CELLS

FILING DATA

[0001] This application is associated with and claims priority from Australian Provisional Patent Application No. 2014903390, filed on 27 August 2014, entitled "A method for culturing mesenchymal stem cells", the entire contents of which, are incorporated herein by reference.

BACKGROUND

FIELD

[0002] The present specification relates generally to a cell culture method for mesenchymal stem cells and other cells of related lineage. Cell populations for use as cellular medicaments and in cell-based and tissue engineering therapies, in diagnostics and in screening protocols for therapeutic agents are also taught therein.

DESCRIPTION OF RELATED ART

[0003] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgement or admission or any form of suggestion that the prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

[0004] Bibliographic details of the publications referred to by author in this specification are collected alphabetically at the end of the description. [0005] Stem cells are self-renewing, pluripotent or at least multipotent cells capable of proliferation and differentiation into various cell types (Eckfeldt et al. (2005) Nat. Rev. Mol. Cell Biol. 6(9) .726-737). Embryonic stem cells, derived from the inner mass of the blastocyst embryo, have long been thought of as having the most clinical benefit due to their pluripotency (Aivarez et al. (2012) J. Mol. Endocrinol 49(2):R&9-\ 11). However, adult stem cells have the potential to exhibit sufficient multipotency for use in cellular therapeutic protocols. In fact, given the unpredictability of embryonic stem cells, ethical issues and a tendency for these types of stem cells to form teratomas, adult stem cells have become the choice for cell-based therapies (Prokhorova et al. (2009) Stem Cells Dev. 7S(7j:47-54; Ulrich et al. (2013) Expert Opin. Biol. Ther. 13(10): 1387-1400).

[0006] Mesenchymal stem (stromal) cells (MSCs) are multipotent, plastic adherent cells having a capacity to proliferate and exhibit clonogenic activity (Vaananen (2005) Am. Med. 370:469-479; Friedenstein et al. (1976) Exp. Hematol. 4(5):267-274). They have the capacity to differentiate into mesodermally-derived tissues such as bone, cartilage, muscle, stromal cells, tendon and connective tissue (Battula et al. (2009) Haematologica 94: 173-184; de la Garza-Rodea et al. (2011) Cell Transplant 20:271-231; Szpalski et al. (2012) Tissue Eng. Part B Rev. 75:258-269; Tuan et al. (2003) Arthritis Res. Ther. 5:32- 45; Xue et al. (2012) Biomaterials 33:5832-5840).

[0007] MSCs have conventionally been isolated from unfractionated bone marrow cells. However, the isolation process has disadvantages by the unpredictable effects of co- cultured hematopoietic cells or other cells. Improvements have been made using immunomagentic isolation and fluorescence-activated cell sorting (FACS) based on MSC- specific cell surface markers (or absence of markers) [Buhring et al. (2007) Ann. N.Y. Acad. Sci. 1106:262-271]. This includes selection for mesenchymal precursor cells (MPCs) using cell markers like STRO-1 and STRO-3 that can give rise to conventional MSCs (Gronthos et al. (2003) J. Cell Sci. 776: 1827-1835).

[0008] A subpopulation of MSCs has been identified in the human endometrium, referred to as endometrial MSCs or eMSCs (Gargett et al. (2009) Biol. Reprod. 80(6) A 136-W45; Chan et al. (2004) Biol. Reprod. 70^: 1738-1750; Gargett et al. (2010) Mol. Hum. Reprod. 76(77, ⁾ :818-834). These cells can readily be obtained form uterine biopsy via the cervix without requiring an anesthetic or the level of invasiveness needed to obtain bone marrow or adipose MSCs.

[0009] MSCs appear to exert biological effects through secretion of soluble bioactive molecules, such as growth factors, angiogenic factors, cytokines and chemokines. These properties of MSCs have led to numerous clinical trials for a variety of diseases including graft versus host disease, cardio-vascular disease as a cell-based therapy or in tissue- engineered constructs where they may contribute to tissue repair and regeneration.

[0010] There is a need to be able to expand MSCs and their precursor forms in an undifferentiated, multipotent form for use in tissue therapy. Importantly, there needs to be consistency in the quality of the MSCs.

[0011] For the development of clinical protocols involving MSCs, these cells require expansion without differentiation, thus maintaining their multipotency. A disadvantage of expanding MSCs in culture is their propensity to spontaneously differentiate into fibroblasts and other cell types. Whilst cell surface markers have been previously proposed, these tend not to distinguish between MSCs, fibroblasts or other differentiated forms (Rajaraman et al. (2013) Tissue Engineering 79(7^:80-92). In addition, sourcing of MSCs is largely limited to young healthy individuals; with age and disease, the relative abundance of MSCs is diminished which could limit the use of MSCs in autologous cell therapy. SUMMARY

[0012] The present disclosure teaches a protocol for expanding a sample comprising mammalian mesenchymal stem cells (MSCs) or precursor forms thereof such as mesenchymal precursor cells (MPCs) into a population comprising substantially non- differentiated, multipotent MSCs. The expanded, multipotent MSC population has a range of clinical applications including in tissue regeneration, organ growth, repair and augmentation, tissue rejuvenation, cosmetic treatment and treatment of inflammatory and other diseases including graft versus host disease, host versus graft, cardiovascular disease, lung disease, liver disease, circulatory disorders and bone disease. Other conditions which can be treated include female subjects requiring pelvic organ prolapse repair or subjects in need of cartilage repair or who present with a hernia. The expanded MSC population also has diagnostic applications and can be used in drug-screening assays. The protocol enables a quality management system to reduce individual MSC variation. This in turn reduces the variability between patients treated and permits a more personalized medical approach to therapy.

[0013] The protocol comprises culturing a sample of cells comprising MSCs or their precursors (including mesenchymal precursor cells [MPCs]) in the presence of an agent which inhibits or otherwise antagonizes signaling by transforming growth factor-β (TGF ). The culturing is conducted for a time and under conditions sufficient to expand the sample comprising MSCs into a population comprising multipotent cells. In an embodiment, the sample of cells is initially enriched for MSCs and/or MPCs.

[0014] The sample of cells comprising MSCs or MPCs can be derived from a range of tissue including endometrium, placenta, bone marrow, adipose tissue, menstrual blood and uterine or cervical biopsy. MSC samples can also be obtained from post-menopausal female subjects. In an embodiment, the MSC sample is from the endometrium such as in the form of biopsy tissue and comprises endometrial MSCs (eMSCs). In another embodiment, the MSC sample is from the placenta and comprises placental MSCs (pMSCs). For brevity purposes, reference hereinafter to "MSCs" or "eMSCs" or 'pMSCs" includes their precursor forms such as MPCs, eMPCs and pMPCs.

[0015] Cell surface markers useful for an initial enrichment of MSCs from a sample comprising MSCs include but are not limited to W5C5, CD29, CD44, CD49a, CD49e, CD90, CD73, CD105, CD106, CD140b, CD146, W3D5, W8B2, W1C5, W3C5, W4A5, W7C6 and a STRO marker such as STRO-1 or STRO-3.

[0016] In an embodiment, the cell surface marker is W5C5, which recognises an epitope on the SUSD2 (Sushi domain containing 2) molecule.

[0017] If cell enrichment is required, it may be by any means including use of magnetic beads or other procedure involving immobilization of selected cells to a solid support via immunointeractive molecules (e.g. antibodies) followed by elution or the potential use of flow cytometry.

[0018] As indicated above, the sample comprising MSCs is cultured in the presence of an agent which inhibits or otherwise antagonizes TGF -mediated signaling. In an embodiment, the agent enables proliferation (i.e. expansion) while blocking or otherwise retarding differentiation and cellular senescence due to prolonged culturing. The agent is generally a chemical compound, an antibody, a peptide or a nucleic acid molecule including a peptide or nucleic aptamer which inhibits activity of a component of the TGF signaling pathway or a gene encoding same.

[0019] Inhibition or antagonism of the TGF -mediated signaling pathway is proposed to reduce or prevent MSC differentiation without reducing expansion potential.

[0020] In an embodiment, the agent inhibits signaling via transforming growth factor receptor-β (TGF -R). Any number of agents may be used to inhibit or otherwise antagonize TGF - or TGF -R mediated signaling including but not limited to 3-(6- methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l-carbo thioamide, 4-[4-2,3- dihyrdo-l,4-benzodioxin-6-yl)-5-(2-pyridynl)-lH-imidazol-2-y l]-benzamide, 4-[4-[3-(2- pyridynl)-lH-pyrazol-4-yl]-2-pyridynl]-N-(tetrahydro-2H-pyra n-4-yl)-benzamide, 4-[3-(2- pyridynl)-lH-pyrazol-4-yl]-quinoline, 2-(3-(6-methylpyridine-2-yl)-lH-pyrazol-4-yl)-l,5- naphthyridine, 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridynl)-lH-imidazol-2-yl] -benzamide, 2-(5-benzo[l,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6- methylpyridine, 6-[2-tert- butyl-5-(6-methyl-pyridin-2-yl)-lH-imidazol-4-yl]-quinoxalin e and 2-(5-chloro-2- fluorophenyl)-4-[(4-pyridyl)amino)-pteridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof including a homolog, ortholog or paralog thereof which retains the ability to block TGF - or TGF -R mediated signaling. In an embodiment, the agent is (3-(6-methylpyridin-2-yl)-N-phenyl-4- quinolin-4-ylpyrazole-l-carbothioamide) which is an activin receptor-like kinase inhibitor (ALK) and is also referred to as compound A83-01.

[0021] Hence, taught herein is a culture method which enables the generation of a population comprising non-differentiated, multipotent MSCs for use in a range of cellular- based and tissue engineering therapies, as cellular medicaments, in diagnostic protocols and in drug screening assays. The MSCs are, in an embodiment, eMSCs or pMSCs, including W5C5 ⁺ eMSCs and W5C5 ⁺ pMSCs. Generally, the MSCs are of human origin however, non-human MSCs such as equine MSCs are contemplated herein. As indicated above, reference to MSCs, eMSCs and pMSCs include their precursor forms such as MPCs, eMPCs and pMPCs, respectively.

[0022] Contemplated herein is a method of cell therapy in a subject comprising the administration, locally or systemically, of an expanded population of multipotent MSCs generated by the culture method disclosed herein for a time and under conditions sufficient for the multipotent MSCs to differentiate into selected tissues. In an embodiment, autologous/homologous MSCs are used in the subject being treated. Reference to "cell therapy" includes cell-based and tissue engineering therapies and cellular medicaments.

[0023] The present disclosure enables the expansion of MSCs to generate into a non- differentiated, multipotent cell population for use in a range of clinical applications, diagnostic assays and drug-screening protocols. It is in effect a quality management system to reduce cell variability and help facilitate a high likelihood of a successful and efficacious outcome. It is akin to a personalized medical protocol.

