DURANNY-TURK, Olga (C. Padilla, 309 7, 4b Barcelona, E-08025, ES)
AIBAR-DURAN, Elena (C/ Sant Joan, no. 1 bis 1° 1, Viledecans Barcelona, E-08840, ES)
MAES, Tamara (Rda. de Ramón Otero Pedrayo 42, Bloc C 3° 1a Castelldefels, Barcelona, E-08860, ES)
DURANNY-TURK, Olga (C. Padilla, 309 7, 4b Barcelona, E-08025, ES)
AIBAR-DURAN, Elena (C/ Sant Joan, no. 1 bis 1° 1, Viledecans Barcelona, E-08840, ES)
CLAIMS
What is claimed is:
1. A method for determining the methylation of DNA comprising:
(a) treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine,
(b) subjecting the resulting DNA to in vitro transcription to synthesize RNA, (c) detecting the RNA to determine the methylation of the DNA.
2. The method of claim 1, comprising:
(a) obtaining or providing a sample having DNA,
(b) fragmenting the DNA with two or more restriction enzymes having different recognition sites,
(c) ligating adaptors to the fragmented DNA wherein cytosines in said adaptors are 5 '-methyl protected cytosine,
(d) treating the ligated DNA fragments with a deaminating agent,
(e) synthesizing double-stranded DNA from the single-stranded DNA obtained from the previous step,
(f) performing in vitro transcription on double-stranded DNA formed from the ligated deaminated DNA fragments to produce RNA, and
(g) detecting the RNA to determine the methylation of the DNA.
3. The method of claim 1 or 2, wherein said detecting the RNA to determine the methylation of the DNA comprises determining the sequence of the RNA, or a nucleic acid derived from the RNA, to determine the identity of the sequences obtained from the in vitro transcription, thereby determining the methylation of the DNA.
4. The method of any one of claims 1-3, wherein said detecting the RNA to determine the methylation of the DNA comprises hybridizing the RNA, or a nucleic acid derived from the RNA, to a microarray to determine the identity of the sequence(s) obtained from the in vitro transcription, thereby determining the methylation of the DNA.
5. The method of any one of claims 1-4, wherein the methylation of 50 or more cytosines in the DNA sample is determined.
6. The method of one of claims 1-5, wherein the methylation of from 50 to 100,000 cytosines in the DNA sample is determined.
7. The method of any one of claims 1-6, wherein the methylation of from 100 to 100,000 cytosines in the DNA sample is determined.
8. The method of any one of claims 1-4, wherein the methylation of three or more promoters in the DNA sample is determined.
9. The method of any one of claims 1-4, wherein the methylation of six or more promoters in the DNA sample is determined.
10. The method of any one of claims 1-4, wherein the methylation of from three to 10,000 promoters in the DNA sample is determined.
11. The method of anyone of claims 1-4, wherein the methylation of six to 10,000 promoters in the DNA sample is determined.
12. The method of any one of claims 1-4, wherein the methylation of three or more CpG islands in the DNA sample is determined.
13. The method of any one of claims 1-4, wherein the methylation of six or more CpG islands in the DNA sample is determined.
14. The method of anyone of claims 1-4, wherein the methylation of from three to 10,000 CpG islands in the DNA sample is determined.
15. The method of anyone of claims 1 -4 wherein the methylation of from six to 10,000 CpG islands in the DNA sample is determined.
16. The method of any one of claims 1-15, wherein the DNA is not amplified prior to treatment with an agent that is capable of distinguishing cytosine from 5-methylcytosine.
17. The method of any one of claims 1-16, wherein said treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine comprises bisulphite treatment.
18. The method of any one of claims 1-17, wherein said treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine comprises fragmentation of the DNA, ligation of adaptors to the fragmented DNA, and treatment of adaptor ligated fragmented DNA with bisulphite.
19. The method of claim 1, wherein said in vitro transcription to synthesize RNA comprises synthesizing double-stranded DNA from the DNA obtained by treatment with an agent that is capable of distinguishing 5-methylcytosine from cytosine and transcribing the double-stranded DNA into RNA with a polymerase.
20. The method of claim 2, wherein said fragmentation of the DNA comprises treating the DNA with one or more restriction enzymes.
21. The method of claim 9, wherein said one or more restriction enzymes are methylation insensitive.
22. The method of claim 11, wherein said restriction enzymes are methylation insensitive.
23. The method of claim 11, wherein the DNA is not amplified prior to treatment with an agent that an agent capable of distinguishing 5-methylcytosine and cytosine.
24. The method of any one of claims 1-23, for diagnosing cancer.
25. The method of any one of claims 1-23, for prenatal diagnosis.
26. A kit having (1) a component for fragmenting DNA, (2) a component for distinguishing 5-methylcytosine and cytosine, (3) an in vitro transcription component, and (4) instructions for using the components of the kit.
27. The kit of claim 26, wherein said component for distinguishing 5-methylcytosine from cytosine comprises reagents for selective bisulphate-mediated deamination of cytosine as compared to 5-methylcytosine.
28. The kit of claim 26, wherein said in vitro transcription component comprises adaptors.
29. A set of probes for detecting for diagnosing cancer, wherein said probes are designed to the methylation status of DNA treated with bisulphite and subsequent in vitro transcription.
30. The set of probes of claim 29, wherein said set of probes comprises probes for from two to 1000 promoters or CpG islands.
31. The set of probes of claim 29, wherein said set of probes comprise probes for from ten to 1000 promoters or CpG islands.
32. The set of probes of claim 29, wherein said the set of probes comprise probes for from twenty to 1000 promoters or CpG islands.
33. The method of any one of claims 1-16 and 19-25, wherein said determining the methylation of the DNA further comprises comparing the sequence of DNA treated with an agent capable of distinguishing 5-methylcyctosine from cytosine to DNA not treated with an agent capable of distinguishing 5-methylcytosine from cytosine. |
METHOD AND COMPOSITION FOR METHYLATION ANALYSIS
PRIORITY CLAIM
This application claims the benefit, under 35 U.S. C. § 119(e) to U.S. Provisional Patent application U.S.S.N. 61/070,104 filed March 19, 2008, titled "Method and Composition for Methylation Analysis."
TECHNICAL FIELD
The invention relates generally to biotechnology and, more particularly, to methods and compositions for correlating the methylation status of DNA with phenotypic information.
BACKGROUND OF THE INVENTION One of the greatest scientific accomplishments of the 20 th Century was the elucidation of the four-letter DNA code and its relation to protein expression. These studies have led to a profound understanding of the relationship between the DNA sequence of genes and how changes in the DNA sequences of genes can affect organisms' characteristics. An immense number of scientific studies probing the genetic code have focused on understanding how changes to the four-letter code of DNA relate to disease. These studies have led to a much deeper understanding of the roots of human disease. Many examples have been described of how alterations in the four letter DNA code of a gene can lead to various diseases. The genes that are implicated in the most common forms of familial cancers have been identified, and now many people routinely have genetic tests on these genes to determine if they are predisposed to cancer. The culmination of these studies is that many diseases are related to underlying alterations in DNA sequences.
More recently, researchers have found that other types of modification to DNA are important determinants of disease and phenotype. One particular type of DNA modification that affects gene function is referred to as "methylation." DNA methylation is a well-known epigenetic modification affecting gene regulation (e.g., gene expression). Cytosine methylation is characterized by the presence of a methyl group on the carbon-5 position of cytosine (referred to as
5-methylcytosine). This modification is responsible for an important form of gene regulation in eukaryotes. Most studies on DNA methylation have focused on the methylation status of the cytosine bases included in the CpG dinucleotide, which seems to be the preferential site for the modification. In the mammalian genome there are about 50 million CpG dinucleotides. In mammals, cytosine methylation occurs almost exclusively at CpG dinucleotides, which are underrepresented in the genome with the exception of CpG islands; regions of the genome containing a high percentage of CpG dinucleotides and are approximately about 1 kb in size. These small CpG-rich regions, in many cases, are associated with promoter regions. Cytosine methylation results in transcriptional repression either by interfering with transcriptional factor binding or by inducing a repressive chromatin structure.
DNA methylation is an important component in mammalian gene silencing for normal processes such as gene imprinting and X-chromosome inactivation. Alterations in DNA methylation are associated with many human diseases and are a hallmark of cancer. A decrease in the total amount of cytosine methylation is observed in many human neoplastic tissues and as indicative of global desregulation. At the same time, aberrant promoter hypermethylation has been observed in sporadic cancer and is thought to contribute to carcinogenesis by inactivating tumor-suppressor genes. Moreover, the change in the methylation state of regulatory genes (hypomethylation or hypermethylation), being a primary event, is frequently associated with the neoplastic process and is proportional to the severity of the disease (J. Paluszczak and W. Baer-Dubowska (2006) J. Appl Genet. 47(4):365-75).
Historically, analysis of methylation of DNA had not received much attention due to the technical difficulties associated with the analysis: the tools commonly used for DNA analysis were not useful for determining DNA methylation patterns. Eventually, it was discovered that some restriction enzymes were sensitive to the methylation status on bases at or near the restriction site. Methylation sensitive restriction enzymes have been used in genome wide analysis of methylation status and in related biomarker discovery.
Currently, the methods for detecting DNA methylation include the use of bisulfite conversion, methylation-sensitive restriction enzymes, methyl-binding
proteins and anti-methylcytosine antibodies. The recent advent of DNA microarrays and high-throughput sequencing has made the mapping of DNA methylomes feasible on a genome-wide scale, but the currently available techniques have numerous shortcomings that limit their ultimate utility. Two techniques are most commonly used to investigate site-specific methylation at CpG residues: (i) DNA sequencing after modification of genomic DNA with sodium bisulfite and (ii) PCR amplification after digestion of genomic DNA with methylation-sensitive endonuclease(s).
The bisulphite methodologies are based on treating the sample with bisulfite under appropriate conditions. Bisulphite treatment leads to the conversion (deamination) of cytosine to uracil, whereas methylcytosine is not converted to uracil under these conditions. Amplification of the bisulphite treated DNA with strand-specific primers results in the uracil being replaced by thymine (the C/G pair is converted to a T/A pair), thus distinguishing cytosine and methylcytosines. In a low throughput approximation, the subsequent cloning and sequencing of the PCR products allows the methylation percentage at any cytosine base in the region to be analyzed.
The methylation sensitive method involves digestion of DNA with a methylation-sensitive restriction endonuclease, which fails to cut if a cytosine base in the recognition sequence is methylated; the endonuclease most commonly used in this kind of analysis is Hpall, which recognizes the CCGG sequence and fails to cut if either of the cytosines is methylated. A subsequent PCR amplification will yield a product only if the DNA is not cut, i.e., if the cytosines are methylated.
Methyl-binding proteins and anti-methylcytosine antibodies methods are both immunocapturing approaches to enriching methylated DNA. Methylated enriched DNA is then amplified and employed on massive screening assays as microarrays. The main limitations of these approaches are that immunoprecipitation of large fragments increases the likelihood of co-precipitating adjacent, unmethylated DNA, causing false-positive signals, especially on high-density oligonucleotides arrays. In addition, these approaches require relatively large amounts of input DNA (2-20 μg); making it very difficult to employ these methods in clinical research.
Bisulfite treatment of genomic DNA, followed by genomic sequencing is a more informative methodology, since it assesses the methylation status (expressed as methylation percentage) of all the cytosine bases (both CpG and non-CpG) in a given sequence, whereas restriction endonuclease methods yield information exclusively on the methylation status of the cytosine bases in the recognition sequence(s). Bisulfite treatment has the disadvantage that the processing of the samples is both more complex, particularly in the DNA modification and purification phases, and time consuming, owing to the number of clones that need to be prepared for sequencing; the disadvantage of the latter is that it may be necessary to use different endonucleases to investigate different cytosine bases, thus increasing the number of the samples that need to be amplified by PCR. Therefore, despite being less exhaustive than the bisulfite technique, Hpall/PCR may still be considered useful because it is an easy technique for studying DNA methylation.
U.S. Patent 6,214,556 describes genomic DNA PCR amplification following bisulphite treatment, using either degenerate oligonucleotides or oligonucleotides which are complementary to adaptors ligated to the ends of cleaved DNA, and final PCR amplification of DNA material followed by hybridization on a microarray. This strategy typically results in the loss of information since there is difficulty on specific-promoter-sequence amplification due to high CG content, which can lead to promoter information loss during genome-wide application, therefore compromising initial sample fidelity.
