, learning and memory tests have been widely used in preclinical search for treatments in AD. However, in most cases these tests do not probe "episodic memory" which is the type most affected in AD. One aspect of the present invention considers different tests that are aimed at evaluating episodic memory. For example, burrowing in rodents mirrors "activities of daily living" in human patients, impairments of which are noticeable at the earliest stages of the illness. These impairments are frequently more of a problem to the patient than the loss of cognitive abilities, and lead to a need for carers or institutionalisation, both of which can be costly. Burrowing has not been described for O. degus before, and the present invention provides a method that results of great importance for discriminating healthy individuals from the ones developing the AD-like neuropathology; the method of the invention can further be used to search for specific biomarkers, when a control group of normal individuals is needed; and also the use of markers for early diagnostic of AD, using an animal model, particularly at early stages of the disease.

Burrowing is a basic species-typical behavior that provides the animal with a form of shelter against predation and exposure to the elements.

Nevertheless, there have been no reports on how to assess the health state of O. degus, i.e. if a particular individual will develop an AD-like disease, or if the individual will stay healthy, with non-intrusive or non-fatal techniques. This is of utmost relevance, since the development of screening processes searching for new drugs requires a proper healthy control to evaluate the real contribution of those drugs in the improvement of any disease, and in particular case of the present invention, Alzheimer's disease.

The patent application US2008171093A1 describes a method to induce cell or tissue stasis directed to the treatment of different diseases by preserving or protecting the cells or tissues or organs. Among the diseases that can be treated with the methods, apparatuses, and compounds described in this document, Alzheimer is mentioned. Nevertheless, there is no description or reference to a drug screening method, and even less so a mention or description of an animal model of AD. It is mentioned degus as one of the potentially species that could be benefited from the methods, apparatuses, and compounds described in said document. Similarly, WO2006113914A2 from the same applicant and the same inventors, is directed to methods, compositions, and apparatuses for increasing survivability of cells, tissues, organs, and organisms, but no description regarding drug screening, disease biomarkers, or animal models is found.

BRIEF DESCRIPTION OF FIGURES

Figure 1 : Burrowing performance in degus expressed as mean±SEM. Performance of three-years old degus after 2 hours and 6 hours of burrowing test.

Figure 2: MALDI-MS profiles of Αβ1 -42 peptide on Octodon degus brains: (a) representative spectra showing the presence of Αβ1 -42 peptide with a m/z 4536 Da in worst burrowers (positives); (b) representative spectra showing the absence of Αβ1 -42 peptide around m/z 4536 Da in best burrowers (negatives).

Figure 3. Expression profile of AD marker genes in the Octodon degus model. Expression was measured using real time qPCR and the data normalised to 18S rRNA gene expression as an endogenous control. Relative expression (RQ) was calculated by using the comparative Ct method with 'Control' O. degus samples used as the calibrator. The RQ value was calculated using the formula: RQ = 2-AACt. Assays were conducted in triplicate. Error bars represent ± standard error of the mean. Data represents 4 'Control O. degus' and 4 'AD O. degus' samples. An unpaired, two-side t- test was performed on the data and significant differences in expression between 'Control' and 'AD' samples are shown as follows: All timepoints showed no significant differences in expression, p≥0.05, except where shown significant, *: 0.01 < p < 0.05, and **:p≤0.01.

Figure 4. Expression profile of cytokines genes in the Octodon degus model. Expression was measured using real time qPCR and the data normalized to 18S rRNA gene expression as an endogenous control. Relative expression (RQ) was calculated by using the comparative Ct method with 'Control' O. degus samples used as the calibrator. The RQ value was calculated using the formula: RQ = 2-AACt. Assays were conducted in triplicate. Error bars represent ± standard error of the mean. Data represents 4 'Control O. degus' and 4 'AD O. degus' samples. An unpaired, two-side t- test was performed on the data and significant differences in expression between 'Control' and 'AD' samples are shown as follows: All timepoints showed no significant differences in expression, p≥0.05, except where shown significant, *: 0.01 < p < 0.05, and **:p≤0.01.

Figure 5. Expression profile of complement component genes in the Octodon degus model. Expression was measured using real time qPCR and the data normalised to 18S rRNA gene expression as an endogenous control. Relative expression (RQ) was calculated by using the comparative Ct method with 'Control' O. degus samples used as the calibrator. The RQ value was calculated using the formula: RQ = 2-AACt. Assays were conducted in triplicate. Error bars represent ± standard error of the mean. Data represents 4 'Control O. degus' and 4 'AD O. degus' samples. An unpaired, two- side t-test was performed on the data and significant differences in expression between 'Control' and 'AD' samples are shown as follows: All time points showed no significant differences in expression, p≥0.05, except where shown significant, *: 0.01 < p < 0.05, and **:p≤0.01.