[0024] In a further embodiment, a kit including a therapeutic kit, is taught herein in compartment form comprising a culturing or washing medium, reconstituted in liquid form or not, and optionally a cellular support matrix upon which expanded MSCs can grow under culture conditions. A TGF signaling inhibitor may optionally be included in a separate compartment.

[0025] Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO). The SEQ ID NOs correspond numerically to the sequence identifiers <400>1 (SEQ ID NO: l), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims.

[0026] A summary of sequence identifiers of forward (F) and reverse (R) primers referred to in the Examples are provided in Table 1.

BRIEF DESCRIPTION OF THE FIGURES

[0027] Some figures contain color representations or entities. Color photographs are available from the Patentee upon request or from an appropriate Patent Office. A fee may be imposed if obtained from a Patent Office.

[0028] Figure 1 is a graphical representation of an analysis of eMSC phenotype markers.

(A) The proportion of eMSCs markers on passage 6 eMSCs was determined with flow cytometry. The percentage of W5C5 ⁺ eMSCs significantly increased with Ι μΜ A83-01 treatment. CD 146 expression was lost over the culture with no improvement with treatment, CD140b expression also increased in treatment. CD90 expression was stable and CD271 was not present. White box = control group and shaded box = treated group.

(B) Individual samples expressing W5C5 in the two groups. Data are mean ± SEM.

[0029] Figure 2 is a graphical representation of autofluorescence of passage 6 eMSCs with or without A83-01 treatment. eMSCs were treated with or without A83-01 for 7 days at P6. Autofluorescence of the unstained eMSCs were determined by flowcytometry by normalizing the treated group. Data are mean ± SEM. Autofluorescence is an indicator of senescent cells (old cells).

[0030] Figure 3 is a photographical and graphical representation of colony formation of A83-01 treated P6 eMSCs. Representative culture plates showing colony formation by control eMSCs (A) and 1 μΜ A83-01 (B) treated cells after incubation in SFM for 4 weeks. (C) Colony forming efficiency of control and A83-01 treated eMSCs seeded at 100 cells/cm ² (clonal density). Comparison of cloning efficiency between two groups, p=0.03.

[0031] Figure 4 is a graphical representation of eMSC phenotype markers CD146, CD90, W5C5 and CD140b on passages 4 or 5 using flow cytometry. The percentage of W5C5 ⁺ eMSCs is significantly increased with Ι μΜ A83-01 treatment. Cells were obtained from endometrial biopsies of three post menopausal women treated with Progynova for 2-3 weeks to thicken the endometrium. The percentage range of W5C5 cells was large in untreated cells compared to treated cells (Table 4) indicating that the A83-01 treatment served as a significant quality management system to control the expanded cell population. Data are mean + SEM.

[0032] Figures 5A and B are a graphical representation showing dose response curve of A83-01 promotion of eMSC proliferation. (A) Passage 3 eMSC incubated A83-01 in SFM in 5% v/v 0 ₂ /5% v/v C0 ₂ at 37°C for 7 days was assessed by MTS cell viability assay. Means for triplicates were obtained for each sample at each concentration, then normalized to vehicle control DMSO (100% v/v) and plotted as mean ± SEM of n=6 patient samples. (B) Passage 6 eMSC lysates with or without Ι μΜ A83-01 were immunoblotted with anti- SMAD 2/3 or antipSMAD 2/3 antibodies. A83-01 inhibited TGF- R-induced phosphorylation of SMAD 2/3. (C=control, T= treated).

[0033] Figures 6A through D are graphical and photographic representations showing Phenotype of P6 eMSC cultured with or without A83-01 in serum free medium in 5% v/v 0 ₂ . (A) % Positive cells for MSC surface markers on passage 6 eMSC (n=8) cultured in Ι μΜ A83-01(black bars) or in 0.01% DMSO (white bars) for 7 days and assessed by single-color flow cytometry. (B) Representative flow cytometric histograms of SUSD2+ eMSC treated with (black bar) and without (white bar) Ι μΜ A83-01 and MFI summarized in (C). (D) SUSD2 expression on control (left panel) and A83-01 treated (right panel) eMSC by immunofluorescence (red). Data are mean ± SEM of n=8 different patient samples. **p<0.01, ***p<0.001.

[0034] Figures 7A through C are graphical and photographic representations showing functional MSC properties of P6 eMSC cultured with or without A83-01 in serum free medium. (A) Representative culture plates seeded at clonal density (50 cell/cm ² ). (B) Graph shows Colony Forming Efficiency of P6 eMSC pre-treated with Ι μΜ A83-01 or 0.01% v/v DMSO vehicle for 7 days in 5% v/v 0 ₂ in SFM followed by clonal culture at 50 cells/cm ² in SFM for 4 weeks. (C) Multilineage mesodermal differentiation of 0.01% v/v DMSO treated control and Ι μΜ A83-01 treated P6 eMSC showing adipogenic, osteogenic, and chondrogenic differentiation (controls were cultured in 1% v/v serum media) for four weeks in 5% v/v 0 ₂ . Oil Red O was used to visualize cellular lipid vesicles for adipogenic differentiation, Alizarin Red to detect calcium mineralization for osteogenic differentiation and Alcian Blue to detect acidic polysaccharides in the extracellular matrix for cartilage differentiation. Representative images from n=3 samples. Data are mean ± SEM of n=6 different samples *p<0.05.

[0035] Figure 8 is a graphical representation showing, quantitative RT-PCR analysis of MSC genes. P6 eMSC cultures treated (black squares) or untreated control (black circles) with Ι μΜ A83-01 in 5% v/v 0 ₂ /5% v/v CO ₂ /90% v/v N at 37°C for 7 days. qRT-PCR analysis of SUSD2, CD146, AOC3, FRZB, MMP3, DKKl, NOTCH3, NOTCH2 and NESTIN. β-Actin or GAPDH were used to normalize the mRNA level, and fold change was calculated using 2 ^"ΔΔ€Τ . Data are mean ± SEM on n=7 different tissue samples. *p<0.05; **p<0.01.

[0036] Figures 9A through F are graphical representations showing. A83-01 blocks apoptosis and promotes eMSC proliferation. P6 eMSC treated with Ι μΜ A83-01 or 0.01% DMSO cultured for 7 days in SFM in 5% v/v 0 ₂ /5% v/v CO ₂ /90% v/v N were assessed by (A) Cell cycle analysis of PI stained cells. Shows representative PI staining on a linear axis of a flow cytometry plot (B) the percentage of cells in SubGl/GO, Gl, S and G2/M stages of the cell cycle (black bar A83-01 treated, White bar control). Data are mean ± SEM, n=7 patient samples; *p<0.05. (C) Annexin-V and PI staining. Representative flow cytometric plots. The lower left quadrant of each panel shows the viable cells, upper left early apoptotic; upper right late apoptotic and lower right necrotic cells and (D) graph showing the percentage of live, apoptotic and necrotic cells. Data are mean ± SEM, n=6 patient samples, *p<0.05. (E) Relative autofluorescence by flow cytometry of unstained P6 cells treated (black bar) and untreated (white bar) with Ι μΜ A83-01. Data are mean ± SEM, n=10, ***p<0.005. (F) Representative images showing the staining of senescence- associated β- galactosidase (SA- -gal) in cultured P6 eMSC treated with or without Ι μΜ A83-01. [0037] Figure 10 is a photographic representation of A83-01 pre-treated postmenopausal eMSC seeded on gelatin/polyamide mesh cultures in serum free medium.

[0038] Figure 11 is a graphical representation of eMSC phenotype markers CD146, CD90, W5C5 and CD 140b on placental MSC immuno-selected with W5C5 at passage 1 and cultured in serum free medium until passage 6. The cells were then grouped into untreated and treated A83-01. Data are based on flow cytometry and show the percentage positive cells expressing the individual markers. The percentage range of W5C5 ⁺ cells was large in untreated cells compared to treated cells (Table 5) indicating that the A83 -01 treatment served as a significant quality management system to control the expanded cell population. Data are mean + SEM.

DETAILED DESCRIPTION

[0039] Throughout this specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or method step or group of elements or integers or method steps but not the exclusion of any element or integer or method step or group of elements or integers or method steps.

[0040] As used in the subject specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to "a mesenchymal stem cell" includes a single cell, as well as two or more cells; reference to "an agent" includes a single agent, as well as two or more agents; reference to "the disclosure" includes a single and multiple aspects taught by the disclosure; and so forth. Aspects taught and enabled herein are encompassed by the term "invention". All such aspects are enabled within the width of the present invention.

[0041] The present disclosure relates to a culture method for expanding mesenchymal stem (stromal) cells (MSCs) into a population comprising substantially non-differentiated MSCs which retain multipotent capability. Reference to a "mesenchymal stem cell" or "MSC" includes the same cells identified by alternative nomenclature such as mesenchymal stromal cells, mesenchymal stem/stromal cells and mesenchymal precursor cells (MPCs). All such cell types are encompassed herein by the term "mesenchymal stem cell" or "MSC". In an embodiment, the MSCs are endometrial-derived MSCs (eMSCs). In another embodiment, the MSCs are placental MSCs (pMSCs). Other sources of MSCs include bone marrow, adipose tissue, menstrual blood and uterine or cervical biopsy. Reference to MSCs, eMSCs and pMSCs includes their precursor forms such as MPCs, eMPCs and pMPCs. For sake of brevity, an MPC or eMPC or pMPC is taken to be encompassed by reference to MSC and eMSC and pMSC, respectively.

[0042] This disclosure provides a method for generating multipotent MSCs useful in therapeutic, diagnostic and drug discovery applications. The disclosure teaches contacting a sample of cells comprising MSCs with a particular compound in order to inhibit or reduce TGF -mediated signaling which would otherwise lead to differentiation and/or cellular senescence due to prolonged culturing. In an embodiment, the sample of cells is first enriched for MSCs such as eMSCs or pMSCs. Reference to a "particular compound" includes a single agent and the use of multiple agents. Multiple agents may target various components within the TGF signaling pathway.

[0043] The instant disclosure teaches a protocol comprising obtaining a tissue or cell sample putatively comprising MSCs and dissociating the tissue or cell clumps by enzymatic and/or mechanical disruption such as using agitation, physical dissection, collagenase and/or deoxyribonuclease. The resulting cell sample is regarded as a single cell suspension comprising single stromal cells and epithelial clumps. The cells are then subject to filtration to remove epithelial clumps, then to centrifugal separation using a hydrophilic polysaccharide such as Ficol-Paque to remove blood cells and retain stromal cells and peripheral blood mononuclear cells. In an embodiment, immunointeractive molecules such as antibodies or other suitable ligands are used to enrich MSCs via selected cell surface markers prior to expansion. Markers include but are not limited to any or all of W5C5, CD29, CD44, CD49a, CD49e, CD90, CD73, CD105, CD106, CD140b, CD146, W3D5, W8B2, W1C5, W3C5, W4A5, W7C6 and a STRO marker such as STRO-1 or STRO-3. Some biomarkers may work more effectively when used in combination with other biomarkers. Generally, antibodies to these markers are used either directly bound to a solid support such as magnetic beads or anti-immunoglobulin molecules bound to the solid support are used to capture specific antibody-labeled cells. Cell isolation may also involve using flow cytometry. In an embodiment, the primary marker used to enrich cells is W5C5 which detects Sushi domain containing 2 (SUSD2). In an alternative embodiment, the sample comprising MSCs is expanded without an initial enrichment step.

