Field of the invention

The present invention relates to methods for amplifying nucleic acids, such as by polymerase chain reaction (PCR), and applications therefor.

Background of the Invention

General

This specification contains nucleotide and amino acid sequence information prepared using Patentln Version 3.3. Each nucleotide sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (e.g.

<210>l, <210>2, <210>3, etc). The length and type of sequence (DNA, protein (PRT), etc), and source organism for each nucleotide sequence, are indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide sequences referred to in the specification are defined by the term "SEQ ID

NO:", followed by the sequence identifier (eg. SEQ ID NO: 1 refers to the sequence in the sequence listing designated as <400>l).

The designation of nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine,

C represents Cytosine, G represents Guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents Adenine or Cytosine, K represents Guanine or Thymine, S represents Guanine or Cytosine, W represents

Adenine or Thymine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue.

As used herein the term "derived from" shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers.

Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.

Each embodiment described herein is to be applied mutatis mutandis to each and every other embodiment unless specifically stated otherwise.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.

The present invention is performed without undue experimentation using, unless otherwise indicated, conventional techniques of molecular biology, microbiology, virology, recombinant DNA technology, peptide synthesis in solution, solid phase peptide synthesis, and immunology. Such procedures are described, for example, in the following texts that are incorporated by reference: i. Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Second Edition (1989), whole of VoIs I, II, and ffl; ii. DNA Cloning: A Practical Approach, VoIs. I and II (D. N. Glover, ed., 1985),

IRL Press, Oxford, whole of text; iii. Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed., 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, ppl- 22; Atkinson et al, pp35-81; Sproat et al, pp 83-115; and Wu et al, pp 135-

151;

iv. Nucleic Acid Hybridization: A Practical Approach (B. D. Hames & S. J.

Higgins, eds., 1985) IRL Press, Oxford, whole of text; v. Perbal, B., A Practical Guide to Molecular Cloning (1984); vi. Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.), whole of series;

Description of the related art

Since their development, nucleic acid amplification techniques have become key tools for gene cloning, gene expression analysis, diagnosis, identification of samples (e.g., for animal breeding or identification of a crop plant), identification of individuals (e.g., forensic identification, maternity testing, paternity testing, marker assisted breeding and other breeding programs) and gene mapping. Generally, these amplification techniques are used to detect a nucleotide sequence variation that forms a basis for genetic diversity between organisms and that contributes to a phenotype of an organism (e.g., a quantitative trait). For example, amplification techniques are used to detect a genetic marker such as, for example, a single nucleotide polymorphism (SNP) or a simple sequence repeat (SSR) (e.g., a dinucleotide repeat or a trinucleotide repeat) that is associated with a phenotype of interest.

The number of known/characterised genetic markers is rapidly expanding. For example, as at January 2005 there were about 5x10 ⁶ validated SNPs in the human genome, about 4xlO ⁴ SNPs in the wheat genome and about 2xlO ⁴ SNPs in the rice genome. With this increase in number of markers there is an associated increase in the number of markers that are associated with a particular phenotype. As a consequence, this has lead to a demand for assays that enable rapid and inexpensive detection of a large number of genetic markers.

Several of the most common techniques currently used for amplification and analysis of genetic markers use a polymerase (such as, for example, a DNA polymerase and/or a RNA polymerase) to replicate a nucleic acid template using, for example, a polymerase chain reaction (PCR; e.g., Saiki et al, Science 230:1350, 1985). These methods are useful for amplifying nucleic acid from DNA, DNA/RNA hybrid or RNA and/or for determining the nucleotide sequence of a specific nucleic acid (e.g., by sequencing, allele specific PCR or primer extension). Generally, a polymerase mediated replication technique uses a primer (e.g., a short oligonucleotide) capable of selectively annealing to a nucleic acid template to provide the binding site for the polymerase to initiate

replication. By iteratively annealing the primer and replicating the nucleic acid template of interest, the nucleic acid is amplified.

A standard PCR involves annealing paired oligonucleotides to opposite strands of a double stranded nucleic acid to thereby define the limits of the region to be amplified.

These oligonucleotides provide the site of binding for a polymerase and initiate replication of the defined region. The nucleic acid template is amplified by sequential rounds of primer annealing and polymerase-mediated replication. PCR provides an advantage in that it facilitates exponential amplification of a nucleic acid by virtue of the ability of the primers to anneal to and initiate amplification of previously replicated nucleic acid.

Numerous variations and modifications of the standard PCR protocol are known. For example, by reverse transcribing RNA (e.g., using a reverse transcriptase) prior to amplification using PCR, nucleic acid corresponding to RNA is amplified. Additional PCR variants include, for example, allele specific PCR, competitive PCR and nested PCR.

PCR is suitable for the amplification and analysis of genetic markers and in applications related thereto such as, for example, identification of individuals, paternity testing, maternity testing, plant breeding, animal breeding, diagnostic, prognostic and therapeutic applications.

While a single polymerase mediated amplification reaction is often sufficient to analyze a single genetic marker or even a small gene or transcript, several reactions are required to conduct analysis at the genomic level or even to analyze a large gene. Accordingly, the analysis of a number of genetic markers is both time consuming and expensive. To overcome this problem, Chamberlain et ah, Nucl. Acids Res., 16: 11141-11156, 1988, performed a single PCR reaction comprising multiple primer sets (i.e., multiplex PCR) to simultaneously analyze multiple loci in the human dystrophin gene.

Essentially, multiplex PCR is a PCR wherein a plurality of primer sets is employed, each set capable of amplifying nucleic acid from a different locus. Primer sets that are likely to anneal to and initiate amplification of their respective target nucleic acids under similar conditions are selected for use in a multiplex reaction to ensure that each

nucleic acid template is amplified. The PCR is then performed under a single set of conditions and nucleic acid from each locus amplified.

Selection of multiplex primers Generally, primers that are capable of use in a multiplex reaction anneal to their nucleic acid template at approximately the same temperature, i.e., the melting temperature (Tm) of each primer is the same or about the same. Methods for determining the Tm of a given nucleic acid sequence are known in the art and include, for example, the Wallace Rule that relies on the G+C and A+T content of the nucleic acid being analyzed (Wallace et al, Nucleic Acids Res. 6, 3543, 1979). Alternatively, the nearest neighbour method is used to estimate the Tm of a primer (Howley, et al, J. Biol. Chem. 254, 4876, Santa Lucia, Proc. Natl. Acad. ScL USA, 95: 1460-1465, 1995 or Bresslauer et al, Proc. Natl. Acad. Sd. USA, 83: 3746-3750, 1986). Should the primer comprise one or more nucleotide analogues, such as, for example, 2-aminoglycine (peptide nucleic acid - PNA) the method of Giesen et al, (Nucl. Acids Res., 26: 5004-5006) is useful for determining the Tm of the primer. Those primers having the same or similar Tm are selected for further analysis to determine their suitability for use in a multiplex reaction.

Primers that are unlikely to self dimerize or do not comprise a region of self- complementarity are also selected. A region of self-complementarity results in formation of secondary structure in the single stranded primer, or enables a primer to anneal to another copy of itself such that it forms a primer dimer that is able to extend during amplification. In either case, the ability of the primer to selectively anneal to a nucleic acid template is reduced. To determine whether or not a primer comprises regions of self complementarity the sequence of the primer is incrementally overlapped and the presence of base-pairing determined. Those primers with a reduced probability of self-dimerization are selected.

A similar screen is used to determine a primer that does not bind to other primers used in a multiplex reaction. Such binding of primers in an amplification reaction leads to the formation of primer dimers thereby reducing the ability of each primer to selectively anneal to a target nucleic acid.

Primer length is also a consideration in determining a primer suitable for a multiplex reaction. Primers useful for multiplex must be of sufficient length to anneal to a

nucleic acid template. While shorter primers are known to anneal to a plurality of sites in a nucleic acid due to non-specific annealing, increasing primer length does not indefinitely increase primer specificity (Burpo, Biochemistry, 218: 1 -11, 2001). Rather, primers of approximately 18 to 30 nucleotides in length are generally considered to be of sufficient length to enable selective annealing to a target nucleic acid.

Notwithstanding that the majority of the parameters for design of a primer may be estimated using in silico techniques, each primer must also be tested empirically to ensure its suitability for use in a multiplex reaction.

It will be apparent to the skilled artisan that significant time and resources must be expended to produce primers useful for even a single multiplex format reaction.

Moreover, multiplex PCR is frequently complicated by the occurrence of artefacts, such as, the amplification of spurious products resulting from non-specific annealing of the primers to template nucleic acid. Furthermore, competition between primers for polymerase binding and nucleic acid amplification has been shown to reduce the yield of PCR ρroduct(s) (Edwards et al, PCR Methods Applic. 3: S65-S75). As a consequence of these and other difficulties, a multiplex PCR generally requires a significant level of time-consuming and costly optimization. Once optimized, only about 10 markers are amplified in any single multiplex PCR (Edwards et al, supra).

Furthermore, as additional primers are added to a multiplex PCR, the reaction components (e.g., Mg ²⁺ , dNTP and/or polymerase type or concentration) and amplification conditions (e.g., annealing temperature and extension time) generally require adjustment (Edwards et al, supra).

Shuber et al, Genome Research 5: 488-493, 1995, addressed the complexity of multiplex PCR, by employing sets of chimeric primers, each of which comprised a region capable of annealing to the nucleic acid template and a 5 '-tag region comprising an unrelated nucleotide sequence (i.e., a "universal tag" comprising a sequence common to all primers of a particular set). Using such chimeric primers, Shuber et al. amplified several genetic markers in a single reaction with little optimization of PCR conditions. The authors suggest that the enhanced specificity and efficiency was due to a normalization of annealing kinetics of the primers to amplified nucleic acid as a result

of the 5'-tag. However, Shuber et al. conceded that a significant concern with the use of the chimeric primers throughout the PCR was the production of spurious amplification products caused by non-specific annealing of the primers to template nucleic acid. Furthermore, the presence of the chimeric primers throughout amplification has been reported to cause the formation of primer dimers (Rudi et al, Nucl. Acids Res. 31: e62, 2003).

Belgrader et al, Genome Science and Technology 1: 77-85, 1996, discloses the use of combinations of chimeric primers and universal primers (i.e., primers consisting of the sequence of the universal tag). According to Belgrader et al, a plurality of sets of chimeric primers is used to amplify alleles of interest in a multiplex reaction and amplification products then amplified further in a separate reaction vessel using the universal primers. The second reaction is effectively a nested PCR in which the primary amplification products are amplified in a "singleplex" reaction. This method is believed to reduce background associated with previous multiplex reaction formats. However, the method of Belgrader et al, suffers from several disadvantages associated with using multiple distinct PCR reactions, such as, for example, the risk of contamination due to increased sample handling (as a result of the use of two distinct reactions). Moreover, as multiple distinct reactions are performed using the different primer types, additional reaction components (e.g., Mg ²⁺ , dNTP and/or polymerase) are required, thereby increasing costs. Similarly, the different reactions generally require different amplification conditions (e.g., annealing temperature and extension time) and optimization.

Oetting et al, Genomics, 30: 450-458, 1995, discloses a method known as Multiplexing Short Tandem Repeat Polymorphisms with Tailed Primers (MSTP), which method employs a chimeric primer and an additional primer comprising the sequence of the universal region of the chimeric primer. MSTP comprises performing an amplification reaction using the chimeric primer, a second primer capable of annealing to the nucleic acid template, and a universal primer that anneals to the universal region of the chimeric primer at a lower temperature than the Tm of the chimeric primer or the second primer. An initial reaction is performed wherein the chimeric primer and the second primer amplify the nucleic acid template and the annealing temperature is then reduced to permit the amplification product to be further amplified using the universal primer and the second primer. Significant optimization of primer concentration, magnesium concentrations and annealing temperatures is required. Accordingly, this

method is not suitable for simple or rapid application to a new multiplex reaction. Furthermore, non-specific amplification may occur frequently in the second stage of the amplification reaction, because the second primer is required to anneal at a temperature substantially lower than its Tm.

Thus, notwithstanding the advances in methods for amplifying nucleic acid (e.g., for the detection of polymorphic nucleic acid), particularly in a multiplex format, it is clear that these methods suffer from several disadvantages, such as, for example, the requirement for significant optimization, risk of contamination and/or increased expense. Accordingly, it is clear that there is a need in the art for a rapid and inexpensive assay that enables amplification of one or more nucleic acids of interest with minimal sample handling. Such an assay would have clear utility in, for example, diagnosis of a condition and/or the identification of an individual or group thereof.

Summary of the Invention

In work leading up to the present invention, the present inventors sought to produce a multiplex PCR assay that facilitates the specific amplification of a number of nucleic acids of interest in a single closed-tube reaction, thereby reducing costs and risks of contamination associated with the use of multiple distinct reactions. By "closed-tube" is meant that reagents for all amplification reactions or stages, e.g., primers, enzyme, buffers, are present throughout said reactions or stages. Such a process would have utility as a low-cost high-throughput process.

As exemplified herein, the present inventors have found that in a single closed-tube PCR it is possible, in a first round, to specifically amplify nucleic acid at a locus of interest using an amount of tagged locus-specific primers suitable for performing exhaustive PCR (i.e., such that there is little or substantially no primer remaining after amplification). In a second round the first round amplification product is then amplified using tag primers having lower Tm than the tagged locus-specific primers and annealed to the incorporated tag sequence in said first round amplification product at a lower annealing temperature than used in the first round. The inventors have demonstrated the efficacy of this method for multiplex PCR, by showing that it is possible to detect simple sequence repeats in nucleic acid from wheat, barley, apricot, cherry, cattle, sheep and a fungus.

The present inventors have also demonstrated the robust nature of this amplification method by amplifying nucleic acid from DNA isolated using a harsh method likely to produce degraded DNA. Furthermore, the method produced by the inventors facilitates amplification of nucleic acid from various concentrations of template DNA.

Accordingly, the present invention provides a method for amplifying nucleic acid comprising:

(i) providing > in a reaction vessel reagents suitable for performing Polymerase

Chain Reaction (PCR) comprising: (a) amount(s) of one or more first primer(s) or set(s) of first primers sufficient to permit amplification of a nucleic acid template without substantial residual unincorporated primer, wherein each first primer comprises a locus-specific sequence capable of annealing to the nucleic acid template at a first temperature and a tag sequence that does not anneal to the nucleic acid template; and (b) a second primer or set of second primers wherein each second primer comprises a sequence capable of annealing to a nucleic acid comprising a sequence complementary to a portion of a first primer comprising the tag sequence and wherein each second primer has a melting temperature (Tm) lower than the Tm of the first primer and is not capable of annealing substantially to the first primer or nucleic acid template at the first temperature;

(ii) performing PCR under conditions sufficient to amplify the nucleic acid template thereby producing an amplification product, wherein said conditions comprise an annealing temperature suitable for annealing of the first primer or set of first primers but not detectably of the second primer or set of second primers, and a sufficient number of amplification cycles for the primer(s) to be substantially incorporated into the amplification product with little or no residual unincorporated primer; and

(iii) performing PCR under conditions sufficient to amplify the amplification product at (ii), wherein said conditions comprise an annealing temperature suitable for annealing of the second primer or set of second primers.

As used herein, the term "PCR" or "polymerase chain reaction" shall be taken to mean an amplification reaction employing multiple cycles of (i) denaturation of double- stranded nucleic acid such as a nucleic acid "template" to be amplified or a hybrid between a "template" and a complementary "primer"; (ii) annealing of a primer to its complementary sequence in the single-stranded "template"; and (iii) extension of the

primer in the 5'- to 3'- direction by a polymerase activity e.g., an activity of a thermostable polymerase, such as, Taq, to thereby produce a double-stranded nucleic acid comprising a newly-synthesized strand complementary to the single-stranded template. By utilizing two primers capable of annealing to the complementary strands in the double-stranded template (i.e., to each denatured single-stranded template), multiple copies of the template are produced in each cycle, thereby amplifying the template. Many formats of PCR are known in the art including, for example, one- armed (or single-primer) PCR, reverse-transcriptase mediated PCR (RT-PCR), nested PCR, touch-up and loop incorporated primers (TULIP) PCR, touch-down PCR, competitive PCR, rapid competitive PCR (RC-PCR), and multiplex PCR. Preferably, the amplification reaction is a multiplex PCR.

In the present context, the term "annealing" or similar term shall be taken to mean that a primer and a nucleic acid to be amplified (i.e., template or primary amplification product) are base-paired to each other to form a double-stranded or partially double- stranded nucleic acid, using a temperature or other reaction condition known in the art to promote or permit base-pairing between complementary nucleotide residues. As will be known to the skilled artisan, the ability to form a duplex and/or the stability of a formed duplex depend on one or more factors including the length of a region of complementarity between the primer and nucleic acid to be amplified, the percentage content of adenine and thymine in a region of complementarity (i.e., "A+T content"), the incubation temperature relative to the melting temperature (Tm) of a duplex, and the salt concentration of a buffer or other solution in which the amplification is performed. Generally, to promote annealing, the primers and nucleic acid to be amplified are incubated at a temperature that is at least about 1-5°C below a primer Tm that is predicted from its A+T content and length. Duplex formation can also be enhanced or stabilized by increasing the amount of a salt (e.g., NaCl, MgCl ₂ , KCl, sodium citrate, etc) in the reaction buffer, or by increasing the time period of the incubation, as described by Sambrook et al., Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory Press ; Hames and Higgins, Nucleic Acid Hybridization: A Practical Approach, IRL Press, Oxford (1985); Berger and Kimmel, Guide to Molecular Cloning Techniques, In: Methods in Enzymology, VoI 152, Academic Press, San Diego CA (1987); or Ausubel et al, Current Protocols in Molecular Biology, Wiley Interscience, ISBN 047150338 (1992).

The "template" may comprise DNA, RNA or RNA/DNA with or without any nucleotide analogs therein including single-stranded or double-stranded genomic DNA, mRNA or cDNA. The present invention is not limited by the nature or source of the template nucleic acid. The template nucleic acid can be derived directly or indirectly from an organism, in a tissue or cellular sample obtained previously from an organism, or present in an aqueous or non-aqueous extract of a tissue or cellular sample. For example, the present invention is particularly useful for amplifying genetic markers. Accordingly, in one embodiment, the nucleic acid template comprises one or more genetic markers, such as, for example, a SNP, a simple nucleotide polymorphism, a short tandem repeat or a polynucleotide repeat (e.g., a trinucleotide repeat or a pentanucleotide repeat). Additional suitable nucleic acid templates are described herein.

As will be known to the skilled artisan, a "primer" is a nucleic acid molecule comprising any combination of ribonucleotides, deoxyribonucleotides and analogs thereof such that it comprises DNA, RNA or DNA/RNA with one or more ribonucleotide or deoxyribonucleotide analogs contained therein, and capable of annealing to a nucleic acid template to act as a binding site for an enzyme, e.g., DNA or RNA polymerase, thereby providing a site for initiation of replication of a specific nucleic acid in the 5' to 3' direction. The nucleotide sequence of a primer is generally substantially complementary to the nucleotide sequence of a template nucleic acid to be amplified, or at least comprises a region of complementarity sufficient for annealing to occur and extension in the 5' to 3' direction there from. However, as will be apparent to the skilled artisan a degree of non-complementarity will not significantly adversely affect the ability of a primer to initiate extension. Suitable methods for designing and/or producing a primer suitable for use in the method of the invention are known in the art and/or described herein. Primers are generally, but not necessarily, short synthetic nucleic acids of about 12-50 nucleotides in length. Preferably, the first primer or each primer of the set of first primers comprises at least about 12-15 nucleotides in length capable of annealing to a strand of the nucleic acid template. Primers may also comprise at least about 20 or 25 or 30 nucleotides in length capable of annealing to a strand of the template.

The term "set" with reference to a "set of first primers" or a "set of second primers" ^" or more generally to a "set of primers" shall be taken to mean a number of primers having different, albeit not necessarily entirely different, sequences. A preferred set of primers

will comprise primers that are capable of annealing to and priming the amplification of different amplicons from one or more template molecules. By "amplicon" is meant an amplified sequence, which may be nucleic acid comprising a short tandem repeat sequence, single nucleotide polymorphism (SNP), microsatellite marker, intron, promoter, open reading frame, or whole gene. A set of first primers may be distinct from a second primer or set of second primers by virtue of their different Tm values and the prohibition on the second primer or set of second primers participating in the first round of amplification. Preferred sets of primers will comprise at least 2-5 primers, or 5-10 primers or 10-15 primers or 15-20 primers or 20-50 primers or even as many as 100 primers in a single reaction vessel.

The amount of a first primer or set of first primers sufficient to permit amplification of a nucleic acid template without substantial residual unincorporated primer is generally determined empirically without undue experimentation. For example, the amount of residual unincorporated primer is determined by performing a series of reactions with different primer concentrations and otherwise identical reaction conditions and determining a primer concentration for which there is little or substantially no residual unincorporated primer. It will be understood in the art that "residual unincorporated primer" means the amount of primer remaining following an amplification reaction comprising a predetermined set of conditions e.g., number of cycles, duration of extension reaction, nucleotide concentration, etc. The term "without substantial residual unincorporated primer" means that the amount of residual unincorporated primer is not sufficient to promote primer amplification in a subsequent round of amplification that is detectable using a detection means, e.g., an amplification reaction, e.g., an amplification reaction performed using the second primer or set of second primers. Accordingly, any unincorporated first primer(s), if present on termination of the first round of amplification, is not in an amount sufficient to be amplified to a detectable level using the second primer(s).

A preferred amount or concentration of first primer is between about 7.5nM and about 25OnM (e.g., about 23nM or about 3OnM or about 4OnM or about 8OnM), more preferably between about 2OnM and about 20OnM, even more preferably between about 5OnM and about 15OnM and still more preferably between about 75nM and about 10OnM. In one embodiment, a limiting amount of a primer is about 23nM of primer or about 3OnM of primer or about 4OnM of primer or about 8OnM of primer.

Preferably, each first primer and each second primer is present in an amount suitable for performing exhaustive PCR, i.e., an amount of primer(s) and number of amplification cycles sufficient for the primer(s) to be substantially incorporated into the amplification product with (or "leaving") little or no residual unincorporated primer. Without being bound by any theory or mode of action, such amounts of both primer sets produce approximately equivalent levels of PCR product in the first and second rounds thereby facilitating detection of the amplified products using a standard detection means, e.g., a semi-automated DNA fragment analyser.

When each second primer is also present in an amount suitable for performing exhaustive PCR, e.g., to control product formation, it is preferred for the primer(s) to be present in an amount of about 7.5 nM to about 500 nM, more preferably, about 50 nM to about 400 nM, even more preferably about 75 nM to about 250 nM and still more preferably about 75 nM to about 200 nM. In a particularly preferred embodiment, a second primer is present at a concentration of about 75nM or 10OnM, 20OnM, 30OnM or 40OnM.

By "locus-specific sequence" is meant a nucleotide sequence complementary to a template nucleic acid being amplified, irrespective of the nature or formulation of said nucleic acid (e.g., it may be intact or fragmented genomic DNA, RNA or a pool thereof, or a library of DNA or cDNA fragments, etc). Preferably, a locus-specific sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 15 to 54 or 57 to 5345. As exemplified herein, a locus specific sequence useful for amplifying nucleic acid from wheat and/or barley comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 57 to 5056; a locus specific sequence useful for amplifying nucleic acid from a Prunus spp., e.g., apricot or cherry, comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 5057 to 5264; a locus specific sequence useful for amplifying nucleic acid from a mammal, e.g., cattle or a sheep comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 5265 to 5294; or a locus specific sequence useful for amplifying nucleic acid from a fungus, e.g., Rhynchosporium secalis comprises a nucleotide sequence set forth in SEQ ID NOs: 5295 to 5342.

By "tag sequence" is meant a sequence other than a locus-specific sequence. The tag region provides for enhanced specificity of the first primer or set thereof, and a template within the amplicon of the first amplification round to which the second

primer or set of second primers anneals. Accordingly, it is preferable that the tag region comprises sufficient nucleotides for a primer to selectively anneal to and produce an amplification product in an amplification reaction. For example, the tag region is at least about 12 nucleotides in length, preferably at least about 15 nucleotides in length, more preferably at least about 17 nucleotides in length and still more preferably at least about 19 nucleotides in length. In an exemplification of the invention, the inventors have used a tag sequence of about 19 or 20 nucleotides in length.

By way of example, a tag sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 14. Preferably, the tag sequence comprises a nucleotide sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 14.