SUMMARY OF THE INVENTION

Octogon degus are the only rodents known to spontaneously develop an Alzheimer's disease (AD)-like neuropathology with hallmark pathological markers, such as amyloid- β (Αβ) plaques and tau hyperphosphorylation, and a concomitant age-related decline in cognition. Nevertheless, it is difficult to discriminate between healthy animals, and those developing the AD-like disease. The present invention is directed to identify individuals that will likely develop AD-like neuropathology. Also, the invention considers a method for drug screening of potentially beneficial compounds, and a method for identification of AD biomarkers. DETAILED DESCRIPTION OF THE INVENTION

The present invention is directed to a drug screening method for evaluating effectiveness of potential drugs in the treatment of Alzheimer disease, which comprises a method for discriminating healthy individuals from the ones developing the AD-like neuropathology; the method can further be used to search for specific biomarkers, when a control group of normal individuals is needed; and also the use of markers for early diagnostic of AD.

A first aspect of the present invention is a method for identification or discrimination of healthy individuals from a population of an animal model among individuals that will potentially spontaneously develop an AD-like neuropathology.

In a second aspect of the present invention, a method for screening potentially beneficial drugs for the treatment and drug response of Alzheimer disease is considered.

A third aspect of the invention considers the identification of biomarkers for early diagnostic of AD.

In a particular embodiment of the first aspect of the present invention, the animal model that spontaneously develops an Alzheimer's disease - like neuropathology is Octogon degus.

The method of the first aspect of the invention considers the following steps: i. providing Octogon degus individuals between ages 2 months to 12 months; ii. subjecting the Octogon degus individuals to a test for identification of potential for development of AD-like neuropathology.

In a more specific embodiment of the first aspect of the invention, in the second step of the method, i.e., subjecting the Octogon degus individuals to a test for identification of potential for development of an AD-like neuropathology, the test is selected among behavioral tests, or genetic marker analysis. In a further specific embodiment, the behavioral test is selected among a burrowing performance test, a nesting performance test, a hoarding performance test, a Y-maze test, a Y-paddling maze test, or combinations thereof.

In a more specific embodiment, the burrowing performance test considers evaluating an individual considering the following steps: i. provide a proper setting for performing the burrowing performance test, including an apparatus simulating a burrow to be excavated;

ii. place the individual in the setting for performing the test at time 0;

iii. wait and record the performance of the individual during a first period of time, counted from time 0;

iv. optionally repeat the record of performance of the individual at subsequent time intervals;

v. evaluate the performance of the individual at different time periods to determine the likeliness of future development of AD-like neuropathology.

In a particular configuration, time 0 is defined as the usual hour of the day of the beginning of the normal activity cycle of Octogon degus. In a further embodiment the first period of time is between 30 minutes and 3 hours, more preferentially between 1 .5 to 2.5 hours. It is preferred to repeat the record of performance of individual at subsequent time intervals, such as for example after 30 minutes, after 1 hour, after 1 .5 hours, after 2 hours, after 2.5 hours, after 3 hours, after 4 hours from the first registry of performance during the first period of time. It is noted that is desirably at least 2 records of performance, such as for example at the first period of time, and at least one more record at a subsequent time interval. Preferred timings, which should not be considered as limitations to the present invention, are 2 hours for the first period of time (2 hours counted from time 0), and 2 hours for the second period of time, i.e., 4 hours counted from time 0.

In a further embodiment of the invention, the setting for performing the burrowing performance test comprises a confined space simulating a burrow, such as for example a cylinder made of plastic, wood, metal, or other suitable material. In a more specific embodiment, the cylinder is between 15 to 100 cm long, more preferentially between 25 and 80 cm, and even more preferentially between 40 and 60 cm. In a further embodiment, the cylinder is between 5 and 40 cm diameter, more preferentially between 7 and 30 cm diameter, even more preferentially between 7 and 20 cm diameter.

The cylinder further having an open end and a closed end. The closed end of the cylinder is located on the floor of the space wherein the burrow performance test takes place, such as for example a cage. The cylinder is fixed to the floor or walls of the space, since during the realization of the burrow performance test, the individual might move the setting altering the results. The apparatus further comprises a suitable filling for the cylinder, such as for example food pellets, wood chips, pebbles, bedding.

In a specific realization, the measurement of the performance of the individual in the burrowing performance test is the amount of filling that was taken out of the cylinder in a predetermined period of time or the accumulated amount of filling taken out at subsequent time intervals.

In a more specific embodiment, the Y-paddling maze test considers evaluating an individual in a setting combining a traditional dry maze and a traditional water maze. The design of this hybrid maze (Y-paddling maze) can be varied, considering different shapes and number of exits, but maintaining the essential elements of i) a dry platform (from dry maze) with exit holes around the periphery, only one of which offers escape to a box placed underneath; ii) a paddling setting, which corresponds to a motivator for Octodon degus, since naturally they are not used to swim in their daily life, and this paddling setting represents a natural escape response increasing the spatial component of the test. In a specific embodiment, the water maze part employs shallow water, from 1 to 5 cm of depth, contained in an optionally white-based container with transparent walls, wherein the walls have true/false exits. The false exits are occluded by black painted wooden plugs, whereas the true exit is open and joined to a black plastic pipe which can be removed with the Octodon degus inside. The Octodon degus is then swiftly and atraumatically returned to its home cage while inside the pipe. Return to the home cage is an effective motivator for learning the test. In a more specific embodiment, the water in the water maze is maintained at a temperature between 18 to 27 ^e C, more preferentially from 20-25 ^e C, and even more preferentially from 20-21 ^e C.