[0044] In either embodiment, the result is a population comprising MSCs in a non- differentiated state having multipotent properties. By "non-differentiated state" includes MSCs in a substantially non-differentiated state. In another embodiment, the cell sample is not enriched for MSCs but is subject to direct MSC expansion conditions. As indicated above, in an embodiment, the MSCs are eMSCs or pMSCs which include eMPCs and pMPCs.

[0045] The next step is to expand the population comprising MSCs in a way which proliferates the MSCs while maintaining the cells in a substantially non-differentiated, multipotent state. This is accomplished by culturing the cells in the presence of an agent which is an inhibitor or antagonist of TGF - or TGF -receptor (TGF -R)-mediated signaling. It is proposed herein that MSCs can be expanded in the presence of the TGF or TGF -R signaling antagonist which will inhibit or retard differentiation into fibroblasts or other cell types and/or retard cellular senescence due to prolonged culturing. Generally, a serum free medium (SFM) is employed.

[0046] Reference to the "serum free medium" or "SFM" include a medium comprising DMEM/F-12, 0.1-10% w/v antibiotic-antimyocotic, 0.5-10mM glutamine, 0.1-10% w/v lipid-rich bovine serum albumin (e.g. AlbuMAXI), 10-500μg heparin, 50-500μΜ L- ascorbic acid, 10-200nM linoleic acid, 10-200μΜ, 2-mercapethanol and 0.1-5% v/v insulin-transferrin-slenium-sodium pyruvate (ITS-A).

[0047] Hence, an aspect of the present disclosure is a method for proliferating a sample of cells comprising mammalian mesenchymal stem cells (MSCs) into a population of substantially non-differentiated, multipotent MSCs in an in vitro culture, the method comprising culturing the sample of cells in the presence of an agent which antagonizes TGF -mediated signaling for a time and under conditions sufficient to expand the sample comprising MSCs into a population of multipotent cells. By "TGF -mediated" includes signaling mediated by its receptor (TGF -R) or via TGF itself. The term "expanding" includes "proliferating".

[0048] In an embodiment, taught herein is a method for expanding a sample of cells comprising mammalian mesenchymal stem cells (MSCs) into a population of substantially non-differentiated, multipotent MSCs in an in vitro culture, the method comprising subjecting a sample of cells comprising MSCs to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched sample of cells in the presence of an agent which antagonizes TGF -mediated signaling pathway for a time and under conditions sufficient to expand the sample of MSCs into a population of multipotent cells.

[0049] In an embodiment, the agent targets TGFP-R.

[0050] Accordingly, enabled herein is a method for proliferating a sample comprising mammalian mesenchymal stem cells (MSCs) into a population of substantially non- differentiated, multipotent MSCs in an in vitro culture, the method comprising culturing the sample of cells in the presence of an agent which antagonizes signaling via TGF -R for a time and under conditions sufficient to expand the sample comprising MSCs into a population of multipotent cells.

[0051] In an embodiment, taught herein is a method for proliferating a sample comprising mammalian mesenchymal stem cells (MSCs) into a population of substantially non- differentiated, multipotent MSCs in an in vitro culture, the method comprising subjecting a sample of cells comprising MSCs to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent which antagonizes signaling via the TGF -R for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells.

[0052] The term "inhibitor" or "antagonist" or an agent which "antagonizes" in relation to TGF or TGF -R signaling is used interchangeably to refer to the agent which by inhibiting TGF /TGF -R mediated signaling, enables expansion and proliferation of MSCs without substantial differentiation into fibroblasts or other cell lineages and/or with reduced cellular senescence due to prolonged culturing. Reference to "an agent" includes a single or multiple (e.g. 2 or more) agents.

[0053] An example of a suitable agent which antagonizes TGF or TGF -R signaling is a compound of Formula (I).

wherein,

E is selected from:

G is N, O, CH or CZ ³ , wherein at least one G is N;

each Z ³ is independently a Ci-C ₈ straight, branched, or cyclic hydrocarbon group, a

Ci-C ₆ alkoxy group, amide optionally substituted with Ci.C ₆ straight or cyclic alkyl or C to C ₆ straight or heterocyclicalkyl or, optionally, two Z groups, together with the carbon atoms to which the Z ³ groups are attached, combine to form a cyclic group;

Z ¹ is H CO HAr, or CS HAr;

N is 0, 1, 2 or 3; and

each Z ² is independently a Ci-C ₈ straight, branched or cyclic hydrocarbon group, a Ci-C ₆ alkoxy group, or, optionally, two Z ² groups, together with the carbon atoms to which said Z ² groups are attached, combine to form a cyclic group. [0054] In an emb iment, the agent is a compound of Formula (II) having the structure:

Formula (II)

Z ¹ is H, CO HAr, or CS HAr

is a Ci-C ₈ straight, branched, or cyclic hydrocarbon group;

each n is independently, 0, 1, 2 or 3.

[0055] In an embodiment, the agent is a compound of Formula (III) having the structure:

(III) having the chemical name 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4- ylpyrazole-1 -carbothioamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof.

[0056] The compound, 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l- carbothioamide, is an activin receptor-like kinase inhibitor and is also referred to as A83- 01. Reference to this or other TGF /TGF -R signaling inhibitors includes any and all pharmaceutically acceptable salts, solvates, tautomers and enantiomers. Furthermore, various chemical derivatives and modified compounds including analogs, homologs, orthologs and paralogs are encompassed by reference to "an agent" in the present disclosure.

[0057] An example of a chemical derivative includes the compound of Formula (IV) which has the structure:

Formula (IV) wherein:

Z ¹ is H, CO HAr or CS HAr;

Z ² is a C -C ₈ straight, branched, or cyclic hydrocarbon group;

each n is indpendently 0, 1, 2 or 3.

[0058] Compounds encompassed include the compound of Formula (V):

[0059] Other compounds include the compound of Formula (VI):

Formula (VI) wherein,

E is selected from

G is N, O, CH or CZ ³ , wherein at least one G is N;

each Z ³ is independently a Ci-C ₈ straight, branched, or cyclic hydrocarbon group, a Ci-C ₆ alkoxy group, amide optionally substituted with Ci-C ₆ straight or cyclicalkyl or Ci- C ₆ straight or heterocyclicalkyl or optionally, two Z ³ groups, together with the carbon atoms to which the Z ³ groups are attached, combine to form a cyclic group;

Z ¹ is a Ci-C ₈ straight, branched or cyclic hydrocarbon group, or an Ar group;

Z ² is a Ci-C ₈ straight, branched or cyclic hydrocarbon group, a Ci-C ₆ alkoxy group, a -CO H ₂ group, or a -CS H ₂ group; and

each n is independently 0, 1, 2 or 3.

[0060] Other compounds have the structure of Formula (VII):

Formula (VII) wherein,

Z ¹ is Ci-C ₈ straight, branched or cyclic hydrocarbon group, or an Ar group;

Z ² is a Ci-C ₈ straight, branched or cyclic hydrocarbon group, a Ci-C ₆ alkoxy group,

Z ³ roups together form a -OCH ₂ 0- or -OCH ₂ CH ₂ 0- group;

each n is independently 0, 1, 2 or 3. [0061] Other compounds have the structure of Formula VIII:

[0062] Other compounds have the structure of Formula IX:

wherein,

G is N, CH or CZ ² ,

Z ² is a Ci-C ₈ straight, branched or cyclic hydrocarbon group, a Ci-C ₆ alkoxy group or amide optionally substituted with Ci-C ₆ straight or cyclicalkyl or Ci-C ₆ straight or heterocyclicalkyl;

Z ⁴ is a COZ ² group, a CON(R ⁵ ) ₂ group; and

each Z ⁵ is independently a hydrogen or C C ₈ straight, branched or cyclic hydrocarbon group.

[0063] Other compounds have the structure of Formula X:

wherein,

Z ² is a Ci-C ₈ straight, branched or cyclic hydrocarbon group, a Ci-C ₆ alkoxy group or amide optionally substituted with Ci-C ₆ straight or cyclicalkyl or Ci-C ₆ straight or heterocyclicalkyl;

Z ⁴ is a COCH ₃ group, a CO H ₂ group, a CO H(CH ₃ ) group; and

each n is independently 0, 1, 2 or 3..

[0064] An example of the latter is the compound of Formula (XI):

[0065] Other examples of compounds include compounds of Formulae XII through XIV:

Formula (XII)

4-[4-(2,3-Dihydro-l,4-benzodioxin-6-yl)-5-(2-pyridynl)-lH -imidazol-2-yl]benzamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer or chemical derivative thereof,

(XIII)

4-[4-[3-(2-Pyridynl)-lH-pyrazol-4-yl]-2-pyridynl]-N-(tetr ahydro-2H-pyran-4-yl)- benzamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer chemical derivative thereof,

(XIV)

4-[3-(2-Pyridynl)-lH-pyrazol-4-yl]-quinoline or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer or chemical derivative thereof,

Formula (XV)

2-(3-(6-methylpyridine-2-yl)-lH-pyrazol-4-yl)-l,5-naphthy ridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer or chemical derivative thereof,

4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridynl)-lH-imidazol-2-yl] benzamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer or chemical derivative thereof,

Formula (XVII)

2-(5-Benzo[l,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl) -6-methylpyridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer or chemical derivative thereof, Formula (XVIII)

6-[2-tert-Butyl-5-(6-methyl-pyridin-2-yl)-lH-imidazol-4-y l]-quinoxaline or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer or chemical derivative thereof,

Formula (XIX)

2-(5-Chloro-2-fluorophenyl)-4-[(4-pyridyl)amino]pteridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer or chemical derivative thereof.

[0066] An "alkoxy" group refers to an (alkyl)O— group.

[0067] An "alkyl" group refers to an aliphatic hydrocarbon group. The term "alkyl group" and "hydrocarbon group" are equivalent and may be used interchangeably. The alkyl moiety may be a "saturated alkyl" group, which means that it does not contain any alkene or alkyne moieties. The alkyl moiety may also be an "unsaturated alkyl" moiety, which means that it contains at least one alkene or alkyne moiety. An "alkene" moiety refers to a group that has at least one carbon-carbon double bond, and an "alkyne" moiety refers to a group that has at least one carbon-carbon triple bond. The alkyl moiety, whether saturated or unsaturated, may be branched, straight chain or cyclic or heterocyclic. Depending on the structure, an alkyl group can be a monoradical or a diradical (i.e. an alkylene group).