Wherein multiple tags are employed, the present invention clearly encompasses the use of the same or different tags on each of the primers, e.g., use of the same or a different set of primers. For example, a primer annealing to a strand of the nucleic acid template may comprises one tag and a primer annealing to the other strand of the nucleic acid template may comprise a different tag. Similarly, tags are employed on first and second primers or sets thereof to monitor first and second round amplifications, respectively. It is also within the scope of the invention to employ first primers annealing to one strand of the template that each comprise one tag, first primers annealing to the other stand of the template that each comprise another tag, to thereby provide substrates for annealing of a set of second primers. Alternatively, a variety of tags is employed and specific first round amplicons are amplified using tag specific primer/s.

It will be apparent from the preceding description that the "portion" of the first primer to which the second primer(s) anneal will comprise a sequence complementary to all or part of the tag sequence in the first primer, and optionally one or more nucleotides complementary to the locus-specific sequence. The present invention is not to be limited by the precise alignment of the first and second primers with respect to the tag sequence provided that the second primer is capable of priming the amplification of an amplicon torn the product of the first amplification round (i.e., the product amplified by priming with a first primer).

By way of example, a second primer comprises a nucleotide sequence comprising at least 10 consecutive nucleotides of a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 14. For example, the second primer comprises a nucleotide sequence comprising at least 11 nucleotides of a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 14. For example, the second primer comprises a nucleotide sequence comprising at least 12 nucleotides of a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 14. For example, the second primer or set thereof comprises a nucleotide sequence set forth in SEQ ID NO: 55 or 56.

In another embodiment, a second set of primers comprises a primer comprising a nucleotide sequence set forth in SEQ ID NO: 55 and a primer comprising a nucleotide sequence set forth in SEQ ID NO: 56.

Preferably, one or more primers is labelled with a detectable ligand, such as, for example a radioactive label, fluorescent molecule, dye, etc. Preferably, one or more of the second primers is labelled with a detectable ligand. For example, by incorporating a dye-label into one of the tag primers, a second round amplification product is labelled thereby enabling rapid detection of amplified nucleic acid e.g., using a DNA fragment analyzer. Such rapid detection is clearly useful for high throughput analyses.

The absence of detectable annealing of the second primer or set of second primers to the template is determined empirically e.g., by the appearance of a correct amplification product following a first round amplification or alternatively by the absence of detectable amplification of template using a second primer or set thereof. This selectivity is partially attributed to the fact that the first primer or set thereof has a greater predicted melting temperature (Tm) than the second primer or set thereof. Preferably, the first primer or set thereof has a Tm at least about 1O ⁰ C greater than that of the second primer or set thereof. More preferably, the first primer or set thereof has a Tm at least about 15 ⁰ C or 18 ⁰ C or 2O ⁰ C greater than that of the second primer or set thereof. Methods for determining the Tm of a primer are known in the art and/or described herein.

Preferably, the difference between the first temperature and the temperature at which the second primer(s) is(are) annealed is at least about 8 ⁰ C or 9 ⁰ C or 1O ⁰ C or 15 ⁰ C. For example, a temperature of 63 ⁰ C can be employed to anneal a first primer and a temperature of 54 ⁰ C employed to anneal a second primer (i.e., a difference of 9 ⁰ C).

It will be apparent that the plurality of amplification reactions are performed in a reaction vessel (i.e., the samples are not transferred to a separate vessel between the amplification reactions). The term "reaction vessel" shall be construed in its broadest context to include any standard vessel suitable for performing a PCR, such as, for example, a reaction tube (such as, for example, an Eppendorf tube, a polypropylene tube, a glass tube or a glass/plastic composite tube), capillary, microtitre well, or a solid substrate such as a glass slide, microarray matrix, or tissue slice.

The term "providing in a reaction vessel" shall be taken to include the supply of one or more reaction vessels with reagents therein, or alternatively, the provision of a reaction vessel with any number of reagents therein, and separately one or more reagents, with instructions for their combination. Preferably, at least the primers are provided in a reaction vessel, or alternatively, provided separately with instructions for their combination.

The skilled artisan will be aware of reagents suitable for performing PCR, such as, for example, primers, template nucleic acid, ribonucleotide triphosphates and/or deoxyribonucleotide triphosphates or analogs thereof, an appropriate reaction buffer, and a polymerase enzyme (e.g., a thermostable polymerase). Other reaction components known to the skilled artisan are not excluded.

The term "deoxyribonucleotide" is an art-recognized term referring to those bases of DNA each comprising phosphate, deoxyribose and a purine or pyrimidine base selected from the group consisting of adenine (A), cytidine (C), guanine (G) and thymine (T). In the triphosphate form, deoxyribonucleotide triphosphates (dNTPs), e.g., dATP, dCTP, dGTP and dTTP, are capable of being incorporated into DNA by an enzyme of DNA synthesis e.g., a DNA polymerase.

The term "ribonucleotide" is an art-recognized term referring to those bases of RNA each comprising a purine or pyrimidine base selected from the group consisting of adenine (A), cytidine (C), guanine (G) and uracil (U) linked to ribose. Ribonucleotides are capable of being incorporated into RNA by an enzyme of RNA synthesis e.g., an RNA polymerase.

In the present context, the term "analog" means a compound having a physical structure that is related to a ribonucleotide or deoxyribonucleotide and preferably is capable of forming a hydrogen bond with a ribonucleotide or deoxyribonucleotide residue or an analog thereof (i.e., it is able to anneal with the ribonucleotide or deoxyribonucleotide residue or an analog thereof to form a base-pair). Such analogs may possess different chemical and biological properties to the ribonucleotide or deoxyribonucleotide residue to which they are structurally related. Methylated, iodinated, brominated or biotinylated residues are particularly preferred, however other analogs may also be used.

Preferably, no additional components are added to the reaction vessel after amplification of the template has commenced and the reaction volume is not modified by the addition or subtraction of any reagents after this point. This feature of the invention avoids or reduces contamination problems associated with excessive sample handling.

In a preferred embodiment, the present invention further comprises combining reagents suitable for performing PCR in a reaction vessel, and more particularly, combining an amount of a first primer or set of first primers sufficient to permit amplification of a nucleic acid template without substantial residual unincorporated primer, and a second primer or set of second primers in a reaction vessel.

The present invention may further comprise providing the nucleic acid template, for example, in the form of a biological sample derived from a subject. Preferably, the biological sample is isolated previously from the subject being characterised.

In a preferred embodiment, the present invention further comprises producing and/or synthesizing a first primer and/or a second primer or set thereof. Methods for the production and/or synthesis of primers are well-known in the art and/or described herein.

In a preferred embodiment, the present invention further comprises detecting the amplified nucleic acid using a detection means e.g., electophoresis or mass spectrometry. Exemplary detection means include hybridization (e.g., hybridization of a nucleic acid, peptide nucleic acid (PNA) or locked nucleic acid (LNA) probe), or amplification (e.g., allele specific PCR, a ligase chain reaction, a rolling circle

amplification, a transcription mediated amplification (TMA), a nucleic acid sequence based amplification (NASBA) or a Q-beta replicase mediated amplification).

As exemplified herein, the present invention is useful for amplifying a single nucleic acid template or, alternatively, a plurality of nucleic acids, e.g., in a multiplex format.

Preferably, the present invention provides a method for amplifying nucleic acid comprising:

(i) providing in a reaction vessel reagents suitable for performing Polymerase Chain Reaction (PCR) comprising: (a) amount(s) of one or more first primer(s) or set(s) of first primers sufficient to permit amplification of a nucleic acid template without substantial residual unincorporated primer, wherein each first primer comprises a locus-specific sequence capable of annealing to the nucleic acid template at a first temperature and a tag sequence comprising a nucleotide sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 14; and (b) a second primer or set of second primers wherein each second primer comprises a nucleotide sequence set forth in SEQ ID NO: 55 or SEQ ID NO: 56, wherein each second primer has a melting temperature (Tm) lower than the Tm of the first primer and is not capable of annealing substantially to the first primer or nucleic acid template at the first temperature;

(ii) performing PCR under conditions sufficient to amplify the nucleic acid template thereby producing an amplification product, wherein said conditions comprise an annealing temperature suitable for annealing of the first primer or set of first primers but not detectably of the second primer or set of second primers, and a sufficient number of amplification cycles for the primer(s) to be substantially incorporated into the amplification product with little or no residual unincorporated primer; and

(iii) performing PCR under conditions sufficient to amplify the amplification product at (iϊ), wherein said conditions comprise an annealing temperature suitable for annealing of the second primer or set of second primers.

The present inventors have clearly demonstrated the applicability of the present invention to multiplex amplification, in particular, multiplex PCR amplification of nucleic acids. Accordingly, the present invention provides a method for multiplex amplification of nucleic acid comprising performing the method described herein according to any embodiment using amount(s) of sets of first primers and set(s) of

second primers and performing the PCR under conditions sufficient to amplify a plurality of nucleic acids. For example, the present invention provides a method for multiplex amplification of nucleic acid comprising:

(i) providing in a reaction vessel reagents suitable for performing Polymerase Chain Reaction (PCR) comprising: (a) amount(s) of one or more set(s) of first primers sufficient to permit amplification of a plurality of nucleic acid templates without substantial residual unincorporated primers, wherein each first primer comprises a locus-specific sequence capable of annealing to a nucleic acid template at a first temperature and a tag sequence that does not anneal to the nucleic acid template; and (b) a set of second primers wherein each second primer comprises a sequence capable of annealing to a nucleic acid comprising a sequence complementary to a portion of a first primer comprising the tag sequence and wherein each member of the set of second primers has a melting temperature (Tm) lower than the Tm of each member of the set of first primers and is not capable of annealing substantially to members of the set of first primers or the plurality of nucleic acid templates at the first temperature;

(ii) performing PCR under conditions sufficient to amplify the plurality of nucleic acid templates thereby producing amplification products, wherein said conditions comprise an annealing temperature suitable for annealing of the members of the set of first primers but not detectably of the members of the set of second primers, and a sufficient number of amplification cycles for the primers to be substantially incorporated into the amplification product with little or no residual unincorporated primers; and

(iii) performing PCR under conditions sufficient to amplify the amplification products at (ii), wherein said conditions comprise annealing temperature(s) suitable for annealing of members of the set of second primers.

Optionally, the subject method additionally comprises performing PCR under conditions sufficient to amplify nucleic acid prior to (ii) wherein said conditions comprise an annealing temperature suitable for members of both the first and second sets of primers to anneal to a nucleic acid template. For example, a temperature of about 5O ⁰ C may be employed and a small number of amplification cycles (e.g., 1 to 5 cycles) carried out. Such amplification is useful for ensuring amplification of all template nucleic acids despite using first primers each with a different Tm.

In one embodiment, a plurality of primers in the first set of primers comprises the same tag sequence. For example a subset of the first set of primers comprises the same tag sequence. For example, a subset of the first set of primers in the first set of primers comprises a first tag sequence and a subset of primers in the first set of primers comprises a second tag sequence.

Alternatively, each primer in the first set of primers or all primers in the first set of primers comprises the same tag sequence.

The present invention additionally provides a method for the multiplex amplification of nucleic acid comprising:

(i) providing in a reaction vessel reagents suitable for performing Polymerase Chain Reaction (PCR) comprising: (a) amount(s) of one or more set(s) of first primers sufficient to permit amplification of a plurality of nucleic acid templates without substantial residual unincorporated primers, wherein each first primer comprises a locus-specific sequence capable of annealing to a nucleic acid template at a first temperature and a tag sequence comprising a nucleotide sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 14; and (b) a second primer or set of second primers wherein each second primer comprises a nucleotide sequence set forth in SEQ ID NO: 55 or SEQ ID NO: 56, wherein each member of the set of second primers has a melting temperature (Tm) lower than the Tm of each member of the set of first primers and is not capable of annealing substantially to members of the set of first primers or nucleic acid template at the first temperature; (ii) performing PCR under conditions sufficient to amplify the plurality of nucleic acid templates thereby producing amplification products, wherein said conditions comprise an annealing temperature suitable for annealing of the members of the set of first primers but not detectably of the members of the set of second primers, and a sufficient number of amplification cycles for the primers to be substantially incorporated into the amplification product with little or no residual unincorporated primers; and

(iii) performing PCR under conditions sufficient to amplify the amplification products at (ii), wherein said conditions comprise annealing temperature(s) suitable for annealing of members of the set of second primers.

Each of the embodiments described herein with reference to a method for amplifying a nucleic acid shall be taken to apply mutatis mutandis to a method of multiplex amplification of nucleic acid.

In one embodiment, the method described herein according to any embodiment additionally comprises determining one or more first primer(s) or set(s) of first primers by a process comprising predicting the lengths of amplification products produced by one or more candidate first primers or candidate set(s) of first primers and determining one or more first primer(s) or set(s) of first primers that are suitable for producing predicted amplification products or groups of predicted amplification products of sufficiently different lengths to permit their resolution by a means that fractionates nucleic acid according to length. Preferably, the method comprises selecting predicted amplification products of sufficiently different length to permit resolution by a means that fractionates nucleic acid according to length.

The skilled artisan will be aware of suitable means for fractionating nucleic acid according to length. For example, the means that fractionates nucleic acid according to length comprises electrophoresis, e.g., polyacrylamide gel electrophoresis or capillary electrophoresis. Alternatively, the means that fractionates nucleic acid according to its length comprises mass spectrometry.

Preferably, the method of the invention additionally comprises grouping the predicted amplification products such that the predicted amplification products in each group are of sufficiently different length to permit their resolution by a means that fractionates nucleic acid according to length and selecting one or more groups of predicted amplification products.

hi one embodiment, the method of determining one or more first primer(s) or set(s) of first primers comprises using a computer-based algorithm to determine the lengths of the predicted amplification products.

In another embodiment, the method of determining one or more first primer(s) or set(s) of first primers additionally comprises producing a database of allele length data from the lengths of the predicted amplification products.

Preferably, the method comprises predicting and/or grouping and/or selecting the predicted amplification products and/or groups of predicted amplification products using a database of allele length data for the predicted amplification products to thereby provide the lengths of said predicted amplification products.

In one embodiment, the method additionally comprises retrieving data pertaining to allele length(s) and/or predicted amplification products and/or groups of predicted amplification products in a computer-readable format.

In a preferred embodiment, the method additionally comprises selecting first primer(s) or set(s) of first primers or one or more groups of first primers. Preferably, the selected first primer(s) or set(s) of first primers are predicted to produce predicted amplification products having at least 5 nucleotides difference in length.

In a preferred embodiment, the method additionally comprises providing, producing or synthesizing the one or more first primer(s) or set(s) of first primers.

Clearly, the detection of one or more nucleic acids is useful for, for example, determining relationships between one or more individuals, isolates of an organism, cultivars of an organism, species or genera. For example, the method of the invention is used to detect one or more nucleic acids that are polymorphic between two or more individuals, isolates of an organism, cultivars of an organism, species or genera. Accordingly, the present invention additionally provides a method comprising performing a method described herein to detect one or more polymorphic nucleic acid/s in an individual, isolate of an organism, cultivar of an organism, species or genus wherein the polymorphic nucleic acid detected characterizes the individual, isolate of an organism, cultivar of an organism, species or genus.

It will be apparent from the description herein that the present invention is useful for typing an organism within or between groups, or for differentiating between individuals or groups (e.g., for identification of a specific plant variety). The skilled artisan will appreciate that the method of the invention is applicable to, for example, the analysis of a sample (e.g., a food sample) to identify the presence of a foreign agent (e.g., a genetically modified plant). Furthermore, the present invention has clear applicability, for example, in the identification/diagnosis of a disease or disorder, for example, by

detection and/or identification of the infectious agent that causes the disease or disorder. Such methods are clearly contemplated by the present invention.

The present invention additionally contemplates methods of screening an animal species for the purpose of animal husbandry, for example, for the selection of a desired trait (e.g., marbled beef from cattle, or enhanced milk quality from cattle, enhanced speed or stamina in horses or enhanced meat quality from pigs). Such screening involves the detection of one or more genetic markers associated with a trait of interest in a sample from a non-human animal and selecting those animals comprising the marker/s, for example, for breeding.

Accordingly, in another embodiment, the present invention provides a process of characterising or identifying one or more individuals, isolates of an organism, cultivars of an organism, species or genera said process comprising: (i) providing in a reaction vessel reagents suitable for performing Polymerase Chain Reaction (PCR) comprising: (a) an amount of a first primer or set of first primers sufficient to permit amplification of a nucleic acid template without substantial residual unincorporated primer, wherein each first primer comprises a locus-specific sequence capable of annealing to the nucleic acid template at a first temperature and a tag sequence that does not anneal to the nucleic acid template; and (b) a second primer or set of second primers wherein each second primer comprises a sequence capable of annealing to a nucleic acid comprising a sequence complementary to a portion of a first primer comprising the tag sequence and wherein each second primer has a melting temperature (Tm) lower than the Tm of the first primer and is not capable of annealing substantially to the first primer or nucleic acid template at the first temperature;

(ii) performing PCR under conditions sufficient to amplify the nucleic acid template in a sample from an individual, isolate of an organism, cultivar of an organism, species or genus thereby producing an amplification product, wherein said conditions comprise an annealing temperature suitable for annealing of the first primer or set of first primers but not detectably of the second primer or set of second primers and a sufficient number of amplification cycles for the primer(s) to be substantially incorporated into the amplification product and little or no residual unincorporated primer;

(iii) performing PCR under conditions sufficient to amplify the amplification product at (ii), wherein said conditions comprise an annealing temperature suitable for annealing of the second primer or set of second primers; and

(iv) detecting the amplified nucleic acid, wherein the amplified nucleic acid is characteristic of the one or more individuals, isolates of an organism, cultivars of an organism, species or genera.

In one embodiment, one or more cultivar(s) of wheat is (are) characterised or identified or one or more cultivar(s) of barley is (are) characterised or identified.

Alternatively, one or more species or genera of plants is characterised or identified, for example, the plant is wheat; or the plant is barley; or the plant is Prunus spp, e.g., apricot or cherry.

Alternatively, one or more species or genera of animals is characterised or identified. Suitable animals will be apparent to the skilled artisan and include, for example, a bovine animal or an ovine animal.

Alternatively, one or more species or genera of fungus is characterised or identified. For example, the fungus is Rhynchosporium secalis

Preferably, the detected, amplified nucleic acid from the individual, isolate of an organism, cultivar of an organism, species or genus is compared to the detected, amplified nucleic acid from a reference sample to thereby characterise or identify the individual, isolate of an organism, cultivar of an organism, species or genus

In this respect, it is preferable that the nucleic acid template or reference sample is selected from the group consisting of:

(i) nucleic acid from an individual, isolate, cultivar, species or genus; (ii) nucleic acid from a plurality of individuals, isolates, cultivars, species or genera;

(iii) a data set comprising information concerning detected, amplified nucleic

For example, the nucleic acid template or reference sample is nucleic acid from a cultivar of wheat. Alternatively, the nucleic acid template or reference sample is

nucleic acid from barley. Alternatively, the nucleic acid template or reference sample is nucleic acid from one or more species or genera of plant, e.g., wheat or barley. Alternatively, the plant is Prunus spp, e.g., apricot or cherry. Alternatively, the nucleic acid template or reference sample is nucleic acid from one or more species or genera of animal, e.g., a bovine animal or an ovine animal. Alternatively, the nucleic acid template or reference sample is nucleic acid from one or more species or genera of fungus, e.g., Rhynchosporium secalis.

Furthermore, the present invention contemplates a method for differentiating between or identifying differences between related organisms. For example, the method may be used to differentiate between members of a population of related (or inbred) organisms that are used to map the site of a gene. Accordingly, the present invention additionally provides a process of differentiating between two or more related organisms or individuals said process comprising: (i) providing in a reaction vessel reagents suitable for performing Polymerase Chain Reaction (PCR) comprising: (a) an amount of a first primer or set of first primers sufficient to permit amplification of a nucleic acid template without substantial residual unincorporated primer, wherein each first primer comprises a locus-specific sequence capable of annealing to the nucleic acid template at a first temperature and a tag sequence that does not anneal to the nucleic acid template; and (b) a second primer or set of second primers wherein each second primer comprises a sequence capable of annealing to a nucleic acid comprising a sequence complementary to a portion of a first primer comprising the tag sequence and wherein each second primer has a melting temperature (Tm) lower than the Tm of the first primer and is not capable of annealing substantially to the first primer or nucleic acid template at the first temperature; (ii) performing PCR under conditions sufficient to amplify the nucleic acid template in a sample from the organism or individual thereby producing an amplification product, wherein said conditions comprise an annealing temperature suitable for annealing of the first primer or set of first primers but not detectably of the second primer or set of second primers and a sufficient number of amplification cycles for the primer(s) to be substantially incorporated into the amplification product and little or no residual unincorporated primer;

(iii) performing PCR under conditions sufficient to amplify the amplification product at (ii), wherein said conditions comprise an annealing temperature suitable for annealing of the second primer or set of second primers; and

(iv) detecting the amplified nucleic acid, wherein the amplified nucleic acid is characteristic of a specific organism or individual, thereby differentiating between the two or more related organisms or individuals.

Preferably, the detected, amplified nucleic acid from the organism or individual is compared to the detected, amplified nucleic acid from one or more related organism(s) or individual(s) to thereby differentiate between the two or more related organisms or individuals.

As will be apparent to the skilled artisan, the present invention is useful for differentiating between any individuals and/or organisms. For example, the present inventors have used the method of the present invention to amplify genetic markers that facilitate differentiation between wheat plants, barley plants, Primus plants, bovine animals, ovine animals or fungi.

As exemplified herein, the present invention is also useful for detecting or diagnosing an infection in a subject. For example, the present invention provides a process for detecting an infection or diagnosing an infection in a subject, said process comprising:

(i) providing in a reaction vessel reagents suitable for performing Polymerase Chain Reaction (PCR) comprising: (a) an amount of a first primer or set of first primers sufficient to permit amplification of a nucleic acid template from an infectious organism without substantial residual unincorporated primer, wherein each first primer comprises a locus-specific sequence capable of annealing to the nucleic acid template at a first temperature and a tag sequence that does not anneal to the nucleic acid template; and (b) a second primer or set of second primers wherein each second primer comprises a sequence capable of annealing to a nucleic acid comprising a sequence complementary to a portion of a first primer comprising the tag sequence and wherein each second primer has a melting temperature (Tm) lower than the Tm of the first primer and is not capable of annealing substantially to the first primer or nucleic acid template at the first temperature;

(ii) performing PCR under conditions sufficient to amplify the nucleic acid template in a sample from a subject thereby producing an amplification product, wherein said conditions comprise an annealing temperature suitable for annealing of the first primer or set of first primers but not detectably of the second primer or set of second primers and a sufficient number of amplification cycles for the

primer(s) to be substantially incorporated into the amplification product and little or no residual unincorporated primer; (iii) performing PCR under conditions sufficient to amplify the amplification product at (ii), wherein said conditions comprise an annealing temperature suitable for annealing of the second primer or set of second primers; and

(iv) detecting the amplified nucleic acid, wherein said detection of is indicative of the presence of the infectious organism in the subject or is indicative of an infection in the subject.

Preferably, the method additionally comprises providing the sample from the subject. For example, the sample is isolated previously from a subject.

Suitable samples will be apparent to the skilled artisan and will depend on the subject from which the sample is isolated and the infectious organism. For example, an infection in a human may be detected by performing the method of the present embodiment to detect nucleic acid from an infectious organism in a blood sample or a sample derived therefrom. Alternatively, as exemplified herein, nucleic acid from an infectious fungus is detected in leaf tissue from a plant.

As described further herein, the present invention is useful for diagnosing a variety of infections and/or diseases. For example, the present inventors have detected the presence of the infectious organism Rhynchosporium secalis in plant tissue.

All embodiments described herein in relation to the amplification of nucleic acid or multiplex amplification of nucleic acid shall be taken to apply mutatis mutandis to a process of characterising or identifying one or more individuals, isolates of an organism, cultivars of an organism, species or genera; a process of differentiating between two or more related organisms or individuals; or a process for detecting an infection or diagnosing an infection.

The present invention additionally provides a primer comprising a locus-specific sequence comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 15 to 54 or 57 to 5345 and a tag sequence. For example, the tag sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 14. Preferably, the tag sequence comprises a nucleotide sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 14.

The present invention also provides a primer (i.e., a second primer) comprising a sequence capable of annealing to a nucleic acid comprising a sequence complementary to the tag sequence of a primer described herein according to any embodiment. For example, the primer comprises the nucleotide sequence set forth in SEQ ID NO: 55 or SEQ ID NO: 56. Preferably, the primer is labelled with a detectable marker, e.g., a fluorescent marker.