Schatz et al. ((2004) Nucleic Acid Res. 32:el67) describe a method of analysis of CpG methylation patterns using bisulphite treatment, PCR amplification, in vitro transcription, RNase Tl cleavage, and MALDI-TOF detection. Reindeers et al. ((2008) Genome Res. doi:10.1101/gr.7073008 January 24) disclose a method for analysis of CpG methylation patterns in Arabidopsis an organism of relatively low methylation complexity compared to e.g., humans. Their method involved treatment of genomic DNA with Dral, bisulphite treatment, PCR amplification using random primers, and detection on a microarray. Yang et al. ((2007) Anal. Biochem., 369:120-127) describe a method for methylation analysis involving shearing genomic DNA by vortex and/or syringe,
treatment with bisulphite, PCR amplification with degenerate primers pairs, and detection by methylation specific PCR.
PCR based amplification of high GC content regions of genomes have proven problematic (McDowell et al., Nucleic Acid Research (1998) 26:3340-3347). PCR Amplification of high GC rich regions give weak signals when amplified using standard PCR conditions and the amplifications can result in non-specific amplification. Various additives and enhancing agents that typically alter melting temperatures have been proposed like DMSO, betaine, formamide, glycerol, non-ionic detergents, and the like to increase PCR efficiency, specificity, and reproducibility (Musso et al. (2008) J. MoI. Diag. 8:544-550). It is related in Sahdev et al. ((2007) Molecular & Cellular Probes 21:303-307) that "Optimization of magnesium concentration, buffer pH, denaturing and annealing times and temperatures, and cycle number have been shown to be useful in some, but not all cases. These approaches, however, are laborious and rather time-consuming for achieving best optimization conditions." Furthermore, the method disclosed relies on specific primer design. Ultimately, the Sahdev et al. solution involved optimizing primer design and optimization of PCR conditions.
Mamedov et al. ((2008) Comp. Biol. & Chem. 32:452-457) present a theoretical analysis of how high GC rich regions hinder PCR amplifications and suggest that shorter annealing times can aid in more efficient PCR amplification.
What is clear is that the currently available methods for assessing genomic DNA genome- wide methylation profiles are inadequate since they do not insure fidelity in retention of promoter sequences throughout the protocol and/or the methods rely on the use of specific primers for each promoter to be assayed.
DISCLOSURE OF THE INVENTION
Disclosed are methods and compositions useful for detecting DNA methylation. The method is useful for characterizing the methylation status or methylation profile of DNA. The method can be used to examine the methylation status/profile of a specific promoter/CpG island and/or a plurality of promoters/CpG islands. The compositions of the invention can be used for assessing the DNA methylation of genomic DNA. The method is useful in numerous applications
including the diagnosis and prognosis of diseases having altered DNA methylation patterns. The method of the invention is also useful for biomarker discovery. The invention can be used to identify specific biomarkers associated with phenotypes and for establishing methylation fingerprints (e.g., patterns, status, profiles, or the methylome). Methylation patterns, status, profiles, and the methylome as determined by the methods of the invention can be associated with phenotypes (prognosis, diagnosis, response to therapeutics, etc.). The methods and compositions of the invention are useful for determining genome-wide methylation patterns. Generally speaking, methods of the invention involve determining the methylation of DNA by treating the DNA with an agent capable of distinguishing cytosine and 5-methylcytosine, subjecting the resulting DNA to in vitro transcription, and detecting the products of the in vitro transcription to determine the methylation of the DNA. The methods can comprise comparing treated DNA (according to the methods of the invention) versus untreated DNA or simply determining the profile of the treated DNA.
In one specific implementation, the method of the invention comprises:
(a) obtaining or providing a sample having DNA,
(b) fragmenting the DNA with two or more restriction enzymes having different recognition sites,
(c) ligating adaptors to the fragmented DNA wherein cytosines in said adaptors are 5 '-methyl protected cytosine,
(d) treating the ligated DNA fragments with a deaminating agent,
(e) synthesizing double-stranded DNA from the single-stranded DNA obtained from the previous step,
(f) performing in vitro transcription on double-stranded DNA formed from the ligated deaminated DNA fragments to produce RNA, and
(g) detecting the RNA to determine the methylation of the DNA.
In one aspect, detecting the RNA to determine the methylation of the DNA comprises determining the sequence of the RNA, or a nucleic acid derived from the RNA, to determine the identity of the sequences obtained from the in vitro transcription, thereby determining the methylation of the DNA.
In another aspect, detecting the RNA to determine the methylation of the DNA comprises hybridizing the RNA, or a nucleic acid derived from the RNA, to a microarray to determine the identity of the sequence(s) obtained from the in vitro transcription, thereby determining the methylation of the DNA. In some aspects of the invention, the methylation of 50 or more cytosines in the DNA sample is determined.
In some aspects of the invention, the methylation of from 50 to 100,000 cytosines in the DNA sample is determined.
In some aspects of the invention, the methylation of from 100 to 100,000 cytosines in the DNA sample is determined.
In some aspects of the invention, methylation of three or more promoters in the DNA sample is determined.
In some aspects of the invention, the methylation of six or more promoters in the DNA sample is determined. In some aspects of the invention, the methylation of from three to 10,000 promoters in the DNA sample is determined.
In some aspects of the invention, the methylation of six to 10,000 promoters in the DNA sample is determined.
In some aspects of the invention, the methylation of three or more CpG islands in the DNA sample is determined.
In some aspects of the invention, the methylation of six or more CpG islands in the DNA sample is determined.
In some aspects of the invention, the methylation of from three to 10,000 CpG islands in the DNA sample is determined. In some aspects of the invention, the methylation of from six to 10,000 CpG islands in the DNA sample is determined.
In some aspects of the invention, the DNA is not amplified prior to treatment with an agent that is capable of distinguishing cytosine from 5-methylcytosine.
In some aspects of the invention treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine comprises bisulphite treatment.
In some aspects of the invention, treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine comprises fragmentation of the DNA,
ligation of adaptors to the fragmented DNA, and treatment of adaptor ligated fragmented DNA with bisulphite.
In some aspects of the invention, in vitro transcription to synthesize RNA comprises synthesizing double-stranded DNA from the DNA obtained by treatment with an agent that is capable of distinguishing 5-methylcytosine from cytosine and transcribing the double-stranded DNA into RNA with a polymerase.
In some aspects of the invention, fragmentation of the DNA comprises treating the DNA with one or more restriction enzymes.
In some aspects of the invention, the one or more restriction enzymes are methylation insensitive.
In some aspects of the invention, the DNA is not amplified prior to treatment with an agent that an agent capable of distinguishing 5-methylcytosine and cytosine.
In some aspects of the invention, the method is for diagnosing cancer.
In some aspects of the invention, the method is for prenatal diagnosis. In some aspects, the invention provides a kit having (1) a component for fragmenting DNA, (2) a component for distinguishing 5-methylcytosine and cytosine, (3) an in vitro transcription component, and (4) instructions for using the components of the kit.
In some aspects, the invention provides a kit having component for distinguishing 5-methylcytosine from cytosine comprises reagents for selective bisulphate-mediated deamination of cytosine as compared to 5-methylcytosine.
In some aspects, the invention provides a kit where in vitro transcription component comprises adaptors.
In some aspects of the invention, the invention provides a set of probes for detecting for diagnosing cancer wherein said probes are designed to the methylation status of DNA treated with bisulphite and subsequent in vitro transcription.
In some aspects of the invention, the set of probes comprise probes for from two to 1000 promoters or CpG islands.
In some aspects of the invention, the set of probes comprise probes for from ten to 1000 promoters or CpG islands.
In some aspects of the invention, the set of probes comprise probes for from twenty to 1000 promoters or CpG islands.
Thus, in one embodiment, the method of the invention involves (1) providing a sample of DNA, (2) treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine in the DNA and converting the resulting single-stranded DNA into double-stranded DNA, (3) subjecting the resulting double-stranded DNA to in vitro transcription, and (4) detecting the products of the in vitro transcription to determine the methylation of the DNA.
The sample of DNA for use in the invention can be from any source and/or organism. For example, the DNA can be from human cells, human cancer cells, circulating DNA, fetal DNA (isolated e.g., from maternal plasma), cancer cell lines, mammalian cells, mammalian cancer cells, mouse cells, cancer cells obtained from mice, plant cells, etc. The sample of DNA can also be obtained by various methods, e.g., from a biopsy, blood sample, aspirate, tissue section, a fluid sample, swab, etc.
The step of treating DNA with an agent that distinguishes cytosine from 5-methylcytosine involves contacting the DNA with an agent that modifies either cytosine or 5-methylcytosine. One example of such a treatment is alkaline bisulphite treatment under conditions which convert cytosine to uracil, but leaves 5-methylcytosine as 5-methyl cytosine. Alternatively, the DNA can be contacted with an agent that modifies both cytosine and 5-methylcytosine, rendering them distinct. This step allows the later determination, at cytosine positions in DNA, whether it is 5-methylcytosine or cytosine. Typically, the step involving treatment with bisulphite results in single-stranded DNA. The single-stranded DNA can be converted to double-stranded DNA for the subsequent in vitro transcription step. In an alternative aspect, the agent that distinguishes cytosine from 5-methylcyctosine can be an agent that inhibits DNA methyltransferase activity (e.g., 5-aza-cytidine). Treatment of cells with an agent that inhibits DNA methyltransferase activity will result in loci that were methylated to lose their methylation, thus distinguishing cytosine from 5-methylcytosine.
The in vitro transcription step in the method of the invention converts the DNA into RNA. The in vitro transcription step typically involves using primers that are complementary to sequences located in the adaptors that are ligated to the fragmented DNA.
The detection of the products of the in vitro transcription step in the method of the invention can be accomplished in a number of ways. One particular method is hybridization of the RNA to a microarray designed to have probes corresponding to various permutations of sequences that can contain 5-methylcytosine and cytosine in the particular genome of interest. The in vitro transcription step can be performed under conditions suitable for incorporating labeled nucleotides into the RNA that allow their later identification on a microarray. Typically, for detection on a microarray, the RNA synthesized in the in vitro transcription step is processed further depending on the type of array used, before being hybridized to the microarray.
Another method for detecting the products of the in vitro transcription step can involve DNA sequencing. The skilled artisan is familiar with and can readily implement methods for sequencing nucleic acids, including DNA.
The invention, therefore, allows for the determination of the methylation profile of the genome of a cell or group of cells. The methylation profile of a cell, tissue or fluid can be correlated with specific phenotypic information and/or compared to "normal" methylation profiles. The methylation profile can also be used for diagnostic and/or prognostic information.
In one embodiment of the invention, a method is provided for determining the methylation status of DNA. The method involves obtaining or providing a sample having DNA. According to the method, the DNA sample is fragmented to provide DNA fragments. The next step involves the treatment of the fragmented DNA with a deaminating agent (e.g., bisulphite) that can deaminate cytosines that do not have a 5-methyl group (in effect converting cytosine to uracil). Following deamination, the resulting DNA is converted to double-stranded DNA by a primer extension reaction. The double-stranded DNA is then subjected to in vitro transcription conditions to yield RNA. The RNA is then detected to determine its identity and therefore provide information as to whether a particular position has a cytosine or 5-methylcytosine. In one specific aspect, the RNA is processed and hybridized to an array to determine the methylation pattern of the DNA.
In another embodiment, the method of the invention involves determining DNA methylation status by (1) obtaining a sample having genomic DNA,
(2) fragmenting the genomic DNA with two or more cytosine methylation insensitive restriction enzymes having different recognition sites, (3) ligating adaptors having 5 '-methyl protected cytosine to the fragmented DNA, (4) treating the ligated DNA fragments with a deaminating agent, (5) synthesizing double-stranded DNA from the single-stranded DNA obtained from the previous step, (6) performing in vitro transcription on double-stranded DNA formed from the ligated deaminated DNA fragments to produce RNA, and (6) hybridizing the RNA to a microarray to determine the identity of the sequences obtained from the in vitro transcription, thereby determining the DNA methylation status of the DNA. Also provided are kits useful for genome-wide screening of methylation status. The kits can also be used for diagnostic and prognostic purposes.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below, hi case of conflict, the present specification, including definitions, will control, hi addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a diagram outlining one specific implementation of the method of the invention. Step A is the provision of genomic DNA. Step B involves the fragmentation of the genomic DNA with two restriction enzymes that are not methylation sensitive. Step C is the ligation of two different adaptors, each adaptor containing a different promoter sequence (one for T7 and the other for T3), and each adaptor engineered to be specific for one of the overhang sequence created from the fragmentation. If the adaptors contain cytosine then they are in the form of 5-methylcytosines. Step D involves the treatment of the fragmented DNA that has been ligated to the adaptors with bisulphite to convert cytosines to uracils, whereas 5-methylcytosines remain 5-methylcytosines. After step D, the DNA is no longer able to hybridize to it complementary strand because the strands are no longer
complementary after conversion of cytosines to uracils. Step E involves converting the single-stranded DNA from step D into double-stranded DNA with a primer extension reaction, using promoters engineered into the ligated adaptors. Step F involves the transcription of the DNA from step E into RNA, using specific transcriptase binding sites engineered into the ligated adaptor, and incorporation of label. Step G involves hybridization of the RNA to an array having a plurality of probes useful distinguishing cytosine and 5-methylcytosine in the original DNA.