[0068] As used herein, Ci-C _x includes Ci-C ₂ , C ₁ -C3,— Ci-C _x , wherein x is 2 to 10.

[0069] The "alkyl" moiety may have 1 to 10 carbon atoms (whenever it appears herein, a numerical range such as "1 to 10" refers to each integer in the given range; e.g. "1 to 10 carbon atoms" means that the alkyl group may have 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to and including 10 carbon atoms, although the present definition also covers the occurrence of the term "alkyl" where no numerical range is designated). The alkyl group of the compounds described herein may be designated as "Ci-C ₆ alky" or similar designations. By way of example, only "Ci-C ₆ alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, e.g. the alkyl chain is selected from among methyl, ethyl, propyl, isopropyl, n-butly, isobutyl, sec-butyl and t-butyl. Thus, Ci-C ₆ alkyl includes Ci- C ₂ alkyl and Ci-C ₃ alkyl. Alkyl groups can be substituted or unsubstituted. Typical alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, penthyl, hexyl, ethenyl, propenyl, butenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like. In an embodiment, the alkyl group is a Ci-C ₈ alkyl group. In another embodiments, the alkyl group is a Ci-C ₆ alkyl group. In another embodiment, the alkyl group is a C ₁ -C4 alkyl group. In another embodiment, the alkyl group is a Ci-C ₃ alkyl group. In another embodiment, the alkyl group is a Ci-C ₂ alkyl group. In another embodiment, the alkyl group is a Ci alkyl group.

[0070] An "amide" is a chemical moiety with the formula -C(0) HR or -NHC(0)R, where R is selected from among alkyl, cycloalkyl, aryl, heteroaryl (bonded through a ring carbon) and heteroalicyclic (bonded through a ring carbon). An amide moiety may form a linkage between an amino acid or a peptide molecule and a compound described herein, thereby forming a prodrug. Any amine or carboxyl side chain on the compounds described herein can be amidified. The amide may be an optionally substituted with Ci-C ₆ straight or cyclicalkyl or a Ci-C ₆ straight heterocyclicalkyl. The procedures and specific groups to make such amides are known to those of skill in the art and can readily be found in reference sources such as Greene and Wuts (1999), Protective Groups in Organic Synthesis, 3 ^rd Ed., Jon Wiley & Sons, New York, N.Y.

[0071] As used herein, the term "aryl" or "Ar" refers to an aromatic ring wherein each of the atoms forming the ring is a carbon atom. Aryl groups can be optionally substituted. Examples of aryl groups include, but are not limited to phenyl, naphthalenyl, phenanthrenyl, anthracencyl, fluorenyl and indenyl. Depending on the structure, an aryl group can be a monoradical or a diradical (i.e. an arylene group).

[0072] The term "aromatic" refers to a planar ring having a delocalized π-electron system containing 4n+2 π electrons, where n is an integer. Aromatic rings can be formed by five, six, seven, eight, nine or more than nine atoms. Aromatics can be optionally substituted. The term "aromatic" includes both carbocyclic aryl (e.g. phenyl) and heterocyclic aryl (or "heteroaryl" or "heteroaromatic") groups (e.g. pyridine), the term includes monocyclic or fused-ring polycyclic (i.e. rings which share adjacent pairs of carbon atoms) groups.

[0073] As used herein, the terms "heteroalkyl", "heterocyclicalkyl", "heteroalkenyl" and "heteroalkynyl" include optionally substituted alkyl, alkenyl and alkynyl radicals in which one or more skeletal chain atoms are selected from an atom other than carbon, e.g. oxygen, nitrogen, sulphur, silicon, phosphorus or combinations thereof.

[0074] The term "optionally substituted" or "substituted" means that the referenced group may be substituted with one or more additional group(s) individually and independently selected from alkyl, cycloalkyl, aryl, heteroaryl, heterocyclic, hydroxy, alkoxy, aryloxy, mercapto, alkylthio, arylthio, alkylsulfoxide, arylsulfoxide, alkylsulfone, arylsulfone, cyano, ahlo, carbonyl, thiocarbonyl, isocyanato, thiocyanate, isothiocyanato, nitro, perhaloalky, perfluoroalky, sily and amino, including mono- and di -substituted amino groups, and the protected derivatives thereof. By way of example, an optional substituent may be L _S R _S , wherein each L _s is independently selected from a bond,— O— ,— C(=0)— ,— S- -, ~S(=0)~, ~S(=0) ₂ ~, -NH-, - HC(O)-, -C(0) H-, S(=o) ₂ H-, - HS(=0) ₂ , - OC(0) H~, ~ HC(0)0~, --(substituted or unsubstituted Ci-C ₆ alkyl), or (-substituted or unsubstituted C ₂ -C ₆ alkenyl); and each R _s is independently selected from H, (substituted or unsubstituted lower alkyl), (substituted or unsubstituted lower cycloalkyl), heteroaryl, or heteroalkyl. The protecting groups that may form the protective derivatives of the above substituents are known to those of skill in the art.

[0075] The compounds presented herein may possess one or more stereocenters and each center may exist in the R or S configuration. The compounds presented herein include all diastereomeric, enantiomeric and epimeric forms as well as the appropriate mixtures thereof. Stereoisomers may be obtained, if desired, by methods known in the art as, for example, the separation of stereoisomers by chiral chromatographic columns. The methods and formulations described herein include the use of N-oxides, crystalline forms (also known as polymorphs), or pharmaceutically acceptable salts of compounds described herein, as well as active metabolites of these compounds having the same type of activity. A "tautomer" refers to a proton shift from one atom of a molecule to another atom of the same molecule. The compounds presented herein may exist as tautomers. Tautomers are compounds that are interconvertible by migration of a hydrogen atom, accompanied by a switch of a single bond and adjacent double bond. In solutions where tautomerization is possible, a chemical equilibrium of the tautomers will exist. The exact ratio of the tautomers depends on several factors including temperature, solvent and pH.

[0076] As indicated above, an agent which inhibits TGF or TGF -R signaling includes but is not limited to an agent selected from the list consisting of 3-(6-methylpyridin-2-yl)- N-phenyl-4-quinolin-4-ylpyrazole-l-carbothioamide (also referred to as A83-01), 4-[4-2,3- dihyrdo-l,4-benzodioxin-6-yl)-5-(2-pyridynl)-lH-imidazol-2-y l]-benzamide, 4-[4-[3-(2- pyridynl)-lH-pyrazol-4-yl]-2-pyridynl]-N-(tetrahydro-2H-pyra n-4-yl)-benzamide, 4-[3-(2- pyridynl)-lH-pyrazol-4-yl]-quinoline, 2-(3-(6-methylpyridine-2-yl)-lH-pyrazol-4-yl)-l,5- naphthyridine, 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridynl)-lH-imidazol-2-yl] -benzamide, 2-(5-benzo[l,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6- methylpyridine and 6-[2-tert- butyl-5-(6-methyl-pyridin-2-yl)-lH-imidazol-4-yl]-quinoxalin e and 2-(5-chloro-2- fluorophenyl)-4-[(4-pyridyl)amino)-pteridine and a pharmaceutically acceptable salt, solvate, tautomer, enantiomer or chemical derivative of any of the above compounds.

[0077] Hence, enabled herein is a method for expanding a sample comprising mammalian mesenchymal stem cells (MSCs) into a population of substantially non-differentiated, multipotent MSCs in an in vitro culture, the method comprising culturing the sample of cells in the presence of an agent selected from the list consisting of 3-(6-methylpyridin-2- yl)-N-phenyl-4-quinolin-4-ylpyrazole-l-carbothioamide, 4-[4-2,3-dihyrdo-l,4- benzodioxin-6-yl)-5-(2-pyridinyl)-lH-imidazol-2-yl]-benzamid e, 4-[4-[3-(2-pyridinyl)- lH-pyrazol-4-yl]-2-pyridinyl]-N-(tetrahydro-2H-pyran-4-yl)-b enzamide, 4-[3-(2- pyridinyl)-lH-pyrazol-4-yl]-quinoline, 2-(3-(6-methylpyridine-2-yl)-lH-pyrazol-4-yl)-l,5- naphthyridine, 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-lH-imidazol-2-yl ]-benzamide, 2-(5-benzo[l,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6- methylpyridine, 6-[2-tert- butyl-5-(6-methyl-pyridin-2-yl)-lH-imidazol-4-yl]-quinoxalin e and 2-(5-chloro-2- fluorophenyl)-4-[(4-pyridyl)amino)-pteridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof which inhibits TGF /TGF -R signaling for a time and under conditions sufficient to expand the sample comprising MSCs into a population of multipotent cells.

[0078] Further, enabled herein is a method for expanding a sample comprising mammalian mesenchymal stem cells (MSCs) into a population of substantially non-differentiated, multipotent MSCs in an in vitro culture, the method comprising subjecting a sample of cells comprising MSCs to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent selected from the list consisting of 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4- ylpyrazole-l-carbothioamide, 4-[4-2,3-dihyrdo-l,4-benzodioxin-6-yl)-5-(2-pyridinyl)-lH- imidazol-2-yl]-benzamide, 4-[4-[3-(2-pyridinyl)-lH-pyrazol-4-yl]-2-pyridinyl]-N- (tetrahydro-2H-pyran-4-yl)-benzamide, 4-[3-(2-pyridinyl)-lH-pyrazol-4-yl]-quinoline, 2- (3-(6-methylpyridine-2-yl)-lH-pyrazol-4-yl)-l,5-naphthyridin e, 4-[4-(l,3-benzodioxol-5- yl)-5-(2-pyridinyl)-lH-imidazol-2-yl]-benzamide, 2-(5-benzo[l,3]dioxol-5-yl-2-tert-butyl- 3H-imidazol-4-yl)-6-methylpyridine, 6-[2-tert-butyl-5-(6-methyl-pyridin-2-yl)-lH- imidazol-4-yl]-quinoxaline and 2-(5-chloro-2-fluorophenyl)-4-[(4-pyridyl)amino)- pteridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof which inhibits TGF /TGF -R signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells.

[0079] In an embodiment, the agent is 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4- ylpyrazole-l-carbothioamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof. This compound is referred to herein as "A83-01 ". Variants and analogs and functional derivatives of A83-01 are also encompassed herein. The amount of TGF /TGF R antagonist such as A83-01 includes but is not limited to from 0.1 μΜ to 50μΜ such as 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 10, 20, 30, 40 and 50μM.