The present invention additionally provides for the use of a primer comprising a locus- specific sequence capable of annealing to a nucleic acid template and a tag sequence in the method or process described herein according to any embodiment. For example, the locus specific sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 15 to 54 or 57 to 5345.

Examples of suitable tag sequences include a tag sequence comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 14.

The present invention also provides for the use of a primer comprising a nucleotide sequence set forth in SEQ ID NO: 55 or SEQ ID NO: 56 in the method or process described herein according to any embodiment..

The present invention additionally provides a kit comprising (a) one or more first primers or set(s) of first primers wherein each first primer comprises a locus-specific sequence and a tag sequence; and (b) a second primer or set of second primers wherein each second primer is capable of annealing to a nucleic acid comprising a sequence complementary to all or a part of said tag sequence, wherein each of said first primers are capable of annealing to a nucleic acid template at a first temperature and wherein each of said second primers is capable of annealing to all or part of said tag sequence at a temperature lower than the first temperature but not at the first temperature.

Preferably, the kit additionally comprises allele length data comprising the lengths of predicted amplification products of the first primer(s) or set(s) of first primers.

Alternatively, the kit additionally comprises an algorithm for determining the lengths of predicted amplification products of the first primer(s) or set(s) of first primers.

In another embodiment, the kit additionally comprises groups of allele length data wherein each group of allele length data comprises the lengths of predicted amplification products of the first primer(s) or set(s) of first primers such that said predicted amplification products in each group are of sufficiently different length to permit their resolution by a means that fractionates nucleic acid according to length.

Alternatively, the kit additionally comprises an algorithm for determining groups of predicted amplification products of the first primer(s) or set(s) of first primers such that said predicted amplification products in each group are of sufficiently different length to permit their resolution by a means that fractionates nucleic acid according to length.

Preferably, the kit additionally comprises an algorithm for determining or selecting first primer(s) or set(s) of first primer(s) or groups thereof from the allele length data or lengths of predicted amplification products that are capable of producing predicted amplification products of sufficiently different length to permit their resolution by a means that fractionates nucleic acid according to length.

In a further embodiment, the kit additionally comprises sufficient information to access allele length data comprising the lengths of predicted amplification products of the first primer(s) or set(s) of first primers and/or an algorithm for determining the lengths of said predicted amplification products and/or for grouping said predicted amplification products such that the predicted amplification products in each group are of sufficiently different length to permit their resolution by a means that fractionates nucleic acid according to length.

Preferably, the kit additionally comprises sufficient information to access an algorithm for determining or selecting first primer(s) or set(s) of first primers or groups thereof from the allele length data or lengths of predicted amplification products. Preferably, the information comprises an access code to a computer-readable medium.

In a preferred embodiment, the allele length data or algorithm in the kit is in a computer-readable medium. For example, the computer-readable medium comprises a computer database and/or is implemented using a computer programme. For example, the computer-readable medium is a web-based database or programme. Alternatively, the computer-readable medium comprises a computer diskette or CD-ROM.

Preferably, the kit is packaged with instructions for use. For example, the kit is packaged with instructions for use in the method or process described herein according to any embodiment.

Preferably, the first primer comprises a locus specific sequence comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 15 to 54 or 57 to 5345.

Preferably, the first primer comprises a tag sequence comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 14.

Preferably, the second primer comprises a nucleotide sequence set forth in SEQ ID NO: 55 or SEQ ID NO: 56.

In a preferred embodiment, the first primer or set of first primers and the second primer or set of second primers are contained within a reaction vessel. For example, the first primer or set of first primers in the reaction vessel are in an amount sufficient to permit amplification of a nucleic acid template without substantial residual unincorporated primer.

Alternatively, or in addition, the second primer or set of second primers in the reaction vessel are in an amount sufficient to permit amplification of a nucleic acid template without substantial residual unincorporated primer.

Preferably, the kit additionally comprises means for amplifying a nucleic acid. Suitable means will be apparent to the skilled artisan and include, for example, a polymerase and/or a suitable buffer and/or dNTPs. Suitable means are described herein and are to be taken to apply mutatis mutandis to the present embodiment of the invention.

Clearly the present invention also provides the kit as described herein according to any embodiment when used in the method as described herein according to any embodiment.

The present invention additionally provides for the use of the kit described herein according to any embodiment for amplifying nucleic acid. For example, the kit is used to amplify nucleic acid using a method described herein according to any embodiment.

Brief description of the drawings

Figure Ia is a copy of a photographic representation showing the effect of DNA concentration on the specificity and efficiency of the assay of the invention. Increasing concentrations of nucleic acid from various strains of wheat was used as a template for a PCR of the invention. This analysis was performed with primer sets capable of amplifying different genetic markers. The primers used in this assay amplified the marker cfd55 or barc55 as shown at the base of the Figure. The marker designations relate to the primers set forth in Table 6, 7 12 or 16. Template source and concentrations used for each reaction are set forth in Table 1.

Figure Ib is a copy of a photographic representation showing the effect of DNA quality on the specificity and efficiency of the assay of the invention. Nucleic acid was extracted from different strains of barley using two different methods (a salt based method that preserved the quality of the nucleic acid or a sodium hydroxide based method that produced low-quality nucleic acid). The effect of DNA quality on an amplification method of the invention was determined using two different primer sets. The primers used in this assay amplified the marker bmagβ or gmsl as shown at the base of the Figure. The marker designations relate to the primers set forth in Table 6, 7 12 or 16. The template used for each amplification reaction is set forth in Table 2.

Figure 2 is a copy of a photographic representation showing the effect of primer concentration on the specificity and efficiency of an assay of the invention. PCR reactions according to an embodiment of the invention were performed using decreasing concentrations of primers to determine the effect of primer concentration on specificity of amplification. The arrows at the bottom of the gel images indicate decreasing concentration of locus-specific primer. The primers used in this assay amplified the marker gwm642, gdm77, gwmlO2 ₅ gwml94 or gwml74 as shown at the base of the Figure. The marker designations relate to the primers set forth in Table 6, 7 12 or 16. Template, primers and primer concentrations are set forth in Table 3.

Figure 3 is a copy of a photographical representation showing amplification products produced using a multiplex reaction of the invention performed to amplify six markers simultaneously. Nucleic acid was amplified from a variety of sources using primers specific for a variety of different marker. The template used for each reaction is set forth in Table 4 and the markers amplified set forth in Table 5.

Figure 4 is a copy of a photographic representation showing a comparison of nucleic acid amplified using conventional techniques (conv) and nucleic acid amplified using the assay of the invention (Mpx Rdy). The primers used in this assay amplified the marker gwm276, gwm301, gwm340, gwm368, gwm389 or gwm513 as indicated at the base of the Figure. The marker designations relate to the primers set forth in Table 6, 7 12 or 16.

Figure 5 is a graphical representation showing the frequency distribution of mean fluorescence peak heights for 366 single-locus barley and wheat multiplex-ready SSRs. Amplification was performed for 366 markers and the approximate level of nucleic acid amplified determined. The average fluorescence peak height for each marker was calculated from the fluorescence peak heights observed for eight genetically diverse barley (or wheat) cultivars, indicating that the method used amplified approximately equal levels of nucleic acid in a large number of reactions.

Figure 6 is a graphical representation showing the frequency distribution of mean fluorescence peak heights for 1070 single-locus barley and wheat multiplex-ready SSRs detected using an ABI3730 instrument. Amplification was performed for 1070 markers and the approximate level of nucleic acid amplified determined. The average fluorescence peak height for each marker was calculated from the fluorescence peak heights observed for eight genetically diverse barley (or wheat) cultivars, indicating that the method used amplified approximately equal levels of nucleic acid in a large number of reactions.

Figure 7 is a graphical representation showing the frequency distribution of mean fluorescence peak heights for 64 single-locus Prunus spp. multiplex-ready SSRs detected using an ABI3730 instrument. Amplification was performed for 64 markers and the approximate level of nucleic acid amplified determined. The average fluorescence peak height for each marker was calculated from the fluorescence peak heights observed for six apricot varieties and six cherry varieties, indicating that the method used amplified approximately equal levels of nucleic acid in a large number of reactions.

Figure 8 is a copy of a photographic representation showing amplicons produced using a multiplex reaction of the invention and separated by electrophoresis on a 4% polyacrylamide gel. Six-plex reactions were performed with nucleic acid from one of

six apricot varieties as set forth in Table 8. The markers amplified are set forth in Table 9 and the primers used to amplify the markers in Table 7.

Figure 9 is a copy of a photographic representation showing amplicons produced using a multiplex reaction of the invention and separated by electrophoresis on a 4% polyacrylamide gel. Ten-plex reactions were performed with nucleic acid from one of two apricot varieties or one of two cherry varieties as set forth in Table 10. The markers amplified are set forth in Table 11 and the primers used to amplify the markers in Table 7.

Figure 10a is a copy of a photographic representation showing the effect of locus specific primer concentration on the amplification of a marker (HMHlR) using nucleic acid from cattle or sheep. Nucleic acid from the sources set forth in Table 13 was amplified with a primer pair set forth in Table 12 and separated by electrophoresis using a 4% polyacrylamide gel. The concentration of primer used is indicated in Table 13.

Figure 10b is a copy of a photographic representation showing the effect of locus specific primer concentration on the amplification of a marker (BM2113) using nucleic acid from cattle or sheep. Nucleic acid from the sources set forth in Table 13 was amplified with a primer pair set forth in Table 12 and separated by electrophoresis using a 4% polyacrylamide gel. The concentration of primer used is indicated in Table 13.

Figure 11 is a copy of a photographic representation showing the effect of template DNA concentration on the amplification of a marker (BM2113) using nucleic acid from cattle or sheep. Nucleic acid from the sources set forth in Table 14 was amplified with a primer pair set forth in Table 12 and separated by electrophoresis using a 4% polyacrylamide gel. The concentration of nucleic acid used is indicated in Table 14.

Figure 12 is a copy of a photographic representation showing amplicons produced using a multiplex reaction of the invention and separated by electrophoresis on a 4% polyacrylamide gel. Three-plex reactions were performed with nucleic acid from cattle or sheep as set forth in Table 15. The markers amplified are set forth in Table 16 and the primers used to amplify the markers in Table 12.

Detailed description of the preferred embodiments Primer design

In one embodiment, a primer is designed such that it comprises a sequence having at least about 80% identity overall to a strand of a template nucleic acid. More preferably, the degree of sequence identity is at least about 85% or 90% or 95% or 98% or 99%. For example, the primer or a region of a primer may comprise a sequence having at least about 80% identity to a strand of a locus of interest. Accordingly, this provides the "locus specific" region of the first primer or set of primers.

Clearly, the specific composition of a primer of the invention (or more specifically, the locus-specific region of a first primer of the invention) will depend upon the sequence of the nucleic acid of interest. Accordingly, the sequence of the locus-specific region of a first primer of the invention is not to be taken to be limited to a particular sequence. Rather the sequence need only be sufficient to allow for annealing of the first primer to a template nucleic acid and initiation of an amplification reaction.

As a primer is generally extended in the 5'- to 3'- direction it is preferred that at least the 3 '-terminal nucleotide is complementary to the relevant nucleotide in the template nucleic acid. More preferably, at least the 3 or 4 or 6 or 8 or 10 contiguous nucleotides at the 3'- terminus of the primer are complementary to the relevant nucleotides in the template nucleic acid. The complementarity of the 3' terminus of the primer ensures that the extending end of the primer is capable of initiating amplification of the template nucleic acid, for example, by a polymerase.

As regions of non-complementarity reduce the predicted Tm of a primer and may be associated with amplification of non-template nucleic acid it is preferred that a primer of the invention does not comprise multiple contiguous nucleotides that are not identical to a strand of the template nucleic acid. Preferably, the primer comprises no more than 6 or 5 or 4 or 3 or 2 contiguous nucleotides that are not identical to a strand of the template nucleic acid. More preferably, any nucleotides that are not identical to a strand of the template nucleic acid are non-contiguous.

To determine whether or not two nucleotide sequences fall within a particular percentage identity limitation recited herein, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences.

In such comparisons or alignments, differences may arise in the positioning of non-

identical residues, depending upon the algorithm used to perform the alignment. In the present context, reference to a percentage identity between two or more nucleotide sequences shall be taken to refer to the number of identical residues between said sequences as determined using any standard algorithm known to those skilled in the art. For example, nucleotide sequences may be aligned and their identity calculated using the BESTFIT program or other appropriate program of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, Nucl. Acids Res. 12, 387-395, 1984).

Alternatively, a suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul et al J. MoI. Biol. 215: 403- 410, 1990), which is available from several sources, including the NCBI, Bethesda, Md.. The BLAST software suite includes various sequence analysis programs including "blastn," that is used to align a known nucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called "BLAST 2 Sequences" that is used for direct pairwise comparison of two nucleotide sequences.

As used herein the term "NCBI" shall be taken to mean the database of the National Center for Biotechnology Information at the National Library of Medicine at the National Institutes of Health of the Government of the United States of America, Bethesda, MD, 20894.

Generally, a primer comprises or consists of at least about 10 nucleotides, more preferably at least about 12 nucleotides or at least about 15 or 20 nucleotides that anneal to a nucleic acid template or are complementary to the nucleic acid template.

However, longer primers are also used in PCR reactions, for example, reactions in which a long region of nucleic acid (e.g., greater than lOOObp) is amplified.

Accordingly, the present invention additionally contemplates a primer comprising at least about 25 or 30 or 35 nucleotides that anneal to a nucleic acid template or are complementary to the nucleic acid template.

Alternatively, a primer comprising one or modified bases, such as, for example, locked nucleic acid (LNA) or peptide nucleic acid (PNA) need only comprise a region of at least about 8 nucleotides that anneal to a nucleic acid template or are complementary to the nucleic acid template. Preferably, the complementary nucleotides are contiguous.

As will be apparent to the skilled, artisan, the number of nucleotides capable of annealing to a nucleic acid template is related to the stringency under which the primer will anneal. Preferably, a primer of the invention anneals to a nucleic acid template under moderate to high stringency conditions.

In one embodiment, the stringency under which a primer of the invention anneals to a template nucleic acid is determined empirically. Generally, such a method requires performance of an amplification reaction using one or more primers under various conditions and determining the level of specific amplification produced.

Alternatively, a primer of the invention is labelled with a detectable marker (e.g., a radionucleotide or a fluorescent marker) and the level of primer that has annealed to a target nucleic acid under suitably stringent conditions is determined.

For the purposes of defining the level of stringency, a moderate stringency annealing conditions will generally be achieved using a condition selected from the group consisting of: (i) an incubation temperature between about 42°C and about 55°C; (ii) an incubation temperature between about 15 ⁰ C and 1O ⁰ C less than the predicted

Tm for a primer; and (iii) a Mg ²⁺ concentration of between about 2mM and 3mM.

High stringency annealing conditions will generally be achieved using a condition selected from the group consisting of:

(i) an incubation temperature above about 55°C and preferably above about 65 ⁰ C; (ii) an incubation temperature between about 1O ⁰ C and I ⁰ C less than the predicted Tm for a primer; and (iii) a Mg ²⁺ concentration of between about ImM and 1.9mM.

Alternative or additional conditions for enhancing stringency of annealing will be apparent to the skilled artisan. For example, a reagent such as, for example, glycerol (5-10%), DMSO (2-10%), formamide (1 - 5%), Betaine (0.5 - 2M) or tetramethylammonium chloride (TMAC, >50mM) are known to alter the annealing temperature of a primer and a nucleic acid ternplate(Sarkar et ah, Nucl. Acids Res. 18:

7465; 1990, Baskaran et al. Genome Res. 6: 633-638, 1996; and Frackman et al, Promega Notes 65: 27, 1998).

Conditions for altering the stringency of a PCR reaction are understood by those skilled in the art. For the purposes of further clarification only, reference to the parameters affecting annealing between nucleic acid molecules is found in Ausubel et al (Current Protocols in Molecular Biology, Wiley Interscience, ISBN 047150338, 1992), which is herein incorporated by reference.

Alternatively, the conditions under which a primer anneals to a nucleic acid template are determined in silico. For example, methods for determining the predicted melting temperature (or Tm) of a primer (or the temperature at which a primer denatures from a specific nucleic acid) are known in the art.

For example, the method of Wallace et al, (Nucleic Acids Res. 6, 3543, 1979) estimates the Tm of a primer based on the G, C, T and A content. In particular, the described method uses the formula 2(A + G) + 4(G + C) to estimate the Tm of a probe or primer.

Alternatively, the nearest neighbour method described by Breslauer et al, Proc. Natl. Acad. ScI USA, 83:3746-3750, 1986 is useful for determining the Tm of a primer. The nearest neighbour method uses the formula:

T _m (cBlc) ^β ΣMi°J '(Mn(C _t M) +ΣήS°)

wherein ΔH° is standard enthalpy for helix formation, ΔS° is standard entropy for helix formation, Q is the total strand concentration, n reflects the symmetry factor, which is 1 in the case of self-complementary strands and 4 in the case of non-self- complementary strands and R is the gas constant (1.987).

Ryuchlik et al, Nucl Acids Res. 18: 6409-6412, 1990 described an alternative formula for determining Tm of an oligonucleotide:

wherein, dH is enthalpy for helix formation, dS is entropy for helix formation, R is molar gas constant (1.987cal/°C mol), "c" is the nucleic acid molar concentration (determined empirically, W.Rychlik et.al, supra), (default value is 0.2 μM for unified thermodynamic parameters), [K ⁺ ] is salt molar concentration (default value is 50 mM).

Suitable software for determimng the Tm of an oligonucleotide using the nearest neighbour method is known in the art and available from, for example, US Department of Commerce, Northwest Fisheries Service Center and Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine.

Alternatively, for longer primers (i.e., a primer comprising at least about 200 nucleotides), the method of Memkoth and WaM (In: Anal Biochem, 138: 267-284, 1984), is useful for determining the Tm of the primer. This method uses the formula:

81.5 + 16.6(log ₁₀ M) + 0.41(% GC) - 0.61 (% form) - 500 / Length in bp,

wherein M is the molarity of Na+ and % form is the percentage of formamide (set to 50%)

For a primer that comprises or consists of PNA the Tm is determined using the formula (described by Giesen et al, Nucl. Acids Res., 26: 5004-5006):

7 ^" mpred = Co + C ₁ * T _mn nDNA + C2 * fpyr + C3 * length,

wherein, in which T _n U _1n D _NA is the melting temperature as calculated using a nearest neighbour model for the corresponding DNA/DNA duplex applying AH ⁰ and AS ⁰ values as described by SantaLucia et al. Biochemistry, 35: 3555-3562, 1995. f _pyr denotes the fractional pyrimidine content, and length is the PNA sequence length in bases. The constants are C ₀ = 20.79, C ₁ = 0.83, C ₂ = -26.13 and C ₃ = 0.44

To determine the Tm of a primer comprising one or more LNA residues a modified form of the formula of SantaLucia et al. Biochemistry, 35: 3555-3562, 1995 is used:

AH Tm a

ΔS+MEMa3^£C/4r ⁷ 3

A suitable program for determining the Tm of a primer comprising LNA is available from, for example, Exiqon, Vedbaek, Germany.

A temperature that is similar to (e.g., within 5 ⁰ C or within 1O ⁰ C) or equal to the proposed/estimated temperature at which a primer denatures from a template nucleic acid is considered to be high stringency. Medium stringency is to be considered to be within 1O ⁰ C to 2O ⁰ C or 1O ⁰ C to 15 ⁰ C of the calculated Tm of the probe or primer.

Preferably, a primer of the invention selectively anneals to a target nucleic acid. The term "selectively anneals" means that the probe is used under conditions where a target nucleic acid, anneals to the probe to produce a signal that is significantly above background (i.e., a high signal-to-noise ratio). The level of specificity of annealing is determined, for example, by performing an amplification reaction using the primer and detecting the number of different amplicons produced. By "different amplicons" is meant that amplified nucleic acids of differing nucleotide sequence and/or molecular weight are produced. Clearly, amplicons that differ in molecular weight are readily identified, for example, using gel electrophoresis. A primer that selectively anneals to a target nucleic acid produces an amplicon at a level greater than any other amplicon. Preferably only one amplicon is produced at a detectable level.

An alternative technique to determine the selective annealing of a primer of the invention comprises performing a search of known nucleotide sequences from the sample being assayed (e.g., a database of known sequences from an organism or cell from which the template nucleic acid is derived). Using this technique a sequence similar to or complementary to the sequence of the primer is identified. While such a technique does not ensure selective annealing it is useful for determining a primer (or set of primers) capable of annealing to a plurality of sites in a nucleic acid and possibly producing multiple amplicons (i.e., non-selective annealing).

A primers or primer sequence that is predicted to be or shown to be capable of selectively annealing to a nucleic acid template is also optionally analyzed for one or more additional characteristics that make it suitable for use as a primer in the method of the invention. For example, a primer is analyzed to ensure that it is unlikely to form secondary structures (i.e., the primer does not comprise regions of self- complementarity).

Furthermore, should the primer be proposed to be used in a reaction with one or more other primers (e.g., a PCR reaction and/or a multiplex reaction) all primers may be assessed to determine their ability to anneal to one another and form "primer dimers". Methods for determining a primer that is capable of self-dimerization and/or primer dimer formation are known in the art and/or described supra.

Methods for designing and/or selecting a primer suitable for use in an amplification reaction are known in the art and described, for example, in Innis and Gelfand (1990) (In: Optimization of PCRs. pp. 3-12 in: PCR Protocols (Innis, Gelfand, Sninsky and White, eds.); Academic Press, New York) and Dieffenbach and Dveksler (Eds) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995). Such methods are particularly suited, for example, for designing a locus specific sequence of a primer of the invention.

Generally, it is recommended that a primer satisfies the following criteria:

(i). the primer comprises a region that is to anneal to a target sequence having at least about 17-28 bases in length; (ii). the primer comprises about 50-60% (G+C); (iii) the 3'-terminus of the primer is a G or C, or CG or GC (this prevents "breathing" of ends and increases efficiency of initiation of amplification); (iv) preferably, the primer has a Tm between about 55 and about 8O ⁰ C; (v) the primer does not comprise three or more contiguous Cs and/or Gs at the 3'- ends of primers (as this may promote mispriming at G or C-rich sequences due to the stability of annealing);

(vi) the 3'-end of a primer should not be complementary with another primer in a reaction; and (vii) the primer does not comprise a region of self-complementarity.

Several software programs are available that enable the design of one or more primers, or a region of a primer (e.g., a locus specific sequence of a first primer of the invention). For example, a program selected from the group consisting of:

(i) Primer3, available from the Center for Genome Research, Cambridge, MA,

USA, designs one or more primers for use in an amplification reaction based upon a known template sequence;

(ii) Primer Premier 5, available from Biosoft International, Palo Alto, CA, USA, designs and/or analyzes primers; (iii) CODEHOP, available from Fred Hutchinson Cancer Research Centre, Seattle,

Washington, USA, designs primers based on multiple protein alignments; and (iv) FastPCR, available from Institute of Biotechnology, University of Helsinki,

Finland, designs multiple primers, including primers for use in a multiplex reaction, based on one or more known sequences.

When designing a primer of the invention, the composition of the template nucleic acid is considered (i.e. the nucleotide sequence) as is the type of amplification reaction to be used. For example, should allele specific PCR be used, the 3 ¹ nucleotide of one of the primers used in such a reaction corresponds to the site of an allele of interest, such as, for example a SNP. In this manner only in the presence of a nucleotide that is complementary to that in the primer does annealing occur and amplification achieved.

Alternatively, should an amplification reaction be performed to detect a simple nucleotide repeat a primer (or pair of primers) is designed that anneals to nucleic acid adjacent (albeit, not necessarily immediately adjacent) to the site of the simple repeat.

Furthermore, should the primer be used in a multiplex reaction it is preferred that the amplification product produced is not similar in molecular weight to that produced using another primer or set thereof thereby rendering detection difficult. Accordingly, it is preferred that there is sufficient difference in molecular weight in amplified products to enable detection using a technique known in the art, such as, for example, gel electrophoresis or mass spectrometry.

While it is preferable to produce amplification products of distinct molecular weights, by using differential labelling with different detectable markers, products of similar length are resolved. Accordingly, it is not essential that each of the nucleic acids amplified using the method of the invention is different molecular weight.

Tag sequences

The tag sequence in a first primer of the invention serves the dual purpose of enhancing the specificity annealing of the first primer and providing a site within the amplicon produced in the first amplification reaction to which a second primer of the invention anneals.

In a preferred embodiment, the tag sequence comprises a sequence of nucleotides that produce a site or template suitable for annealing of another primer when used in an amplification reaction. Methods for determining a sequence suitable for annealing of a primer are known in the art and/or described hereinabove.