FIG. 2 illustrates one specific implementation of the method of the invention relating to steps following the ligation of the adaptors to the fragmented DNA. The "C"s marked with an asterisk (*) represent 5-methylcytosine. Step A represents the bisulphite treatment of DNA with a Forward ORI sequence and a reverse ORI sequence to exemplify the method for one particular sequence. The bisulphite treatment converts the cytosines (C) to uracil (U) whereas the 5-methylcytosines remain 5-methylcytosines and the strands are no longer complementary. Step B: using primers based on the promoter sequences ligated into the adaptors, double-stranded DNA is synthesized using a primer extension reaction. Step C involves synthesis of RNA from the double-stranded DNA using an in vitro transcription reaction (with specific transcriptase binding sites engineered into the ligated adaptor) with incorporation of label into the RNA that is synthesized. The final product is complementary to the forward ORI sequence after bisulphite treatment. As shown in FIG 3, if the target sequence has its cytosine methylated it will hybridize to one probe corresponding to the methylated state (+) whereas it will not hybridize to the probe corresponding to the non-methylated state (-).
FIG. 3 illustrates a specific example of how probes may be designed for use in the methods of the invention. Probe design involves starting with a sequence and determining in silico the effects of a theoretical bisulphite treatment. (A) corresponds to the forward ORI sequence with complete cytosine methylation and modification after bisulphite treatment; (B) corresponds to the forward ORI sequence with no cytosine methylation and modification after bisulphite treatment; (C) corresponds to the reverse ORI sequence with complete cytosine methylation and modification after bisulphite treatment; and (D) corresponds to the reverse ORI sequence with no cytosine methylation and modification after bisulphite treatment.
FIG. 4 shows the results of the experiments described in Example 1 with a synthetic ER-alpha (FIG. 4A) promoter with the y-axis having the Cy5 signal intensity corresponding to the methylated sample and the x-axis having the Cy3 signal intensity corresponding to the non-methylated signal intensity (the light gray triangles are for the probes to the non-methylated sequences whereas the darker diamonds are for the probes to the methylated sequence); the pl6INK4a promoter (FIG. 4B) with the y-axis having the Cy5 signal intensity corresponding to the non-methylated sample and the x-axis having the Cy3 signal intensity corresponding to the methylated signal intensity (the light gray triangles are for the probes to the methylated sequences whereas the darker circles are for the probes to the non-methylated sequence); and E-cadhedrin promoter (FIG. 4C) with the y-axis having the Cy5 signal intensity corresponding to the methylated sample and the x-axis having the Cy3 signal intensity corresponding to the non-methylated signal intensity (the light gray triangles are for the probes to the non-methylated sequences whereas the darker circles are for the probes to the methylated sequence). The results show the methods of the invention are capable of distinguishing the methylation status of several GC rich promoters.
FIG. 5 shows the results of the experiment carried out to test the applicability of the method for genome-wide determination of methylation patterns as described in Example 2. The experiments were designed to examine the promoters of six genes: pl6INK4a, ER-alpha, E-cadherin, MGMT, GSTPl, and APC from genomic DNA samples with the y-axis having the Cy5 signal intensity corresponding to the methylated sample and the x-axis having the Cy3 signal intensity corresponding to the non-methylated signal intensity (the light gray triangles are for the probes to the non-methylated sequences whereas the darker circles are for the probes to the methylated sequence). The results show that the methylation status of a number of promoters can be distinguished use complex biological samples using the methods of the invention.
MODE(S) FOR CARRYING OUT THE INVENTION The invention is based on the development of a method useful for detecting methylation patterns. Methylation patterns are sometimes referred to as the methylome, methylation fingerprint, methylation status, or methylation profile. The invention relates to the discovery of methods and compositions useful for detecting and characterizing the methylation of nucleic acids, e.g., DNA. The method can be used for assessing the DNA methylation of genomic DNA (including DNA derived from genomic DNA) and DNA from other sources like circulating cell-free DNA. The method is useful in numerous applications including the diagnosis and prognosis of diseases having altered DNA methylation patterns. Other applications include the correlation of the methylation of specific biomarkers with disease, increased susceptibility to disease, and prognosis. Thus, the method of the invention is useful for biomarker discovery. The invention can be used to identify specific biomarkers associated with phenotypes and for establishing methylation profiles (or methylation status). The method of the invention can also be used for detecting the methylation profiles of tissues obtained from biopsy or surgery. The method can also involve detection of methylated CpG islands in easily accessible biological materials such as serum and other fluids. The method of the invention is also useful for the early diagnosis of disease and cancer. The method and compositions of the invention are therefore generally useful for determining genome- wide methylation patterns.
Generally speaking, the method of the invention involves determining the methylation of a nucleic acid by treating the nucleic acid with an agent capable of distinguishing 5-methylcytosine and cytosine, subjecting the resulting nucleic acid to in vitro transcription, and detecting the products of the in vitro transcription to determine the methylation of the nucleic acid.
In one embodiment, the method of the invention involves (1) providing a sample having nucleic acid, (2) treating the nucleic acid sample with an agent capable of distinguishing a base and its methylated version, (3) subjecting the resulting nucleic acid to conditions sufficient for reverse transcription and (4) detecting the products of the reverse transcription to determine the methylation of the nucleic acid. In one aspect of this embodiment, the nucleic sample is
fragmented prior to treatment with the agent that a base and its methylated version. In one aspect of this embodiment, adaptors are ligated to the fragment nucleic acid prior to treatment with the agent that distinguishes a base and its methylated version. In one aspect of this embodiment, the detecting step comprises processing the products of the in vitro transcription step and hybridizing them to a microarray. In a specific aspect, the base is cytosine and the methylated version is 5-methylcytosine.
In yet another embodiment, the method of the invention involves (1) providing a sample of DNA, (2) treating the DNA sample with an agent capable of distinguishing 5-methylcytosine and cytosine, thereby creating single-stranded DNA, (3) subjecting the resulting single-stranded DNA to conditions sufficient to create double-stranded DNA, (4) subjecting the double-stranded DNA to conditions sufficient for in vitro transcription, and (5) detecting the products of the in vitro transcription to determine the methylation of the DNA. In one aspect of this embodiment, the DNA sample is fragmented prior to treatment with the agent that distinguishes cytosine and 5 '-methylcytosines. In one aspect of this embodiment, adaptors are ligated to the fragment DNA prior to treatment with the agent that distinguishes 5 '-methylcytosine and cytosine. In one aspect of this embodiment, step 3 is accomplished by a primer extension reaction using primers complementary to adaptors that are ligated to the fragmented DNA. In one aspect of this embodiment, the detecting step comprises processing the products of the in vitro transcription step and hybridizing them to a microarray.
Many prior art techniques, especially those using PCR amplification, for determining methylation of a nucleic acid cannot be effectively used to determine the methylation of nucleic acids containing CpG islands since these regions have high melting temperatures, are likely to form problematic secondary structures and are difficult to amplify. Thus, in specific aspects of the method of the invention, no PCR DNA amplification step or exponential amplification step is used in the specific methods of the invention. In some aspects of the invention, the in vitro transcription step involves linear amplification of DNA to produce RNA. The lack of DNA amplification step in this aspect ensures fidelity and avoids the loss of methylation status information caused by amplification.
The sample of nucleic acid used in the method of the invention can be obtained from any cell (or cells), a tissue, a fluid, or composition having methylated nucleic acid. In some aspects of the invention, the nucleic acid sample is genomic DNA obtained from a cell or cells suspected of being cancerous. In some aspects of the invention the cells are derived from the culture of a cell line, hi some aspects of the invention, the tissue is derived from a xenograft. In some aspects of the invention, the genomic DNA is obtained from a body fluid like serum, plasma, saliva, urine, or other bodily fluids. In some aspects of the invention, the DNA is obtained from a biopsy, hi some aspects, the sample is from a body fluid chosen from blood serum, blood plasma, fine needle aspirate of the breast, biopsy of the breast, ductal fluid, ductal lavage, feces, urine, sputum, saliva, semen, lavages, biopsy of the lung, bronchial lavage or bronchial brushings. In some aspects, the sample is from a tumor or polyp. In some aspects, the sample is a biopsy from lung, kidney, liver, ovarian, head, stomach, neck, thyroid, bladder, cervical, colon, endometrial, esophageal, prostate or skin tissue. In some embodiments, the sample is from cell scrapes, washings, or resected tissues. hi some embodiments, the methylation status of at least one cytosine, CpG island, or promoter is compared to the methylation status of a control locus. In some embodiments, the control locus is an endogenous control (e.g., comparison of tumor tissue to healthy tissue of the same origin as the tumor). In some embodiments, the control locus is an exogenous control (e.g., comparison of DNA from tissue of one individual to the DNA from the same tissue from a different individual). hi some aspects of the invention, the methylation status of normal tissue is compared to the methylation status of disease tissue. Several variants of these comparisons can be employed with the method of the invention, including comparing normal tissue from a group of subjects to matched disease tissue from a group of patients. For example, the methylation status of prostate cancer tissue obtained from patients having prostate cancer can be compared to normal non-cancerous prostate tissue (either derived from the sample population of patients and/or from healthy patients). Another example can use other tissue besides the diseased tissue: skin macrophages from healthy patients compared to skin macrophages from patients having disease (e.g., lung cancer). With a suitable
sample size and sufficient experimental design, changes in the methylation status between the normal and diseased groups can identify biomarkers correlated with the characteristic of interest (e.g., diagnosis, prognosis, likelihood of response to a therapeutic, etc.). The invention therefore allows for the determination of the methylation profile of the genome of a cell or group of cells. The methylation profile of a cell, tissue or fluid can be correlated with specific phenotypic information and/or compared to "normal" methylation profiles to identified patterns or specific markers associated with particular phenotypic information.
One important step in the method of the invention involves contacting the DNA sample with an agent capable of distinguishing cytosine from 5-methylcytosine. In some aspects, the agent that distinguishes cytosine and 5-methylcytosine changes the base pairing characteristic of one of these bases. Any number of treatments can accomplish this, including bisulphite treatment which converts cytosine to uracil (or a base with similar base-pairing properties as uracil) and leaves 5-methylcytosine unchanged. Any number of treatments can accomplish this, including bisulphite treatment which converts cytosine to uracil and leaves 5-methylcytosine unchanged. Bisulphite treatment can involve treatment of the DNA with a bisulphite solution under alkaline conditions for a time sufficient to deaminate cytosine but not 5-methylcytosine. Descriptions of bisulfite treatment methods can be found in, e.g., U.S. Patents 6,265,171 and 6,331,393; Boyd and Zon, Anal. Biochem. 326:278-280, 2004.
The in vitro transcription step in the method of the invention converts the DNA into RNA. In vitro transcription normally requires double-stranded DNA as a template. Thus, prior to the in vitro transcription step, extension of single-stranded DNA obtained from the treatment of the DNA with from the previous step can be accomplished using primers complementary to sequence in the adaptors that were previously ligated to the fragmented DNA. The double strand DNA is template for RNA polymerase, e.g., transcriptase, which binds to a specific promoter sequence also included in the adaptor sequence. Other components of the in vitro transcription include the necessary nucleotides (rNTPs), and an appropriate reaction buffer.
Detection of the products of the in vitro transcription can be accomplished in a number of ways. One particular method is hybridization of the RNA to a microarray designed to have probes corresponding to methylated and unmethylated sequences in the genome, hi some aspects, the RNA produced from the in vitro transcription step is processed prior to hybridizing to the microarray (e.g., fragment and purified). In silico simulations of the treatment of DNA according to the method of the invention can be performed to design probes specific for distinguishing whether or not a particular position in the DNA is methylated or not. Procedures for hybridizing and detecting sequences on a microarray are known to the skilled artisan and depend on the microarray platform used. Such procedures, for example, can involve dual hybridization and/or co-hybridization protocols.