In a more specific embodiment, the Y maze test considers evaluating an individual using a Y-shaped maze, considering the following steps: placing the Octodon degus at the end one of the closed arms of a Y-shaped maze, facing away from the center. The sequence of arms chosen as the starting position is defined by a semi-random sequence; no more than three consecutive trials with the same position, and equal numbers of the left or right arms. Each trial lasts 60 seconds. If the Octodon degus fails to exit, i.e. whole head in exit tube, within this time, it must be encouraged to enter the arm with the aid of a piece of transparent material, in a preferred embodiment made of Perspex. The exit arm's base is blocked by the piece of transparent material and the Octodon degus allowed to find the exit by itself; this should encourage better learning than pushing it right into the tube. Finally, record the measures of the total time to exit and the number of errors (whole body excluding tail enters a blind arm).

In a further embodiment of the invention, the nesting test is performed as following:

Firstly, an apparatus is provided, such that the test is performed in individual cages; the same ones as used for burrowing are suitable. Normal bedding should cover the floor to a depth of 0.5 cm. (Variation in depth, and very deep bedding, could affect nest construction). Each cage is supplied with a 'Nestlet', a 5 cm square of pressed cotton batting. Once the apparatus is configured, the Octodon degus are placed individually into the nesting cages about one hour before the dark phase, and the results are assessed the next morning. Depending on the results, the test is scored. For this scoring, the nests are assessed on a 5-point scale, and the amount of untorn Nestlet is also weighed.

For example, the 5-point scale for scoring the nesting test is made considering the following:

The Nestlet is largely untouched (>90% intact).

The Nestlet is partially torn up (50-90% remaining intact).

The Nestlet is mostly shredded but often there is no identifiable nest site: < 50% of the Nestlet remains intact but < 90% is within a quarter of the cage floor area, i.e. the cotton is not gathered into a nest but spread around the cage.

An identifiable, but flat nest: > 90% of the Nestlet is torn up, the material is gathered into a nest within a quarter of the cage floor area, but the nest is flat, with walls higher than mouse body height (curled up on its side) on less than 50% of its circumference.

A (near) perfect nest: > 90% of the Nestlet is torn up, the nest is a crater, with walls higher than mouse body height on more than 50% of its circumference.

Where criteria do not agree split the difference. For example a perfect nest with an unshredded 0.7g piece would score 4.5.

In a further embodiment of the invention, the hoarding test is performed as following:

Firstly, an apparatus is provided, such that a series of 'home bases' are connected to tubes made of wire mesh, sealed permanently at the distal end where the food pellets are placed and temporarily at the proximal end by a wooden plug. This is used to prevent the mice entering the tubes before adaptation to the home base has occurred. The apparatus can be made in various ways, as long as the basic principles are adhered to. For example, an apparatus may consist of a row of 8 wooden boxes, each 30 x 13 x 15 cm with transparent Perspex lids. Each is supplied with a water bottle, and has a hole in the back into which the hoarding tube is push-fitted. Tubes are made of black plastic, joined to a wire mesh tube to form a total length of 50 cm. The mesh consists of 13 mm squares, and is a double roll with the meshes mis-aligned to make the holes in the mesh smaller and prevent food pellets dropping through. The distal end of the tube, where the food pellets are placed, is closed. The proximal end is sealed with a removable wooden plug.

Once the setting for the test is configured, an Octodon degus is put into each box early in the day to habituate to it. The box is provided with a cardboard tunnel which has been in the real group home cage for at least one night, also a generous portion of soiled bedding, to make it feel like 'home'. Access to the hoarding tube is prevented until evening with a wooden bung. 100 g food pellets (a mixture of small and large) is placed at the distal end of the hoarding tube (by pouring them in at the other end with the tube held vertically). To make sure the mouse is mildly hungry before testing begins, the home box is not provided with food. Just before the start of the dark phase, the wooden bung is removed to allow the Octodon degus access to the hoarding tube. The next morning, all the food pellets which have been hoarded into the home base box are collected and weighted.

In a further embodiment, the evaluation of the performance in the burrowing test is assessed by statistical tests comparing different individuals and/or different time intervals. In a preferred embodiment, data records of at least two time points are statistically analyzed. Suitable tests are, for example, Mann-Whitney U test for two groups, Krustal-Wallis one-way ANOVA for multiple groups, etc.

In a particular embodiment of the second aspect of the invention, the method for drug screening comprises the following steps: i. determining likelihood of an individual for developing AD-like neuropathy, using the method according to the first aspect of the present invention; ii. separating individuals that will likely develop the AD-like neuropathy from those that would not likely develop the AD-like neuropathy;

iii. use the group of individuals that will likely develop the AD-like neuropathy for evaluating the effects of a candidate drug, and using the group of individuals that would not likely develop the AD-like neuropathy as negative control. In a particular embodiment of the third aspect of the invention, the method for biomarker identification in early stages of AD comprises the following steps: i. determining likelihood of an individual for developing AD-like neuropathy, using the method according to the first aspect of the present invention;

ii. separating individuals that will likely develop the AD-like neuropathy from those that would not likely develop the AD-like neuropathy;

iii. use the group of individuals that will likely develop the AD-like neuropathy for evaluating the appearance of early biomarkers, and using the group of individuals that would not likely develop the AD-like neuropathy as negative control.