The length of the tag sequence depends on the number of nucleotides required by the second primer to anneal and initiate nucleic acid amplification in an amplification reaction. Preferably, the second primer is capable of annealing to the amplicon produced in the first reaction under moderate to high stringency conditions. For example, should the second primer comprise one or more ribonucleotides and/or one or more PNA residues and/or one or more LNA residues the number of nucleotides required for annealing is fewer than in the case of a primer comprising only deoxyribonucleotides .

As discussed supra probes comprising LNA and/or PNA are capable of selectively annealing to a target comprising as few as 8 nucleotides. Accordingly, it is preferred that the tag sequence comprises at least about 8 nucleotides. More preferably, the tag region comprises at least about 10 nucleotides, more preferably about 12 nucleotides, even more preferably, at least about 15 nucleotides, still more preferably, at least about 17 nucleotides and even more preferable at least about 19 nucleotides.

A tag sequence that is unable to anneal to the template nucleic acid is selected to ensure that it does not cause non-specific annealing of the first primer in the first amplification reaction and the amplification of non-template nucleic acid. Preferably, the tag sequence is unable to anneal to a nucleic acid in a sample being assayed to such a degree as to amplify nucleic acid to a detectable level (i.e. background amplification).

As will be apparent to the skilled artisan, the requirement that the tag sequence not anneal to a template nucleic acid does not require that the tag sequence not anneal under any conditions. Rather, it is preferred that the tag sequence is not capable of annealing to the template nucleic acid under conditions sufficient for annealing of the locus specific sequence to the template nucleic acid. For example, the tag sequence may anneal to the template nucleic acid under low stringency conditions.

In one embodiment, it is preferred that the tag comprises a sequence of nucleotides that does not naturally occur in a sample being assayed. Methods for determining a sequence that is not present in a sample being assayed will be apparent to the skilled artisan. For example, the nucleotide sequence of the tag sequence is analyzed using a program, such as, for example, BLAST to determine whether or not that sequence (or its complement) occurs naturally in an organism being assayed.

Alternatively, or in addition a nucleotide sequence is selected from an organism different to that from which a sample being assayed is derived. For example, should the sample being assayed be derived from a mammal or a plant, the tag is derived from, for example, an unrelated mammal or plant or a virus or a bacteria or a fungus that is not a pathogen of the mammal or plant. In one embodiment, a tag sequence is selected from a bacterial page gene, e.g., tag comprises a sequence from M13 phage GTAAACGACGGCCAGT (SEQ ID NO: 1) or a sequence from T7 phage TAATACGACTCACTATAGGG (SEQ ID NO: 2). Such a tag is useful as, for example, a tag sequence for a primer used to amplify a sequence from a mammal or a plant or a fungus.

Alternatively, an artificial sequence is used for a tag. For example, a tag sequence described by Heath et al, Med Genet 37:272-280, 2000 is used (i.e., a tag sequence comprises a nucleotide sequence selected from the group consisting of:

(i) TCCGTCTTAGCTGAGTGGCGTA (SEQ ID NO: 3);

(ii) AGGCAGAATCGACTCACCGCTA (SEQ ID NO: 4);

(iii) TCCGTCTTAGCTGAGTGGCGTA (SEQ ID NO: 5); and (iv) AGGCAGAATCGACTCACCGCTA(SEQIDNO ₁ -O).

These sequences were found to be useful as tag sequences for use in a human sample.

In another embodiment, the tag sequence comprises a nucleotide sequence selected from the group consisting of: (i) GCTAAATCGGACTAGCTACC (SEQ ID NO: 7); and (ii) TAATCCAGCTACGCTGCATC (SEQ ID NO: 8).

Pemov et al, (Nucl Acids Res. 33:el l, 2005) showed that these tag sequences were useful with samples from Bacillus subtilis.

In a further embodiment, a zip-code sequence is used as a tag sequence. For example, a tag sequence comprises the nucleotide sequence GGAGCACGCTATCCCGTTAGAC

(SEQ ID NO: 9) or CGCTGCCAACTACCGCACATG (SEQ ID NO: 10) or CCTCGTGCGAGGCGTATTCTG (SEQ ID NO: 11) or

GCGACCTGACTTGCCGAAGAAC (SEQ ID NO: 12). A zip code sequence is generally a sequence of nucleotides that has been produced synthetically and is predicted not to occur in a nucleic acid derived from a specific organism.

The present inventors have used a tag sequence that is artificially produced and predicted not to anneal to amplify nucleic acid under conditions suitable for annealing of the locus specific sequence of a first primer of the invention. Accordingly, in a preferred embodiment, the tag region of the first primer or set of primers comprises a nucleotide sequence CACGACGTTGTAAAACGAC (SEQ ID NO: . 13) or GTACATTAAGTTCCCATTAC (SEQ ID NO: 14).

In one embodiment, the tag comprises or consists of the sequence of the second primer of the invention.

As will be apparent to the skilled artisan, the tag sequence need not only comprise a region that provides a suitable template for annealing of a second primer to an amplicon produced in the first amplification. For example, the tag comprises additional sequence to facilitate binding of a polymerase to enable replication of amplified nucleic acid.

Alternatively, or in addition, the tag comprises a spacer sequence between the locus specific sequence and the tag sequence. Preferably, such a spacer region is rich in adenosine and/or thymine rather than cytosine and/or guanine. This is because a spacer region rich in cytosine and/or guanine increases the Tm of the first primer more than a spacer region rich in adenosine and/or thymine. Accordingly, a CG rich spacer may cause background by non-specific amplification of nucleic acids.

In another embodiment, the tag comprises the nucleotide sequence of one or more restriction endonuclease sites. Such a restriction endonuclease site is located at, for example, the 5' end or the 3' end or both the 5' and 3' ends or within the primer. The use of such a restriction endonuclease site enables, for example, cloning of a nucleic acid amplified using the method of the invention.

Should the primer comprise a restriction endonuclease site, it may be advantageous to include sufficient additional nucleic acid to ensure binding and cleavage of the site. Suitable sequences to ensure such cleavage are known in the art and described, for example, in Dieffenbach (ed) and Dveksler (ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995).

In another embodiment, the tag comprises additional sequence to enable for transcription and/or translation of a nucleic acid amplified by the method of the invention. For example, the tag comprises the sequence of a promoter, such as, for example, the T7 promoter. Such a promoter enables the production of, for example, a riboprobe, for use in, for example, in situ hybridization and/or Northern or Southern hybridization. Accordingly, the method of the invention enables not only the amplification and/or detection of a template nucleic acid but also the production of a probe that allows detection of a cell, tissue or organism that comprises or expresses the template nucleic acid.

Second primers

A second primer of the invention is capable of annealing to and initiating amplification of an amplicon produced in a first reaction using a first primer of the invention. As will be apparent from the description herein, the second primer is capable of annealing to a strand of template nucleic acid comprising the tag sequence of the first primer. This is not to say that the second primer anneals to the entire tag sequence of the first primer. Nor does the second primer only anneal to the tag sequence of the first primer. Rather, the second primer anneals to a nucleic acid comprising a tag sequence, or to a nucleic acid within a tag sequence.

Preferably, the degree of nucleotide sequence identity between the portion of the first primer comprising the tag sequence (or a portion thereof) and the second primer is at sufficient to enable selective annealing of the second primer to an amplicon produced using the first primer. Accordingly, it is preferable that the second primer is at least about 80% or 90% identical to a region of the first primer. Preferably, the degree of identity is at least about 95%, more preferable 97% or 98% or 99%.

Preferably, the portion of the first primer comprising the tag sequence includes a sufficient number of nucleotides to enable the second primer to selectively anneal to an amplicon produced using a first primer of the invention. As will be apparent to the

skilled artisan, the number of nucleotides required for annealing of a primer to a template nucleic acid is dependent on the composition of the primer. For example, a primer consisting of deoxynucleotides comprises at least about 12 nucleotides, or 14 nucleotides or 16 nucleotides. Suitable criteria for the design of a primer (for example, primer length) are described supra and are taken to apply mutatis mutandis to this embodiment of the invention.

hi one exemplified form of the invention, a second primer comprises 14 nucleotides or 16 nucleotides identical to a portion of a first primer comprising a tag sequence.

Preferably, the region of the first primer is also of sufficient nucleotide composition to enable annealing of the second primer or set thereof to an amplification product produced using the first primer and initiation of nucleic acid replication mediated by a polymerase.

It will be apparent from the forgoing description that a second primer of the invention has a Tm lower than that of the first primer and is not capable of annealing substantially to its template nucleic acid at the temperature at which the first primer anneals to its template in the first reaction. By using primers that anneal under different conditions the invention enables the amplification using only one (or one set) of primers, notwithstanding the presence of all primers in a single reaction.

In particular, it is preferred that the first primer anneals to target nucleic acid at a temperature at which there is no detectable annealing of the second primer to target nucleic acid.

Preferably, the difference in the Tm of the first and second primers is sufficient that the second primer is unable to anneal to a detectable level under conditions sufficient for selective annealing of the first primer. Accordingly, the second primer is unable to anneal under moderate to high stringency conditions as determined for the first primer.

Preferably, the difference in Tm between the first and second primers is at least about 1O ⁰ C or at least about H ⁰ C or at least about 12 ⁰ C or at least about 15 ⁰ C or at least about 2O ⁰ C. In a preferred embodiment, the first primer (or set thereof) has a Tm at least about 15 ⁰ C to 18 ⁰ C greater than that of the second primer. This is not to say that all primers of a set of primers must have the same Tm, rather the Tm of each primer of a

first set of primers is at least about 1O ⁰ C greater than that of a second primer or set thereof.

In a preferred embodiment, the second primer has a Tm of at least about 35 ⁰ C, for example, at least about 38 ⁰ C, preferably, at least about 4O ⁰ C, more preferably, at least about 42 ⁰ C.

As will be apparent to the skilled artisan, while a second primer may be analyzed in silico to predict whether or not it will anneal under conditions sufficient for selective annealing of the first primer, the presence or absence of detectable annealing of the second primer should be determined or confirmed by empirical means. For example, an amplification reaction is performed using the second primer and a suitable template under conditions used for annealing the first primer.

Preferably, the first primer (or set thereof) anneals to its target at a temperature at least about 5 ⁰ C greater than the temperature at which the second primer anneals to its target, more preferably, at least about 6 ⁰ C, more preferably, at least about 7 ⁰ C greater and even more preferably, at least about 9 ⁰ C greater.

Methods for determining the temperature at which a primer anneals to a nucleic acid template will be apparent to those skilled in the art and/or described herein.

Li a preferred embodiment, a second primer used in the method of the present invention comprises the nucleotide sequence of a tag region described supra or a region thereof.

Preferably, the second primer comprises a nucleotide sequence within a nucleotide sequence set forth in any one of SEQ ID NOs: 1-13. Preferably, the second primer comprises a sequence of at least 10 consecutive nucleotides of a nucleotide sequence set forth in any one of SEQ ID NOs: 1-13. For example, the second primer comprises a sequence of at least 12 consecutive nucleotides of a nucleotide sequence set forth in any one of SEQ ID NOs: 1-13. For example, the second primer comprises a sequence of at least 15 consecutive nucleotides of a nucleotide sequence set forth in any one of SEQ ID NOs: 1-13. Preferably, the second primer comprises a nucleotide sequence set forth in SEQ ID NO: 55 or 56.

Primer selection

As will be apparent to the skilled artisan based on the disclosure herein, the present invention provides a method amenable to multiplex amplification or detection of nucleic acids. The term "multiplex amplification" will be understood by the skilled artisan to mean that a plurality of distinct nucleic acids are amplified in a single reaction, e.g., a plurality of nucleic acids are amplified using the method of the present invention.

The term "multiplex detection of nucleic acids" shall be taken to mean that a plurality of nucleic acids is detected in a single detection reaction. In this respect, each of the nucleic acids may be amplified individually using the method described herein according to any embodiment. Alternatively, a plurality of nucleic acids, e.g., a set of the nucleic acids to be detected is amplified in a multiplex reaction. For example, the present invention contemplates amplifying one or more nucleic acids using the method of the invention and pooling the amplified nucleic acid with additional amplified nucleic acid prior to detecting the amplified nucleic acids.

In such assays or methods of amplification or detection it is preferred to perform the method described herein according to any embodiment using primers suitable for producing amplification products of sufficiently different lengths to permit their resolution by a means that fractionates nucleic acid according to its length. By making use of such primers, a multiplex assay is performed in which each of the amplification products produced may be detected using a detection means such as, for example, electrophoresis, e.g., polyacrylamide gel electrophoresis or capillary electrophoresis or mass spectrometry. Suitable fractionation methods will be apparent to the skilled artisan and/or described herein.

Methods for determining suitable primers will be apparent to the skilled artisan based on the description herein. For example, the length of an amplification product produced by a primer or a set of primers is determined empirically and/or predicted from in silico information. For example, suitable primers are determined from a database comprising nucleotide sequence information, such as, for example, the database of the National Center for Biotechnology Information or the Ensembl database available from the European Biotechnology Institute and/or the Wellcome Trust Sanger Institute.

Alternatively, or in addition, amplification products having sufficiently different lengths are determined from a database of allele length data, e.g., , information concerning the length of amplification products produced by amplifying specific alleles or markers, e.g., a SSR. Suitable databases of such information are known in the art and include, for example, the Multiplex-Ready Marker Database available from Molecular Plant Breeding CRC, Victoria, Australia; the Plant Simple Sequence Repeat Database available from Clemson University Genomics Institute, Clemson, SC, USA; or the cotton SSR database available from Cotton Functional Genomics Center, University of California, Davis, CA, USA. Following determining amplification products having suitably different lengths one or more primer(s) or sets of primers is/are designed, produced or obtained that is/are capable of amplifying said amplification products. Such primers may be, for example, produced using a method described herein or obtained from a commercial source.

Based on this information primers or sets of primers are selected that produce amplification products having a sufficient difference in length to permit their resolution by a means that fractionates nucleic acid according to its length. For example, primers capable of producing amplification products having at least 5 nucleotide residues difference in length are selected. Preferably, primers capable of producing amplification products having at least 6 nucleotide residues difference in length are selected. Preferably, primers capable of producing amplification products having at least 7 nucleotide residues difference in length are selected. Preferably, primers capable of producing amplification products having at least 8 nucleotide residues difference in length are selected. Preferably, primers capable of producing amplification products having at least 9 nucleotide residues difference in length are selected. Preferably, primers capable of producing amplification products having at least 10 nucleotide residues difference in length are selected. Preferably, primers capable of producing amplification products having at least 15 nucleotide residues difference in length are selected. Preferably, primers capable of producing amplification products having at least 20 nucleotide residues difference in length are selected. Preferably, primers capable of producing amplification products having at least 25 nucleotide residues difference in length are selected. Preferably, primers capable of producing amplification products having at least 50 nucleotide residues difference in length are selected.

In a preferred embodiment, the primer(s) or set(s) of primers is(are) selected using a computer-based algorithm or nucleic acids to be amplified is(are) selected using a computer-based algorithm. For example, a computer-based algorithm is used that analyses the predicted length of each of the amplification products that are proposed to be amplified. Said algorithm then selects those amplification products that are of sufficiently different lengths to permit their resolution by a means that fractionates nucleic acid according to its length. Based on the selected amplification products, primers capable of amplifying said amplification products are selected, produced or obtained.

In a preferred embodiment, the algorithm selects one or more sets of first primers suitable for amplifying a plurality of amplification products. The algorithm preferably groups primers suitable for producing amplification products of sufficiently different lengths to permit their resolution by a means that fractionates nucleic acid according to its length to produce a set of primers, wherein the primers are grouped to reduce or minimize the number of sets of first primers required to amplify the plurality of nucleic acids.

Alternatively, or in addition, the algorithm selects one or more nucleic acids to be amplified or detected in a reaction from a plurality of nucleic acids. The algorithm preferably groups nucleic acids of sufficiently different lengths to permit their resolution by a means that fractionates nucleic acid according to its length, wherein the nucleic acids are grouped to reduce or minimize the number of groups required to amplify the plurality of nucleic acids.

Suitable algorithms will be apparent to the skilled artisan and/or are commercially available. For example, the BINNER software available from Molecular Plant Breeding CRC, Victoria, Australia is a software program that implements a suitable algorithm.

Preferably, the algorithm selects suitable primers or nucleic acids from a database of allele length data for nucleic acids. Suitable databases will be apparent to the skilled artisan and include a database discussed supra. Alternatively, a suitable database is produced, e.g., using suitable software, and accessed by the algorithm. In this respect, such a database may be stored or saved on a computer-readable medium, such as, for example, a diskette, a CD-ROM or a computer.

Preferably, the algorithm then selects, using this data, those primers capable of producing amplification products that are of sufficiently different lengths to permit their resolution by a means that fractionates nucleic acid according to its length.

Alternatively, or in addition, the algorithm selects nucleic acids or amplification products that are of sufficiently different lengths to permit their resolution by a means that fractionates nucleic acid according to its length.

Alternatively, or in addition, in the case of a plurality of nucleic acids to be amplified, the algorithm preferably determines one or more groups of nucleic acids that are of sufficiently different lengths to permit their resolution by a means that fractionates nucleic acid according to its length or nucleic acids capable of producing amplification products comprising same. Preferably, the number of groups is minimized or reduced.

In a preferred embodiment, the algorithm is stored in a computer-readable medium, for example, a computer-readable diskette, a computer-readable CD-ROM or memory of a computer or web-based database or programme. Computer-based medium shall also be taken to include a web-based means, such as, for example, a web-site or access to a web-site.

As will be apparent to the skilled artisan from the foregoing, the computer-based algorithm may be in the form of a computer program or a computer code.

The present invention clearly contemplates such a computer-based algorithm, whether in the form of a computer program or a computer code or stored on a computer-based medium.

Preferably, the computer-based algorithm is provided in any form as a component of a kit.

The embodiments described herein relating to determining or selection one or more first primer(s) or set(s) of first primers shall be taken to apply mutatis mutandis to methods for selecting amplification products that may be amplified in a multiplex reaction and/or detected in a single reaction.

Primer synthesis

Following design and or analysis a specific the primer is produced and/or synthesized. Methods for producing/synthesizing a primer of the present invention are known in the art. For example, oligonucleotide synthesis is described, in Gait (Ed) (In: Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, 1984). For example, a probe or primer may be obtained by biological synthesis (eg. by digestion of a nucleic acid with a restriction endonuclease) or by chemical synthesis. For short sequences (up to about 100 nucleotides) chemical synthesis is preferable.

In one embodiment, a nucleotide comprising deoxynucleotides (e.g., a DNA based oligonucleotide) is produced using standard solid-phase phosphoramidite chemistry. Essentially, this method uses protected nucleoside phosphoramidites to produce a short oligonucleotide (i.e., up to about 80 nucleotides). Typically, an initial 5'-protected nucleoside is attached to a polymer resin by its 3'-hydroxy group. The 5' hydroxyl group is then de-protected and the subsequent nucleoside-3'-phophoramidite in the sequence is coupled to the de-protected group. An internucleotide bond is then formed by oxidizing the linked nucleosides to form a phosphotriester. By repeating the steps of de-protection, coupling and oxidation an oligonucleotide of desired length and sequence is obtained. Suitable methods of oligonucleotide synthesis are described, for example, in Caruthers, M. H., et al., "Methods in Enzymology," Vol. 154, pp. 287-314 (1988).

Other methods for oligonucleotide synthesis include, for example, phosphotriester and phosphodiester methods (Narang, et al. Meth. Enzymol 68: 90, 1979) and synthesis on a support (Beaucage, et al Tetrahedron Letters 22: 1859-1862, 1981), and others described in "Synthesis and Applications of DNA and RNA," S. A. Narang, editor, Academic Press, New York, 1987, and the references contained therein.

For longer sequences standard replication methods employed in molecular biology are useful, such as, for example, the use of Ml 3 for single stranded DNA as described by J. Messing (1983) Methods Enzymol, 101, 20-78.

Alternatively, a plurality of primers are produced using standard techniques, each primer comprising a portion of a desired primer and a region that allows for annealing to another primer. The primers are then used in an overlap extension method that

comprises allowing the primers to anneal and synthesizing copies of a complete primer using a polymerase. Such a method is described, for example, by Stemmer et al, Gene 164, 49-53, 1995.

As discussed supra a primer of the invention may also include one or more nucleic acid analogs. For example, a primer comprises a phosphate ester analog and/or a pentose sugar analog. Alternatively, or in addition, a primer of the invention comprises polynucleotide in which the phosphate ester and/or sugar phosphate ester linkages are replaced with other types of linkages, such as N-(2-aminoethyl)-glycine amides and other amides (see, e.g., Nielsen et al, Science 254: 1497-1500, 1991; WO 92/20702; and USSN 5,719,262); morpholinos (see, for example, USSN 5,698,685); carbamates (for example, as described in Stirchak & Summerton, J Org. Chem. 52: 4202, 1987); methylene(methylimino) (as described, for example, in Vasseur et al, J. Am. Chem. Soc. 114: 4006, 1992); 3'-thioformacetals (see, for example, Jones et al, J. Org. Chem. 58: 2983, 1993); sulfamates (as described, for example in, USSN 5,470,967); 2- aminoethylglycine, commonly referred to as PNA (see, for example, WO 92/20702). Phosphate ester analogs include, but are not limited to, (i) C ₁ -C ₄ alkylphosphonate, e.g. methylphosphonate; (ii) phosphoramidate; (iii) alkyl-phosphotriester; (iv) phosphorothioate; and (v) phosphorodithioate. Methods for the production of a primer comprising such a modified nucleotide or nucleotide linkage are known in the art and discussed in the documents referred to supra.

For example, a probe or primer of the invention comprises one or more LNA and/or PNA residues. Probes or primers comprising one or more LNA or PNA residues have been previously shown to anneal to nucleic acid template at a higher temperature than a probe or primer that comprises substantially the same sequence but does not comprise the LNA or PNA residues. Furthermore, incorporation of LNA into a probe or primer has been shown to result in increased signal produced in reactions in which the level of the probe or primer is limiting (Latorra et al., MoI. Cell Probes 17: 253-259, 2003).

Methods for the synthesis of an oligonucleotide comprising LNA are described, for example, in Nielsen et al, J. Chem. Soc. Perkin Trans., 1: 3423, 1997; Singh and Wengel, Chem. Commun. 1247, 1998. Methods for the synthesis of an oligonucleotide comprising are described, for example, in Egholm et al., Am. Chem. Soc, 114: 1895, 1992; Egholm et al, Nature, 365: 566, 1993; and Oram et al, Nucl Acids Res., 21: 5332, 1993.

The present inventors have also made use of a detectable marker (for example, a fluorescent dye) to enable detection of an amplification product produced using the method of the invention. Accordingly, in one embodiment, at least one primer of the invention comprises or is conjugated to a label. As used herein, the term "label" refers to any moiety which can be attached to a primer of the invention and: (i) provides a detectable signal; (ii) interact with a second label to modify the detectable signal provided by the second label, e.g. FRET (Fluorescent Resonance Energy Transfer); (iii) stabilize annealing, e.g., duplex formation; or (iv) provide a member of a binding complex or affinity set, e.g., affinity, antibody/antigen, ionic complexation, hapten/ligand, e.g. biotin/avidin.

Labelling of a primer is accomplished using any one of a large number of known techniques employing known labels, linkages, linking groups, reagents, reaction conditions, and analysis and purification methods. Labels include, but are not limited to, light-emitting or light-absorbing compounds which generate or quench a detectable fluorescent, chemiluminescent, or bioluminescent signal (for example, as described in Kricka, L. in Nonisotopic DNA Probe Techniques (1992), Academic Press, San Diego, pp. 3-28). Fluorescent reporter dyes useful for labelling biomolecules include, but are not limited to, fluoresceins (see, for example USSN 5,188,934; 6,008,379; or USSN 6,020,481), rhodamines (as described, for example, in USSN 5,366,860; USSN 5,847,162; USSN 5,936,087; or USSN 6,051,719), benzophenoxazines (for example, as described in USSN U.S. Pat. No. 6,140,500), energy-transfer fluorescent dyes, comprising pairs of donors and acceptors (as described in USSN 5,863,727; USSN 5,800,996; or 5,945,526), or a cyanine (as described, for example, in WO 97/45539). Exemplary fluorescein dyes include, but are not limited to, 6-carboxyfluorescein; 2',4',1,4,-tetrachlorofluorescein; and 2',4',5',7 ^I ,l,4-hexachlorofluorescein. Labels also include, but are not limited to, semiconductor nanocrystals, or quantum dots (as described, for example in USSN 5,990,479 or USSN 6,207,392). Suitable methods for linking a label to a primer (or labelling a primer) are also describe din the references supra.