The microarrays for use in the invention can be one-dimensional, two-dimensional and/or a three-dimensional arrangement of addressable regions bearing a particular chemical moiety or moieties (such as ligands, e.g., biopolymers such as polynucleotide or oligonucleotide sequences (nucleic acids) associated with that region. Generally, the arrays used in the embodiments are arrays of polymeric binding agents, where the polymeric binding agents may be any one or more of: polypeptides, proteins, nucleic acids, polysaccharides, synthetic mimetics of such biopolymeric binding agents, etc. In some embodiments, the arrays are arrays of nucleic acids, examples of which include, but are not limited to, oligonucleotides, polynucleotides, cDNAs, mRNAs, synthetic mimetics thereof, and the like. Where the arrays are arrays of nucleic acids, the nucleic acids may be covalently attached to the arrays at any point along the nucleic acid chain, but are generally attached at one of their termini (e.g., the 3 ' or 5' terminus). Methods for manufacturing and using arrays are known to the skilled artisan and are commercially available.
Definitions
As used herein, the term "methylation insensitive enzyme" refers to any enzyme that will cut a nucleic acid sequence at a CpG site with or without a 5-methylcytosine. In other words, a methylation insensitive enzyme will cleave a methylation restriction site independent of its methylation status. Examples of methylation insensitive enzyme include Mspl, Taql, Xmal, and FspBI.
As used herein "methylation" generally refers to cytosine methylation at position C5 of cytosine (5-methylcytosine). As the skilled artisan is aware other forms of nucleic acid methylation are known, and it is contemplated the methods of the invention, when appropriate, can be used for their detection. As used herein, the term "methylation profile" refers to a set of data representing the methylation state of one or more loci within a molecule of DNA from e.g., the genome of an individual or cells or tissues from an individual (including for example cell free DNA). The profile can indicate the methylation state of every chosen base in an individual, can have information regarding a subset of the bases (e.g., the methylation state of specific promoters or quantity of promoters or specific sequences within the promoter) in a genome, or can have information regarding regional methylation density of each locus.
As used herein, the term "methylation status" refers to the presence, absence and/or quantity of methylation at a nucleotide or nucleotides within a portion of DNA. The methylation status of a particular DNA sequence can indicate the methylation state of every base in the sequence or can indicate the methylation state of a subset of the bases (e.g., whether the specific bases are cytosine or 5-methylcytosine) within the sequence. Methylation status can also indicate information regarding regional methylation density within the sequence without specifying the exact location.
As used herein, the term "ligation" refers to any process of forming phosphodiester bonds between two or more polynucleotides, such as those comprising double-stranded DNAs. Techniques and protocols for ligation may be found in standard laboratory manuals and references. Sambrook et al., In: Molecular Cloning. A Laboratory Manual 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (1989); and Maniatis et al., pg. 146.
As used herein, the term "probe" refers to any nucleic acid or oligonucleotide that can form a hybrid structure with a sequence of interest in a target gene region (or sequence) due to complementarily of at least one sequence in the probe with a sequence in the target region.
As used herein, the terms "nucleic acid," "polynucleotide" and "oligonucleotide" refer to nucleic acid regions, nucleic acid segments, primers,
probes, amplicons and oligomer fragments. The terms are not limited by length and are generic to linear polymers of polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and any other N-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine bases. These terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. A nucleic acid, polynucleotide or oligonucleotide can comprise, for example, phosphodiester linkages or modified linkages including, but not limited to phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages.
As used herein, the term "CpG Island," refers to any DNA region wherein the GC composition is over 50% in a "nucleic acid windows" having a minimum length of 200 bp nucleotides and a CpG content higher than 0.6.
As used herein, the term "promoter," refers to a sequence of nucleotides that reside on the 5' end of a gene's open reading frame. Promoters generally comprise nucleic acid sequences which bind with proteins such as, but not limited to, RNA polymerase and various histones. Some promoters are not completely to the 5 ' of a genes open reading frame: these promoters are also within the scope of the invention.
Embodiments of the Invention
The following embodiments are meant to illustrate non-limiting examples of methods and compositions of the invention.
In one embodiment of the invention, a method is provided for determining the methylation status of DNA. The method involves obtaining or providing a sample having DNA. Any sample or source of DNA can be used in this embodiment. For example, the DNA can be derived from a fluid sample, a tissue sample, a cell culture, cells, an aspirate, a biopsy, or a tissue section. Furthermore, the DNA can be derived from various types of eukaryotic organisms including mammals (e.g., human) and plants. According to the method, the DNA sample is
fragmented to provide DNA fragments that can be further processed for use in a subsequent in vitro transcription reaction. In some aspects of this embodiment, the fragments suitable for in vitro transcription are prepared by treating the DNA sample with one or more restriction enzymes. The conditions and restriction enzyme(s) used for fragmenting the DNA are chosen to produce fragments suitable for in vitro transcription. Adaptors, having promoters for in vitro transcription, are then ligated to the fragmented DNA. The next step involves the treatment of the DNA with a deaminating agent (e.g., alkaline bisulphite treatment) that can deaminate cytosines that do not have a 5 '-methyl group. Following deamination, the resulting single-stranded DNA is converted to double-stranded DNA by primer extension reactions. The double-stranded DNA is then subjected to in vitro transcription conditions to yield RNA. The RNA is then processed and hybridized to an array to determine the methylation pattern of the DNA. In specific aspects of the method of this embodiment, no PCR DNA amplification step or exponential amplification step is used in the specific method of this embodiment.
In another embodiment, the method of the invention involves determining DNA methylation status by (1) obtaining a sample having genomic DNA, (2) fragmenting the genomic DNA with two or more methylation insensitive restriction enzymes having different recognition sites, (3) ligating adaptors having 5 '-methyl protected cytosine to the fragmented DNA, (4) treating the ligated DNA fragments with deaminating agent, (5) performing in vitro transcription on double-stranded DNA formed from the ligated deaminated DNA fragments, and (6) hybridizing the probes to an microarray for determining the identity if the sequences obtained from the in vitro transcription, thereby determining the DNA methylation status of the DNA. In specific aspects of the method of this embodiment, no PCR DNA amplification step or exponential amplification step is used in the specific method of this embodiment.
In one embodiment, the invention provides a genome-wide screening method for determining the methylation status of genomic DNA. The method involves: (a) providing genomic DNA (gDNA),
(b) fragmenting the genomic DNA,
(c) ligating adaptors to the fragmented genomic DNA,
(d) treating the adaptor ligated fragmented DNA with an agent that deaminates cytosine bases but not 5-methylcytosine bases,
(e) synthesizing double-stranded DNA from single-stranded DNA obtained from step (d) (f) transcribing the double-stranded DNA obtained from step (e) into
RNA, and
(g) hybridizing the RNA to a microarray to determine the genome wide methylation status of the genomic DNA. In a specific aspect of this embodiment, determining the methylation of the DNA further comprises comparing the sequence of DNA treated with an agent capable of distinguishing 5-methylcyctosine from cytosine to DNA not treated with an agent capable of distinguishing 5-methylcytosine from cytosine.
According to a specific aspect of the method of this embodiment, the method is as follows. First genomic DNA (gDNA) is provided. The gDNA can be extracted from a sample using any suitable method. The gDNA is incubated with one or more restriction enzymes to give digested genomic DNA. The ends of the digested gDNA are ligated with phosphorylated and cytosine-methylated adaptors to give digested gDNA with adaptors. The digested gDNA ligated with adaptors is then treated with bisulphite under conditions sufficient to deaminate cytosine bases that are not methylated. This steps yields single-stranded DNA (sDNA). The complementary strand of the sDNA is then synthesized to give double-stranded DNA (dsDNA) which can be the substrate for a subsequent in vitro transcription reaction. For example, the complementary strand can be synthesized using a primer extension reaction with primers based on the sequences contained in the adaptor. Next, the template double strand DNA is in vitro transcribed to synthesize RNA. The RNA is then hybridized to an array to determine the methylation status of the gDNA. hi specific aspects of the method of the invention, no PCR DNA amplification step or exponential amplification step is used in the specific method of this embodiment, hi a specific aspect of this embodiment, determining the methylation of the DNA further comprises comparing the sequence of DNA treated with an agent capable of
distinguishing 5-methylcyctosine from cytosine to DNA not treated with an agent capable of distinguishing 5-methylcytosine from cytosine.
In one embodiment, the invention provides a genome-wide screening method for determining methylation status of genomic DNA. The method involves providing genomic DNA (gDNA). The gDNA can be extracted from a sample using any suitable method. The gDNA is incubated with one or more restriction enzymes to give digested genomic DNA. The ends of the digested gDNA are ligated with phosphorylated and cytosine-methylated adaptors suitable to give digested gDNA with ligated adaptors. The digested gDNA ligated with adaptors is treated with bisulphite under conditions sufficient to deaminate cytosines that are not methylated. This steps yields single-stranded DNA (sDNA). The complementary strand of the bisulphite treated sDNA is then synthesized to give template double-stranded DNA (dsDNA). For example, the complementary strand can be synthesized using a primer extension reaction with primers based on the sequence contained in the adaptor. Next, the template double strand DNA is transcribed to RNA. The resulting RNA is then hybridized to an array to determine the methylation status of the gDNA. In specific aspects of the method of the invention, no PCR DNA amplification step or exponential amplification step is used in the specific method of this embodiment. In a specific aspect of this embodiment, determining the methylation of the DNA further comprises comparing the sequence of DNA treated with an agent capable of distinguishing 5-methylcyctosine from cytosine to DNA not treated with an agent capable of distinguishing 5-methylcytosine from cytosine.
In a more specific aspect of this embodiment, the method is as follows. Genomic DNA is incubated with two endonucleases having restriction sites that yield overhangs with different sequences. The endonuclease treatment can be at the same time in the same reaction or the treatment can be sequential. In a specific aspect, the endonucleases can be tetracutters (e.g., Taql and Bfal). Next the fragmented genomic DNA is then contacted with adaptors under conditions sufficient to ligate the adaptors to the fragmented DNA. Two types of adaptors are used in this step, and if either contains cytosine these cytosines are in the form of 5-methylcytosine to protect from deamination in subsequent bisulphite treatment. The two types of adaptors are designed so that one type can be specifically ligated to
a site corresponding to one endonuclease site and the other type can be specifically ligated to the other endonuclease site. The adaptor ligated fragmented genomic DNA is then treated with bisulphite to deaminate cytosine bases but not 5-methyl cytosines. This step yields bisulphite treated single-stranded DNA (sDNA). The complementary strand of the bisulphite treated sDNA is synthesized using a primer extension reaction based on sequences contained in the adaptors to give template dsDNA. The template dsDNA is then transcribed into RNA using promoters sequences engineered into the adaptors and conditions sufficient for transcription. The RNA is then hybridized to an array to determine the methylation status of the genomic DNA. In one specific aspect of the method of the invention, no PCR DNA amplification step or exponential amplification step is used in the specific method of the invention prior to treatment of the DNA with bisulphite. In one specific aspect of the method of the invention, no PCR DNA amplification step or exponential amplification step is used in the specific method of this embodiment. In a specific aspect of this embodiment, determining the methylation of the DNA further comprises comparing the sequence of DNA treated with an agent capable of distinguishing 5-methylcyctosine from cytosine to DNA not treated with an agent capable of distinguishing 5-methylcytosine from cytosine.
In yet another embodiment, the present invention provides methods for diagnosing or predicting a cancer by genome-wide methylation profiling. The method of this embodiment can comprise (1) obtaining a test sample from cells or tissue, (2) obtaining a control sample from cells or tissue that is normal, and (3) detecting or measuring in both the test sample and the control sample the genome-wide methylation profile using the method of the invention. If the methylation profile of test sample is altered compared to the control sample (or value), this indicates a cancer or a precancerous condition in the test sample cells. If the level methylation of one or more tumor suppressors is higher in the test sample as compared to the control sample (or value), this indicates a cancer or a precancerous condition in the test sample cells or tissue. If the level methylation of one or more oncogenes (e.g., genes whose higher expression imparts a more neoplastic or cancerous phenotype (such as EGFR)) is lower in the test sample as compared to the control sample (or value), this indicates a cancer or a precancerous
condition in the test sample cells or tissue. In another aspect the control sample may be obtained from a different individual or be a normalized value based on baseline data obtained from a population. In a specific aspect of this embodiment, determining the methylation of the DNA further comprises comparing the sequence of DNA treated with an agent capable of distinguishing 5-methylcyctosine from cytosine to DNA not treated with an agent capable of distinguishing 5-methylcytosine from cytosine.