DESCRIPTION OF EMBODIMENTS

EXAMPLE 1 : Burrowing performance inversely correlates with β-amyloid plaques

A number of 84 O. degus were used in this study. The burrowing performance was chosen as an assessment for screening healthy from affected animals at three years old of age. At this age O. degus start to show early AD-like symptoms.

The burrowing performance was evaluated at two different times: two-hour and six- hour periods from the start of the test (see Figure 1 ). The two-hour measurement appears to be more sensitive than the six-hour one; the latter measurement often suffers from a ceiling effect, as many animals will burrow the entire tube contents. O. degus do not seem to burrow much between 2 and 6 hours.

We observed that a large percentage of three-year-old degus (50%) were able to empty the burrow, and 30% of degus were unable to remove more than 50 g of pellets (p«0.01 ). Around 20% of three-year-old degus were in an intermediate situation (see Figure 1 ).

Based on their burrowing capacity, we were able to identify two clearly distinct groups in three-year-old degus: those animals that perform well (the "good burrowers") and those that perform badly (the "bad burrowers").

Out of 84 O. degus, we took the 10 worst "bad burrowers" and the 10 best "good burrowers" and we performed a post-mortem examination of the degree of amyloid accumulation in the brain as assed by MALDI-TOF-MS. MALDI-TOF-MS is an ideal tool to investigate complex protein mixtures and generally requires destruction of the specimen under study, but recent technological advances have made it possible to apply the MALDI-MS and MALDI-IMS for the analysis of a variety of different endogenous and exogenous molecules directly in tissue sections with minimal ionization.

In particular, the presence of a particular Αβ isoform, Αβ1 -42, was analyzed in brain extracts of both O. degus groups (Figure 2). Αβ1 -42 has been shown to play a pivotal role in the pathogenesis of AD due to its neurotoxic potential (De-Paula et al., 2012). It has been suggested that soluble aggregates of Αβ1 -42 are more neurotoxic than the amyloid plaques and, in particular, that Αβ1 -42 is more amyloidogenic and more neurotoxic than Αβ1 -40 (Zhang et al., 2013).

The results reported here for three-year-old degus demonstrate that the presence of Αβ1 -42 peptide signal at m/z 4536 in the brains of worst "bad burrowers" is an indication of affected animals, those which showed impairment to displace food material at 2 h and 6 h. In contrast, the absence of Αβ1 -42 peptide peak at m/z 4536 in brains of best "good burrowers" is an indication of healthy animals, those which were able to displace all the food material at 2 and 6 h.

EXAMPLE 2: Gene expression profile in three-year-old O. degus:

Gene expression profiles were obtained for 10 best "good burrowers" and 10 worst "bad burrowers" using quantitative real-time RT-PCR (qRT-PCR).

As observed in Figure 3, apolipoprotein E (ApoE), and amyloid precursor protein (APP) were significantly upregulated in "bad burrowers" compared to their wild type "good burrowers" control. This finding supports the hypothesis that the dysregulation of ApoE and APP may contribute to accumulation of Αβ1 -42 in the AD model.

The mRNA levels Nuclear factor E2-related factor 2 (Nrf2) were also significantly upregulated in "bad burrowers" compared to their wild type "good burrower" control (Figure 3). Nrf2 is a transcription factor known to induce expression of a variety of cytoprotective and detoxification genes, and several of the genes commonly regulated by Nrf2 have been implicated in protection from neurodegenerative conditions.

The differential expressions of a number of pro-inflammatory cytokines between 'good' and 'bad' burrowers were also examined. As shown in Figure 4, the levels of IL-6, IFN- a, TNF-a and GM-CSF were considerably higher in bad burrowers (AD rodents) compared to good digger control animals. Compared to the pro-inflammatory cytokines mentioned above, IL-1 β was slightly but significantly upregulated in "bad burrowers". Given the role of complement proteins in the neuroinflammation in AD and in other neurodegenerative disease, we also examined if complement proteins, especially classical pathway components were affected in "good" versus "bad burrowers" (Figure 5). The targets we examined were: C1 q (the first recognition subcomponent of the classical pathway), C4 (the protein involved in the generation of the C3 convertase in the classical pathway activation), C3 (the common target for C3 convertases from all three complement pathways i.e. classical, alternative and lectin pathways), C5 (the target of C5 convertase in all three pathways), and C9 (one of the major constituents of the membrane attack complex i.e. MAC). In addition, we also examined the differential levels of factor H (a negative regulator of the alternative pathway) and properdin (an upregulator of the alternative pathway). Our data, as evident in Figure 5 appear to suggest a dramatic upregulation of C1 q, 03, 04, 05 and 09, suggesting that the classical pathway, via its interaction with Αβ, may be the key to complement activation and subsequent inflammatory response in the brains of "bad burrowers".