[0080] Hence, enabled herein is a method for expanding a sample of mammalian mesenchymal stem cells (MSCs) into a population of substantially non-differentiated, multipotent MSCs in an in vitro culture, the method comprising culturing the sample of cells in the presence of 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l- carbothioamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof which inhibits TGF /TGF -R signaling for a time and under conditions sufficient to expand the sample comprising MSCs into a population of multipotent cells. The MSCs include in an embodiment W5C5 ⁺ MSCs.

[0081] Further, enabled herein is a method for expanding a sample of mammalian mesenchymal stem cells (MSCs) into a population of substantially non-differentiated, multipotent MSCs in an in vitro culture, the method comprising subjecting a sample of cells comprising MSCs to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of 3-(6- methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l-carbo thioamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof which inhibits TGF /TGF -R signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells. The MSCs include in an embodiment W5C5 ⁺ MSCs.

[0082] As indicated above, the MSCs include eMSCs or pMSCs. MSCs, eMSCs and pMSCs include MPCs, eMPCs and pMPCs, respectively. The culture protocol taught by the present disclosure enables the generation of a population of MSCs including eMSCs and pMSCs which has a variety of clinical, diagnostic and drug discovery applications. In relation to cell therapies, these include tissue regeneration, organ growth, repair and augmentation, tissue rejuvenation, cosmetic treatment or treatment of an inflammatory disease such as host versus graft disease, graft versus host disease or disease of the liver or lung or pelvic organ prolapse. Other conditions include the treatment of circulatory disorders, bone disorders, cardiac disease, damaged or abnormal cartilage and hernia repair.

[0083] Accordingly, enabled herein is a method for cell therapy in a subject, the method comprising administering to the subject, an effective amount of a population of non- differentiated MSCs generated by isolating a sample comprising MSCs from the same (autologous/homologous) subject or a different (allogeneic/heterologous) subject, culturing the cells in the presence of an agent which antagonizes a TGF -mediated signaling for a time and under conditions sufficient to expand the sample comprising MSCs into a population of multipotent cells, the administration being for a time and under conditions sufficient for the MSCs to differentiate into the selected tissue.

[0084] Taught herein is a method for cell therapy in a subject, the method comprising administering to the subject, an effective amount of a population of non-differentiated MSCs generated by isolating a sample comprising MSCs from the same (autologous/homologous) subject or a different (allogeneic/heterologous) subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent which antagonizes TGF -mediated signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells, the administration being for a time and under conditions sufficient for the MSCs to differentiate into the selected tissue.

[0085] Taught herein is a method for cell therapy in a subject, the method comprising administering to the subject, an effective amount of a population of non-differentiated MSCs generated by isolating a sample comprising MSCs from the same (autologous/homologous) subject or a different (allogeneic/heterologous) subject, culturing the cells in the presence of an agent which antagonizes TGF -R-mediated signaling for a time and under conditions sufficient to expand the sample MSCs into a population of multipotent cells, the administration being for a time and under conditions sufficient for the MSCs to differentiate into the selected tissue.

[0086] Further taught herein is a method for cell therapy in a subject, the method comprising administering to the subject, an effective amount of a population of non- differentiated MSCs generated by isolating a sample comprising MSCs from the same (autologous/homologous) subject or a different (allogeneic/heterologous) subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent which antagonizes TGF -R-mediated signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells, the administration being for a time and under conditions sufficient for the MSCs to differentiate into the selected tissue.

[0087] Enabled herein is a method for cell therapy in a subject, the method comprising administering to the subject, an effective amount of a population of non-differentiated MSCs generated by isolating a sample comprising MSCs from the same (autologous/homologous) subject or a different (allogeneic/heterologous) subject, culturing the cells in the presence of 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l- carbothioamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof, the administration being for a time and under conditions sufficient for the MSCs to differentiate into the selected tissue. In an embodiment, the MSCs are W5C5 ⁺ MSCs.

[0088] In an embodiment, enabled herein is a method for cell therapy in a subject, the method comprising administering to the subject, an effective amount of a population of non-differentiated MSCs generated by isolating a sample comprising MSCs from the same (autologous/homologous) subject or a different (allogeneic/heterologous) subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of 3-(6- methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l-carbo thioamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof, the administration being for a time and under conditions sufficient for the MSCs to differentiate into the selected tissue. In an embodiment, the MSCs are W5C5 ⁺ MSCs.

[0089] Other TGF /TGF -R antagonists include but are not limited to 4-[4-2,3-dihyrdo-

1.4- benzodioxin-6-yl)-5-(2-pyridinyl)-lH-imidazol-2-yl]-benzamid e, 4-[4-[3-(2- pyridinyl)-lH-pyrazol-4-yl]-2-pyridinyl]-N-(tetrahydro-2H-py ran-4-yl)-benzamide, 4-[3- (2-pyridinyl)-lH-pyrazol-4-yl]-quinoline, 2-(3-(6-methylpyridine-2-yl)-lH-pyrazol-4-yl)-

1.5- naphthyridine, 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-lH-imidazol-2-yl ]- benzamide, 2-(5-benzo[l,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6- methylpyridine, 6-[2-tert-butyl-5-(6-methyl-pyridin-2-yl)-lH-imidazol-4-yl]- quinoxaline and 2-(5-chloro- 2-fluorophenyl)-4-[(4-pyridyl)amino)-pteridine.

[0090] In an embodiment, the MSCs are eMSCs or pMSCs. In an embodiment, they are W5C5 ⁺ MSCs.

[0091] In another embodiment, the agent is an antibody to TGF -R or a recombinant fusion protein targeting the receptor. Reference to an "antibody" includes conventional monoclonal and polyclonal antibodies, derivatives and chimeric forms of antibodies such as humanized and deimmunized antibodies as well as cartilaginous marine animal-derived immunoglobulins (IgNARs) as well as camelid immunoglobulins. In another embodiment, the agent is a peptide or mimetic of the soluble TGF -R or a peptide or mimetic of a non- signaling form of TGF . In yet another embodiment, the agent is a genetic molecule which reduces expression of a particular gene encoding a component of the TGF signaling pathway. Genetic agents include RNA, DNA, siRNA, microRNA, siDNA and the like. In still another embodiment, the agent is a peptide aptamer or nucleic acid aptamer which inhibits a component in the TGF signaling pathway or a gene encoding same such as but not limited to TGF -R.

[0092] Examples of tissue therapy include tissue regeneration, organ growth, repair or augmentation, tissue rejuvenation, cosmetic treatment or treatment of an inflammatory or autoimmune disease include host versus graft and graft versus host disease, as well as cardiovascular disease, lung disease, liver disease, circulatory disorders, bone disease, pelvic organ prolapse, cartilage repair and hernia repair.

[0093] The present disclosure enables the production of a population of MSCs in non- differentiated, multipotent form. In an embodiment, the MSCs are eMSCs or pMSCs. The protocol is a quality management system to reduce variability between batches of MSCs and between patients. It enables a more consistent outcome.

[0094] Taught herein is an isolated population of non-differentiated, multipotent MSCs generated by the method of isolating a sample comprising MSCs from a subject, culturing the cells in the presence of an agent which antagonizes a TGF -mediated signaling for a time and under conditions sufficient to expand the sample comprising MSCs into a population of multipotent cells.

[0095] Enabled herein is an isolated population of non-differentiated, multipotent MSCs generated by the method of isolating a sample comprising MSCs from a subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent which antagonizes TGF -mediated signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells. [0096] Also taught herein is an isolated population of non-differentiated, multipotent MSCs generated by the method of isolating a sample comprising MSCs from a subject, culturing the cells in the presence of an agent which antagonizes TGF -R-mediated signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells.

[0097] The present specification is instructional on an isolated population of non- differentiated, multipotent MSCs generated by the method of isolating a sample comprising MSCs from a subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent which antagonizes TGF -R-mediated signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells. The specification enables a quality management system to reduce individual MSC variation. This in turn reduces the variability between patients treated and permits a more personalized medical approach to therapy.

[0098] Taught herein is an isolated population of non-differentiated, multipotent MSCs generated by the method of isolating a sample comprising MSCs from a subject, culturing the cells in the presence of an agent selected from the list consisting of 3-(6-methylpyridin- 2-yl)-N-phenyl-4-quinolin-4-ylpyrazole- 1 -carbothioamide, 4-[4-2,3 -dihyrdo- 1 ,4- benzodioxin-6-yl)-5-(2-pyridinyl)-lH-imidazol-2-yl]-benzamid e, 4-[4-[3-(2-pyridinyl)- lH-pyrazol-4-yl]-2-pyridinyl]-N-(tetrahydro-2H-pyran-4-yl)-b enzamide, 4-[3-(2- pyridinyl)-lH-pyrazol-4-yl]-quinoline, 2-(3-(6-methylpyridine-2-yl)-lH-pyrazol-4-yl)-l,5- naphthyridine, 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-lH-imidazol-2-yl ]-benzamide, 2-(5-benzo[l,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6- methylpyridine, 6-[2-tert- butyl-5-(6-methyl-pyridin-2-yl)-lH-imidazol-4-yl]-quinoxalin e and 2-(5-chloro-2- fluorophenyl)-4-[(4-pyridyl)amino)-pteridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof, for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells. [0099] Enabled herein is an isolated population of non-differentiated, multipotent MSCs generated by the method of isolating a sample comprising MSCs from a subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent selected from the list consisting of 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l- carbothioamide, 4-[4-2,3-dihyrdo-l,4-benzodioxin-6-yl)-5-(2-pyridinyl)-lH-im idazol-2- yl]-benzamide, 4-[4-[3-(2-pyridinyl)-lH-pyrazol-4-yl]-2-pyridinyl]-N-(tetra hydro-2H- pyran-4-yl)-benzamide, 4-[3-(2-pyridinyl)-lH-pyrazol-4-yl]-quinoline, 2-(3-(6- methylpyridine-2-yl)-lH-pyrazol-4-yl)-l,5-naphthyridine, 4-[4-(l,3-benzodioxol-5-yl)-5- (2-pyridinyl)-lH-imidazol-2-yl]-benzamide, 2-(5-benzo[l,3]dioxol-5-yl-2-tert-butyl-3H- imidazol-4-yl)-6-methylpyridine, 6-[2-tert-butyl-5-(6-methyl-pyridin-2-yl)-lH-imidazol-4- yl]-quinoxaline and 2-(5-chloro-2-fluorophenyl)-4-[(4-pyridyl)amino)-pteridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof, for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells.

[0100] Taught herein is an isolated population of non-differentiated, multipotent MSCs generated by the method of isolating a sample comprising MSCs from a subject, culturing the cells in the presence of 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l- carbothioamide or a pharmaceutically acceptable salt, solvate, tautomer, or enantiomer thereof or a chemical derivative thereof, for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells.