In one embodiment, the method of the invention is used to determine whether two or more tumors are more likely to have arisen independently or more likely to be clonal (e.g., primary and metastasis). According to this method the methylation profiles determined by the method of the invention are compared. Methylation profiles that are substantially similar indicate that the tumors are more likely to be clonal whereas methylation profiles that are substantially different are more likely to have originated independently. In one embodiment, the method of the invention comprises determining the methylation status of one or more miRNA cytosines, CpG dinucleotides, CpG islands, and/or promoters. The method of this embodiment involves obtaining or providing a sample having nucleic acid (e.g., genomic DNA) suspected of having miRNA (e.g., nucleic acid involved in the regulation of expression of the miRNA). According to the method, the DNA sample is fragmented to provide DNA fragments that can be further processed for use in subsequent in vitro transcription reaction(s). In some aspects of this embodiment, the fragments suitable for in vitro transcription are prepared by treating the DNA sample with one or more restriction enzymes. The conditions and restriction enzyme(s) used for fragmenting the DNA are chosen to produce fragments suitable for in vitro transcription. Adaptors, having promoters for in vitro transcription, are then ligated to the fragmented DNA. The next step involves the treatment of the DNA with a deaminating agent (e.g., alkaline bisulphite treatment) that can deaminate cytosines that do not have a 5 '-methyl group. Following deamination, the resulting single-stranded DNA is converted to double-stranded DNA by primer extension reactions. The double-stranded DNA is then subjected to in vitro transcription conditions to yield RNA. The RNA is then processed and hybridized to an array to determine the methylation pattern of the
DNA of one or more miRNA promoters. Examples of miRNA genes which have altered methylation status and/or profiles in cancer are known in the art. In Hepatocellular cancer, a CGI of miR-1-lwas shown to have differential methylation in HCC cell lines and primary tumors but not in matching liver tissue (Datta et al. (2008) Cancer Res. 68:5049-5058); Roman-Gomez et al. ((2009) Doi: 1299/JCO, 2008, 19:3441) disclose that miRNA are epigenetically regulated in Acute Lymphoblastic Leukemia where altered expression levels associated with altered CpG methylation of the promoters of these miRNA (Hsa-miR-9, Hsa-miR-lOb, Hsa-miR-34, Hsa-miR-124, Hsa-miR-132, Hsa-miR-196b, Hsa-miR-203, and Hsa-miR-212); Lujambo et al. ((2008) PNAS 105:13556-13561) show that miRNA DNA methylation profiles are useful for predicting metastasis (miR-148a, miR-34b/c and miR-9 were found to undergo cancer specific methylation); Lodygin et al. ((2008) Cell Cycle 7:2591-2600) showed that miR-34a is inactivated in multiple types of cancer by aberrant CpG methylation. According to this embodiment, the methylation status and/or profile of cytosines in any nucleic acid sequence associated with a miRNA sequence can be determined using the method of the invention. In one aspect of this embodiment, probes for different methylation states of miRNA can be created and used to detect methylation of miRNA promoter sequences, cytosines, CpG dinuccleotides, and/or CpG islands involved in regulation of expression of the miRNA. hi one aspect of this embodiment, the methylation status of one or more miRNA chosen from Hsa-miR-9, Hsa-miR-10b, Hsa-miR-34, miR-34a, Hsa-miR-124, Hsa-miR-132, Hsa-miR-196b, Hsa-miR-203, Hsa-miR-212, miR-148a, miR-34b/c, miR-9, and miR-1-1 is determined using the methods of the invention, hi specific aspects of the method of this embodiment, the DNA is not exponentially amplified. In a specific aspect of this embodiment, determining the methylation of the DNA further comprises comparing the sequence of DNA treated with an agent capable of distinguishing 5-methylcyctosine from cytosine to DNA not treated with an agent capable of distinguishing 5-methylcytosine from cytosine. hi one embodiment, the method is used to measure the methylation status of one or more markers in fetal DNA. hi a specific aspect, the fetal DNA is obtained from maternal plasma. In a specific aspect of this embodiment, the fetal DNA is analyzed for prenatal diagnosis, hi one aspect of this embodiment, the methylation
status or profile of one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more cytosines, promoters, and/or CpG islands are determined according to the methods of the invention. In one aspect of this embodiment, the methylation status or profile of from 2 to 1000, 3 to 1000, 4 to 1000, 5 to 1000, 6 to 1000, 7 to 1000, 8 to 1000, 9 to 1000, or 10 to 1000 cytosines, promoters, and/or CpG islands are determined according to the methods of the invention. Chim et al. (2008) CHn. Chem. 54:3 500-511. In a specific aspect of this embodiment, the method comprises detecting the presence or absence of fetal trisomy 21 in DNA obtained from maternal plasma. In one specific aspect of this embodiment, the method comprises analyzing the methylation profile one or more promoters, CpG islands, and/or cytosines that are differentially methylated in maternal as compared to fetal DNA. hi one aspect of this embodiment, the one or more promoters, CpG islands, and/or cytosines that are differentially methylated in maternal as compared to fetal DNA are on chromosome 21. hi a more specific aspect of this embodiment, the one or more promoters, CpG islands, and/or cytosines that are differentially methylated in maternal as compared to fetal DNA are on chromosome 21 are chosen from CGI009, CGI023, CGI027, CGI028, CGI045, CGI051, CGI052, CGI071, CGI105, CGI109, CGI113, CGI127, CGI149, CGI40, CGI43, CGI084, CGI092, CGI093, CGI136, CGI137, CGI139, and CGIl 40. In a specific aspect of this embodiment, determining the methylation of the DNA further comprises comparing the sequence of DNA treated with an agent capable of distinguishing 5-methylcyctosine from cytosine to DNA not treated with an agent capable of distinguishing 5-methylcytosine from cytosine.
In one embodiment, the method is used to measure the methylation status of one or more markers for diagnosing prostate cancer. In one aspect, the sample to be analyzed is obtained from circulating DNA obtained from blood of an individual. In another aspect, the sample to be analyzed is obtained from urine or urine sediment, hi yet another aspect, the sample to be analyzed is obtained from a patient suspected of having or desiring screening for prostate cancer (e.g., biopsy). According to this diagnostic method, the sample having DNA that is to be analyzed with an agent capable of distinguishing 5-methylcytosine and cytosine (e.g., bisulphite treatment), (3) subjecting the resulting DNA to in vitro transcription and (4) detecting the
products of the in vitro transcription to determine the methylation of the DNA. In a specific aspect, the one or more markers that are analyzed are chosen from RASSFl, RARB2, and GSTPl. In another specific aspect, the markers that are analyzed are chosen from pi 6, ARF, MGMT, and GSTPl. In one specific aspect, the primers used for in vitro transcription are based on sequences contained in adaptor sequences that are ligated to the DNA in the sample, hi one aspect of this embodiment, the genomic DNA is not amplified by PCR. Hoque et al. ((2005) J. Clin. Oncol. 23:6569-75) and Sunami et al. ((2009) Clin. Chem. 55:3) describe markers for detecting prostate cancer. In an alternative embodiment, the method of this embodiment is used to measure the methylation status of one or more markers for prognosis and/or risk stratification of prostate cancer. hi one embodiment, the method of the invention is used to determine the methylation status of more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 tumor suppressor promoters. In one aspect of this embodiment, the method of the invention is used to determine the methylation status of from 1 to 1000 promoters, 2 to 1000 promoters, 3 to 1000 promoters, 4 to 1000 promoters, 5 to 1000 promoters, 6 to 1000 promoters, 7 to 1000 promoters, 8 to 1000 promoters, 9 to 1000 promoters, or 10 to 1000 promoters. In one aspect of this embodiment, the one or more tumor suppressors are chosen from p53; the retinoblastoma gene, commonly referred to as RbI; the adenomatous polyposis of the colon gene (APC); familial breast/ovarian cancer gene I (BRCAl); familial breast/ovarian cancer gene 2 (BRC A2); CDHl cadherin 1 (epithelial cadherin or E-cadherin) gene; cyclin-dependent kinase inhibitor 1C gene (CDKNlC, also known as p57, KIP2 or BWS); cyclin-dependent kinase inhibitor 2 A gene (CDKN2A also known as pi 6 MTSl (multiple tumor suppressor 1), TP 16 or INK4); familial cylindromatosis gene (CYLD; formerly known as EAC (epithelioma adenoides cysticum)); ElA-binding protein gene (p300); multiple exostosis type 1 gene (EXTl); multiple exostosis type 2 gene (EXT2); homolog of Drosophila mothers against decapentaplegic 4 gene (MADH4; formerly referred to as DPC4 (deleted in pancreatic carcinoma 4) or SMAD4 (SMA- and MAD-related protein 4)); mitogen-activated protein kinase kinase 4 (MAP2K4; also referred to as JNKKl, MEK4, MKK4, or PRKMK4; formerly known as SEKl or SERKl); multiple endocrine neoplasia type 1 gene
(MENl); homolog of E. coli MutL gene (MLHl also known as HNPCC (hereditary non-polyposis colorectal cancer) or HNPCC2; formerly referred to as COCA2 (colorectal cancer 2) and FCC2); homolog of E. coli MutS 2 gene (MSH2 also called HNPCC (hereditary non-polyposis colorectal cancer) or HNPCCl and formerly known as COCAl (colorectal cancer 1) and FCCl); neurofibromatosis type 1 gene (NFl); neurofibromatosis type 2 gene (NF2); protein kinase A type 1, alpha, regulatory subunit gene (PRXARlA, formerly known as PRKARl or TSε1 (tissue-specific extinguisher I)); homolog of Drosophila patched gene (PTCH; also called BCNS); phosphatase and tensin homolog gene (PTεN, also called MMACl (mutated in multiple advanced cancers 1), formerly known as BZS (Bannayan-Zonana syndrome) and MHAMl (multiple hamartoma I)); succinate dehydrogenase cytochrome B small subunit gene (SDHD; also called SDH4); Swi/Snf5 matrix-associated actin-dependent regulator of chromatin gene (SMARCBl, also referred to as BAF47, HSNFS, SNF5/INI1, SNF5L1, STHlP, and SNRl); serine/threonine kinase 11 gene (STKI l also known as LKBl and PJS); tuberous sclerosis type 1 gene (TSCl also known as KIAA023); tuberous sclerosis type 2 gene (TSC2, previously referred to as TSC4); von Hipple-Lindau syndrome gene (VHL); and Wilms tumor 1 gene (WTl, formerly referred to as GUD (genitourinary dysplasia), WAGR (Wilms tumor, aniridia, genitourinary abnormalities, and mental retardation), or WIT-2), DAP-kinase, FHIT, Werner syndrome gene, and Bloom syndrome gene, hi another aspect, the one or more tumor suppressors are chosen from, APC, BRCAl, BRC A2, CDHl, CDKN2A, DCC, DPC4 (SMAD4), MADR2/JV18 (SMAD2), MεN1, MLHl, MSH2, MTSl, NFl, NF2, PTCH, p53, PTεN, RBl, TSCl, TSC2, VHL, WRN, and WTl. In yet another aspect, the one or more tumor suppressors are chosen from CDHl (ε_Cadherin), pl6INK4a, APC, GSTPl, and MGMT.
In one embodiment, the method of the invention is used to determine the methylation status and/or profile of the promoters of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 oncogenes. In one aspect of this embodiment, the method of the invention is used to determine the methylation status of from 1 to 1000 oncogene promoters, 2 to 1000 oncogene promoters, 3 to 1000 oncogene promoters, 4 to 1000 oncogene promoters, 5 to 1000 oncogene promoters,
6 to 1000 oncogene promoters, 7 to 1000 oncogene promoters, 8 to 1000 oncogene promoters, 9 to 1000 oncogene promoters, or 10 to 1000 oncogene promoters. In one aspect, the one or more oncogenes are chosen from K-RAS, H-RAS, N-RAS, EGFR, MDM2, RhoC, AKTl, AKT2, MEK (also called MAPKK), c-myc , n-myc, beta-catenin, PDGF, C-MET, PIK3CA, CDK4, cyclin Bl, cyclin Dl, estrogen receptor gene, progesterone receptor gene, ErbBl, ErbB2 (also called HER2), ErbB3, ErbB4, TGF-alpha, TGF-beta, ras-GAP, She, Nek, Src, Yes, Fyn, Wnt, BCL 2 , and Bmil.