EXAMPLE 3: Αβ peptide deposition and neurotoxicity in O. degus

The present work confirms an AD-like neuropathology in "bad burrower" O. degus with a similar gene expression profile to that of human AD.

The amyloid hypothesis of AD postulates that Αβ peptide deposition and neurotoxicity play a causative role in AD. Αβ peptides are generated from β-amyloid precursor protein (APP) through sequential cleavages and inhibition of Αβ generation has become a hot topic in AD research. Excess APP production in AD, which potentially leads to amyloidogenesis, is in part due to over expression of APP mRNA. Altered transcription of APP in AD has been shown to be proportionately associated with Αβ peptide and may contribute to Αβ deposition in sporadic AD. In human endothelial cells a similar increase (50%) of total APP mRNA after treatment with human recombinant IL-1 beta was observed proposing a role of IL-1 in the neuronal mechanisms related to beta-amyloid protein deposition in AD.

In O. degus, Αβ plaque depositions in brains of "bad burrowers" was confirmed by the presence of Αβ(1 -42) peaks in MALDI-TOF spectra. This result is consistent with raised levels of APP mRNA found in brains of AD-like O. degus.

Apolipoprotein E (ApoE) is a major lipid transport protein of the central nervous system (CNS) that also mediates the transport and clearance of Αβ peptides, implicating altered lipid homeostasis in AD pathogenesis [Couttas et al., 2014]. Raised levels of ApoE mRNA were found in brains of AD-like O. degus consistent with that found in brains of AD patients as assessed by quantitative PCR. EXAMPLE 4: Neuroinflammation, oxidative injury and immune response in O. degus

The present invention confirms a comprehensive set of neurodegeneration biomarkers in the brains of "bad burrower" O. degus similar to that found in human AD.

Neurodegeneration in humans is known to occur as a result of several primary causes, including expression of certain gene alleles, toxicant administration, and aging. In general, oxidative stress and mitochondrial dysfunction have been firmly established as elevated in these models of neurodegeneration. As well, neuroinflammation occurs in close relation to neurodegenerative diseases. In neuroinflammation, cellular and molecular immune components such as specialised macrophages (microglia), cytokines, complement, and pattern-recognition receptors are the contributing players, which in turn lead to the activation of the glial cells, such as microglia and astrocytes. Chronic neuroinflammation is associated with harmful consequences for the CNS. Although the causal nature of each of these conditions is often vigorously debated, their persistent presence and strong correlation with neuronal death warrants attempts to translate these processes to an animal model in order to rationally design therapeutics that may have efficacy not only against one disease but potentially against multiple neurodegenerative conditions. Considering the gene expression profile results presented in this work, O. degus appears as an ideal candidate for this.

Oxidative injury is thought to be central in the pathogenesis of AD. Nrf2, that binds to the antioxidant response element ARE in gene promoters, has recently been reported to constitute a key regulatory factor in the coordinate induction of a battery of endogenous cytoprotective genes, including those encoding for both antioxidant- and anti-inflammatory proteins. Despite this cellular mechanism, oxidative damage is abundant in Alzheimer AD suggesting that Nrf2-mediated transcription is not induced in neurons in AD despite the presence of oxidative stress.

Αβ peptides evoke an inflammatory response in AD that leads to synaptic dysfunction, neuronal death, and neurodegeneration and it is becoming evident that sustained brain inflammation might be an essential cofactor in AD. The inflammatory response increases over time as the disease progresses. Thus, we examined the levels of proinflammatory cytokines and complement proteins in "good" and "bad burrowers". Not surprisingly, there was a clear evidence of pro-inflammatory milieu in the brain extracts of "bad burrowers" compared to control "good burrowers".

Microglia, which are the resident macrophages in brain, perform immunosurveillance functions. Αβ peptides activate microglia through a variety of innate immune receptors expressed on these cells. The mechanisms through which amyloid deposits provoke an inflammatory response are not fully understood, but it is believed that these receptors cooperate in the recognition, internalization, and clearance of Αβ and in cell activation. Microglia, via their activation by Αβ, are capable of secreting pro-inflammatory cytokines including IL-1 β, IL-6, TNF-a and IFN-γ, a range of chemokinesand growth factors, as well as complement proteins. Their raised levels have been reported in AD brains.

In culture, Αβ challenge to microglial cells can induce production of a wide range of proinflammatory soluble factors including cytokines and complement. In addition to microglia, astrocytes and oligodendrocytes are likely sources of these pro-inflammatory factors. The most possible scenario in the "bad burrower" brains is the activation of these cells in response to a varying level of aggregated Αβ, leading to generation of pro-inflammatory cytokines (and complement proteins; see below), which can impact upon amyloidosis, neurodegeneration, and cognition.