[0101] In terms of in vitro culture technology, the MSCs can be produced on either a small scale or on a larger scale. In terms of small scale production, this may be effected in tissue culture flasks for example and may be suitable for producing populations of cells for a given individual and in the context of a specific condition. One means of achieving large scale production in accordance with the method of the instant invention is via the use of a bioreactor, generally under hypoxic conditions. [0102] In relation to the above embodiments, the MSCs include eMSCs and pMSCs. In an embodiment, the MSCs are W5C5 ⁺ MSCs.

[0103] The present disclosure further teaches an isolated population of non-differentiated, multipotent MSCs generated by the method of isolating a sample comprising MSCs from a subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l- carbothioamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof, for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells.

[0104] Bioreactors are designed to provide a culture process that can deliver medium and nitrogen at controlled concentrations and rates that mimic nutrient concentrations and rates in vivo. Bioreactors are available commercially and employ a variety of types of culture technologies. Of the different bioreactors used for mammalian cell culture, most have been designed to allow for the production of high density cultures of a single cell type and as such find use in the present invention. In most instances, expansion and use of cultured MSCs require the use of suitable microcarriers or beads for adhesion and proliferation of the undifferentiated MSCs. Those skilled in the art will be aware of the range of possible synthetic and biological carriers including surface coated carriers to allow efficient MSC adhesion. Also included in the present invention is a means of culturing and expanding undifferentiated MSCs on biomaterial scaffolds and meshes of both synthetic and natural origin intended for clinical intervention for tissue repair and regeneration including, for example, but not restricted to, the repair of damaged pelvic organ prolapse, cartilage repair and hernia repair.

[0105] The development of the cell culture protocol facilitates the development of means for therapeutically or prophylactically treating subjects based on administering to those patients a population of expanded MSCs. The protocol enables a quality management system to reduce individual MSC variation. This in turn reduces the variability between patients treated and permits a more personalized medical approach to therapy.

[0106] Reference to "administering" to a subject means providing an effective number of MSCs to the mammal, such as a human.

[0107] In accordance with this embodiment, the subject cells are generally autologous (homologous) or allogeneic (heterologous) MSCs expanded in culture to allow sufficient amplification of a source of therapeutic undifferentiated MSCs. It should be understood, however, that the purpose of these expanded MSCs for cell therapies or tissue engineering could include paracrine effects from those subject cells or differentiation of these cells in vivo to replace diseased or damaged cells and tissue.

[0108] Reference to an "effective amount" means that number of cells necessary to at least partly attain the desired effect, or to delay the onset of, inhibit the progression of, or halt altogether the onset or progression of the particular condition being treated. Such amounts will depend, of course, on the particular conditions being treated, the severity of the condition and individual patient parameters including age, physical conditions, size, weight, physiological status, concurrent treatment, medical history and parameters related to the disorder in issue. One skilled in the art would be able to determine the number of cells and tissues of the present invention that would constitute an effective dose, and the optimal mode of administration thereof without undue experimentation. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. Generally, a maximal cell number is used which is the highest safe number according to sound medical judgement. It will be understood by those of ordinary skill in the art, however, that a lower cell number may be administered for medical reasons, psychological reasons or for any other reasons.

[0109] The cells which are administered to the patient can be administered as single or multiple doses by any suitable route. Where possible, a single administration is utilized. Administration via injection can be directed to various regions of a tissue or organ, depending on the type of repair required. The cells which are administered to the patient can be administered as single or multiple doses by any suitable route. Where possible, a single administration is utilized. Administration via injection can be directed to various regions of a tissue or organ, depending on the type of repair required. It would also be appreciated by those skilled in the art, that a variety of cell delivery systems could be used with the subject cells, including those derived from synthetic or biological materials including but not restricted to hydrogels, meshes, patches, sponges. Use of these systems could assist in retention of the delivered subject cells to the site of administration. Alternatively these systems can be used as part of the tissue engineered product along with embedded or seeded subject cells that allow either retention of the subject cells in the undifferentiated state or controlled differentiation of subject cells towards cells and tissues required for replacement of the damaged tissue. Detailed guidelines for generating or obtaining suitable scaffolds, culturing such scaffolds and therapeutically implanting such scaffolds are available in the literature (for example, refer to Kim and Vacanti (1999) Semin Pediatr Surg. 8: 119, U.S. Patent No. 6,387,369 and U.S. Patent Application No. US20020094573 Al).

[0110] In a related aspect, the subject undergoing treatment or prophylaxis may be any human or animal in need of therapeutic or prophylactic treatment. In this regard, reference herein to "treatment" and "prophylaxis" is to be considered in its broadest context. The term "treatment" does not necessarily imply that a mammal is treated leading to total recovery. Similarly, "prophylaxis" does not necessarily mean that the subject will not eventually contract a disease condition. Accordingly, treatment and prophylaxis include amelioration of the symptoms of a particular condition or preventing or otherwise reducing the risk of developing a particular condition. The term "prophylaxis" may be considered as reducing the severity of the onset of a particular condition. "Treatment" may also reduce the severity of an existing condition.

[0111] Generally, the subject being treated is a human. However, the present disclosure extends to veterinary applications.

[0112] Another aspect of the present invention is directed to the use of a population of MSCs generated by the method of isolating a sample comprising MSCs from a subject, culturing the cells in the presence of an agent which antagonizes TGF -mediated signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells in the manufacture of a medicament for cell therapy in a subject.

[0113] In an embodiment, enabled herein is the use of a population of MSCs generated by the method of isolating a sample comprising MSCs from a subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent which antagonizes TGF -mediated signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells in the manufacture of a medicament for cell therapy in a subject.

[0114] The present specification is instructional on the use of a population of MSCs generated by the method of isolating a sample comprising MSCs from a subject, culturing the cells in the presence of an agent which antagonizes TGF -R-mediated signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells in the manufacture of a medicament for cell therapy in a subject.

[0115] Taught herein is the use of a population of MSCs generated by the method of isolating a sample comprising MSCs from a subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent which antagonizes TGF -R- mediated signaling for a time and under conditions sufficient to expand the sample of enriched MSCs into a population of multipotent cells in the manufacture of a medicament for cell therapy in a subject.

[0116] Another aspect of the present invention is directed to the use of a population of MSCs generated by the method of isolating a sample comprising MSCs from a subject and culturing the cells in the presence of an agent selected from the list consisting of 3-(6- methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l-carbo thioamide, 4-[4-2,3- dihyrdo-l,4-benzodioxin-6-yl)-5-(2-pyridinyl)-lH-imidazol-2- yl]-benzamide, 4-[4-[3-(2- pyridinyl)-lH-pyrazol-4-yl]-2-pyridinyl]-N-(tetrahydro-2H-py ran-4-yl)-benzamide, 4-[3- (2-pyridinyl)-lH-pyrazol-4-yl]-quinoline, 2-(3-(6-methylpyridine-2-yl)-lH-pyrazol-4-yl)- 1,5-naphthyridine, 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-lH-imidazol-2-yl ]- benzamide, 2-(5-benzo[l,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6- methylpyridine, 6-[2-tert-butyl-5-(6-methyl-pyridin-2-yl)-lH-imidazol-4-yl]- quinoxaline and 2-(5-chloro- 2-fluorophenyl)-4-[(4-pyridyl)amino)-pteridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof in the manufacture of a medicament for cell therapy in a subject.

[0117] Further enabled herein is the use of a population of MSCs generated by the method of isolating a sample comprising MSCs from a subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of an agent selected from the list consisting of 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l- carbothioamide, 4-[4-2,3- dihyrdo-l,4-benzodioxin-6-yl)-5-(2-pyridinyl)-lH-imidazol-2- yl]-benzamide, 4-[4-[3-(2- pyridinyl)-lH-pyrazol-4-yl]-2-pyridinyl]-N-(tetrahydro-2H-py ran-4-yl)-benzamide, 4-[3- (2-pyridinyl)-lH-pyrazol-4-yl]-quinoline, 2-(3-(6-methylpyridine-2-yl)-lH-pyrazol-4-yl)- 1,5-naphthyridine, 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-lH-imidazol-2-yl ]- benzamide, 2-(5-benzo[l,3]dioxol-5-yl-2-tert-butyl-3H-imidazol-4-yl)-6- methylpyridine, 6-[2-tert-butyl-5-(6-methyl-pyridin-2-yl)-lH-imidazol-4-yl]- quinoxaline and 2-(5-chloro- 2-fluorophenyl)-4-[(4-pyridyl)amino)-pteridine or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof in the manufacture of a medicament for cell therapy in a subject.

[0118] Another aspect of the present invention is directed to the use of a population of MSCs generated by the method of isolating a sample comprising MSCs from a subject, culturing the cells in the presence of 3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4- ylpyrazole-l-carbothioamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof in the manufacture of a medicament for cell therapy in a subject.

[0119] Enabled herein is the use of a population of MSCs generated by the method of isolating a sample comprising MSCs from a subject, exposing the sample of cells to enrichment of MSCs by selection of a cell surface marker expressed by the MSCs followed by culturing the enriched cells in the presence of 3-(6-methylpyridin-2-yl)-N-phenyl-4- quinolin-4-ylpyrazole-l-carbothioamide or a pharmaceutically acceptable salt, solvate, tautomer or enantiomer thereof or a chemical derivative thereof in the manufacture of a medicament for cell therapy in a subject.

[0120] The development of a method for generating an expanded population of non- differentiated, multipotent MSCs such as eMSCs or pMSCs enables in vitro based screening systems for testing the effectiveness and toxicity of existing or potential treatment or culture regimes and further enables product discovery and evaluation.

[0121] Thus, according to yet another aspect of the present invention, there is provided a diagnostic method of assessing the effect of new drugs or small molecules in a treatment protocol or culture regime, the method comprising subjecting a population of non- differentiated, multipotent MSCs produced by the method herein to the treatment or culture regime and screening for retention of the original uncultured phenotype.

[0122] The present specification is instructional on a means of optimizing a treatment which is designed to normalize and maintain MSC-derived cellular functioning. However, the method can also be used to assess the toxicity of a treatment, in particular a treatment with a compound. Thus, failure to generate a characteristic associated with a mesenchymal or mesenchymal -derived phenotype in the cells and tissues of the present invention in response to treatment with a compound can be used to assess the toxicity of such a compound.

[0123] Generally, the treatment to which the cells or tissues of the present invention are subjected is an exposure to a drug. Generally, the drug is a chemical compound, peptide or protein, or a nucleic acid molecule. Alternatively the compound can be a growth factor or differentiation factor. To this end, it is highly desirable to have available a method which is capable of predicting such side effects on mesenchymal or mesenchymal -derived tissue prior to administering the drug.