In some embodiments, the method comprises determining the methylation status and/or profile of more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 50, 75, or 100, 150, 200, 250, 300, 400, 500, 750, or 1000 cytosines in a DNA sample. In one aspect of this embodiment, the method comprise determining the methylation status of from 1 to 10,000 cytosines, 2 to 10,000 cytosines, 3 to 10,000 cytosines, 4 to 10,000 cytosines, 5 to 10,000 cytosines, 6 to 10,000 cytosines, 7 to 10,000 cytosines, 8 to 10,000 cytosines, 9 to 10,000 cytosines, or 10 to 10,000 cytosines.
In some embodiments, the method comprises determining the methylation status and/or profile of more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 50, 75, or 100, 150, 200, 250, 300, 400, 500, 750, or 1000 promoters in a DNA sample. In one aspect of this embodiment, the method of the invention is used to determine the methylation status of from 1 to 1000 promoters, 2 to 1000 promoters, 3 to 1000 promoters, 4 to 1000 promoters, 5 to 1000 promoters, 6 to 1000 promoters, 7 to 1000 promoters, 8 to 1000 promoters, 9 to 1000 promoters, or 10 to 1000 promoters. In some embodiments, the method comprises determining the methylation status and/or profile of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 50, 75, or 100, 150, 200, 250, 300, 400, 500, 750, or 1000 CpG islands within a DNA sample. In one aspect of this embodiment, the method of the invention is used to determine the methylation status of from 1 to 1000 CpG islands, 2 to 1000 CpG islands, 3 to 1000 CpG islands, 4 to 1000 CpG islands, 5 to 1000 CpG islands, 6 to 1000 CpG islands, 7 to 1000 CpG islands, 8 to 1000 CpG islands, 9 to 1000 CpG islands, or 10 to 1000 CpG islands.
In one embodiment, the invention provides a microarray for determining the methylation status and/or profile of more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 tumor suppressor promoters. In a specific aspect of this embodiment, the invention provides a microarray for determining the methylation status of from 2 to 1000 tumor suppressor promoters, 3 to 1000 tumor suppressor promoters, 4 to 1000 tumor suppressor promoters, 5 to 1000 tumor suppressor promoters, 6 to 1000 tumor suppressor promoters, 7 to 1000 tumor suppressor promoters, 8 to 1000 tumor suppressor promoters, 9 to 1000 tumor suppressor promoters, or 10 to 1000 tumor suppressor promoters. According to this embodiment, the microarray is designed to have probes for determining the methylation status (or profile) of each promoter for each tumor suppressor, according to the method of the invention. In one aspect of this embodiment, one or more of the tumor suppressors are chosen from p53; the retinoblastoma gene, commonly referred to as RbI; the adenomatous polyposis of the colon gene (APC); familial breast/ovarian cancer gene I (BRCAl); familial breast/ovarian cancer gene 2 (BRCA2); CDHl cadherin 1 (epithelial cadherin or E-cadherin) gene; cyclin-dependent kinase inhibitor 1C gene (CDKNlC, also known as p57, KIP2 or BWS); cyclin-dependent kinase inhibitor 2 A gene (CDKN2A also known as pl6 MTSl (multiple tumor suppressor 1), TP 16 or INK4); familial cylindromatosis gene (CYLD; formerly known as EAC (epithelioma adenoides cysticum)); ElA-binding protein gene (p300); multiple exostosis type 1 gene (EXTl); multiple exostosis type 2 gene (EXT2); homolog of Drosophila mothers against decapentaplegic 4 gene (MADH4; formerly referred to as DPC4 (deleted in pancreatic carcinoma 4) or SMAD4 (SMA- and MAD-related protein 4)); mitogen- activated protein kinase kinase 4 (MAP2K4; also referred to as JNKKl, MEK4, MKK4, or PRKMK4; formerly known as SEKl or SERKl); multiple endocrine neoplasia type 1 gene (MENl); homolog of E. coli MutL gene (MLHl also known as HNPCC (hereditary non-polyposis colorectal cancer) or HNPCC2; formerly referred to as COC A2 (colorectal cancer 2) and FCC2); homolog of E. coli MutS 2 gene (MSH2 also called HNPCC (hereditary non-polyposis colorectal cancer) or HNPCCl and formerly known as COCAl (colorectal cancer 1) and FCCl); neurofibromatosis type 1 gene (NFl); neurofibromatosis type 2 gene (NF2); protein kinase A type 1, alpha,
regulatory subunit gene (PRXARlA, formerly known as PRKARl or TSEl (tissue-specific extinguisher I)); homo log of Drosophila patched gene (PTCH; also called BCNS); phosphatase and tensin homolog gene (PTEN, also called MMACl (mutated in multiple advanced cancers 1), formerly known as BZS (Bannayan-Zonana syndrome) and MHAMl (multiple hamartoma I)); succinate dehydrogenase cytochrome B small subunit gene (SDHD; also called SDH4); Swi/Snf5 matrix-associated actin-dependent regulator of chromatin gene (SMARCBl, also referred to as BAF47, HSNFS, SNF5/INI1, SNF5L1, STHlP, and SNRl); serine/threonine kinase 11 gene (STKI l also known as LKBl and PJS); tuberous sclerosis type 1 gene (TSCl also known as KIAA023); tuberous sclerosis type 2 gene (TSC2, previously referred to as TSC4); von Hipple-Lindau syndrome gene (VHL); and Wilms tumor 1 gene (WTl, formerly referred to as GUD (genitourinary dysplasia), WAGR (Wilms tumor, aniridia, genitourinary abnormalities, and mental retardation), or WIT-2), DAP-kinase, FHIT, Werner syndrome gene, and Bloom syndrome gene. In another aspect, the one or more tumor suppressors are chosen from, APC, BRCAl, BRCA2, CDHl, CDKN2A, DCC, DPC4 (SMAD4), MADR2/JV18 (SMAD2), MENl, MLHl, MSH2, MTSl, NFl, NF2, PTCH, p53, PTEN, RBl, TSCl, TSC2, VHL, WRN, and WTl. In yet another aspect, the one or more tumor suppressors are chosen from CDHl (E_Cadherin), p 16INK4a, APC, GSTP 1 , and MGMT.
In one embodiment, the invention provides a microarray for determining the methylation status and/or profile of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 oncogenes. According to this embodiment, the microarray is designed to have probes for determining the methylation status (or profile) of each promoter for each tumor oncogene, according to the method of the invention, hi one aspect of this embodiment, the microarray has probes for detecting the methylation status or profile of from 2 to 1000 oncogene promoters, 3 to 1000 oncogene promoters, 4 to 1000 oncogene promoters, 5 to 1000 oncogene promoters, 6 to 1000 oncogene promoters, 7 to 1000 oncogene promoters, 8 to 1000 oncogene promoters, 9 to 1000 oncogene promoters, or 10 to 1000 oncogene promoters. In one aspect, one or more of the oncogenes are chosen from K-RAS, H-RAS, N-RAS, EGFR, MDM2, RhoC, AKTl, AKT2, MEK (also called MAPKK), c-myc , n-myc,
beta-catenin, PDGF, C-MET, PIK3CA, CDK4, cyclin Bl, cyclin Dl, estrogen receptor gene, progesterone receptor gene, ErbBl, ErbB2 (also called HER2), ErbB3, ErbB4, TGF-alpha, TGF-beta, ras-GAP, She, Nek, Src, Yes, Fyn, Wnt, BCL 2 , and Bmil. In one embodiment, the invention provides a method of diagnosis and/or prognosis of cancer. In one aspect of this embodiment, the method comprises obtaining a sample having a nucleic acid, subjecting the nucleic acid to conditions sufficient to deaminate 5-methyl cytosine, subjecting the treated nucleic acid to intra transcription. In one specific aspect, the method comprises diagnosis of prostate cancer. In one aspect, the methylation of CpG islands in GSTPl, FLNC, RARB2, and PTX2 are determined to differentiate between prostate cancer and benign prostatic hyperplasia (Vanaja et al. (2009) Cancer Investigation DOI 10.1080/07357900802620794). In one aspect of this embodiment, the method comprises PITX2, PDLIM4, KCNMAl, GSTPl, FLNC, EFS, and ECRG4 to distinguish cancers are more likely to be recurrent or less likely to be recurrent. In particular, methylation of FLNC, PITX, EFS, and ECRG4 are associated with recurrent prostate cancer. Methylation of individual CpG units can be used to diagnose prostate cancer e.g., RARB2_CpG_10.11, RARB2_CpG_l, RARB2_CpG_9, GSTPl_CpG_21, GSTPl_CpG_10, GSTPl_CpG_22, GSTPl_CpG_17.18, PITX2_CpG_31.32, GSTPl_CpG_19, GSTPl_CpG_8, FLNC_CpG_36.37.38, PITX2_CpG_14, PITX2_CpG_6.7, PITX2_CpG_34, GSTPl_CpG_l l, GSTPl_CpG_12.13, and PITX2_CpG_26.27.
In one aspect of this embodiment, the method relates to the diagnosis of breast cancer. The method of this aspect comprise comparing the methylation profile of nucleic acid obtained from a breast cancer patient or a patient suspected of having or desiring screening for breast cancer. The methylation profile as determined by the method of the invention can be compared to the methylation profile for normal breast cells, blood cells, and/or a control value. In a specific aspect, the markers analyzed for methylation are chosen from cytosines, CpG, and promoters involved in the regulation of expression of a specific gene(s). In one specific aspect, the markers are chosen from GHSR, chr7-8256880, LMTK3, MGA, chrl-203610783, CD9, hATHl, STK36, h3-OST-2, FLRT2, PRDM 12, NFIX,
CDX-2, CXCLl, ZBTB 8, and Hox-A7. Ordway et al. (2007J PLoS ONE 2(12):el314 describe methylation markers with high sensitivity and specificity for breast cancer.
In one embodiment, the invention provides a method of characterizing tumor progression (and/or diagnosing cancer) by determining hypermethylation and/or hypomethylation of DNA in a sample from a patient suspected of having cancer (or desiring screening for cancer). According to this embodiment, the method comprises obtaining a cancer sample from a patient and determining the methylation status of the DNA by treating the DNA with a deaminating agent (e.g., bisulphite treatment), subjecting said treated DNA to in vitro transcription, and detecting the methylation the DNA is the sample. DNA hypomethylation and hypermethylation have been associated with a number of cancers including lung cancer (see e.g., Anisowicz et al. (2008) BMC Cancer 8:222), ovarian cancer (see e.g., Widschwendter et al. (2004) Cancer Res. 64:4472-4480, and Barton et al. (2008) Gyn. One. 109:129-139), breast cancer (see e.g., Jackson et al. (2004) Cancer Biol. Ther. 3:1225-1231; Shann et al. (2008) Gen. Res. 18:791-801; Ordway et al. (2007) PLoS ONE 2(12):el314), cervical cancer (see e.g., Kim et al. (1994) Cancer 74.893-899), Prostate cancer (see e.g., Vanaja et al. (2009) Cancer Invest, ifirst 1-12; Cho et al. (2009) Virchows Arch. 454:17-23; Kron et al. (2009) PLoS ONE 4(3): e4830. doi:10.1371/journal.pone.0004830), Colorectal cancer (see e.g., Shen et al. (2009) Int. J. Clin. Exp. Pathol. 2:21-33; Baylin et al. (1998) Adv. Cancer Res. 72:141-96), Hepatocellular cancer (see e.g., Lin et al. (2001) Cancer Res. 61 :4238-4243), Melanoma (see e.g., Bonazzi et al. (2009) Genes, Chromosomes & Cancer 48:10-21), and gastric cancer (see e.g., Jee et al. (2009) Eur. J. Cancer doi:10.1016/j.ejca.2008.12.027). In specific aspects of this embodiment, specific promoters, CpG islands and/or cytosines can be examined using the method of this embodiment to determine their methylation status and diagnose cancer (including characterizing tumor progression).