Complement system appears to be one of the key mediators of inflammation in neurodegenerative diseases. Raised levels of the classical pathway components, together with components of the membrane attack complex (MAC) in the brains of bad burrowers, are suggestive of intrinsic production of complement proteins endogenously and possible interaction between Αβ and C1 q. This interaction can first lead to the production of pro-inflammatory side products, C3a, C4a and C5a, which can act as potent anaphylatoxins, recruiting infiltration in the CNS. The second major impact of the complete complement activation is the deposition of MAC at the senile plaques. Consistent with these notions, C1 q and MAC can be co-localised with amyloid plaques. In addition, complement gene expressions are upregulated in the AD brain.

Our data clearly show that that the inflammatory pathways are dysregulated in the brains of bad burrowers. This heightened level of pro-inflammatory cytokines and soluble factors such as complement proteins are likely to be pathogenic in O. degus, as is the case in human neurodegeneration.

EXAMPLE 5: Burrowing impairment in AD-like O. degus

The present invention introduces a novel behavioral approach to preclinical screening for AD based on characterizing the ADL of O. degus. Our results show that burrowing in O. degus appears to be sensitive to soluble Αβ accumulation during the early events of AD and could be of great value for investigation of the pathogenesis of AD.

Burrowing is a simple, cheap, easy to measure, sensitive, and objective ethological measure. It exploits a common natural rodent behavior, provides quantitative data under controlled laboratory conditions, and has proved extremely sensitive to degenerative diseases, drug administration, strain differences, and brain lesions.

A series of experiments have demonstrated that burrowing in rodents is easily and simply measured, and is extremely sensitive to hippocampal lesions and scrapie (prion disease) infection. To a reasonable extent, these conditions model AD; the hippocampus is one of the first brain areas to be affected in AD. Mice with near- complete lesions of the hippocampus showed that the effects of these cytotoxic lesions on burrowing capacity were consistent and reproducible. The histopathological damage to the hippocampus seen in affected degus provides a physiological/anatomical correlate of their impaired burrowing, given the large burrowing impairments seen in mice with hippocampal lesions. Hippocampal lesions profoundly impair many other species-typical behaviors in rodents. Such characterization has potentially wide- ranging implications, because many of these changes in species-typical behaviors are reminiscent of the impairments in ADL so characteristic of Alzheimer's disease.

The strong impairment produced by hippocampal lesions on burrowing, nesting and hoarding, all of which are species-typical behaviors, complements the impairments in spatial learning and memory, which are such well-established effects of these lesions. They appear to be equivalent to the impairments in the activities of daily living so characteristic of AD.

Since its inception, a question often asked about burrowing is: what does it mean or represent? Clearly it is a species-typical behavior, essential for (particularly small prey animals) to make a relatively safe place to hide, sleep, store food and raise young. In our protocol, however, the animals are presented with a burrow, they do not create an entirely new one, but simply empty the pre-supplied contents. The burrow size, moreover, is larger than the species generally digs in the natural habitat. A large burrow may act as a supra-normal stimulus, in the same way that Tinbergen observed that birds tend to prefer eggs that are larger than that particular species lays. Observations of mice in a naturalistic setting showed that, in springtime, piles of excavated material appeared around the entrances to the larger burrows. The mice were apparently "spring cleaning" removing detritus that might breed pathogens in the warmer weather. The analogy with AD is compelling; it is highly unlikely that an AD patient would spontaneously start a demanding task such as spring-cleaning.

Burrowing is a good measure of an animal's "mental" wellbeing in the same way as measuring the body's temperature may indicate systemic pathology. The fact that temperature is a non-specific measure of pathology does not deter clinicians from using this measure: if it is abnormal, there is something wrong with the patient. And if an animal does not burrow, while its peers do, then there is something wrong with that animal. This is why researchers are now using burrowing as a non-reflexive pain assay. Historically, reflexive techniques such as the hot plate, tail flick or toe pinch were used in analgesic assays. Burrowing, however, is spontaneous, not elicited bye completed noxious stimuli that generate defensive reflexes. As such, it measures what the animal is "feeling" in its brain or higher nervous system, rather than a largely spinal reflex (epitomized by the tail-flick assay).

Conclusions

Neurodegeneration, the gradual death of neurons is a consortium of processes that includes neuroinflammation, oxidative injury, immune response and accumulation of Αβ plaques in the brain. Learning the mechanisms that trigger this ensemble of molecular responses is of great interest for modern medicine. Furthermore, a behavioral response emerges in affected individuals as a result of these molecular processes. In humans, the first signs of neurodegeneration at a behavioral level are impairments of activities of daily living.

A window of opportunity exists to introduce truly effective disease-modifying treatment regimens between disease onset and cognitive decline in AD. Although challenges exist, significant progress has been made over the past 30 years. Animal models provide the means to study pathological processes in living animals, which may yield insights into disease mechanisms and also opportunities to test therapeutic agents. The present invention and the examples presented in the present document, confirm a natural neuropathology in O. degus, which develops with age with similar characteristics to AD at molecular, cellular and behavioral levels. The gene expression profile of affected O. degus confirms the same consortium of processes as human AD: neuroinflammation, oxidative injury, immune response and accumulation of Αβ plaques in the brain. These characteristics put O. degus in a singular position as a natural model for AD, a position practically unique in its type. O. degus offers the opportunity for investigating the ensemble of neurodegeneration mechanisms in natural living animals from early onset of the disease till its last stages. Further understanding of the ensemble of neurodegeneration mechanisms might hold the key to the pathogenesis of AD, and thus to new pharmacotherapy treatments, which might protect neurons from their maybe no longer inexorable death.