[0124] Kits are also contemplated herein for use in expanding population of MSCs for use in therapy, diagnosis and drug discovery and evaluation.

[0125] The kit may be in the form of a therapeutic kit or a pre-medicament kit. In an embodiment, the kit is in compartment form wherein one compartment comprises a matrix support for cells. An example is gelatine/polyamide mesh. Expanded MSCs are seeded onto the mesh. The kit may further comprise culture fluid such as one or more of the media listed in Table 2. In an embodiment, the medium is the serum free medium. The media or medium may be in liquid form or is capable of being reconstituted in liquid form. The kit may also contain fibronectin for coating the mesh prior to cell seeding. Additional components include but are not limited to a TGF -signaling inhibitor (e.g. A83-01) and a growth factor. The kit may further be designed to act as a receptacle for components and/or reagents alone or as a culture vessel for culturing the MSC-seeded mesh. Alternatively, the kit is designed for MSC enrichment and culturing.

[0126] Aspects disclosed herein are further described in the following non-limiting Examples.

Materials and Methods

Human endometrial tissue samples

[0127] Human endometrial tissues samples were collected from pre-menopausal women who were undergoing endometrial curette or hysterectomy for non-endometrial pathologies and who were not taking any exogenous hormones for three months prior to the surgery. Isolation and magnetic bead sorting of SUSD2+ eMSC

[0128] eMSC were isolated from endometrial tissues obtained from hysterectomy tissue which were carefully scraped off the underlying myometrium. Both hysterectomy and curette tissues were mechanically minced and digested with 0.5% w/v collagenase type I and 40μg/ml deoxyribonuclease type I (both Worthington Biochemical Corporation) in Dulbecco's modified Eagle's medium (DMEM/F12) for 90 and 60 minutes, respectively in a humidified incubator at 37°C on a rotating MACSmix (Miltenyi Biotech). The tissue digest was filtered through 40 μπι cell strainer (BD Biosciences) to separate the epithelial gland fragments and undigested tissues. The red blood cells in the filtrate were separated from the single stromal cells by density gradient centrifugation using Ficoll-Paque (GE healthcare Bio-science). eMSC were obtained by incubating the stromal cells in Phycoerythrin (PE)-conjugated anti-human SUSD2 (10μg/ml, BioLegend) in 0.5% v/v FCS/PBS (bead medium) and anti-PE magnetic-activated cell sorting microbeads (Miltenyi Biotec) for 30 minutes each in the dark on ice. The conjugated pellet was resuspended in bead medium and applied to a Miltenyi column (Miltenyi Biotec, #130-042-201) in a magnetic field. The separated cells, containing the SUSD2+ eMSCs in the column were eluted in bead medium and the cells counted.

Cell culture and assessment of cell proliferation

[0129] The SUSD2+ eMSC were initially maintained in DMEM/F12 medium containing 10%) v/v fetal calf serum (FCS) (Invitrogen), 1%> w/v antibiotic-antimycotic (Life Technologies) and 2mM glutamine and slowly changed to a DMEM/F12 serum free medium supplemented with basic fibroblast growth factor (FGF2, lOng/ml) and epidermal growth factor (EGF, lOng/ml) (SFM) at 37°C in 5% v/v 0 ₂ /5% v/v CO ₂ /90% v/v N, as described previously22. The cells were seeded at 5000 cells/cm ² density at subsequent passages in fibronectin (10μ§/ιη1) pre-coated culture flasks. Cell proliferation assays were performed at passage 3 by seeding 1000 cells in ΙΟΟμΙ SFM per well in fibronectin pre- coated 96-well plates with or without A83-01, concentrations varying from 0-ΙΟμΜ. Medium was changed every second day and contained A83-01 at the same concentration. Following 7 days of culture, 20μ1 of MTS tetrazolium reagent (Promega) was added to each well and incubated for 2 hours and the soluble formazan product was quantified using a micro plate reader (SpectraMax Plus384; Molecular Devices) at 490nm. Further experiments were done at passage 6 where the cells were separated into two groups, one group was treated with 1 μΜ A83-01 and the control with (0.01% v/v DMSO) vehicle. The data were normalized to the control and reported as a percentage.

Immunophenotyping

[0130] eMSC were trypsinized with TrypLETM (Life technologies, #12604-021)) and resuspended at 10 ⁵ cells/tube. Cells were washed with 5% v/v heat-inactived newborn calf serum in DMEM (bench medium) and incubated with PE-, APC- or FITC-conjugated primary antibodies or matched-isotype controls in bench medium for 30 minutes in the dark on ice. Primary antibody used was CD146 (1 : 1 supernatant, clone CC9, (CSIRO, Australia). PE-conjugated antibodies were SUSD2 (1 :20, Biolegend, #327406), CD140b (1 :20, R&D systems FAB1263P) and CD271 (1 :20, Miltenyi Biotec). APC-conjugated antibody was CD90 (1 :20, BD Pharmingen). Isotype control antibodies at the same concentration as the primary antibody were included for each run and were used to set the electronic negative control gate on the flow cytometer. Finally, cells were washed with bench medium and fixed with 4% v/v paraformaldehyde (PFA) in 2% v/v FBS/PBS. Samples were analyzed using a MoFlo Flow Cytometry (Beckman Coulter) and Summit software (version 5.2., Beckman Coulter).

Immunofluorescence microscopy

[0131] Passage 6 (P6) eMSC were cultured on coverslips with or without Ι μΜ A83-01 for 7 days and then fixed in 4% v/v PFA followed by protein block (Dako, X0909) for 10 minutes each at room temperature with washing in between with PBS. PE-conjugated SUSD2 antibody (1 :200, BioLegend, #327406) in 2% v/v FCS/PBS was incubated for 2 hours at room temperature in dark. Isotype control IgGl antibody was used as a negative control. Hoechst 33258 (1 :2000, Molecular Probes) was used to visualize nuclei. Images were visualized and photographed using a Delta Vision microscope, and analyzed using ImageJ software (ImageJ-win32.Ink). Immunoblotting

[0132] Cell lysates were prepared using lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% v/v triton X-100) with mini protease inhibitor cocktail tablet (Roche) and phosphatase inhibitor sodium vanadate (2 mM). The following antibodies were used: anti-SMAD 2/3 antibody (#3102S), antiphospho-SMAD 2/3 (#8828S), horseradish peroxidise conjugated secondary antibody (#7074S) from Cell Signaling Technology. The specific protein was detected by treating the membrane for two minutes with enhanced chemiluminescence (# 133406, Abeam) which provides the HRP substrate, and capturing the signal in X-ray films.

Quantitative RT-PCR

[0133] RNA was isolated using PureLink (Registered Trade Mark) RNA mini Kit (Life technologies, #12183018A) and further treated with DNase (PureLink (Registered Trade Mark) DNase, Invitrogen) to obtain DNA-free total RNA. First-strand cDNA was synthesized using Superscript III first-strand synthesis system (Invitrogen). An aliquot of 50ng of cDNA was amplified and detected using TaqMan probes for OCT4, NANOG and SOX2, and SYBR Green Super Mix for SUSD2, CD146, AOC3, MMP3, FRZB, DKK1, NOTCH3, NOTCH2 and NESTIN. The PCR conditions consisted of initial denaturation at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds and annealing/polymerization at 60°C for 60 seconds.

[0134] Primer sets are detailed in Table 1 (F, Forward primer; R, Reverse primer). GAPDH or β-Actin was used as an endogenous control to normalize the target gene expression and fold change was calculated using the 2 ^{" CT} method.

Mesenchymal stent/stromal cell properties

[0135] To assess colony-forming ability, P6eMSC pre-treated and untreated with Ι μΜ A83-01 for 7 days were seeded at 50 and 100 cells/cm ² on fibronectin-coated 100mm culture dishes (BD Falcon) in SFM in a tri-gas incubator 5% v/v 0 ₂ /5% v/v CO ₂ /90% v/v N for four weeks. The cells were then formalin-fixed for 10 minutes and stained with haematoxylin (AMBER SCIENTIFIC). The colonies were washed twice with distilled water and counterstained with Scott's tap water to develop the blue color. Colony efficiency was calculated by counting the number of colonies divided by the number of cells seeded and the percentage determined.

[0136] To assess multipotency, the remaining cells were cultured in adiopogenic and osteogenic, and control medium (1% v/v fetal calf serum) on 13-mm coverslips, and for chondrogenic differentiation the cells were cultured as 3D pellets in chondrogenic induction media for 4 weeks at 37°C in 5% v/v C0 ₂ /5% v/v 0 ₂ as previously described (Rajaraman et al. (2013) supra). To detect the differentiation, the cells were fixed with 4% w/v PFA and incubated with 1% v/v Oil Red O for adipogenesis, 4% w/v Alizarin Red (pH 4.1) for osteogenesis and 1% w/v Alcian blue (pH 2.5) on paraffin embedded sections (5μπι) of the micromass pellet for chondrogenesis. Stained cells were examined under an Olympus BX41 microscope (Olympus) and images were taken with 10X objective lens using the DP25 digital camera (Olympus).

Cell cycle analysis and apoptosis by flow cytometry

[0137] To assess the cell cycle status, P6 A83-01 treated and untreated cells were detached, pelleted and fixed in ice-cold 70% v/v ethanol at 4°C overnight. They were washed with 2%FBS/PBS and incubated with 50μ1 RNAse (10( g/ml, Sigma) at room temperature for 15 minutes. 200μ1 of propidium iodide (PI) (50μg/ml, Sigma P4170) was added and the cells were analyzed immediately by flow cytometry using BD FACS Canto (Trade Mark) II on Pi-linear scales. The data were analyzed using FlowJo 7.6.3.

[0138] To assess apoptosis, P6 A83-01 treated and untreated cell-pellets were stained with Annexin VAPC/ PI kit following the manufacturer's protocol (#88-8007, eBioscience). Briefly, cells were trypsinized and resuspended in ΙΟΟμΙ binding buffer, 5μ1 of Annexin V- APC solution was added to the cell suspension and incubated for 15 minutes at room temperature protected from light. Following washing with the binding buffer, 5μ1 of PI was added to the cells suspended in 200μ1 binding buffer and events immediately acquired by flow cytometry using BD FACS Canto (Trade Mark) II and analyzed with FlowJo 7.6.3. Cell senescence by β-galactosidase and auto-fluorescence

[0139] Senescent cells were assessed by staining for beta-galactosidase activity. P6 A83- 01 treated and untreated eMSC were cultured on coverslips for 7 days as described above, then fixed in 4% v/v PFA for 10 minutes and stained in freshly prepared X-Gal (lmg/ml in DMSO) staining reagent (5mM K ₃ Fe(CN), 5mM K ₄ Fe(CN), 2mM MgCl ₂ , 150mM NaCl) in citrate buffer at pH6 for 24 hours at 37°C. The cells were washed twice with PBS and counter stained with nuclear fast red (Sigma-Aldrich, 0.1% w/v) for 10 minutes, then examined under an Olympus BX41 microscope (Olympus). Images were taken with 10X objective lens using the DP25 digital camera (Olympus).