Alternatively, or in addition, the probe or primer is produced with a fluorescent nucleotide analog to facilitate detection. For example, coupling allylamine-dUTP to the succinimidyl-ester derivatives of a fluorescent dye or a hapten (such as biotin or digoxigenin) enables preparation of many common fluorescent nucleotides. Such a

method is described in, for example Henegariu, Nat, Biotechnol. 75:345-348, 2000. Other fluorescent nucleotide analogs are also known in the art and described, for example, Jameson, Methods Enzymol. 278:363-390, 1997 or USSN 6,268,132. Such nucleotide analogs are incorporated into nucleic acids, e.g., DNA and/or RNA, or oligonucleotides, via either enzymatic or chemical synthesis (e.g., a method described supra).

In a particularly preferred embodiment, a primer of the invention is labelled with a fluorescent dye, such as, for example, 6-carboxyfluorescein (FAM), VIC, NED or PET. To label a primer with a fluorescent dye a simple two-step process is used. In the first step, an amine-modifϊed nucleotide, 5-(3-aminoallyl)-dUTP, is incorporated into DNA using conventional enzymatic labeling methods. This step ensures relatively uniform labeling of the probe with primary amine groups. In the second step, the amine- modified DNA is chemically labeled using an amine-reactive fluorescent dye. Various commercial kits for labelling a primer are known in the art and available from, for example, Molecular Probes (Invitrogen detection Technology) (Eugene, OR, USA) or Applied Biosystems (Foster City, CA, USA).

Commercial sources for the production of a labelled probe or primer or for a suitable label will be known to the skilled artisan, e.g., Sigma-Genosys, Sydney, Australia or Applied Biosystems, Foster City, CA, USA.

Using any method for oligonucleotide synthesis described herein and/or known in the art a first primer or group thereof and/or a second primer or group thereof is synthesized.

In another embodiment, a first primer of the invention is produced by coupling an oligonucleotide comprising a tag region to an oligonucleotide comprising a sequence enabling specific annealing to a nucleic acid template. For example, an oligonucleotide comprising a tag region is linked to another oligonucleotide using a RNA ligase, such as, for example T4 RNA ligase (as available from New England Biolabs). An RNA ligase catalyzes ligation of a 5' phosphoryl-terminated nucleic acid donor to a 3' hydroxyl-terminated nucleic acid acceptor through the formation of a 3'-5' phosphodiester bond, with hydrolysis of ATP to AMP and PPj. Suitable methods for the ligation of DNA and/or RNA molecules using a RNA ligase are known in the art and/or described in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley

Interscience, ISBN 047 150338, 1987) and Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).

The present invention additionally provides a first and/or second primer of the invention, for example, as produced using a method known in the art and/or described herein.

In one embodiment, a second primer of the invention is capable of annealing to an amplicon produced using a first primer.

Clearly the present invention additionally contemplates a kit comprising one or more first primers and/or one or more second primers. The kit optionally comprises reagents suitable for amplification of a nucleic acid using the method of the invention (e.g., a buffer and/or one or more deoxynucleotides and/or a polymerase). Optionally, the kit is packaged with instructions for use.

2. Nucleic acid amplification

The method of the present invention is based on the amplification of a template nucleic acid using multiple rounds of PCR in a single reaction vessel. Accordingly, this single reaction vessel contains all of the components required for the performance of the multiple PCRs. Reagents required for a PCR are known in the art and include for example, one or more primers (described herein), a suitable polymerase, deoxynucleotides and/or ribonucleotides, a buffer. Suitable reagents are described for example, in Dieffenbach (ed) and Dveksler (ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995).

For example, a suitable polymerase for use in the method of the invention include, a DNA polymerase, a RNA polymerase, a reverse transcriptase, a T7 polymerase, a SP6 polymerase, a T3 polymerase, Sequenase™, a Klenow fragment, a Taq polymerase, a Taq polymerase derivative, a Taq polymerase variant, a Pfu polymerase, a Pfx polymerase, an AmpliTaq™ FS polymerase, a thermostable DNA polymerase with minimal or no 3 '-5' exonuclease activity, or an enzymatically active variant or fragment of any of the above polymerases. Preferably, a polymerase used in the method of the invention is a thermostable polymerase.

In one embodiment, a mixture of two or more polymerases is used. For example, the mixture of a Pfx or Pfu polymerase and a Taq polymerase has been previously shown to be useful for amplifying templates comprising a high GC content or for amplifying a large template.

Suitable commercial sources for a polymerase useful for the performance of the invention will be apparent to the skilled artisan and include, for example, Stratagene (La Jolla, CA, USA), Promega (Madison, WI, USA), Invitrogen (Carlsbad, CA, USA), Applied Biosystems (Foster City, CA, USA) and New England Biolabs (Beverly, MA, USA).

In a preferred embodiment, the amplification reaction used is a PCR or a variant thereof. A suitable variant of a PCR includes, for example, one-armed (or single- primer PCR), reverse-transcriptase mediated PCR (RT-PCR), nested PCR, touch-up and loop incorporated primers (TULIP) PCR, touch-down PCR, competitive PCR, rapid competitive PCR (RC-PCR) or multiplex PCR. Preferably, the amplification reaction is a PCR or a multiplex PCR. Preferably, the amplification reaction is a PCR or a multiplex PCR.

Methods of PCR are known in the art and described, for example, in Dieffenbach (ed) and Dveksler (ed) {In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995). Generally, for PCR two non-complementary nucleic acid primers comprising at least about 8, more preferably, at least about 15 or 20 nucleotides are annealed to different strands of a template nucleic acid, and amplicons of the template are amplified enzymatically using a polymerase, preferably, a thermostable DNA polymerase.

Ih adapting the general PCR technique to the present invention, an initial reaction is performed wherein one or more nucleic acid templates are amplified using one or more sets of first primers. Each primer of a set of primers anneals to a different strand of the template nucleic acid such that the target region is defined by the sites of annealing. At this stage the second set of primers is unable to anneal to target nucleic acid. The intervening region of nucleic acid is then replicated enzymatically, for example, using a polymerase. By cycling the temperature to enable denaturation of template nucleic acid, annealing of the primer/s and polymerase mediated replication of nucleic acid, the nucleic acid template is amplified. Following a sufficient number of cycles for

substantial incorporation of the first primer into amplification products and little or no unincorporated primer remaining, the annealing temperature is reduced and the second set of primers are able to anneal to amplicons produced using the first set of primers. Following further cycles, the nucleic acid template is amplified.

^" While the first primers used in the reaction comprise a tag sequence it will be apparent to the skilled artisan that each primer in the first set of primers need not comprise the same tag region. Rather, the primer that anneals to the sense strand of the nucleic acid template comprises one tag and the primer that anneals to the antisense strand comprises a distinct tag. For example, the present inventors have produced a primer capable of annealing to the sense strand of a nucleic acid template that comprises tag region and a primer capable of annealing to the complement thereof. Accordingly, a set of different second primers is used to amplify the amplicons produced by the first primers.

The present invention uses a form of amplification (e.g., PCR) known as exhaustive PCR. Exhaustive PCR is thus named as a primer or set of primers used in the reaction is exhausted (or incorporated into amplicons) such that a detectable level of amplification initiated by that primer or set of primers no longer detectably occurs.

Without being limited by theory or mode of action, by ensuring the exhaustion of the first primer or set thereof the inventors have reduced the likelihood of non-specific annealing of the first primer at the reduced annealing temperature used for the second primer. Furthermore, the use of exhaustive PCR also reduces the likelihood of the first and second primer or sets of primers interacting and producing "primer-dimers".

Preferably, a first primer is used at a concentration of between about 7.5nM and about 25OnM, more preferably between about 2OnM and about 20OnM, even more preferably between about 5OnM and about 15OnM and still more preferably between about 75nM and about 10OnM. In one embodiment, a first primer is used at about 23nM or about 3OnM of primer or about 4OnM of primer or about 8OnM of primer.

In one embodiment, the second amplification reaction (i.e., a reaction using a second primer or set thereof) is additionally performed under exhaustive conditions. Accordingly, a PCR is performed under conditions sufficient to amplify the amplicon produced by the first primers said conditions comprising an annealing temperature

suitable for annealing of a second primer or set of second primers and a sufficient number of amplification cycles for the second primer(s) to be substantially incorporated into the amplification product(s) and little or no residual unincorporated second primer.

Using such a method, the level or amount of amplified nucleic acid produced in the amplification reaction is controlled by the amount of the first primer or set thereof and/or the second primer or set thereof. Preferably, a second primer is used at a concentration between about 7.5nM and about 40OnM (e.g., about 23nM or about 3OnM or about 4OnM or about 8OnM), even more preferably about 75 nM to about 250 nM and still more preferably about 75 nM to about 200 nM. In a particularly preferred embodiment, a second primer is present at a concentration of about 75nM or 10OnM, 20OnM, 30OnM or 40OnM.. In one embodiment, a limiting amount of a primer is about 23nM of primer or about 3OnM of primer or about 4OnM of primer or about 8OnM of primer.

For example, when amplifying a single template nucleic acid, a second primer is preferably used at a concentration of between about 50 and 10OnM and more preferably, about 75nM.

When performing a multiplex reaction, e.g., as described herein, the concentration may be increased, however, this is not necessarily required. For example, the present inventors have amplified two template nucleic acids using a second primer concentration between about 50 and 10OnM and more preferably, about 75nM.

When amplifying at least three template nucleic acids a preferred concentration of second primer is at least about 9OnM or 10OnM. For example, the inventors have shown that a concentration of 10OnM of second primer is sufficient to amplify three template nucleic acids using the method of the invention.

A suitable concentration of second primer for amplifying at least six template nucleic acids at least about 175nM or 20OnM, for example, the inventors have shown that a concentration of 20OnM of second primer is sufficient to amplify three template nucleic acids using the method of the invention.

The present invention additionally contemplates RT-PCR. For RT-PCR, RNA is reverse transcribed using a reverse transcriptase (such as, for example, Moloney

Murine Leukemia Virus) to produce cDNA. In this regard, the reverse transcription of the RNA is primed using, for example, a random primer (e.g., a hexa-nucleotide random primer) or oligo-dT (that binds to a poly-adenylation signal in mRNA). Alternatively, a locus-specific primer is used to prime the reverse transcription (e.g., a first primer of the invention). A sample is heated to ensure production of single stranded nucleic acid and then cooled to enable annealing of the primer. The sample is then incubated under conditions sufficient for reverse-transcription of the nucleic acid adjacent to an annealed primer by a reverse transcriptase. Following reverse transcription, the cDNA is used as a template nucleic acid for a PCR reaction, e.g., as described supra.

As the name suggests single primer PCR uses only one primer to amplify nucleic acid. Generally this technique comprises annealing a first primer to template nucleic acid at sufficiently low stringency to ensure that it anneals to multiple sites in the template. Following polymerase mediated replication, nucleic acid products are produced in those cases wherein the primer has annealed sufficiently closely to enable amplification. Using a second primer or set thereof, the amplified nucleic acid is amplified further. Such a method is useful for, for example, cloning nucleic acid homologs or determining a molecular marker that is diagnostic or characteristic of a disease or trait.

Alternatively, the PCR performed using the second primer of the invention is a single primer PCR. For example, each of the first primers of the invention comprise the same tag at their 5'-termmus and are used in a PCR amplification. A single second primer is then used to amplify the amplicons produced with the first primer.

In another embodiment of the invention, a nested PCR is performed. Nested PCR is described in detail in, for example, Dieffenbach (ed) and Dveksler (ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995). Essentially a nested PCR reaction involves the use of two sets of primers that are specific to a sequence of interest. The first set of primers is used to amplify the nucleic acid template to a desired level. The second set of primers is designed to anneal to a region of the nucleic acid between the sites of annealing of the first primers and further amplify the nucleic acid template. Such a method is useful for, for example, amplifying a nucleic acid template using a small amount of template nucleic acid (e.g., nucleic acid from a single cell). In this regard, a nested PCR reaction is preferably

performed using a second set of primers that comprise a tag region to permit annealing of a further set of primers (i.e. to enable performance of the method of the invention).

In one embodiment, a nested PCR reaction is performed with all primers in a single closed tube. Alternatively, the initial PCR is performed in one tube and the second and third PCRs (i.e. the method of the invention) are performed in a separate closed tube.

In a preferred embodiment, the method of the invention is performed in a multiplex format. As will be apparent from the description herein, a multiplex reaction is used to amplify a plurality of distinct nucleic acids of interest in a single reaction. In adapting the standard method for multiplex PCR to the present invention, an initial amplification reaction is performed using a plurality of sets of first primers, each set capable of amplifying a specific nucleic acid template. A second primer or set of second primers is then used to amplify the amplicons produced using the first primers in what is effectively, a "singleplex" reaction (i.e., a single second primer or set of second primers is used to amplify a plurality of different amplicons).

Ih one embodiment, each of the first primers that anneals to a sense stand comprises a tag region and each of the primers that anneals to the antisense strand comprises another tag region. Each of the nucleic acid templates is then amplified with the sets of first primers. Following amplification with the first primers, the annealing temperature is reduced and the amplification products further amplified using the second primer/s.

This method enables the simultaneous amplification of all nucleic acids amplified in the initial stage of amplification.

In another embodiment, a variety of tag regions are used for the set of first primers.

Accordingly, a subset of amplification products is amplified using a specific set of second primers. Alternatively, all primers comprise the same tag, thereby enabling amplification with a single second primer.

Advantageously, the present inventors have found that the method of the invention requires little optimisation to successfully amplify a plurality of nucleic acids of interest in a single multiplex reaction.

In one embodiment, the amount of each of the first sets of primers required for exhaustive PCR varies between primers or sets of primer. The amount of each set of

primers is preferably selected to ensure that each nucleic acid template is amplified to a desired level. Methods for determining a suitable amount of each primer or set thereof will be apparent to the skilled artisan and include, for example, performing an amplification reaction with each primer set individually to determine a suitable amount of primer (i.e., empirically).

Optionally, a multiplex PCR of the invention comprises an additional amplification step prior to amplification using a locus-specific primer. In particular, this optional step comprises performing an amplification reaction under conditions suitable for annealing of the first and second sets of primers. Preferably, such amplification is performed for a limited number of cycles (for example, 1 to 5 amplification cycles). Such an optional amplification is useful for, for example, performing a multiplex reaction in which plurality of locus specific primers have different Tms.

In a preferred embodiment, a multiplex reaction is performed with two or three or four or five or six or more primers comprising a locus specific region.

3. Detecting amplified nucleic acid

In one embodiment, the amplicon/s produced using the method of the invention is/are separated using gel electrophoresis. The separated amplicon/s is/are then detected using a detectable marker that selectively binds nucleic acid, such as, for example, ethidium bromide, 4'-6-diamidino-2-phenylinodole (DAPI), methylene blue or SYBR® green I or II (available from Sigma Aldrich). Suitable methods for detection of a nucleic acid using gel electrophoresis are known in the art and described, for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) and Sambrook et al (ui: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).

In one embodiment, the nucleic acid is separated using one dimensional agarose, agaorse-acrylamide or polyacrylamide gel electrophoresis. Such separation techniques separate nucleic acids on the basis of molecular weight.

Alternatively, an amplicon is separated using two dimensional electrophoresis and detected using a detectable marker (e.g., as described supra). Two dimensional agarose gel electrophoresis is adapted from the procedure by Bell and Byers Anal. Biochem.

130:527, 1983. The first dimension gel is run at low voltage in low percentage agarose

to separate DNA molecules in proportion to their mass. The second dimension is run at high voltage in a gel of higher agarose concentration in the presence of ethidium bromide so that the mobility of a non-linear molecule is drastically influenced by its shape.

Alternatively, or in addition, an amplification product is characterized or isolated using capillary electrophoresis. Capillary electrophoresis is reviewed in, for example, Heller, Electrophoresis 22:629-43, 2001; Dovichi et al, Methods MoI Biol 167:225-39, 2001; Mitchelson, Methods MoI Biol 162:3-26, 2001; or Dolnik, J Biochem Biophys Methods 47:103-19, 1999. Capillary electrophoresis uses high voltage to separate molecules according to their size and charge. A voltage gradient is produced in a column (i.e. a capillary) and this gradient drives molecules of different sizes and charges through the tube at different rates.

Alternatively, an amplification product is identified and/or isolated using chromatography. For example, ion pair-reversed phase HPLC has been shown to be useful for isolating a PCR product (Shaw-Bruha and Lamb, Biotechniques. 28:794-7, 2000.

Rather than contacting amplified nucleic acid with a detectable marker, the present invention additionally contemplates using a primer that comprises a detectable marker to facilitate detection of an amplicon. For example, a second primer of the invention is labelled with a detectable marker using a method known in the art and/or described herein and used in the method of the invention.

The use of such a labelled second primer is particularly useful in the performance of a multiplex reaction of the invention as it facilitates the rapid and inexpensive labelling of all nucleic acid amplified with said primer (i.e., all amplicons in a single multiplex reaction are labelled with one primer). In this regard, the use of a plurality of tag sequences and their corresponding labelled second primers facilitates labelling of subsets of nucleic acids with different labels.

Amplified nucleic acid is then readily detected by detecting the label. In the case of a radiolabeled primer, the detection technique may comprise, for example, the use of a photographic film. In the case of a fluorescently labelled primer, the nucleic acid is

detected, for example, by exposing the gel to light of a suitable wavelength to excite the label and detecting the fluorescence produced therefrom.

The present invention particularly contemplates an automated or semi-automated method for detection of a nucleic acid of the invention. For example, the present inventors have used polyacrylamide gel electrophoresis to separate nucleic acids and an automated system to detect each amplified nucleic acid. Such automated systems are available from, for example, Applied Biosystems.

In another embodiment, the amplified nucleic acid is detected using, for example, mass spectrometry (e.g., MALDI-TOF). For example, a sample comprising nucleic acid amplified using the method of the invention is incorporated into a matrix, such as for example 3-hydroxypropionic acid, α-cyano-4-hydroxycinnamic acid, 3,5 dimethoxy-4- hydroxycinnamic acid (Sinapinic acid) or 2,5 dihydroxybenzoic acid (Gentisic acid). The sample and matrix are then spotted onto a metal plate and subjected to irradiation by a laser, promoting the formation of molecular ions. The mass of the produced molecular ion is analyzed by its time of flight (TOF), essentially as described by Yates, J Mass Spectrom. 33, 1-19, 1998 and references cited therein. A time of flight instrument measures the mass to charge ratio (m/z) ratio of an ion by determining the time required for it to traverse the length of a flight tube. Optionally, such a TOF mass analyzer includes an ion mirror at one end of the flight tube that reflects said ion back through the flight tube to a detector. Accordingly, an ion mirror serves to increase the length of a flight tube, increasing the accuracy of this form of analysis. By determining the time of flight of the ion, the molecular weight of an amplified nucleic acid is determined.

The advantage of this form of technique is that an amplification product is detected and characterised without the requirement for labelling of the nucleic acid.

Variations of MALDI-TOF are available in the art and will be apparent to the skilled artisan.

Clearly, the present invention additionally contemplates the use of a high-throughput method to detect a nucleic acid amplified using a method of the present invention. For example, a nucleic acid microarray is used to detect a nucleic acid amplified using the method of the invention.

In one embodiment of the invention, a detection reaction is performed to detect a nucleic acid produced by the method of the invention. For example, the detection reaction is performed to detect the entire amplified nucleic acid, or alternatively, a detection reaction is performed to detect a portion of the amplified nucleic acid. For instance, the method of the invention is useful for amplifying a nucleic acid comprising a genetic marker such as, for example a SSR or a SNP and subsequently detecting the genetic marker.

Many detection methods currently in use are unable to directly detect a nucleic acid from a biological sample. Rather, they require amplification of a nucleic acid template prior to detection. The present invention provides the means to rapidly, specifically and inexpensively amplify a template nucleic acid (or a plurality of nucleic acid templates) for use with such a detection reaction.

In one embodiment, the nucleic acid is amplified using a primer labelled with a tag, such as, for example, biotin. Such a biotinylated primer facilitates isolation of amplified nucleic acid, e.g., using a streptavidin coated chip or bead. The isolated amplified nucleic acid or nucleic acid therein is then detected using a method known in the art and/or described herein. For example, the nucleic acid is denatured to produce single-stranded DNA, and a genetic marker of interest therein detected using a hybridization reaction, e.g., a hybridization reaction described below.

In one embodiment, the detection reaction is a hybridization reaction. A suitable hybridization based assay will be apparent to the skilled artisan and/or described herein.

For example, a fluorescently labelled locked nucleic acid (LNA) molecule or fluorescently labelled protein-nucleic acid (PNA) molecule is used to detect a nucleic acid (e.g., a specific nucleotide in a sample, e.g., a SNP) (as described in Simeonov and Nikiforov, Nucleic Acids Research, 30(17): 1-5, 2002). LNA and PNA molecules bind, with high affinity, to nucleic acid, in particular, DNA. Flurophores (in particular, rhodomine or hexachlorofluorescein) conjugated to the LNA or PNA probe fluoresce at a significantly greater level upon hybridization of the probe to nucleic acid template compared to a probe that has not hybridized to a target nucleic acid. However, the level of increase of fluorescence is not enhanced to the same level when even a single nucleotide mismatch occurs. Accordingly, the degree of fluorescence detected in a

sample is indicative of the presence of a mismatch between the LNA or PNA probe and the target nucleic acid, such as, in the presence of a SNP or SSR in a nucleic acid amplified using a method described supra.

As will be apparent to the skilled artisan, LNA or PNA detection technology is amenable to a high-throughput detection of one or more markers immobilising an LNA or PNA probe to a solid support, as described in Oram et ah, Clin. Chem. 45: 1898- 1905, 1999.

Similarly, Molecular Beacons™ are useful for detecting specific nucleotides, eg., a SNP or a SSR in an amplified nucleic acid produced using the method of the invention (see, for example, Mhlang and Malmberg, Methods 25: 463-471, 2001). Molecular Beacons™ are single stranded nucleic acid molecules with a stem-and-loop structure. The loop structure is complementary to the region surrounding the nucleic acid of interest. The stem structure is formed by annealing two "arms" that are complementary to each other and that are on either side of the probe (loop). A fluorescent moiety is bound to one arm and a quenching moiety, that suppresses any detectable fluorescence when the molecular beacon is not bound to a target sequence, is bound to the other arm. Upon binding of the loop region to its nucleic acid template the arms are separated and fluorescence is detectable. However, even a single base mismatch significantly alters the level of fluorescence detected in a sample. Accordingly, the presence or absence of a particular base at the site of a SNP or SSR is determined by the level of fluorescence detected.

A nucleic acid of interest (e.g., SNP or SSR) in an amplified product can also be identified by hybridization to nucleic acid arrays, an example of which is described in WO 95/11995. WO 95/11995 also describes subarrays that are optimized for detection of a variant form of a precharacterized polymorphism. Such a subarray contains probes designed to be complementary to a second reference sequence, which is an allelic variant of the first reference sequence. The second group of probes is designed by the same principles, except that the probes exhibit complementarity to the second reference sequence. The inclusion of a second group (or further groups) can be particularly useful for analyzing short subsequences of the primary reference sequence in which multiple mutations are expected to occur within a short distance commensurate with the length of the probes (e.g., two or more mutations within 9 to 21 bases).

61

Cycling Probe Technology uses chimeric synthetic probe that comprises DNA-RNA- DNA that is capable of hybridizing to a target sequence. Upon hybridization to a target sequence the RNA-DNA duplex formed is a target for RNase H thereby cleaving the probe. The cleaved probe is then detected using, for example, electrophoresis or MALDI-TOF.

In another embodiment, a genetic marker within a nucleic acid amplified using the method of the invention is detected using an amplification reaction. Again, a suitable amplification reaction will be apparent to the skilled artisan.

For example, a ligase chain reaction (described in EU 320,308 and US 4,883,750) uses at least two oligonucleotides that bind to a nucleic acid template in such a way that they are adjacent. A ligase enzyme is then used to link the oligonucleotides. Using theπnocycling the ligated oligonucleotides then become a target for further oligonucleotides. The ligated fragments are then detected, for example, using electrophoresis, or MALDI-TOF. Alternatively, or in addition, one or more of the probes is labelled with a detectable marker, thereby facilitating rapid detection. By using a probe or primer that hybridizes to the nucleic acid at the site of the genetic marker such that it is only capable of being linked to the second probe or primer in the presence of a specific marker (e.g., a specific allele) the presence or absence of a marker is detected.