In one embodiment, the invention provides a set of probes useful for the diagnosing, prognosis, and/or characterization of prostate cancer, wherein said probes are designed to detect changes in the methylation profile or status of the DNA of promoters, CpG islands, and/or cytosines differentially methylated in
prostate cancer according to the method of the invention. In one aspect of this embodiment, the set of probes is attached to a solid support. In one aspect of this embodiment, the set of probes has from 10 to 100,000 distinct probes, from 10 to 50,000 distinct probes, from 10 to 10,000 probes, and from 10 to 1,000 probes. In a specific aspect, the probes are designed to detect markers with differential methylation in prostate cancer, wherein the method of analyzing the DNA comprises treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine (e.g., bisulphate treatment) and followed by subjecting the resulting DNA to in vitro transcription, hi a specific aspect, the DNA is not amplified prior to treatment of the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine. hi one embodiment, the invention provides a set of probes useful for the diagnosing, prognosis, and/or characterization of breast cancer, wherein said probes are designed to detect changes in the methylation profile or status of the DNA of promoters, CpG islands, and/or cytosines differentially methylated in breast cancer according to the method of the invention. In one aspect of this embodiment, the set of probes is attached to a solid support. In one aspect of this embodiment, the set of probes has from 10 to 100,000 distinct probes, from 10 to 50,000 distinct probes, from 10 to 10,000 probes, and from 10 to 1,000 probes. In a specific aspect, the probes are designed to detect markers with differential methylation in breast cancer, wherein the method of analyzing the DNA comprises treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine (e.g., bisulphate treatment) and followed by subjecting the resulting DNA to in vitro transcription, hi a specific aspect, the DNA is not amplified prior to treatment of the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine. hi one embodiment, the invention provides a set of probes useful for the diagnosing, prognosis, and/or characterization of colorectal cancer, wherein said probes are designed to detect changes in the methylation profile or status of the DNA of promoters, CpG islands, and/or cytosines differentially methylated in colorectal cancer according to the method of the invention, hi one aspect of this embodiment, the set of probes is attached to a solid support, hi one aspect of this embodiment, the set of probes has from 10 to 100,000 distinct probes, from 10 to
50,000 distinct probes, from 10 to 10,000 probes, and from 10 to 1,000 probes. In a specific aspect, the probes are designed to detect markers with differential methylation in colorectal cancer, wherein the method of analyzing the DNA comprises treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine (e.g., bisulphate treatment) and followed by subjecting the resulting DNA to in vitro transcription. In a specific aspect, the DNA is not amplified prior to treatment of the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine.
In one embodiment, the invention provides a set of probes useful for the diagnosing, prognosis, and/or characterization of lung cancer, wherein said probes are designed to detect changes in the methylation profile or status of the DNA of promoters, CpG islands, and/or cytosines differentially methylated in lung cancer according to the method of the invention. In one aspect of this embodiment, the set of probes is attached to a solid support. In one aspect of this embodiment, the set of probes has from 10 to 100,000 distinct probes, from 10 to 50,000 distinct probes, from 10 to 10,000 probes, and from 10 to 1,000 probes. In a specific aspect, the probes are designed to detect markers with differential methylation in lung cancer, wherein the method of analyzing the DNA comprises treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine (e.g., bisulphate treatment) and followed by subjecting the resulting DNA to in vitro transcription. In a specific aspect, the DNA is not amplified prior to treatment of the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine.
In one embodiment, the invention provides a set of probes useful for the diagnosing, prognosis, and/or characterization of ovarian cancer, wherein said probes are designed to detect changes in the methylation profile or status of the DNA of promoters, CpG islands, and/or cytosines differentially methylated in ovarian cancer according to the method of the invention. In one aspect of this embodiment, the set of probes is attached to a solid support. In one aspect of this embodiment, the set of probes has from 10 to 100,000 distinct probes, from 10 to 50,000 distinct probes, from 10 to 10,000 probes, and from 10 to 1,000 probes. In a specific aspect, the probes are designed to detect markers with differential methylation in ovarian cancer, wherein the method of analyzing the DNA comprises
treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine (e.g., bisulphate treatment) and followed by subjecting the resulting DNA to in vitro transcription. In a specific aspect, the DNA is not amplified prior to treatment of the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine.
In one embodiment, the invention provides a set of probes useful for prenatal diagnose and/or prognosis, wherein said probes are designed to detect in the methylation profile or status of the DNA of promoters, CpG islands, and/or cytosines that are differentially methylated in fetal DNA as compared to maternal DNA according to the method of the invention. In one aspect of this embodiment, the DNA that is analyzed is circulating DNA (e.g., obtained from maternal plasma). In one aspect of this embodiment, the set of probes is attached to a solid support. In one aspect of this embodiment, the set of probes has from 10 to 100,000 distinct probes, from 10 to 50,000 distinct probes, from 10 to 10,000 probes, and from 10 to 1,000 probes. In one aspect of this embodiment, the method comprises determining the DNA methylation of markers for trisomy 21 (Down syndrome). In a specific aspect, the probes are designed to detect markers with differential methylation in fetal DNA as compared to Maternal DNA, wherein the method of analyzing the DNA comprises treating the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine (e.g., bisulphate treatment) and followed by subjecting the resulting DNA to in vitro transcription. In a specific aspect, the DNA is not amplified prior to treatment of the DNA with an agent capable of distinguishing 5-methylcytosine and cytosine. hi one embodiment, the invention provides a set of probes useful for the diagnosing, prognosis, and/or characterization of circulating DNA in plasma, wherein said probes are designed to detect changes in the methylation profile or status of the DNA of promoters, CpG islands, and/or cytosines differentially methylated in circulating DNA in plasma in different disease states according to the method of the invention. In one aspect of this embodiment, the set of probes is attached to a solid support. In one aspect of this embodiment, the set of probes has from 10 to 100,000 distinct probes, from 10 to 50,000 distinct probes, from 10 to 10,000 probes, and from 10 to 1,000 probes.
In one embodiment of the invention, a human whole genome microarray(s) is provided that covers all known gene-promoters with a significant CpG content enrichment (>=0.6). For all these promoters, different number of probes are designed covering from sequence of maximal concentration of CpGs (normally located around 1000 pb up-stream transcription site) to the CpG enriched sequences near transcription site. In a specific aspect, the probes are between 21-27 nt long and selected to avoid non-specific cross-hybridization at the hybridization conditions: 60 0 C.
In some embodiments of the invention, the methylation-insensitive restriction enzyme recognizes a restriction enzyme target sequence of 4, 5, or 6 base pairs.
In an embodiment of the invention, labeling includes incorporation of nucleotide analogs containing directly detectable labeling substances, such as fluorophores, nucleotide analogs incorporating labeling substances detectable in a subsequent reaction, such as biotin or haptens, or any other type of nucleic acid labeling. In an embodiment of the invention, the nucleotide analog is selected from among the group comprising Cy3-UTP, Cy5-UTP, fluorescein-UTP, biotin-UTP, and aminoallyl-UTP.
The term functional promoter sequence refers to a sequence of nucleotides that can be recognized by an RNA polymerase and from which transcription can be initiated. In general, each RNA polymerase recognizes a specific sequence, so that the functional promoter sequence included in the adapters is chosen according to the
RNA polymerase used. Examples of RNA polymerases that can be used in the method of the present invention include, but are not limited to, T7 RNA polymerase, T3 RNA polymerase, and SP6 RNA polymerase.
Determination of the methylation state of the sample can be performed using any nucleic acid analysis technique. In an embodiment of the invention, determination of the methylation state of the sample is carried out by hybridization of the RNA fragments obtained with the immobilized oligonucleotides on a DNA microarray, detection of the labeling incorporated in the fragments to be analyzed, and quantitative comparison of the signal values of the hybridized fragments with the values of the reference signals. In another embodiment of the invention the
methylation status of the sample is determined by analyzing and/or comparing the nucleic sequence of the bisulphite treated DNA and DNA not treated with bisulphite.
In one embodiment, the invention provides a kit having (1) a component for fragmenting DNA, (2) a component for distinguishing 5-methylcytosine and cytosine, (3) an in vitro transcription component, and (4) instructions for using the components of the kit.
In one embodiment, the invention provides a kit having (l) two or more methylation insensitive restriction enzymes that have different restriction sites, (2) a deaminating agent, (3) adaptors, (4) an in vitro transcription component, and (5) instructions for using the components of the kit.
In one embodiment, the invention provides a kit having (l) two or more methylation insensitive restriction enzymes that have different restriction sites,
(2) adaptors designed to be complementary to the overhangs created by the two or more restriction enzymes, (3) a deaminating agent, (4) an in vitro transcription component, and (5) instructions for using the components of the kit.
In one embodiment, the invention provides a kit having (1) a component for extracting DNA, (2) two or more restriction endonucleases that are methylation insensitive and produce different overhanging sequences, (3) protected adaptors engineered to have promoters for in vitro transcription and that will hybridize to the overhangs created by the two or more restriction endonucleases, (4) a component for ligating the adaptors to the sites created by the restriction endonucleases, (5) a component for deaminating cytosines but not 5-methylcytosines, (6) an in vitro transcription component, and (7) instructions for using the components of the kit.
In one embodiment, the invention provides a kit having (1) a component for extracting DNA, (2) two or more restriction endonucleases that are methylation insensitive and produce different overhanging sequences, (3) protected adaptors engineered to have promoters for in vitro transcription and that will hybridize to the overhangs created by the two or more restriction endonucleases, (4) a component for ligating the adaptors to the sites created by the restriction endonucleases, (5) a component for deaminating cytosines but not 5-methylcytosines, (6) a component capable of synthesizing dsDNA from sDNA, (7) an in vitro transcription component, and (8) instructions for using the components of the kit.
In one embodiment, the invention provides a kit having (1) a component for extracting DNA, (2) a fragmenting component having two or more restriction endonucleases that are methylation insensitive and produce different overhanging sequences and reagents suitable for producing fragment DNA, (3) an adaptor component having protected adaptors engineered to have promoters for in vitro transcription and that will hybridize to the overhangs created by the two or more restriction endonucleases, (4) a component for ligating the adaptors to the sites created by the restriction endonucleases, (5) a component for deaminating cytosines but not methylcytosines, (6) a component capable of synthesizing dsDNA from sDNA, (7) an in vitro transcription component, (8) a component for preparing the RNA for hybridization to a microarray, and (9) instructions for using the components of the kit.
In one embodiment, the invention provides a kit having (1) a component for extracting DNA, (2) a fragmenting component having two or more restriction endonucleases that are not methylation sensitive and produce different overhanging sequences and reagents suitable for producing fragment DNA, (3) an adaptor component having protected adaptors engineered to have promoters for in vitro transcription and that will hybridize to the overhangs created by the two or more restriction endonucleases, (4) a component for ligating the adaptors to the sites created by the restriction endonucleases, (5) a component for deaminating cytosines but not 5-methylcytosines, (6) a component capable of synthesizing dsDNA from sDNA, (7) an in vitro transcription component, (8) a component for preparing the RNA for hybridization to a microarray, (9) a microarray, and (10) instructions for using the components of the kit. A component for extracting DNA refers one or more reagents useful for isolating DNA from a sample. Various methods and agents for extracting DNA from a sample are known to the skilled artisan. In one aspect, the component for extracting DNA comprises an agent for chelating divalent cations (e.g., EDTA) which help prevent degradation of the DNA, an agent for rupturing cells and remove membrane lipids (e.g., sonication and addition of a detergent), an agent for removing cellular and histone proteins bound to the DNA (e.g., a protease, or by precipitation with sodium or ammonium acetate, or by using a phenol-chloroform extraction
step), an agent for precipitating DNA (cold ethanol or isopropanol), and an agent for solubilizing the DNA. °
A component for fragmenting DNA refers to an agent that can fragment the DNA and yield a size range of fragments that are suitable for use in the other steps of the method. Various methods and agents for fragmenting DNA are known to the skilled artisan. In one aspect, the component for fragmenting DNA yields DNA fragment with cohesive ends. In one aspect, the component for fragmenting DNA comprises a restriction endonuclease. In one aspect, the component for fragmenting DNA comprises a restriction enzyme (or enzymes), that are not sensitive to DNA methylation. In another aspect, the component for fragmenting DNA comprises two restriction enzymes. In one aspect, the restriction enzymes are chosen from Taql and FspBI.
An adaptor component refers to adaptors that are designed to hybridize to cohesive ends of fragmented DNA. Various adaptor and adaptor designs are known to the skilled artisan and can be used as the adaptor component. In one aspect, all of the cytosines in the promoter are 5 '-methylated (i.e., 5-methylcytosine). hi one aspect, the adaptor component has a promoter useful for in vitro transcription, hi one specific aspect, the promoter engineered into the adaptor is a T7 or T3 promoter.