MATERIALS AND METHODS

Animals

Octodon degus (Rodentia: Octodontidae) of 3-6 months old were used in the studies. They were housed in standard metal cages 50 x 40 x 35 cm with a layer of wood shaving as bedding and containing a small metallic box (metallic box 25 x 15 x 10 cm with a single entrance), under natural photoperiod, in an air-conditioned animal room at the University of Chile. They were fed with rabbit pellet and alfalfa and provided water ad libitum during the entire experimental period. All procedures followed the recommendations of the ethics committee of the Faculty of Sciences of the University of Chile, and complied with Chilean regulations (Servicio Agricola y Ganadero - SAG) as well as recommendations by the Animal Behavior Society. A set of animals was used when they were three-year old.

Degus burrowing

Apparatus: Each burrow was a 30 cm long grey plastic cylinder, 10.5 cm diameter, the open end of the tube being raised 5 cm by bolting two 50 mm machine screws under it, 1 cm in from end, spaced just less than a quadrant of the tube apart, protruding like the undercarriage of a small aircraft. The lower end of the tube was closed with a grey plastic plug, fitted with two screws to bolt the tube to the end of the cage using wing nuts.

Procedure: We used the burrowing test which assesses the spontaneous burrowing behaviour of this semi-fossorial species. Briefly, we filled each burrow with 800 g food pellets (the rabbit diet pellets that the degus were used to eating (to avoid inducing any anxiety or neophobia) placed in a clean cage with a thin layer of bedding, a water bottle but no cage furniture. The closed end of the burrow was located on the floor and bolted to the back wall of the cage, as the degus would otherwise move it around. Each trial started at 9-10 am approximately, at the beginning of the degu normal activity cycle. An individual degu (not food deprived) was put into each burrowing test cage. After 2 h, the amount of food displaced from the burrow was measured. The test continued for another 4 h, making 6 h in total. The 2 h measurement is generally more sensitive than the 6 h one, the latter often suffering from a ceiling effect as almost all the food is displaced. With sensitivity, however, comes increased variability, hence the two measurements. Each degu was given three burrowing tests on separate days.

The degus seldom carried the pellets in their mouths, but actively pushed them out of the burrows with their hind feet; the topology is closely similar to the way they dig burrows in the wild. They typically face away from the open end of the tube, pulling pellets under or around their bodies with the front feet, then pushing them out with the back ones.

The 2 h and 6 h measures were compared separately, using pairwise control vs. treatment group comparisons, or an ANOVA for multi-group comparisons. The data, particularly for the 6 h measure, tended to be non-parametric, at least partially so, due to some ceiling effects (all the pellets emptied from the burrow). Therefore, for consistency, both the 2 h and 6 h data were compared using non-parametric tests (the Mann-Whitney U test for two groups or the Kruskal-Wallis one-way ANOVA for multiple groups) and the results expressed as medians, with the variability shown by the interquartile range.

MALDI-TOF MS Analysis

Tissue collection: Harvesting of the organ or tissue was performed in accordance with the appropriate local ethical guidelines, which is generally followed by freezing the tissue directly in liquid nitrogen after dissection, cooling on dry ice and storing at -80 °C until use.

Sample preparation: Using a surgical blade, frozen Degu brains were sectioned into right and left hemispheres. The right hemisphere containing cerebral cortex region was found to have β-amyloidal deposits. The obtained section was homogenized in 2 mL of ultrapure water by ultrasonication for 4 h. The supernatant liquid was isolated and lyophilized to get the solid sample. This was re-suspended into 200 μΙ_ of 0.1 % TFA solution, centrifuged at 3000 rpm for 10 min to get the concentrated sample.

Peptide enrichment: Concentrated samples were further processed using Zip-Tip pipette tips containing C18 or C4 media for enrichment of peptides prior to MS analysis. A Zip-Tip is a 10 μΙ_ pipette tip with a bed of chromatography media fixed at its end. This was performed mainly to concentrate the peptide sample by removing salts and interfering agents. Following are the steps that were performed with Zip-Tips C18 (Millipore). Activation of Zip-tip was done by aspirating 10 μΙ_ of Acetonitrile and dispensed to waste, then equilibration of the Zip-tip for binding was done by aspirating 10 μΙ_ of 0.1 % TFA in water and dispensed to waste, this process was repeated for 3 times. Then, concentration of the sample on the bed was done by aspirating 10 μΙ_ of the sample and dispense to the vial, this process was repeated 10 times for maximum binding of the complex mixture. Followed by washing the Zip-tip by 10 μΙ_ of 0.1 % TFA in water and dispensed to waste, this process was repeated at least 5 times to improve desalting efficiency. Finally elution of the sample onto the Anchor Chip target plate (Bruker Daltonics) was done with 1 μΙ_ of 50% ACN in 0.1 % TFA in water.