Alternatively, a nucleic acid (e.g., a SNP) is detected using single stranded conformational polymorphism (SSCP) analysis. SSCP analysis relies upon the formation of secondary structures in nucleic acids and the sequence dependent nature of these secondary structures, hi one form of this analysis an amplification method, such as, for example, a method described supra, is used to amplify a nucleic acid that comprises a SNP. The amplified nucleic acids are then denatured, cooled and analyzed using, for example, non-denaturing polyarcrylamide gel electrophoresis, mass spectrometry, or liquid chromatography (eg. HPLC or dHPLC). Regions that comprise different sequences form different secondary structures, and as a consequence migrate at different rates through, for example, a gel and/or a charged field. Clearly, a detectable marker may be incorporated into a probe/primer useful in SSCP analysis to facilitate rapid marker detection.

Allele specific PCR (as described, for example, In Liu et al, Genome Research, 7: 389- 398, 1997) is also useful for determining the presence of one or other allele of a SNP. An oligonucleotide is designed, in which the most 3' base of the oligonucleotide anneals to a specific form of the SNP of interest (i.e., allele). During a PCR reaction, if the 3' end of the oligonucleotide does not anneal to a target sequence, little or no PCR product is produced, indicating that a base other than that present in the oligonucleotide is present at the site of SNP in the sample. PCR products are then detected using, for example, gel or capillary electrophoresis or mass spectrometry.

In adapting allele-specific PCR to the present invention, in one embodiment, a nucleic acid comprising an allele to be tested is amplified using the method of the present invention. The amplified nucleic acid is then used in a reaction with one or more allele specific primers to determine the presence or absence of an amplification product of interest.

In another embodiment, a first primer of the invention is an allele specific primer. Accordingly, only in the presence of a specific allele will the first primer anneal to the template nucleic acid sufficiently to produce an amplification product. Accordingly, detection of an amplification product is indicative of indicative of a specific allele.

Primer extension methods (described, for example, in Dieffenbach (ed) and Dveksler (ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995)) are also useful for the detection of a SNP or SSR or a nucleic acid of interest. An oligonucleotide is used that anneals to the region of a nucleic acid adjacent to the nucleic acid of interest. This oligonucleotide is then used in a primer extension protocol with a polymerase and a free nucleotide diphosphate that corresponds to either or any of the possible bases that occur at the nucleic acid of interest. Preferably the nucleotide- diphosphate is labelled with a detectable marker (e.g. a flurophore). Following primer extension, unbound labelled nucleotide diphosphates are removed, e.g. using size exclusion chromatography or electrophoresis, or hydrolized, using for example, alkaline phosphatase, and the incorporation of the labelled nucleotide into the oligonucleotide is detected, indicating the base that is present at the site of the nucleic acid of interest.

In yet another embodiment, the presence of a genetic marker in a nucleic acid amplified using the method of the invention is detected using pyrosequencing, such as, for

example, as described in Uhlmann et at, Electrophoresis, 23: 4072 -4079, 2002. Essentially this method is a form of real-time sequencing that uses a primer that anneals to a site adjacent or close to the site of a genetic marker of interest. Following annealing of the primer and template in the presence of a DNA polymerase each of four modified deoxynucleotide triphosphates is added separately according to a predetermined dispensation order. Only an added nucleotide that is complementary to the template nucleic acid is incorporated and inorganic pyrophosphate (PPi) is liberated. The liberated PPi then drives a reaction resulting in production of detectable levels of light. Such a method allows determination of the identity of a specific nucleotide adjacent to the site of annealing of the primer.

In a still further embodiment, a primer of the present invention comprises an additional region (e.g., a second tag region) that comprises a binding site for a polymerase, preferably, an PvNA polymerase. For example, a primer comprises a T7 or a T3 polymerase binding site. Such a polymerase binding site permits detection and/or identification of the genetic marker in amplified nucleic acid using a method known in the art, such as, for example, RNaseCut (Krebs et at, Nucleic Acids Research, 31: e37, 2003). Essentially, the RNaseCut method comprises amplifying nucleic acid comprising a genetic marker of interest, e.g., a SNP, using a primer of the present invention additionally comprising an PvNA polymerase binding site. The amplified nucleic acid is then transcribed using the RNA polymerase, and the resulting RNA digested with a RNase capable of cleaving a particular RNA sequence, such as, for example, guanosine- specific ribonuclease Tl. The resulting RNA fragments are then analysed using mass spectrometry to determine, for example, a change in the number of RNA fragments produced compared to a control sample.

4. Characterisation of an individual or group of individuals As the present invention is useful for amplification and detection of a genetic marker, the invention has clear application in determining relationships between one or more individuals, isolates of an organism, cultivars of an organism, species or genera. Furthermore, the present invention is useful for identifying an individual, isolate of an organism, cultivar of an organism, species or genus. Accordingly, the present invention additionally provides a method comprising performing a method described herein to detect one or more polymorphic nucleic acid/s in an individual, isolate of an organism, cultivar of an organism, species or genus wherein the polymorphic nucleic acid detected identifies and/or characterizes the individual, isolate of an organism, cultivar of an organism, species or genus.

Furthermore, the detection of polymorphic nucleic acid facilitates differentiation between related organisms. For example, should a population of inbred or highly related organisms be used for a genetic mapping experiment, the method of the invention is useful for determining those organisms that, for example, comprise a phenotype of interest, and only comprise one region of nucleic acid different to a related organism.

For example, the method of the invention is useful for a form of genetic mapping, such as, for example bulked segregant analysis (BSA). In its simplest form this form of analysis uses nucleic acid from a plurality of organisms (preferably, plants) that only differ in one trait (e.g., as a result of mutation or introgression). Nucleic acid from organisms with one phenotype is pooled, as is nucleic acid from organisms with the other phenotype. Using the method of the invention, a region of nucleic acid in which the two pools of nucleic acid differ is determined. Such a method is particularly useful for, for example, mapping of a gene responsible for a monogenic trait or a quantitative trait. Suitable methods for BSA are described, for example, in Wang and Paterson Theor. Appl Genet. 55:355-361, 1994 and Mackay and Caligari Crop Science 40:626- 630, 2000.

Clearly, the present invention contemplates performing a multiplex reaction to identify or characterize an individual, isolate of an organism, cultivar of an organism, species or genus, for example, the detection of a plurality of genetic markers such as, for example, SNP or SSR.

As used herein, the term "genetic marker" shall be taken to mean a nucleic acid that is polymorphic between, for example, two or more individuals (e.g., related individuals), isolates of an organism, cultivars of an organism, species or genera. Preferable, a genetic marker is additionally linked to or associated with a trait of interest.

As used herein, the term "linked to" shall be taken to mean that there is sufficient proximity between a genetic marker (e.g., a polymorphic nucleic acid) and a nucleic acid that causes a trait of interest to permit said linked nucleic acid to be predictive of said trait.

As used herein, the term "associated with" shall be taken to mean that the presence of a specific genetic marker is significantly correlated with a trait of interest in an organism or a population of organisms. Preferably, the presence of the genetic marker is significantly correlated with the presence of the trait of interest in a population of unrelated organisms.

A suitable amplification and/or detection reaction is described supra and is to be taken to apply mutatis mutandis to the present embodiment of the invention. For example, the present embodiment of the invention is used to amplify a plurality of nucleic acids, each comprising a SNP. Following amplification, the allele present at the site of each SNP is determined using a method described herein.

Clearly, the method of the present invention has broad reaching application in any assay that detects one or more genetic markers. Accordingly, the present invention is useful for, for example, marker assisted breeding programs (e.g., animal husbandry), gene mapping, identification of specific strains, isolates or cultivars of plants, identification of organisms likely to have a trait of interest and diagnosis of a disease or disorder.

Genetic markers in plants

Genetic markers are used for a variety of purposes in association with plants. For example, one or more genetic markers is (are) used to identify a specific plant variety.

For instance, a plant that is protected by an intellectual property right is characterised to determine one or more genetic markers that are specific to said plant. This then enables

simple and rapid characterisation of similar plants to determine whether or not an intellectual property right has been infringed.

In another embodiment, a plant or plant matter (e.g., a foodstuff comprising plant matter) is screened to determine whether or not it is or comprises or is a genetically modified organism. Such a screen is useful for, for example, determining whether or not a food product must be labelled to state that it contains a genetically modified product, or alternatively, for the detection of a specific genetically modified organism that is the subject of an intellectual property right.

For example, Rudi et at, Nucl. Acids Res. 31: e62, 2003 describe a variety of markers useful for detecting a transgenic plant based on the detection of a region of a transgenic expression construct. Adapting these studies to the present invention, either a multiplex PCR or a singleplex PCR is performed using a method of the invention to detect one or more nucleic acids that are found within a plant transgenic expression construct. Examples of suitable nucleic acids and suitable primers include, for example:

(i) 35S promoter GCTCCTACAAATGCCATCA (SEQ ID NO: 15); and

CTTGCTTTGAAGACGTGGTTGG (SEQ ID NO: 16); (ii) Nos promoter GAATCCTGTTGCCGGTCTTG (SEQ ID NO: 17); and

AATTTATCCTAGTTTGCGCGCTA (SEQ ID NO: 18); (iii) CrylAb gene (Bt) TGCTATGCGGGAGCTGCG (SEQ ID NO: 19); and

(MON810 event)A ATAAAGTGACAGATAGCTGGGCA (SEQ ID NO: 20); (iv) CrylAb gene (Bt) CGCACAATCCCACTATCCTT (SEQ ID NO: 21); and (BtIl event) GCCTCCCAGAAGTAGACGTC (SEQ ID NO: 22).

By producing these primers with a tag sequence at their 5' ends, a set of first primers for use in the present invention is produced. The second primers are then used to amplify amplicons produced using the previously described primers, thereby enabling detection of a plant or plant matter derived from a genetically modified organism. Additional suitable primers for the detection of transgenic plants, such as, for example, maize of soybean are known in the art and described, for example, in Germini et at, J. Agric.food Chem., 52: 3275-3280, 2004.

In another embodiment, the present invention is used to determine a plant that is likely to comprise a phenotype of interest. Such a phenotype is, for example, resistance to a

pest, enhanced growth or biomass production or enhanced fruit production, amongst others. For example, Moczulski and Salmanowicz, J Appl. Genetics 44: 459-471, 2003, describe an assay for determining wheat with an enhanced bread-making phenotype (based on the presence of HMW glutenin alleles). In adapting the assay to the present invention, the following primers are produced with a tag sequence located at their 5' end: (i) ACGTTCCCCTACAGGTACTA (SEQ ID NO: 23); and

TATCACTGGCTAGCCGACAA (SEQ ID NO: 24); (ii) CCATCGAAATGGCTAAGCGG (SEQ ID NO: 25); and GTCCAGAAGTTGGGAAGTGC (SEQ ID NO: 26)

(iii) CCGATTTTGTTCTTCTCACAC (SEQ ID NO: 27); and

CACCAAGCGAGCTGCAGAT (SEQ ID NO: 28) (iv) ATGGCTAAGCGCCTGGTCCT (SEQ ID NO: 29); and

TGCCTGGTCGACAATGCGTCGCTG (SEQ ID NO: 30) (v) GCCTAGCAACCTTCACAATC (SEQ ID NO: 31); and

GAAACCTGCTGCGGACAAG (SEQ ID NO: 32) (vi) GTTGGCCGGTCGGCTGCCATG (SEQ ID NO: 33); and

TGGAGAAGTTGGATAGTACC (SEQ ID NO: 34)

These primers are then used to amplify nucleic acid derived from a wheat plant in a single reaction. Using second primers corresponding to a region of the respective tag sequences each of the amplification products are further amplified. By selecting wheat strains positive for amplification products produced by the primer pairs, a wheat with good bread making quality is selected.

Furthermore, the present invention is useful for marker-assisted selection of a plant that is resistant to a pathogen. For example, adapting the method of Zhang et ah, Theor. Appl. Genet. 109: 433-439, 2004 to the present invention, a set of primers comprising the following nucleotide sequences are produced linked to a tag sequence: (i) TCTGGTGAGGCAAACCTTCTGG (SEQ ID NO: 35); and TCTGGTGAGGGAGGTGTGATGACG (SEQ ID NO: 36).

By performing a PCR reaction with the tagged primers and then with the corresponding second set of primers a plant, preferably a wheat plant, is identified that is resistant to powdery mildew. As will be apparent to the skilled artisan, the instant assay may be

used in a multiplex reaction to determine a plant that is resistant to a plurality of pathogens.

Furthermore, it will be apparent to the skilled artisan that a method that facilitates the rapid analysis of a plurality of genetic markers is useful for gene mapping experiments. Such a method enables, for example, the differentiation between, for example, two individuals that differ in only one nucleic acid (for example, a region of nucleic acid introduced by crossing). Accordingly, the method of the invention enables rapid and inexpensive marker based genetic mapping.

In other embodiments, genetic markers are detected to differentiate between specific cultivars of plant, to determine genetic relationships between specific cultivars of a plant and to select plants with desirable characteristics for further analysis.

For example, the present inventors have clearly demonstrated the applicability of the instant invention to the differentiation between various strains of wheat and/or barley. Accordingly, the method of the invention is clearly useful for, for example, identifying a strain of wheat or barley of commercial value or of interest. Such a method is useful for, for example, ensuring the purity of a crop or determining the presence of a contaminating strain of wheat or barley in a sample.

On this basis, one embodiment of the present invention provides a process of characterising or identifying one or more strains of wheat or barley said method comprising: (i) providing in a reaction vessel reagents suitable for performing PCR comprising: (a) an amount of a first primer or set of first primers sufficient to permit amplification of a nucleic acid template without substantial residual unincorporated primer, wherein each first primer comprises a locus-specific and a tag sequence; and (b) a second primer or set of second primers; (ii) performing PCR under conditions sufficient to amplify the nucleic acid template thereby producing an amplification product, wherein said conditions comprise an annealing temperature suitable for annealing of the first primer or set of first primers but not detectably of the second primer or set of second primers and a sufficient number of amplification cycles for the primer(s) to be substantially incorporated into the amplification product and little or no residual unincorporated primer;

(iii) performing PCR under conditions sufficient to amplify the amplification product at (ii), wherein said conditions comprise an annealing temperature suitable for annealing of the second primer or set of second primers; and

(iv) detecting the amplified nucleic acid, wherein the amplified nucleic acid is characteristic of the one or more strains of wheat or barley.

As this embodiment of the invention is useful for amplifying nucleic acids that are polymorphic between individuals (including related individuals), it shall be taken to apply mutatis mutandis to a method for differentiating between two or more related individuals.

Furthermore, the present invention provides a process of characterising or identifying one or more individuals, strains or species of the genus Prunus said method comprising: (i) providing in a reaction vessel reagents suitable for performing PCR comprising:

(a) an amount of a first primer or set of first primers sufficient to permit

, amplification of a nucleic acid template without substantial residual unincorporated primer, wherein each first primer comprises a locus-specific sequence and a tag sequence; and (b) a second primer or set of second primers; (ii) performing PCR under conditions sufficient to amplify the nucleic acid template thereby producing an amplification product, wherein said conditions comprise an annealing temperature suitable for annealing of the first primer or set of first primers but not detectably of the second primer or set of second primers and a sufficient number of amplification cycles for the primer(s) to be substantially incorporated into the amplification product and little or no residual unincorporated primer;

(iii) performing PCR under conditions sufficient to amplify the amplification product at (ii), wherein said conditions comprise an annealing temperature suitable for annealing of the second primer or set of second primers; and (iv) detecting the amplified nucleic acid, wherein the amplified nucleic acid is characteristic of the one or more strains of wheat or barley.

As discussed supra the invention is useful for differentiating between related organisms or individuals. Accordingly, this embodiment shall be taken to apply mutatis mutandis to a method for differentiating between two or more related organisms or individuals.

Genetic markers in humans and animals

The method of the present invention for detecting one or more genetic markers is also useful for, for example, marker assisted breeding of animals and/or to select for those animals with one or more desired traits.

For example, the assay is used to screen animals for enhanced commercial properties, such as, for example, food quality for human consumption. Such an assay is performed to detect one or more markers that is (are) associated with increased marbling in beef. Marbled beef is of commercial importance as consumers in several countries pay a premium price for beef with a high level of marbling. Recently, several markers have been reported that are associated with an increased level of marbling.

For example, Barandse et al., Beef Quality CRC Marbling Symposium, Coffs Harbour pp. 52-57, 2001 describe a SNP in the calpastatin gene (detected using primers comprising the sequence GGGGATGACTACGAGTATGACTG (SEQ ID NO: 37) and GTGAAAATCTTGTGGAGGCTGTA (SEQ ID NO: 38).

Furthermore, researchers have reported markers in the leptin gene are associated with an increased marbling score in cattle (Buchanan et al, Genet SeI Evol. 54:105-16,

2002). Accordingly, by producing primers used by Barandse et al. and/or Buchanan et al., tagged with a tag sequence described herein a multiplex reaction is performed to amplify the respective markers. The amplified nucleic acid is then further amplified using the relevant second set of primers. By subsequently detecting the presence or absence of the described markers cattle with increased marbling scores are identified.

Ciobanu et al, J. Anim. Set 82: 2829-2839, 2004 and Chang et al, Vet. J. 165: 157- 163, 2003 describe markers useful for determining an increased pork quality from a pig. The marker described by Ciobanu et al, occurs in the calpastatin gene, while the marker described by Chang et al, is a dinucleotide repeat (CT) in the desmin gene. Furthermore, a plurality of markers in the melanocortin-4 receptor that are associated with increased meat quality in swine are disclosed in USSN 20040261138. Further markers associated with increased meat quality in pigs include, for example, the microsatellite markers SW413, SW1482, SW439, S0005 and SW904 (described in USSN 20040101842). Clearly each marker described herein may be detected individually using the method of the present invention. Alternatively, a plurality of the

markers may be detected in a single assay (i.e., a multiplex assay) using a method described herein.

Such methods are also applicable to, for example, selecting enhanced race horses (e.g., with enhanced speed and/or endurance), selecting sheep that produce superior wool, or selecting a mammal (e.g., a cow) that produces superior quality milk.

Furthermore, the method of the invention is useful for "typing" an animal or human. Such a process is used for, for example, maternity and/or paternity testing. Typically such an assay involves detecting a plurality of markers (e.g., SSR) that are highly polymorphic in a population in the test organism and in one or more of the suspected parents. By comparing the nucleic acid detected in the samples, it is possible to determine the nature of the relationship (if any) between the test sample and the suspect parent.

Such a typing assay important for human testing, in fact it is regularly used to determine the lineage of an animal, such as, for example, a horse, a cow or a bull. For example, Bowling et ah, Animal Genetics, 28: 247-252, 1997 describe a parallel test that detects 11 dinucleotide microsatellite markers and 15 blood group or protein markers to determine the parentage of a horse with 99.99 percent accuracy. Clearly, the method of the present invention is useful for detecting the microsatellite markers described by Bowling et al. either in parallel or in a multiplex reaction. The microsatellite markers detected were AHT4, AHT5, HMSl, HMS3, HMS6, HMS7, HTG4, HTG6, HTG7, HTGlO and VHL20.

Diagnostics

As the present invention is useful for the detection of genetic differences, it is particularly useful for the diagnosis of a disease or disorder or the presence of one or more infectious agents in a sample. For example, the method of the invention is useful for detecting a genetic change that is associated with a disease or disorder in a human or a non-human animal.

Exemplary common genetic diseases or disorders in humans include, for example, cystic fibrosis, sickle cell anemia, β-thalasemia, albinism, Huntington's disease, Down's Syndrome or muscular dystrophy. Exemplary common diseases in sheep include, for example, dermatosparaxis, erythrocyte glutathione deficiency, globoid cell

leukodystrophy, glycogen storage disease, anury, cataract, glomerulonephritis, and lethal grey. Examples of common genetic diseases in goats include, for example, gynecomastia and anotia-microtia complex. Exemplary genetic diseases in horses include, for example, hyperkalemic periodic paralysis (HYPP), combined immune deficiency syndrome (CID), overo-lethal white syndrome and epitheliogenesis.

The mutations that cause these disorders are now known and, as a consequence, a screen may be developed using the method of the invention to screen for any or all of these disorders in a specific organism.

For example a screen to amplify nucleic acid comprising a mutation associated with cystic fibrosis may be performed using the following primers:

(i) TCACATATGGTATGACCCTC (SEQ ID NO: 39) and

TTGTACCAGCTCACTACCTA (SEQ ID NO: 40); (ii) GCAGAGTACCTGAAACAGGA (SEQ ID NO: 41) and

CATTCACAGTAGCTTACCCA (SEQ ID NO: 42); (iii) CAACTGTGGTTAAAGCAATAGTGT (SEQ ID NO: 43) and

GCACAGATTCTGAGTAACCATAAT (SEQ ID NO: 44);

(iv) TGCTAAAATACGAGACATATTGCA (SEQ ID NO: 45) and ATCTGGTACTAAGGACAG (SEQ ID NO: 46);

(v) TCAATCCAATCAACTCTATACGAA (SEQ ID NO: 47) and

TACACCTTATCCTAATCCTATGAT (SEQ ID NO: 48); (vi) GAACACCTAGTACAGCTGCT (SEQ ID NO: 49) and

AACTCCTGGGCTCAAGTGAT (SEQ ID NO: 50); (vii) TTCAAAGAATGGCACCAGTGT (SEQ ID NO: 51) and

ATAACCTATAGAATGCAGCA (SEQ ID NO: 52); and (viii) AATGTTCACAAGGGACTCCA (SEQ ID NO: 53) and

CAAAAGTACCTGTTGCTCCA (SEQ ID NO: 54).

By producing each primer conjugated to a tag sequence the primers are then used in a multiplex PCR according to the method of the present invention. Following initial amplification with the allele specific primer, all amplified nucleic acid is further amplified with a set of tag specific primers. Following amplification, the specific mutations are detected, for example, using DGGE essentially as described in Fanen et al, Genomics, 13, 770-776, 1992.

In another example a diagnostic method of the invention is performed to detect the presence of a respiratory tract infection using one or more of the primer sets described by Tempelton et al, J. CHn. Microbiol, 42: 1564-1569, 2004 with a tag sequence of the invention. Following exhaustive PCR using these primers, a second reaction with a second primer of the invention is performed. Using such a reaction the following infections are detected: influenza A virus, influenza B virus, RSV, PIVl, and PIV3 infections.

Alternatively, the method is used for the detection of an infection in a non-human animal. For example, the primers used by Ohashi et al, J Virol Methods. 120:79-85,

2004 are used to detect bovine arboviruses using a RT-PCR assay of the invention.

Essentially, RNA isolated from a bovine source is reverse transcribed and amplified using the primers described by Ohashi et al, supra tagged with a tag region of the invention. Following substantial incorporation of each of the primers a second reaction is performed with a second primer of the invention. By determining the molecular weight of the amplified nucleic acid/s the presence and identity of a bovine arbovirus is determined.

As exemplified herein, the present invention is also useful for detecting an infection in a plant. For example, the present invention is useful for detecting a fungal infection in a plant, e.g., an infection by Rhynchosporium secalis. Additional plant infections that may be detected by the method of the present invention include, for example, Tilletia indica Mitra or T. waϊkeri, both of which cause karnal bunt in wheat. Suitable primers for the detection of such a microorganism include, for example, a pair of primers comprising a tag sequence as described herein according to any embodiment and a locus specific sequence comprising a nucleotide sequence such as, for example,

GCAGAATTCAGTGAATCATCAAG (SEQ ID NO: 5343) and

CACTCAAAATCCAACATGC (SEQ ID NO: 5344) or

GCAGAATTCAGTGAATCATCAAG (SEQ ID NO: 5343) and GCAACACTCAAAATCCAACAAT (SEQ ID NO: 5345).

In one embodiment, the nucleic acid that is amplified is within a biological sample. Preferably, the biological sample has been previously isolated from a subject and, as a consequence, the method is performed ex vivo. Suitable biological samples will be apparent to the skilled artisan and include, for example, a body fluid (e.g., blood, saliva or sputum) or a pollen sample, a soil sample or a leaf sample.

Clearly, the method of the invention may comprise comparing the nucleic acid amplified and detected to nucleic acid amplified and detected using a variety of infectious organisms, to thereby detect or determine the organism causing the infection. These comparative samples may be amplified at the same time as the test sample, or alternatively, may be previously amplified and, for example, stored in a library of amplification products.

Clearly, the present invention additionally contemplates a multiplex method for diagnosing a disease or disorder or detecting an infectious organism. Suitable multiplex methods are known in the art and/or described herein.