A component for distinguishing 5-methylcytosine and cytosine refers to an agent that modifies either 5-methylcytosine or cytosine in a way that can be detected in subsequent steps. One example of a component that distinguishes 5-methylcytosine and cytosine is bisulphite treatment, which under appropriate conditions converts cytosine to uracil whereas 5-methylcytosine remains 5-methylcytosine. An in vitro transcription component refers to reagents for transcribing DNA into RNA. hi one aspect, the component comprises an RNA polymerase, hi one aspect, the in vitro transcription component comprises a polymerase capable of transcribing DNA into RNA and rNTPs (e.g., the 5 ribonucleotides needed for transcription, hi one specific aspect in vitro transcription component comprises T7 RNA Polymerase, rNTPs, and labeled CTPs. Other RNA polymerases commonly used for in vitro transcription include T3 and S6.
A component for ligating the adaptors refers to agents that will ligate the adaptor component to the fragment DNA. In one aspect, the component for ligating the adaptors comprises a ligase. In a specific aspect, the ligase is T4 ligase.
A component capable of synthesizing dsDNA from sDNA refers to an agent that will synthesize double-stranded DNA from a single-stranded template. In one embodiment, the component comprises a DNA polymerase. In another embodiment, the component comprises primers specific for sequence in the adaptors. In one aspect, the primers will hybridize to a T7 promoter, or complement thereof.
A component for preparing RNA for hybridization to a microarray refers to buffers and reagents that prepare the RNA for hybridization to a microarray.
The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., T. Maniatis et al. (1982) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.); J. Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed. (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.); F.M. Ausubel et al. (1992) Current Protocols in Molecular Biology (J. Wiley and Sons, NY); D. Glover (1985) DNA Cloning, I and II (Oxford Press); R. Anand (1992) Techniques for the Analysis of Complex Genomes (Academic Press); G. Guthrie and G.R. Fink (1991) Guide to Yeast Genetics and Molecular Biology (Academic Press); Harlow and Lane (1988) Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y.; W.B. Jakoby and LH. Pastan (eds.) (1979) Cell Culture, Methods in Enzymology, Vol. 58 (Academic Press, Inc., Harcourt Brace Jovanovich (NY); Nucleic Acid Hybridization (B. D. Hames and SJ. Higgins eds. 1984); Transcription And Translation (B.D. Hames and S.J. Higgins eds. 1984); Culture Of Animal Cells (R.I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (ERL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N. Y.); Gene Transfer Vectors For Mammalian Cells (J.H. Miller and M.P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, VoIs. 154 and 155 (Wu
et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987).
EXAMPLES The present invention is described by reference to the following Examples, which are offered by way of illustration and is not intended to limit the invention in any manner. Standard techniques well known in the art or the techniques specifically described below were utilized.
Example 1:
The validation of a method for genome-wide methylation detection was accomplished by specifically determining the methylation state of three synthetic promoter fragments that have high content CpG island promoters. Specifically, fragments of the ERa, Ecadherin and pl6INK4a were used to validate the method. Microarray chips were fabricated using standard techniques for microarray synthesis design. The chips were designed to include specific probes to interrogate each one of the CpG islands for three genes promoter: pl6INK4a, ERa, Ecadherin. Based on sequence knowledge and in silico theoretical bisulphite reactions modifications, four probes were designed for each CpG evaluation. These probes correspond to the four possible different results from being subjected to the method of the invention. These situations correspond to forward and reverse directions, with and without complete cytosine methylation (see FIG. 3).
The PCR primers used to obtain the promoter fragments were as follows. ER α-F: CAGCAGCGACGACAAGTAAA (SEQ ID NO:1) ER α-R: TCCAAACACCCCCAACTTTA (SEQ ID NO:2)
Ecad_B_ F: CTCACACCTGAAATCCTAGC (SEQ ID NO:3) Ecad_B_R: CCCTCAACCTCCTCTTCTTT (SEQ ID NO:4) pl6INK4a _B_ F: GCTCCTCATTCCTCTTCCTT (SEQ ID NO: 5) pl6INK4a _B'_R: TCCCTCCCCATTTTCCTATC (SEQ ID NO:6) PCR was performed using 30 ng DNA genomic template and Taq
Polymerase (Ecogen). The PCR mix consisted in 1 μl of genomic DNA, 1.5 mM MgCl 2 , 200 nM dNTP, 4% DMSO, 1 x Buffer Taq , 0.25 pmol forward primer, 0.25
pmol reverse primer and 1 U Taq Polymerase. For pl6INK4a promoter, the PCR protocol consisted of a denaturing step of three minutes at 94 0 C, followed by 34 cycles of 94 0 C for one minute, 58 0 C for one minute, and 72 0 C for two minutes with a final extension at 72°C for ten minutes. For both the ER-alpha and Ecadherin promoter regions, the PCR conditions were a denaturing step of three minutes at 94 0 C, followed by seven cycles at (94 0 C for one minute, 64 0 C for one minute, and 72 0 C for two minutes) followed by 24 cycles of 94°C for one minute, 57°C for one minute, and 72°C for two minutes with a final extension at 72°C for ten minutes.
PCR products were purified from primers and dNTPs by Amicon Microcon-PCR Centrifugal Filter Devices (UFC7 PCR 50, Millipore, Bedford, MA, USA).
From the obtained synthetic fragments of all three promoters (2 μg), we have generated to samples for comparison: one corresponding to full CpG-methylated promoters (half of the digestion samples were treated with Sssl Methylase (New England Biolabs) (8 U) adding 640 μM of SAM (S-adenosyl methionine) during three hours at 37°C) and one corresponding to full CpG unmethylated promoter (as PCR amplification product, the other half of synthetic fragment).
From here on, all the samples (both methylated and unmethylated) were treated in parallel, hi order to obtain cohesive ends for specific adaptors ligation, samples were completely digested by incubation first with Taql and finally with FspEl. Taql digestion details: (Fermentas Canada, Burlington, ON) (10 U) in a total volume of 30 μL overnight at 37 0 C; FspBl digestion details: (Fermentas Canada, Burlington, ON) (10 U) in a total volume of 20 μL three hours at 37 C.
The ends of the cleaved DNA fragments were ligated to phosphorylated and cytosine-methylated adaptors. The ligation-mixture with 1600 ng promoter regions was supplemented with 3 μl of 10 x ligation buffer (Fermentas), 1 μl T4 Ligase (Fermentas) (5 U), 20:1 ratio DNA:adapter pmols and water to 30 μl. The ligation reaction was carried out at room temperature for 3.5 hours.
The EZ DNA methylation kit (Zymo Research) was used for bisulphite conversion of all promoter samples used in this study, according to the manufacturer's recommendations. For each conversion, 500 ng of ligated DNA was used.
The complementary strands of the bisulphite treated sDNA were synthesized with a primer extension, using a T7 forward primer, the sequence of which was contained in one of the adaptor.
This template double strand DNA was in vitro transcribed to RNA with 40 U T7 RNA Polymerase (Ambion), 7,5 mM rNTPs, 2 μl Cy3-CTP 6 mM (PerkinElmer,
Waltham, Massachusetts) or 2 μl Cy5-CTP 4 mM (PerkinElmer) overnight at 37 0 C.
After the transcription the samples were purified with MEGAclear™ columns
(Ambion, Austin, Texas).
100 ng RNA (corresponding to methylated) with 100 ng RNA (corresponding to unmethylated) for each hybridization were pooled with 11 μl of Blocking Agent (Agilent), 2.2 μl of 25 x Fragmentation Buffer (Agilent, Santa Clara, California) and nuclease-free water to 52.8 μl. Before hybridization to the array, the samples are incubated 30 minutes at 65°C to fragment RNA. Then, 55 μl of 2x GExHybridization Buffer Hi-rpm (Agilent) was added to stop the fragmentation reaction. The sample was applied to the array by using Agilent microarray hybridization chamber, and hybridization was carry out for 17 hours at 65°C in a rotating oven at 10 rpm. The arrays were then disassembled in Gene Expression Wash Buffer 1 (Agilent) then washed with Wash Buffer 1 and 2 (Agilent). The slides were dried with acetonitrile wash and stabilization and drying solution according to manufacturer's recommendations. Slides were scanned by using and Agilent 62505B DNA microarray scanner.
FIGS. 4A, 4B, and 4C show co-hybridization scatter-plots for the three promoters corresponding to the completely not methylated vs. completely-methylated samples. These results demonstrate the high specificity of the strategy for methylation patterns identification: probes specifically designed for methylated sequence give significant positive response for artificial methylated samples and probes specifically designed for the completely not methylated sequence gave significant positive response for completely not methylated samples.
Example 2: Experimental evidence for genome-wide application of methylation status study method.
These experiments involve genome-wide screening of methylation patterns using complex biological samples where the gDNA is extracted from clinical tissues.
A second chip was designed as described in Example 1 but containing probes for a larger set of promoters: pl6INK4a, ERa, Ecadherin, MGMT, GSTPl, and APC.
Genomic DNA extracted from a clinical sample (2 μg) was incubated with Taql (Fermentas Canada, Burlington, Ontario) (10 U) in a total volume of 30 μL overnight at 37°C to give digested genomic DNA. To generate a representation of
CpG island promoter methylated DNA, half of the digested genomic DNA samples were treated with Sssl Methylase (New England Biolabs, Ipswich, Massachusetts) (8
U) and adding 640 μM of SAM (S-adenosyl methionine) during three hour at 37 0 C. The other half of the digested samples were maintained at -20 0 C during this time, and served to represent the CpG island promoter unmethylated genomic DNA.
From here on, all the samples both methylated and unmethylated samples were treated in parallel, so both methylated and unmethylated DNAs were completely digested with FspBI (Fermentas Canada, Burlington, ON) (10 U) in a total volume of 20 μL three hour at 37°C.
The ends of the cleaved DNA fragments were ligated to phosphorylated and cytosine-methylated adaptors. The ligation-mixture with 1600 ng DNA genomic was supplemented with 3 μl of 10 x ligation buffer (Fermentas), 1 μl T4 Ligase
(Fermentas) (5 U), 20:1 ratio DNA:adapter pmols and water to 30 μl. The ligation reaction was carried out at room temperature for 3.5 hours.
The EZ DNA methylation kit (Zymo Research) was used for bisulphite conversion of all promoter samples used in this study, according to the manufacturer's recommendations. For each conversion, 500 ng of ligated DNA was used. The complementary strand of the bisulphite treated sDNA was synthesized with a primer extension reaction, using a T7 forward primer, which sequence was contained in one adaptor.
The template double strand DNA was in vitro transcribed to RNA with 40 U T7 RNA Polymerase (Ambion), 7.5 mM rNTPs, 2 μl Cy3-CTP 6 mM (PerkinElmer) or 2 μl Cy5-CTP 4 mM (PerkinElmer) overnight at 37 0 C. After the transcription the samples were purified with MEGAclearTM columns (Ambion). 100 ng methylated RNA with 100 ng unmethylated RNA for each hybridization were pooled with 11 μl of Blocking Agent (Agilent), 2.2 μl of 25 x Fragmentation Buffer (Agilent) and nuclease-free water to 52.8 μl. Before hybridization to the array, the samples were incubated 30 minutes at 65°C to fragment the RNA. Then, 55 μl of 2x GExHybridization Buffer Hi-rpm (Agilent) are added to stop the fragmentation reaction. The sample was applied to the array by using Agilent microarray hybridization chamber, and hybridization was carry out for 17 hours at 65°C in a rotating oven at 10 rpm. The arrays were then disassembled in Gene Expression Wash Buffer 1 (Agilent) then washed with Wash Buffer 1 and 2 (Agilent). The slides were dried with acetonitrile wash and stabilization and drying solution according to manufacturer's recommendations. Slides were scanned by using and Agilent 62505B DNA microarray scanner.
The chip employed for co-hybridization of human gDNA was made in accordance with the strategy outlined in Example 1. FIG. 5 shows high specificity of the methodology in the identification of the methylation state of each promoter sequence in a human complex clinical sample: probes specifically designed for methylated sequence give significant positive response just for artificial methylated samples and probes specifically designed for the completely not methylated sequence gave major significant positive response for completely not methylated samples (as the six promoters of tumor suppressor genes have been previously described to be unmethylated in healthy human samples).
All publications, patents, and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The
mere mentioning of the publications and patent applications does not necessarily constitute an admission that they are prior art to the instant application.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, certain changes and modifications may be practiced and still remain within the scope of the appended claims.