Matrix selection and preparation: For this analysis a-cyano-4-hydroxycinnamic acid was employed as matrix, which is appropriate for peptide masses < 10 KDa.

Matrix solution preparation: This solution was prepared as a 10 mg/mL solution; 10 mg of a-cyano-4-hydroxycinnamic acid (Sigma) was dissolved in 1 ml_ of 0.1 % TFA with 50% acetonitrile and sonicated in a water bath for 10 min. This solution was prepared freshly on the day of the experiment for every usage. For sample deposition the dried- droplet loading approach was used. To the freshly prepared 1 .5 μΙ_ of the a-Cyano-4- hydroxycinnamic acid matrix solution the sample solution was mixed in a micro centrifuge tube, vortex well and deposited directly on to the MALDI plate and left for air drying.

Ionization and detection: MALDI is capable of forming singly charged ions, but multiply charged ions [M + nH]n+ can also be created, as a function of the matrix, laser intensity and/or the voltage used. The obtained spectra were analyzed and the biomarkers of Alzheimer's disease were identified based on the theoretical masses of the concerned peptides.

The peak for the Αβ1 -42 peptide was assigned based on matching the measured molecular mass of the peak with the calculated molecular mass of Αβ1 -42 peptide based on the Degu Αβ1 -42 amino acid sequence. Normal processing of the mass spectra included smoothing of the local linear baseline subtraction and nonlinear regression peak fitting with a Lorentzian peak shape for quantification according to Bruker DataAnalysis 4.0 Software. qPCR procedure

Primer sequences were designed and analysed for specificity using the nucleotide BLAST and Primer-BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The primer sequences are detailed in supplementary data. The qPCR reaction consisted of 5μΙ Power SYBR Green MasterMix (Applied Biosystems), 75nM of forward and reverse primer and 500ng template cDNA in a 10μΙ final reaction volume. PCR was performed in a 7900HT Fast Real-Time PCR System (Applied Biosystems). The initiation steps involved 2' at 50°C followed by 10' at 95°C. The template was then amplified for 40 cycles, each cycle comprised of 15 sec at 95°C and V at 60°C. Samples were normalized using the expression of human 18S rRNA. Data was analyzed using the RQ Manager Version 1 .2.1 (Applied Biosystems). Ct (cycle threshold) values for each target gene were calculated and the relative expression of each target gene was calculated using the Relative Quantification (RQ) value, using the equation: RQ = 2- AAC\ for each target gene, and comparing relative expression with that of the 18S rRNA constitutive gene product. Assays were conducted in triplicate. Statistical analysis was performed using GraphPad Prism version 6.0 (GraphPad Software). An unpaired 2-side t-test was used to compare the data for any significant difference in expression. P values were computed and graphs compiled and analyzed. Gene Forward Primer Seq. Reverse Primer Seq.

18S ATGGCCGTTCTTAGTTGGTG CGCTGAGCCAGTCAGTGTAG

IL-1 β TCTTTGAAGTCGATGGCCCC CTCAAGTCGCCATCCTGGAA

IL-6 CTCGTGAAACCTGAGGCCAA CTCCCCATTTGACTCCGCAT

TNF-a AAGCCTGTAGCTCACGTTGT GTGAGCAGCAGGTAGGAGTG

GM-CSF GACCCAGCTGCTGTGATGAA AGGAAGTTTCTGGGGTTGGC

IFN-a ACAAATGAGGAGAATCTCCACTTT CTCCTGGGTCAGGCAGGCC

C1 q AGCAGCCAAAGAAGGTGGTT CACACATCCACATCGGGGAA

C3 CACTCAGGAGGCTGACGTTT CAACCTGTCCAGCATGGCTA

C4 CCCAGGTTGCTTCTTTTCGC GCTGAGGAGCTGGAAGTCTC

C5 GATCGAGCAGTGGATTGGCT GATGACTCCTCCTTGCTCGG

C9 ACAATGGTGACACAAGCCGA AGAGTGTTTCCACCCCAAGC

CFH AATGGAGTTCACCGCCTGAG AGACTGGTGGAGTGGACCAT

CFP TGCAACACAACTGTGCCTTG AGCAGTGTCGGATTTCCTGG

APOE GTCACGCTTCTGGCAGGAT GTCAGTTCCTGGGTGACCTG

APP TCCAGCCATGGCATCCTTTT ATACCCTGAGTCGTGTCGGA

NFE2L2 CTTGGGGCAAGTCGAGAAGT TGACTGGATGTGCTGAGCTG

PPARa GAGAGCCCCCTGTCTGAGTA GGGTAAATGACGGAGGACGG

Statistical Analysis: Statistical analysis was performed using GraphPad Prism version 6.0 (GraphPad Software). An unpaired 2-side t-test was used to compare the means of the cytokine targets with and without serum for any significant difference in expression. P values were computed and graphs compiled and analyzed.

INDUSTRIAL APPLICABILITY

The present invention has application in the pharmaceutical industry for drug screening, more particularly for evaluating or discriminating the likelihood that an individual might develop an AD-like neuropathology.