The invention is further described in the following non-limiting examples:

EXAMPLE 1 A multiplex or singleplex assay for amplifying nucleic acid

1.1 Materials and Methods 1.1.1 Primer synthesis

PCR primers for markers were synthesized with a generic 19-bp nucleotide sequence at their 5' end (Primer sequences are set forth in Tables 6, 7, 12 and 16, and in the Sequence Listing). Specifically, the forward primer (as labelled in Tables 6, 7, 12 and 17) for each marker was synthesised with the 19-bp nucleotide sequence: 5 '- CACGACGTTGTAAAACGAC -3 ' (SEQ ID NO: 13).

The reverse primer (as labelled in Tables 6, 7, 12 and 17) for each marker was synthesised with the 19-bp nucleotide sequence: 5'- GTACATTAAGTTCCCATTAC -3' (SEQ ID NO: 14).

Primer aliquots for each marker were prepared by mixing equimolar amounts of appropriate forward and reverse primer in Ix TE (1 mM EDTA, 10 mM Tris-HCL, pH 8.0), and are hereafter referred to as locus-specific primers.

Generic tag primers, tagF and tagR, were also synthesised and comprise the sequences: 5' ACGACGTTGTAAAA 3' (SEQ ID NO: 55); or 5' CATTAAGTTCCCATTA 3' (SEQ ID NO: 56).

The tagF primer was dye-labelled at its 5' end with VIC®, FAM™, NED™ or PET™ (Applied Biosystems).

1.1.2 Primer optimisation

The optimal concentration of locus-specific primer required for marker amplification was determined empirically. Typically, PCR was performed for each marker using 20, 30, 40 or 80 nM of locus-specific primer. PCR products were electrophoresed on a GelScan2000 instrument as described herein, and the optimal primer concentration was determined by visual inspection of the yield of target amplicon and PCR specificity. The optimal concentration of locus-specific primer was defined as the primer concentration producing a strongly amplified target fragment(s) with a high level of PCR specificity. In instances where it was desirable to adjust the PCR specificity observed for a marker, additional locus-specific primer concentrations were tested.

Locus-specific primer concentrations as low as 7.5 nM, and as high as 240 nM, were used to achieve the desired level of PCR specificity.

1.1.3 Singleplex and multiplex amplification The amplification of SSRs by singleplex and multiplex PCR was performed under identical reaction conditions. PCR was performed in a 6 μl reaction mixture containing 0.2 niM dNTP, be ImmoBuffer (Bioline) (16 mM (NKO ₂ SO ₂ , 0.01% Tween-20, 100 mM Tris-HCl, pH 8:3), 1.5 mM MgCl ₂ , 100 ng/μl bovine serum albumin, 15 nmol each of dye-labeled tagF and unlabeled tagR primer, 50 ng genomic DNA, 0.15 U Immolase DNA polymerase (Bioline) and an appropriate concentration of locus-specific primer (see section 1.1.2, above). For multiplex PCR, locus-specific primers for several markers were added to each reaction at the optimal concentration determined using singleplex amplification. Following an initial denaturation step of 10 min at 95 ⁰ C to heat activate the DNA polymerase, PCR was performed for a total of 55 cycles with the profile: 60 s at 92°C, 90 s at 50°C, 60 s at 72°C for five cycles. The next 20 cycles were with 30 s at 92°C, 90 s at 63°C, and 60 s at 72°C, followed by 40 cycles with 15 s at 92°C, 60 s at 54°C, and 60 s at 72°C, and a final extension step of 10 min at 72°C.

Electrophoresis and visualization of SSR alleles was performed on a GelScan2000 (Corbett Research), or an ABI3700 instrument or an ABI3730 instrument (Applied Biosystems).

For analysis on the GelScan2000, the PCR products were mixed with an equal volume of gel loading buffer (98% formamide, 10 mM EDTA, and 0.5% basic fuchsin as tracking dye), heated for 3 min at 95 °C, chilled quickly on ice and separated on a 4% sequencing gel (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001)).

For analysis on the ABI3700, PCR products for each set of markers were mixed together in a ratio of 1:2:2:5 for VTC:FAM:NED:PET, desalted by ethanol precipitation (Sambrook et al (hi: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001)), and resuspended in an appropriate volume of sterile water to give a final dilution factor of 1:500. The diluted PCR products were separated by capillary electrophoresis on the ABI3700 using LIZ-labeled GeneScan500 as an internal size standard (Applied Biosystems).

For analysis on the ABI3730, PCR products for each set of markers were mixed together at a ratio of 3:4:2:4 for VIC:FAM:NED:PET, desalted by vacuum filtration on an AcroPrep 384-well filter plate with a 1OK Omega membrane (PALL Life Sciences) essentially according to the manufactures instructions, and resuspended in an appropriate volume of sterile water to give a final dilution factor of 1:500. The diluted PCR products were separated by capillary electrophoresis on the ABI3730 using LIZ- labeled GeneScan500 as an internal size standard (Applied Biosystems).

PCR fragment sizes were determined using GeneMapper v3.7 analysis software (Applied Biosystems). The pooling of PCR products with different dye-labels at the described ratios for each ABI instrument was to account for differences in the relative fluorescence of each fluorophore dye, and the detection sensitivity of each instrument. 1.2 DNA quality and concentration does not affect amplification

The effect of the concentration of DNA used in the multiplex assay of the invention on PCR specificity and amplification yield was determined by comparing the SSR profiles of 64 barley and wheat markers amplified using 10, 30, 50, 70, 100, 150 and 250 ng of genomic DNA purified from leaf material using a salt-based extraction method (Rogowsky et al, Theoretical and Applied Genetics 82, 537-554 1991). Each PCR was performed in triplicate.

The SSRs markers shown in Figure Ia are representative of the effect that genomic DNA concentration had on the amplification yield and PCR specificity. DNA was loaded onto the gel represented in Figure 1 a in the following order:

To determine the effect of DNA quality, the SSR profiles of 32 barley markers amplified from high quality genomic DNA prepared from leaf material using a salt- based extraction method (Rogowsky et al. supra) was compared with that amplified using genomic DNA extracted from leaf and root material using a sodium hydroxide- based method (Paris and Carter, Plant Molecular Biology Reporter 18,351-360 2000).

The latter method produces a low yield of relatively poor quality single-stranded DNA.

For both methods, genomic DNA was extracted from the barley variety Sloop.

The SSRs shown in Figure Ib are representative of the effect that genomic DNA quality had on the amplification yield and PCR specificity. In both experiments PCR products were separated by gel electrophoresis using a 4% denaturing polyacrylamide gel and detected by fluorescence using a GelScan2000 instrument.

DNA was loaded onto the gel represented in Figure Ib as set forth in Table 2:

Table 2 : Source of nucleic acid, i.e.. tissue from which DNA was extracted and the method used to extract DNA for PCR amplification and location on the gel depicted in

Figure ] b

Lane Plant material and method used to extract genomic DNA

1 Leaf; salt-based extraction

2 Leaf; salt-based extraction

3 Seed; sodium hydroxide based extraction

4 Seed; sodium hydroxide based extraction

5 Seed; sodium hydroxide based extraction

6 Seed; sodium hydroxide based extraction

7 Seed; sodium hydroxide based extraction

8 Leaf; sodium hydroxide based extraction

9 Leaf; sodium hydroxide based extraction

10 Leaf; sodium hydroxide based extraction

11 Leaf; sodium hydroxide based extraction

12 Leaf; sodium hydroxide based extraction

The results of these experiments demonstrate that the concentration and quality of genomic DNA had no observable effect on PCR specificity and amplification yield. The tolerance of the PCR assay of the invention to a broad range of DNA template concentrations indicated that quantification of genomic DNA samples is not necessary. In particular, the tolerance of the assay to high concentrations of genomic DNA indicated that the assay was not susceptible to PCR over-cycling effects. Such over- cycling effects often result in assay failure due to the conversion of PCR products into random high molecular sized fragments (Bell and DeMarini, Nucl. Acids Res. 19, 5079, 1991). The compatibility of the assay with low-quality DNA samples prepared by sodium hydroxide extraction is also useful for facilitating high throughput genotyping in marker-assisted breeding.

1.3 Effect of primer concentration on PCR specificity

This experiment aimed to determine how PCR specificity and amplification yield was affected by the concentration of locus-specific primer used in the assay. DNA fingerprints of 32 wheat SSRs amplified using 40, 20, 10, 5, 3.3, 2.5, 2 or 1.6 nM of locus-specific primer were compared. Each PCR was performed in triplicate using genomic DNA from the genetically diverse wheat varieties Olympic, Gabo and Chinese Spring. PCR products were separated on a 4% denaturing polyacrylamide gel and

detected by fluorescence using a GelScan2000 instrument (see Materials and Methods). The amplification products shown in Figure 2 are representative of the different types of effects that the concentration of locus-specific primer had on amplification yield and PCR specificity.

The gel represented in Figure 2 was loaded with samples set forth in Table 3.

Table 3: Source of nucleic acid used in PCR am lification and location in Fi ure 2.

* LSPconc is the concentration of locus-specific primer (mM) used in the multiplex- ready PCR assay

The results of this experiment show that the concentration of locus-specific primer affects both the PCR specificity and yield of amplification product(s) for each marker. For example, the marker gwm642 amplified two microsatellite loci when the concentration of locus-specific primer in the multiplex-ready assay was <5 nM. However, at higher locus-specific primer concentrations, i.e., >10 nM, the microsatellite locus producing the smallest SSR fragment was preferentially amplified. In contrast, a locus-specific primer concentration of 40 nM achieved relatively uniform amplification of the two microsatellite loci amplified by the marker gwml74. These results indicate that a specific concentration of each locus-specific primer resulted in satisfactory marker amplification, and that the optimal concentration of locus-specific primer is determined empirically. In subsequent experiments, it was possible to achieve relatively uniform yield of amplification products for more than 2018 barley and wheat markers at a desired level of PCR specificity by empirically determining the optimal concentration of locus-specific primer required for each marker.

In additional experiments, tag primers were assessed for their ability to anneal to and initiate replication of nucleic acid from the barley and bread wheat genomes. PCR reactions were performed with primer concentrations of 75nM, 20OnM, 30OnM or 40OnM. No amplification was detected with these primers in the absence of locus- specific primers, indicating that the tag primers do not anneal to and initiate amplification of nucleic acid in the barley and bread wheat genomes.

1.4 A multiplex reaction to detect a plurality of nucleic acid markers To demonstrate the ability of the assay of the invention to achieve a high level of multiplex PCR amplification in bread wheat (Triticum aestivum L.) a multiplex assay was performed using locus-specific primer sequences from sources.

The routine development of multiplex PCR assays in this allohexaploid species is difficult due to the large size and complexity of its genome (Doninni et al. Genetic Research and Crop Evolution 45, 415-4211998). Based on the known PCR fragment sizes of wheat markers, it was determined that on average a maximum of six SSRs could be coseparated on an automated DNA fragment analyzer whilst maintaining correct spatial separation to avoid marker allele overlap.

To demonstrate that the PCR assay of the invention is capable of coamplifying up to six wheat markers without assay optimization, 32 marker panels consisting of twelve 6- plex and twenty 4-plex reactions were tested. Each PCR was performed in duplicate across six genetically diverse wheat varieties. PCR products were separated on a 4% denaturing polyacrylamide gel and detected by fluorescence using a GelScan2000 instrument.

The multiplex marker panels shown in Figure 3 are representative of the PCR specificity and amplification yield achieved. The DNA was loaded onto the gel depicted in Figure 3 in the order shown in Table 4.

Table 4: Source of nucleic acid used in PCR amplification and location in Figure 3. Lane Wheat Variety

1 Buranga

2 Buranga

3 VPM Cook

4 VPM Cook

5 Chinese Spring

6 Chinese Spring

7 Gabo

8 Gabo

9 Norin 10

10 Norm 10

11 Olympic

12 Olympic

The specific markers detected in the assay are shown in Table 5.

Table 5: Markers amplified in multiplex reactions and the location in Figure 3 of the electro horesed amplicons roduced

Marker names correspond to primer sets set forth in Table 6.

The results of this experiment demonstrate that robust multiplex PCR amplification could be achieved without assay optimization. This was indicated by the high PCR specificity and relatively uniform amplification yield achieved for 89% (135/152) of the SSRs tested. Moreover, there was no apparent difference in the success of 4- and 6- plex PCR assays, with 90% (72/80) and 88% (63/72) of markers producing PCR fragments of expected size and amplification yield, respectively. In subsequent experiments, similar success rates were achieved in barley (Hordeum spontenaum) for the development of 4- and 6-plex PCR assays.

Table 6: Sequence of primers and concentrations used to amplify nucleic acid markers from wheat or barley.

oe

O

VO

Ul

-4

o o

O K)

O

O

o

O -4

o

OO

o

W

OO

v*

K)

O

K) κ>

κ>

K) -4

K)

OO

K)

O

W

-4

OO

U)

W

O

Ul K>

Ul Ul

-4

o

c \

Ul

-4

¹ LSPopt is the optimal concentration of the locus specific primer for marker amplification in nM.

oe

1.5 Comparison of the method of the invention to standard techniques To demonstrate that markers amplified using the assay of the invention produced SSR fingerprints that were indistinguishable from those generated by conventional PCR, the method of the invention and traditional assays were performed in parallel.

Sixty four SSR markers amplified from six genetically diverse wheat varieties using the assay of the invention and conventional PCR assays were compared. The markers were amplified using the primers set forth in Table 6. Microsatellite marker amplification by conventional PCR was performed in a 6 μl reaction mixture containing 0.2 mM dNTP, Ix PCR buffer containing 1.5 mM MgCl ₂ (Qiagen), 200 nmol each of dye-labelled forward and unlabelled reverse primer, 50 ng genomic DNA, and 0.15 U DNA polymerase (Qiagen). Conventional PCR amplification was performed for a total of 48 cycles with the touchdown profile: 30 s at 94 ⁰ C, 30 s at 60°C, and 30 s at 72°C. Following the first cycle, the annealing temperature was reduced by 0.5 ⁰ C per cycle for the next twenty cycles. The PCR profile was completed with a final extension step of 10 min at 72 ⁰ C. PCR products were separated on a 4% denaturing polyacrylamide gel and detected by fluorescence using a GelScan2000 instrument.

The wheat varieties used in this experiment from left to right in Figure 4 were: Rialto, Spark, Halberd, Cranbrook, Sunco and Tasman.

The results of this experiment showed that SSR profiles generated using the multiplex- ready marker assay of the invention and conventional PCR assays were indistinguishable, except for a 38-bp fragment size offset caused by the addition of the tag primer sequences to the 5' ends of the multiplex-ready locus-specific primers. The indistinguishable amplification of target loci for markers in the multiplex-ready marker and conventional PCR assays was further confirmed in subsequent experiments. This was confirmed by comparing the allele sizes observed for more than 800 markers amplified from a set of reference barley and wheat varieties using the assay of the invention with those previously reported for the same markers assayed by conventional PCR (data not shown).

1.6 The level of nucleic acid amplified for each marker is approximately equal Using the semi-automated ABI3700 instrument and Genotyper version 3.7 analysis software (Applied Biosystems), the average fluorescence peak height for each of 366 markers was calculated from the fluorescence peak heights observed for eight genetically diverse barley (or wheat) cultivars. Additionally, using the semi-automated ABI3730 instrument and Genemapper version 3.7 analysis software (Applied Biosystems), the average fluorescence peak height for each of 1070 markers was calculated from the fluorescence peak heights observed for eight genetically diverse barley (or wheat) cultivars.

As shown in Figure 5, of the 366 SSRs tested using the ABI3700 instrument, 75% had mean fluorescence peak heights within the target range (i.e., the desirable fluorescence peak height range in which semi-automated genotyping is easiest to perform).

As shown in Figure 6, of the 1070 SSRs analysed on the ABI3730 instrument, 85% had mean fluorescence peak heights within. the target range (i.e., the desirable fluorescence peak height range in which semi-automated genotyping is easiest to perform).

The variation observed in the observed fluorescence peak height largely results from polymerase stutter during amplification of the markers. However, this variation is minimal and does not prevent the detection of amplified nucleic acids.

Accordingly, these results demonstrate that the majority of nucleic acids amplified using the method of the present invention are amplified to a level to permit automated or semi-automated electrophoretic analysis. The difference in the desirable fluorescence peak height range for the ABI3700 and ABI3730 instruments reflects the detection sensitivity of each instrument, and their ability to correct for emission spectra overlap between the fluorescent dyes VIC, FAM NED and PET.

EXAMPLE 2

Amplification of polymorphic markers from Prunus spp.

One hundred and four primer sets for amplifying a characterised marker from Prunus spp. were produced essentially as described in Example 1.1.1. The nucleotide sequence of the locus specific region of the primers used is set forth in Table 7. Forward primers were synthesized with a 19-bp tag sequence and the reverse primers synthesized with a 20-bp tag sequence.

The optimum concentration of each locus-specific primer was determined using singleplex reactions, essentially as described in Section 1.1.2, above, and are listed in Table 7. However, the template nucleic acid used in the reactions was derived from apricot and cherry varieties (P.armeniaca and P. avium, respectively). Conditions for the PCR reactions were essentially as described in Section 1.1.3, above.

Tag primers were also assessed for their ability to anneal to and initiate replication of nucleic acid from the apricot and cherry genomes. PCR reactions were performed with primer concentrations of 75nM, 20OnM, 30OnM or 40OnM. No amplification was detected with these primers in the absence of locus-specific primers, indicating that the tag primers do not anneal to and initiate amplification of nucleic acid in the apricot and cherry genomes.

Table 7: Nucleotide sequence of locus specific regions for amplifying template nucleic acid from Prunus sp.

Marker name Marker type Fwd primer sequence Rvs primer sequence LSPopt

BPPCTOOl SSR AATTCCCAAAGGATGTGTATGAG CAGGTGAATGAGCCAAAGC 100

BPPCT002 SSR TCGACAGCTTGATCTTGACC CAATGCCTACGGAGATAAAAGAC 100

BPPCT004 SSR CTGAGTGATCCATTTGCAGG AGGGCATCTAGACCTCATTGTT 100

BPPCT005 SSR GCTAGCAGGGCACTTGATC ACGCGTGTACGGTGGAT 80

BPPCT006 SSR GCTTGTGGCATGGAAGC CCCTGTTTCTCATAGAACTCACAT 100

BPPCT007 SSR TCATTGCTCGTCATCAGC CAGATTTCTGAAGTTAGCGGTA 100

BPPCT008 SSR ATGGTGTGTATGGACATGATGA CCTCAACCTAAGACACCTTCACT 80

BPPCT009 SSR ATTCGGGTCGAACTCCCT ACGAGCACTAGAGTAACCCTCTC 100

BPPCTOlO SSR AAAGCACAGCCCATAATGC GTACTGTTACTGCTGGGAATGC 70

BPPCTOIl SSR TCTGAGGGCTAGAGTGGGC TGTTTCAGGAGTCGAACAGC 70

BPPCT012 SSR ACTTCCATTGTCAGGCATCA GGAGCAACGATGGAGTGC 70 -4

BPPCT013 SSR ACCCACAAATCAAGCATATCC AGCTTCAGCCACCAAGC 100

BPPCT014 SSR TTGTCTGCCTCTCATCTTAACC CATCGCAGAGAACTGAGAGC 80

BPPCT015 SSR ATGGAAGGGAAGAGAAATCG GTCATCTCAGTCAACTTTTCCG 140

BPPCTO 16 SSR GATTGAGAGATTGGGCTGC GAGGATTCTCATGATTTGTGC 100

BPPCT017 SSR TTAAGAGTTTGTGATGGGAACC AAGCATAATTTAGCATAACCAAGC 100

BPPCT018 SSR CTCAACTGCTGTCCTCACTTC CATGTCTGATCCTAACCCCA 140

BPPCT019 SSR TGATACCACCATCCAATCTAGC TTGCTGGGACATGGTCAG 140

BPPCT020 SSR CGTGGATGGTCAAGATGC ATTGACGTGGACTTACAGGTG 140

BPPCT021 SSR TGCATGAGAAACTTGTGGC CCAAGAGCCTGACAAAGC 100

BPPCT022 SSR TTGCGTCTCGCAGGTTATA CTACCCCTGCCACAAGCT 100

BPPCT023 SSR TGCAGCTCATTACCTTTTGC AGATGTGCTCGTAGTTCGGAC 140

BPPCT024 SSR GAGGAATGTGCCTCTTCTGG CTCCCGTACGCGTTTACC 100

BPPCT025 SSR TCCTGCGTAGAAGAAGGTAGC CGACATAAAGTCCAAATGGC 140

BPPCT026 SSR ATACCTTTGCCACTTGCG TGAGTTGGAAGAAAACGTAACA 140

BPPCT027 SSR CTCTCAAGCATCATGGGC TGTTGCCCGGTTGTAATATC 70

BPPCT028 SSR TCAAGTTAGCTGAGGATCGC GAGCTTGCCTATGAGAAGACC 70

BPPCT029 SSR GGACGGACAGAAATGAAGGT CCTTAACCCACGCAACTCC 100

BPPCT030 SSR AATTGTACTTGCCAATGCTATGA CTGCCTTCTGCTCACACC 70

Marker name Marker type Fwd primer sequence Rvs primer sequence LSPopt

BPPCT031 SSR CTGGGGAGAAGAAGTGGC GCTTTCATGCCACCTCTCTA 140

BPPCT032 SSR TTAAGCCACAACATCCATGAT AATGGTCTAAGGAGCACACG 100

BPPCT033 SSR GTAGCCGGAGCCGTGTAT CTAGAACCCTATAAACACATGGC 100

BPPCT034 SSR CTACCTGAAATAAGCAGAGCCAT CAATGGAGAATGGGGTGC 100

BPPCT035 SSR TGAAGGATGGCTCTGATACC AATTCATCTACTTCTTCCTCAAGC 100

BPPCT036 SSR AAGCAAAGTCCATAAAAACGC GGACGAAGACGCTCCATT 70

BPPCT037 SSR CATGGAAGAGGATCAAGTGC CTTGAAGGTAGTGCCAAAGC 120

BPPCT038 SSR TATATTGTTGGCTTCTTGCATG TGAAAGTGAAACAATGGAAGC 140

BPPCT039 SSR AATACGTACCCTAAAGCTTCTGC GATGTCATGAAGATTGGAGAGG 100

BPPCT040 SSR ATGAGGACGTGTCTGAATGG AGCCAAACCCCTCTTATACG 100

BPPCT041 SSR CAATAAGGCATTTGGAGGC CAGCCGAACCAAGGAGAC 70

BPPCT042 SSR AACCCTACTGGTTCCTCAGC GACCAGTCCTTTAGTTGGAGC 140

PceGA25 SSR GCAATTCGAGCTGTATTTCAGATG CAGTTGGCGGCTATCATGTCTTAC 140

PceGA34 SSR GAACATGTGGTGTGCTGGTT TCCACTAGGAGGTGCAAATG 140 -4

PceGA59 SSR AGAACCAAAAGAACGCTAAAATC CCTAAAATGAACCCCTCTACAAAT 100 pchcmsOl SSR GTTACACCTCTGTCACA CTTGGCTGGCATTCCTA 100 pchcmsO2 SSR AGGGTCGTCTCTTTGAC CTTCGTTTCAAGGCCTG 140 pchcmsO3 SSR CTGCAGAACACTACTGA GCTTTGCAACCACCAGC 70 pchcmsO4 SSR CTCACGCTATTTCTCGG CCTCGACGAAGAGCTCG 140 pchcmsO5 SSR CGCCCATGACAAACTTA GTCAAGAGGTACACCAG 70 pchgmsOl SSR GGGTAAATATGCCCATTGTGCAATC GGATCATTGAACTACGTCAATCCTC 140 pchgmsO2 SSR GTCAATGAGTTCAGTGTCTACACTC AATCATAACATCATTCAGCCACTGC 70 pchgmsO3 SSR ACGGTATGTCCGTACACTCTCCATG CAACCTGTGATTGCTCCTATTAAAC 100 pchgmsO4 SSR ATCTTCACAACCCTAATGTC GTTGAGGCAAAAGACTTCAAT 140 pchgmsO5 SSR CCAGTAGATTTCAACGTCATCTACA GGTTCACTCTCACATACACTCGGAG 140 pchgmslO SSR GGTCACGCATCCTTTCATTT GACACCTCCATTTGTATCAAAGC 120 pchgmsll(l) SSR AAGCAATAAAACCAGCAGCAA TCAATCAATTGGCATGTTCG 120 pchgmsl l(2) SSR TTGAGGCCCACTTATTAGCC CCCCCATTATTCAAACTTCTG 140 pchgmsl2 SSR CGACACTTAGCTAGAAGTTGCCTTA TCAAGCTCAAGGTACCAGCA 70 pchgmsl3 SSR CACAGCACCCTAGAAATGGAA ACTATATAGTGGAGAATGTC 90 pchgmsl4 SSR GCAAAGAGTACAACAATATCTACCG GGATGGTGAAGACGATGAGG 140 pchgmsl5 SSR TGTCCCCTAGCCATGCTAAT CGGACAGTTATTCAGGCAAT 70

Marker name Marker type Fwd primer sequence Rvs primer sequence LSPopt pchgmslό SSR TCATTGGGCCAAGAAAAGTC TGAGGTTCCTATCTGCTTGG 100 pchgmsl7 SSR ATGCACTCAAGTGGCAAGC GGTTTTTGAGCAAAGATGCAC 100 pchgmslδ SSR TTAAGTGGCGCACGTAAGG TTTTGTGGGTATCTGAGCAAA 120 pchgmsl9 SSR GAAGCACAAGTTGGTGCAAA GCACAACATGGACCAAATGA 140 pchgms20(l) SSR AATTGCATCACAGCAAGAGC ACCACCACAACCAAACCATT 140 pchgms20(2) SSR CCCTTACCCCCTTACCACTT ACCACCACAACCAAACCATT 140 pchgms21(l) SSR ACCACCATTTTGGCTCTCTG ACCACCACAACCAAACCATT 100 pchgms21(2) SSR ACCACCATTTTGGCTCTCTG CATGCAACCCAAAACCATCT 140 pchgms22 SSR ATAATCCGGCAGGGGTCTTA TTGGGGTTTGTCAGTATTTTACA 70 pchgms23 SSR CTGCCGAAAGCATTTTGAAT GAGCTCATGGCAACACAGAA 140 pchgms24 SSR CAACGAGCTCCCATGACTTT ACCACCACAACCAAACCATT 140 pchgms25 SSR GCCAGGAGGCTTTAACCTGT TCAGACCCCCTTTCATCATC 140 pchgms26(l) SSR TGAACGGGTTCTATCCGTGT AAACGGTTGCGTCCAATAAG 70 pchgms26(2) SSR TTTGATAGGATCCCAAGGGTA TTGGCTGGCAGTTATCATCA 140 -4

4-

PMS2 SSR CACTGTCTCCCAGGTTAAACT CCTGAGCTTTTGACACATGC 140

PMS3 SSR TGGACTTCACTCATTTCAGAGA ACTGCAGAGAATTTCACAACCA 120

PMS30 SSR CTGTCGAAAGTTTGCCTATGC ATGAATGCTGTGTACATGAGGC 120

PMS40 SSR TCACTTTCGTCCATTTTCCC TCATTTTGGTCTTTGAGCTCG 120

PMS49 SSR TCACGAGCAAAAGTGTCTCTG CACTAACATCTCTCCCCTCCC 100

PMS67 SSR AGTCTCTCACAGTCAGTTTCT TTAACTTAACCCCTCTCCCTCC 90

PS01H03 SSR TGAGGAGCATAATGACAGT TCACCATGTGTCATACT 100

PS05C03 SSR AGATCTCAAAGAAGCTGA AGCTTATGCATATACCTG 80

PS07A02 SSR CAGGGAAATAGATAAGATG TCTAATGGTGGTGTTCATT 100

PS08E08 SSR CCCAATGAACAACTGCAT CATATCAATCACTGGGATG 100

PS12A02 SSR GCCACCAATGGTTCTTCC AGCACCAGATGCACCTGA 120

SrChrry[AB] SSR GCTGGAACCGTTGAATTCA GGGGCATATCTAAGTATAA 100

UDP96-001 SSR AGTTTGATTTTCTGATGCATCC TGCCATAAGGACCGGTATGT 90

UDP96-003 SSR TTGCTCAAAAGTGTCGTTGC ACACGTAGTGCAACACTGGC 100

UDP96-005 SSR GTAACGCTCGCTACCACAAA CCTGCATATCACCACCCAG 140

UDP96-008 SSR TTGTACACACCCTCAGCCTG TGCTGAGGTTCAGGTGAGTG 100

UDP96-010 SSR CCCATGTGTGTCCACATCTC TTGATGATTCCATGCGTCTC 120

UDP96-013 SSR ATTCTTCACTACACGTGCACG CCCCAGACATACTGTGGCTT 140

Marker name Marker type Fwd primer sequence Rvs primer sequence LSPopt

UDP96-015 SSR CCTTGACCTATTTGTTCGTCA ACTAGTCAAACAATCCCCCG 90

UDP96-018 SSR TTCTAATCTGGGCTATGGCG GAAGTTCACATTTACGACAGGG 90

UDP96-019 SSR TTGGTCATGAGCTAAGAAAACA TAGTGGCACAGAGCAACACC 120

UDP97-401 SSR TAAGAGGATCATTTTTGCCTTG CCCTGGAGGACTGAGGGT 120

UDP97-402 SSR TCCCATAACCAAAAAAAACACC TGGAGAAGGGTGGGTACTTG 120

UDP97-403 SSR CTGGCTTACAACTCGCAAGC CGTCGACCAACTGAGACTCA 120

UDP97-405 SSR ACGTGATGAACTGACACCCA GAGTCTTTGCTCTGCCATCC 120

UDP97-406 SSR TCGGAAACTGGTAGTATGAACAGA ATGGGTCGTATGCACAGTCA 120

UDP97-407 SSR AGCGGCAGGCTAAATATCAA AATCGCCGATCAAAGCAAC 120

UDP97-408 SSR ACAGGCTTGTTGAGCATGTG CCCTCGTGGGAAAATTTGA 120

UDP97-409 SSR GCTGATGGGTTTTATGGTTTTC CGGACTCTTATCCTCTATCAACA 120

-4 Ul

2.1 The level of nucleic acid amplified for each marker is approximately equal

To demonstrate that the assay of the invention amplifies approximately equal amounts of nucleic acid for each Primus marker, the average fluorescence peak height for each of 64 markers was calculated from the fluorescence peak heights observed for six apricot and six cherry varieties.

As shown in Figure 7, of the 64 SSRs analysed on the ABI3730 instrument using Genemapper version 3.7 software (Applied Biosystems), 85% had mean fluorescence peak heights within the target range (i.e. the desirable fluorescence peak height range in which semi-automated genotyping is easiest to perform).

Accordingly, these results demonstrate that the majority of nucleic acids amplified from Prunus species using the method of the present invention are amplified to a level to permit automated or semi-automated electrophoretic analysis.

2.2 Multiplex reactions to detect a plurality of nucleic acid markers

To demonstrate the ability of the assay of the invention to achieve a high level of multiplex PCR amplification in Prunus spp., multiplex assays were performed using locus-specific primer sequences from sources.

Based on the known PCR fragment sizes of the Prunus markers, 32 six-plex PCR assays were performed using genomic DNA from apricot or cherry. Each PCR was performed in duplicate across six varieties of each of apricot and cherry. PCR products were separated by electrophoresis using a 4% denaturing polyacrylamide gel and detected by fluorescence using a GelScan2000 instrument. Redundant use of markers to construct the 6-plex marker panels was performed to demonstrate the combinability of different markers in multiplex PCR.

The multiplex marker panels shown in Figure 8 are representative of the PCR specificity and amplification yield achieved. The DNA was loaded onto the gel depicted in Figure 8 in the order shown in Table 8.

Table 8: Source of nucleic acid used in PCR amplification and location of the electro horesed am licon in Fi ure 8.

The specific markers detected in the assay are shown in Table 9.

Table 9: Markers amplified in multiplex reactions and the location of the electrophoresed amplicons in Figure 8

Panel Marker Composition

A (rows 2-13) BPPCT016, BPPCTOlO, BPPCT013, PS08E08, BPPCT034, pchgmsl5

B (rows 14-25) UDP96-003, UDP96-008, BPPCT028, BPPCT014, pchgms21(2), pchgmsl7

C (rows 27-38) UDP96-010, BPPCT039, BPPCT004, pchcmsO4, pchgmsl 1(2), pchgms23

D (rows 39-50) | BPPCT016, BPPCT040, PceGA59, BPPCT017, BPPCT027, pchgmsl5 Marker names correspond to primer sets set forth in Table 7.

The results of this experiment demonstrate that robust 6-plex PCR amplification could be achieved without assay optimisation. This was indicated by the high PCR specificity and relatively uniform amplification yield achieved for 92% (177/192) and 91% (175/192) of markers tested in apricot and cherry, respectively.

In a subsequent experiment, the ability of the assay of the invention to achieve 10-plex PCR amplification in Prunus species was tested using locus-specific primer sequences from sources. A total of thirteen and eight 10-plex assays were performed in apricot and cherry, respectively. Each PCR was performed in six replicates using template nucleic acid from a single variety. To avoid allele overlap, marker panels were constructed using the known PCR fragment sizes for the markers in the variety assayed. Redundant use of the markers to construct the 10-plex marker panels was allowed to demonstrate the combinability of different markers in multiplex PCR assays. PCR

products were separated by electrophoresis using a 4% denaturing polyacrylamide gel and detected by fluorescent imaging using a GelScan2000 instrument.

The 10-plex marker panels shown in Figure 9 are representative of the PCR specificity and amplification yield achieved. The DNA was loaded onto the gel depicted in Figure 9 in the order shown in Table 10.

Table 10: Source of nucleic acid used in PCR amplification and location of the electrophoresed am licon in Fi ure 9.

The specific markers detected in the assay are shown in Table 11.

Table 11 : Markers depicted in multiplex reactions and the location in Figure 9 of the electrophoresed amplicons roduced

Marker names correspond to primer sets set forth in Table 7.

The results of this experiment demonstrate that robust 10-plex PCR amplification could be achieved without assay optimisation. This was indicated by the high PCR specificity and relatively uniform amplification yield achieved for 75% (97/130) and 83% (66/88) of markers tested in apricot and cherry, respectively.

Overall, the results for the 6-plex and 10-plex PCR assays show that the present invention can achieve a high multiplex level in Prunus species without optimisation or reliance on specialised reagents, such as PCR buffers and PCR enhancers.

EXAMPLE 3 Amplification of polymorphic markers from mammalian species

Fifteen primer sets for amplifying characterised markers from domesticated cattle (Bos taurus) and sheep (Ovis aries) were produced essentially as described in Example 1.1.1. The nucleotide sequence of the locus specific region of the primers used is set forth in Table 12. Forward primers were synthesised with a 19-bp tag sequence and the reverse primers synthesised with a 20-bp sequence as described in Example 1.1.1.

The optimum concentration of each locus specific primer was determined using singleplex reactions, essentially as described in Section 1.1.2, above, and is listed in Table 12. However, the template nucleic acid used in the reactions was derived from cattle or sheep. Conditions for the PCR reactions were essentially as described in Section 1.1.3, above.

Tag primers were also assessed for their ability to anneal to and initiate replication of nucleic acid from cattle and sheep genomes. PCR reactions were performed with primer concentrations of 75nM, 20OnM, 30OnM or 40OnM. No amplification was detected with these primers in the absence of locus-specific primers, indicating that the tag primers do not anneal to and initiate amplification of nucleic acid in cattle and sheep genomes.

Table 12: Nucleotide sequence of locus specific regions for amplifying template nucleic acid from cattle and sheep.

Marker

Marker name type Fwd primer sequence Rvs primer sequence LSPopt

TGLA231 SSR ATTTCCCTTTGGTTTGTAAAGACAG CTGCAAAGAGTTGGACAGAACTGA 20

TGLA23 SSR GAGACACAAGCTTTCAACCACC TGCCCCAGTTGATTTATTAAAAACA 20

BMS1316 SSR CCTTCATGGAAGAAATTTTGTG GGAGTTACAGTCCATGGGTTC 20

BM1258 SSR GTATGTATTTTTCCCACCCTGC GAGTCAGACATGACTGAGCCTG 20

BM304 SSR CTGGTGTTCCTTTCATATCAACC GGCACGTACTAACCTGTAAAACC 20

BM2113 SSR GCTGCCTTCTACCAAATACCC CTTCCTGAGAGAAGCAACACC 30

HMH1R(MBO84) SSR GAAAGCTGGAGCAAACATCC AACTGCCACCACTGTCAGG 15

BMS1248 SSR GTAATGTAGCCTTTTGTGCCG TCACCAACATGAGATAGTGTGC 15

TGLA272 SSR GCGGTTAGAGGCTTGCACGCT TTTCGCTGAGTAGGTCATTATTAAG 20

CSSM31 SSR CCAAGTTTAGTACTTGTAAGTAGA GACTCTCTAGCACTTTATCTGTGT 20

BM4513 SSR GCGCAAGTTTCCTCATGC TCAGCAATTCAGTACATCACCC 20 O

BM1329 SSR TTGTTTAGGCAAGTCCAAAGTC AACACCGCAGCTTCATCC 30

BMC3224 SSR CCATCACTGCTATTCTACCTCC CACAGCCAATTTCTGATTTCA 15

ADCY2(MB085) SSR AAAGTGACACAACAGCTTCTCC ACAAGTGAGTGCGTAACAAAGG 15

INRA133 SSR ATCCTCAAAGCAACCTGGC GAATCTTCTCCCCCTGCATC 15

*LSPconc is the concentration (in nM) of locus-specific primer used in the multiplex-ready PCR assay

3.1 Effect of primer concentration on PCR specificity and amplification yield The effect of the concentration of locus-specific primer on PCR specificity and amplification yield was determined for each marker in cattle and sheep across the concentration range of 5 to 80 nM. Specifically, each marker was amplified by PCR in triplicate from each of sheep and cattle DNA using 5, 10, 15, 20, 25, 30, 40 or 80 nM of locus-specific primer. PCR products were separated by electrophoresis using a 4% denaturing polyacrylamide gel and the fluorescent marker on the forward primer detected using a GelScan2000 instrument. The microsatellite markers shown in Figure 10a and Figure 10b are representative of the effects that locus-specific primer concentration had on PCR specificity and amplification yield.

The gels represented in Figure 10a and Figure 10b were loaded with samples set forth in Table 13.

Table 13: Source of nucleic acid used in PCR amplification and location of the electrophoresed amplicon in Fi ure 10.

LSPconc is the concentration (in nM) of locus-specific primer used in multiplex-ready PCR

The results of this experiment showed that the concentration of locus-specific primer had a minimal effect on PCR specificity and amplification yield for all markers across the concentration range tested, once the minimum concentration required for efficient SSR amplification was reached. The results demonstrate that the assay of the invention permit efficient marker amplification under standardized reaction conditions, despite a large difference in the theoretical optimal PCR annealing temperature for each marker (T _a 51°C to 65°C).

3.2 Effect of DNA concentration on PCR specificity and amplification yield The effect of the concentration of template nucleic acid used in the assay of the invention on PCR specificity and amplification yield was determined by comparing the

SSR profiles of the 15 markers using 1, 2, 5, 10, 15, 20, 30 or 40ng each of cattle and sheep genomic DNA. Each PCR was performed in triplicate. The recommended amount of DNA template per PCR assay is 20 ng (Maddox et at, Genome Research 11: 1275-1289 2001). PCR products were separated by electrophoresis using a 4% denaturing polyacrylamide gel. PCR products were detected by detecting the fluorescent dye conjugated to the forward primer using a GelScan2000 instrument. The SSRs shown in Figure 11 are representative of the effect that genomic DNA concentration had on the amplification yield and PCR specificity.

The gel represented in Figure 11 was loaded with samples depicted in Table 14.

Table 14: Source and amount of nucleic acid used in PCR amplification and location of

The results of this experiment show that the concentration of genomic DNA had little or no effect, on PCR specificity and the amplification yield for the concentration range tested. These results demonstrate the robustness of the multiplex-ready assay over a broad range of DNA template concentrations, and indicate that accurate quantification of DNA samples is unnecessary.

3.3 Multiplex reactions to detect plurality of nucleic acid markers To demonstrate the ability of the assay of the invention to achieve robust multiplex PCR amplification in cattle and sheep, multiplex assays were performed using locus- specific primer sequences from sources.

Based on the PCR fragment sizes of 15 markers in cattle and sheep, 42 three-plex PCR assays were constructed. The limit of 3-plex assays was used to maintain correct spatial separation to avoid marker allele overlap. Redundant use of the markers to construct the 3-plex assays was allowed to demonstrate the combinability of different markers in

multiplex PCR. Each 3-plex PCR was performed as six replicates on each of sheep and cattle genomic DNA. PCR products were separated be electrophoresis using a 4% denaturing polyacrylamide gel. PCR products were detected by detecting the fluorescent dye conjugated to the forward primer using a GelScan2000 instrument.

The 3-plex marker panels shown in Figure 12 are representative of the PCR specificity and amplification yield achieved. The DNA was loaded onto the gel depicted in Figure 12 in the order shown in Table 15.

Table 15: Source of nucleic acid used in PCR amplification and location of the electrophoresed am licon in Fi ure 12.

The specific markers detected in the assay are shown in Table 16.

Table 16: Markers depicted in multiplex reactions and the location in Figure 12 of the electro horesed am licons roduced

Marker names correspond to primer sets set forth in Table 12.

The results of this experiment show that robust three-plex PCR amplification can be achieved without assay optimisation. This was indicated by the high PCR specificity and relatively uniform amplification yield achieved for 96% (121/126) and 94% (118/126) of the markers tested in cattle and sheep, respectively. Additionally, the redundant use of the markers to develop the multiplex assays showed a high combinability of markers in the assay of the invention.

EXAMPLE 4 Amplification of polymorphic markers from fungal species

Twenty four primer sets for amplifying characterised microsatellite markers from the fungal pathogen Rhynchosporium secalis (causal agent of scald disease in barley) were produced essentially as described in Example 1.1.1. The nucleotide sequence of the locus specific region of the primers used is set forth in Table 17. Forward primers were synthesised with a 19-bp tag sequence and the reverse primers synthesised with a 20-bp sequence as described in Example 1.1.1.

The optimum concentration of each locus specific primer required to amplify the markers inplanta was determined using singleplex reactions, essentially as described in

Section 1.1.2, above, and are listed in Table 16. However, the template nucleic acid used in the reactions was a heterogenous mixture of genomic DNA from barley and the fungal pathogen. Genomic DNA was isolated from barley leaf tissue infected with the fungal pathogen using a salt-based extraction method (Rogowsky et al, supra). Each PCR was performed in triplicate. Conditions for the PCR reactions were essentially as described in Section 1.1.3, above. Successful amplification of 88% (21/24) of the markers tested showed that the assay of the present invention is suitable for in planta detection of fungal pathogen.

Tag primers were also assessed for their ability to anneal to and initiate replication of nucleic acid from the heterogenous mixture of barley and R. secalis genomic DNA. PCR reactions were performed with primer concentrations of 75nM, 20OnM, 30OnM or 40OnM. No amplification was detected with these primers in the absence of locus- specific primers, indicating that the tag primers do not anneal to and initiate amplification of nucleic acid in barley or R. secalis genomes.

Table 17: Nucleotide sequence of locus specific regions for amplifying template nucleic acid from Rhynchosporium secalis.

Marker

Marker name type Fwd primer sequence Rvs primer sequence LSPopt hSRS_ACAg3 SSR AGGTGGAGGATGCGTCTTTGGACAG ACACACACACACACAGAGAGAG 120 hSRS_ACAg4 SSR CCGTGGTACAGTACAGTGAAAGAGG ACACACACACACACAGAGAGAG 60 hSRS_ACAg6 SSR AAGTCCAGACAAATCTAACAAGCAC ACACACACACACACAGAGAGAG 120 hSRS_ACTCl SSR CTCTCAAAGAACAGAACAGTACAATA ACACACACACACACTCTCTCTC 200 hSRS_ACTC8 SSR TAAATACCTACCCTCACTACCCACA ACACACACACACACTCTCTCTC 60 hSRS_ACTC13 SSR GATCACTTTGGATACGGCGGTTAAG ACACACACACACACTCTCTCTC 60 hSRS_AgAC3 SSR TCGACACGAGAGAGAAACCTAAGAT AGAGAGAGAGAGAGACACACAC 120 hSRS_AgAC8 SSR TGAACTCATCAGTCAACCTTGG AGAGAGAGAGAGAGACACACAC 120 hSRS_AgAC9 SSR GGGGGGCATAACCTCGCTGAATT AGAGAGAGAGAGAGACACACAC 40 hSRS_AgTgl l SSR GCTTTGATCATGCTTGTGCAGGA AGAGAGAGAGAGAGTGTGTGTG 60 hSRS_AgTgl4 SSR CAGCCCAGCTTATCTCTACATTCTTC AGAGAGAGAGAGAGTGTGTGTG 200 hSRS_AgTgl7 SSR TCATACCCAAAAAATCCCGCTCTA AGAGAGAGAGAGAGTGTGTGTG 60 hSRS_TCAC3 SSR GCTTCTAATTTACCCTACCTGCTTC TCTCTCTCTCTCTCACACACAC 60 hSRS_TCAC4 SSR TCGAAATACGTATATCGTGCACA TCTCTCTCTCTCTCACACACAC 180 hSRS_TCAC5 SSR GACCTGACTTGCTTGCTTGAC TCTCTCTCTCTCTCACACACAC 120 hSRSJTgAgl SSR CATCATCATCATCATCATCAACAGT TGTGTGTGTGTGTGAGAGAGAG 180

SRS_TgAgl SSR AAGAGTATGAATTTCATCGCACTGG TGTGTGTGTGTGTGAGAGAGAG 120

SRS_TgAg5 SSR ACACACAGTTCATTCCAGTTTCAAG TGTGTGTGTGTGTGAGAGAGAG 200

SRS-TgAgI 9 SSR CTATCTGAAGCGAAGAAGGTAAGTG TGTGTGTGTGTGTGAGAGAGAG 60

SRS_TgAg28 SSR GTAATGGACTATGGACTGTGGAGAA TGTGTGTGTGTGTGAGAGAGAG 200

SRS_TgAg29 SSR GTCAGGTATGTAGGCAAGGTAGTCG TGTGTGTGTGTGTGAGAGAGAG 60

SRS_TgAg31 SSR TAGAGAGAAGGGTTTACAAAGACGA TGTGTGTGTGTGTGAGAGAGAG 60

SRS_TgAg32 SSR TAGAGGAATAGACACCGTCAACAA TGTGTGTGTGTGTGAGAGAGAG 200

SRS_TgAg35 SSR TGGTCTGTTCATTTATTGACTCGTA TGTGTGTGTGTGTGAGAGAGAG 200

*LSPconc is the concentration (in nM) of locus-specific primer used in the multiplex-ready PCR assay

EXAMPLE 5 BINNER software

BHSfNER is. a software program that determines the most cost-efficient way to separate a set of markers, e.g., electrophoretically. In essence, the program uses a few simple rules to construct marker panels for the markers of interest. Each marker panel consists of amplification products that can be resolved, e.g., by electrophoresis; i.e. marker panels are constructed so that each amplification product has a unique length. The mathematical algorithm essentially calculates from all possible marker combinations the minimum number of panels in which the markers of interest can be placed. This minimizes the cost of marker separation, since the number of marker panels determines the total number of capillaries that are required for electrophoretic separation. This process is also useful for determining which markers are to be amplified in a single multiplex amplification reaction.

The BINNER software supports individual user accounts to permit users to upload and manage marker data. Following login, a list of markers is shown for which allele length data is available, such as, for example, allele length data for barley and wheat markers that are published in the Multiplex-Ready Marker Database. This allele length data was generated using eight genetically diverse varieties. The varieties used for barley were Alexis, Chebec, Clipper, Harrington, Haruna Nijo, Sahara 3771, Sloop and WI3408; and for wheat were Barunga, VPM Cook, Chinese Spring, Gabo, WI7984 (a synthetic hexaploid), NorinlO, Olympic and Opata85.

Alternatively, marker allele length data is uploaded to BINNER and used to develop marker panels for, for example, specific germplasm or a specific species or a specific genus. For example, suitable marker allele length data are saved as a Microsoft® Excel® file and uploaded to the BINNER software.

Marker panels for deployment or separation on an automated DNA fragment analyser are then constructed automatically by BINNER for a set of user-defined markers using either default or imported allele length data. To determine suitable marker panels, the minimum amount of distance (in base-pairs) that BINNER must leave between markers when building a marker panel is selected. It is recommended that a minimum padding of 10-bp is used for marker polymorphism screening unless the allele length range for

each marker is known for the germplasm of interest. For genetic mapping, a minimum padding of 5-bp is recommended.

Each panel of markers created by BESENER contains a list of markers that have correct spatial separation to avoid allele overlap when separated on an automated DNA fragment analyser. These panels are then used to select appropriate primers or set of primers for use in a multiplex amplification reaction to produce amplification products that can be resolved, e.g., using electrophoresis.