Statistical A nalysis

[0140] Non parametric Friedman's test with Dunn's multiple comparison post hoc tests were used to test for multiple groups and Wilcoxon matched-pairs signed rank tests were used to test for statistical significance between treated and control groups. Data are presented as mean ± standard error of mean. Differences were considered statistically significant at p<0.05.

Table 1

RT-PCR Primers

GENE PRIMER SEQUENCE SEQ ID NO:

OCT4 F:CAGTGCCCGAAACCCACAC 1

R: GGAGACCCAGCAGCCTCAAA 2

NANOG F: TAATAACCTTGGCTGCCGTCTCTG 3

R: GCCTCCCAATCCCAAACAATACGA 4

SOX2 F: ACACCAATCCCATCCACACT 5

R: GCAAACTTCCTGCAAAGCTC 6

SUSD2 F: AGAGCTGGATGGACCTGAAA 7

R: ATGCCAGCATGATGGAGAC 8

CD146 F : GAAGCATGGGGCTTCCCAG 9

R:CCTCCGGAGCTTTGTAGACG 10

AOC3 F:TCAGCTGGGAGAGGATTTGG 11

R: CGGAAGTAGATGGAGTCGGC 12

MMP3 F:AGCAAGGACCTCGTT TTCATT 13

R : GTCAATCCCTGGAAAGTCTTCA 14

FRZB F:CCTGCCCTGGAACATGACTAA 15

R: CAGACCTTCGAA CTGCTCGAT 16

NESTIN F : GAAAC AGCC AT AGAGGGCAAA 17

R:TGGTTTTCCAGAGTCTTCAGTGA 18

DKK1 F:GATCATAGCACCTTGGATGGG 19

R:GGCACAGTCTGATGACCGG 20

NOTCH2 F: GTTTGTGTGGATGGGGTCAA 21

R: TCCACATCCTCTGTGCAGAA 22

NOTCH3 F : GGACCTGCCGTGGCT ATA 23

R:ACGTCGTCCTCACAGTTATCA 24

GAPDH F:TGTGGGCATCAATGGATTTGG 25

R : ACACC ATGTATTCCGGGTC A AT 26 β-ACTIN FiGGGCATGGGTCAGAAGGATT 27

R:AGTTGGTGACGATGCCGTG 28 EXAMPLE 1

Preparation of single cell suspensions of purified eMSCs

[0141] Human endometrial tissue was collected from women of reproductive age undergoing hysterectomy or endometrial biopsy for non-endometrial pathologies. A single cell suspension of endometrial cells was obtained using enzymatic digestion and mechanical means (Chan et al. (2004) supra). Briefly, the endometrial tissue is scraped off and is minced using scissors to small pieces (<lmm ³ ) and spun down in bench medium (Table 2) at HOOrpm, 5 minutes, 4°C. Further digestion is done by adding collagenase I (0.5% w/vl) [Worthington Biochemical Corporation, Lakewood, NJ, USA] and deoxyribonuclease type I (40μg/ml) [Worthington Biochemical Corporation] in bench medium (10ml) to the cell pellet and incubating in a MacsMix at 37°C (60 minutes for endometrial biopsy and 90 minutes for hysterectomy tissues). Bench medium is added to the cell suspension to stop the collagenase activity and filtered through a cell strainer (40μπι). The filtrate (containing stromal and red blood cells) is spun down at HOOrpm, 5 minutes, 4°C and supernatant removed. After adding 5ml bench medium to the cell pellet, red blood cells are removed by density gradient centrifugation by underlying 3ml Ficoll- Paque PLUS (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) at 1500 rpm for 15 minutes at room temperature. Cells are collected from the medium/Ficoll interface and counted using trypan blue. The stromal cell pellet is incubated in ΙΟΟμΙ of buffer with 5μ1 W5C5-PE antibody (Miltenyi Biotec) [^g/ml] for 10-30 minutes at 4°C in dark. Washed with 1ml of buffer (Table 2) and the cell pellet is resuspended in 80μ1 buffer per 10 ⁷ cells and 20μ1 of anti-PE MACS Microbeads per 10 ⁷ cells and incubated 15-30 minutes at 4°C in dark. Washed with 1ml of buffer and the cell pellet resuspended with 500μ1 buffer. The cell suspension is passed through the MACS column (Miltenyi Biotec) in the magnetic field. The column is washed with 500μ1 buffer three times. The column is removed from the magnetic field and placed in a sterile tube. An aliquot of 1ml of buffer is applied to the cells to flush out W5C5 ⁺ eMSCs and the cells counted. An amount of 800μ1 of buffer is removed after centrifuging and the cells cultured in a fibronectin pre-coated flask with stromal medium (Table 2) at 5% v/v 0 ₂ , 5% v/v C0 ₂ /95% v/v N at around 10-20,000 cells/cm ² . At passage 1, the cells are slowly starved off serum by decreasing the serum concentration from 5 to 1% over 48 hours and cultured in serum free medium (Table 2) with basic fibroblast growth factor (lOng/ml) and epidermal growth factor (lOng/ml) then onward. A similar protocol is adopted to isolate pMSCs.

Table 2

Media

[0142] AlbuMaxI is a lipid-rich bovine serum albumin. It is chromatographically purified and has an IgG content of <0.1% w/v. ITS-A is insulin-transferrin-selenium-sodium pyruvate. EXAMPLE 2

Generation of population of multipotent eMSCs

[0143] A83-01 (3-(6-methylpyridin-2-yl)-N-phenyl-4-quinolin-4-ylpyrazole-l - carbothioamide) enables culture expansion of eMSCs in their undifferentiated state in serum free medium (Table 2) under hypoxic conditions. In an embodiment, A83-01 is used at a concentration of ΙμΜ. Targeting the TGF -R signaling pathway increased human eMSC clonogenicity during culture expansion (Figure 3), generating an increased proportion of W5C5 ⁺ eMSCs (Figure 1), an effect regulated by Smad 2/3 signaling. The effect of A83-01 was greater on MSC derived from older compared to younger women. Thus, the culture protocol using A83-01 may have greater application when using autologous MSC as they frequently can be derived from older women. eMSCs can be isolated from postmenopausal women given short term estrogen treatment (Tables 3 and 4) [Ulrich et al. (2014) Human Reproduction 29;1895-1905]. This group of patients are generally in an age group that might be seeking a cell based therapy using their own cells.

[0144] Serotyping and flow cytometry identified increased W5C5 ⁺ marker expression in eMSC cultured with A83-01 (Figure 1) indicating increased MSC population in the cultures and less spontaneous differentiation to fibroblasts in passage 6 cultures.

[0145] There are significantly fewer senescent cells in passage 6 W5C5 ⁺ eMSC cultures treated with A83-01 (Figure 2). This is analyzed using autofluorescence or cell cycle analysis by flow cytomertric method using propidium iodide stained cells and by Annexin V (Figure 9).

[0146] A83-01 treated eMSCs were more clonogenic (Figures 3 and 7) indicating less differentiation of the cells to fibroblasts (Figures 3 and 7).

[0147] Other laboratory analysis demonstrated that the A83-01 treated passage 6 eMSC retain their MSC properties by differentiating into adipocytes, smooth muscle cells, chondrocytes and osteoblasts, qualitatively greater than untreated passage 6 cultures (Figure 7). Optionally, the cells are then tested for clonogenicity. EXAMPLE 3

Generation of eMSC from endometrial biopsy

[0148] Three postmenopausal women were selected as follows and given codes (Table 3):

Table 3

Women in trial

Code Description

121.12 50 year old; cells analyzed at Passage 5

11.13 65 year old; cells analyzed at Passage 4

44.12 65 year old; cells analyzed at Passage 4

[0149] The women were given oestradiol valerate (product name Progynova), a precursor of oestradiol for a few weeks to increase the thickness of endometrium in order to provide sufficient tissue to harvest. The cells were then cultured in the presence or absence of Ι μΜ A83-01 as described in the Materials and Methods and in Examples 1 and 2. Following culture, markers CD146, CD90, W5C5 and CD140b were used for flow cytometric analysis.

[0150] Table 4 provides actual values in A83-01 untreated versus A83-01 treated cells. The values are the percentage of positive cells expressing individual markers. These data are also represented graphically in Figure 4. Table 4

Flow cytometry data of placental MSC

[0151] The data show that W5C5 eMSCs are significantly elevated compared to other biomarkers. Pictures of A83-01 pretreated postmenopausal eMSC seeded on gelatine/polyamide mesh cultures in the serum free medium are shown in Figure 10. The gelatine/polyamide mesh was coated with fibronectin for at least 30 minutes before seeding the cells. The significance of the pictures of eMSC pre-treated with A83-01 is to show that the cells can attach to fibronectin pre-coated polyamide/gelatine mesh which is the scaffold used as a tissue engineer construct for treating pelvic organ prolapse.

EXAMPLE 4

A83-01 dose dependently promotes eMSC prolifertion

[0152] SUSD2+ cells diminished in number with increasing passage (Ulrich et al. (2014) Cell Transplant 27:2201-2214), despite their high purity on initial seeding following SUSD2 magnetic bead sorting (Masuda et al. (2012) Cell Transplant 27:2201-2214). To examine the effect of the TGF-βΡν inhibitor, A83-01 on eMSC proliferation, passage 3 eMSC were cultured in SFM in 5% v/v 0 ₂ with A83-01 concentrations ranging from 0- 10μΜ for 7 days. Control medium was supplemented with vehicle. The MTS cell viability end-point assay was used to assess the effect of A83-01 on eMSC growth. As shown in Figure 5A, A83-01 dose dependently increased the number of viable cells with maximal effect at Ι μΜ concentration (p<0.05) by day 7. This result indicates that TGF-βΡν signaling regulates cell growth in a negative manner. All further experiments were carried out with P6 eMSC using A83-01 at ΙμΜ concentration. A83-01 blocks the phosphorylation of SMAD2/3 (Figure 5B) thus indicating its activity via SMAD pathway.

EXAMPLE 5

Surface phenotype Expression of A83-01 treated eMSC

[0153] The phenotype of A83-01 treated eMSC was examined. Single-color flow cytometry analysis of five MSC markers showed that untreated P6 eMSC cultures comprised 69%-SUSD2+, 53%-CD140b+, \%- CD146+, 95%-CD90+ and 0%-CD271+ positive cells (Figure 6A), suggesting loss of the MSC phenotype and spontaneous differentiation. It is noteworthy that CD90, the representative ISCT MSC marker 4 did not change over the period of culture, and that P6 eMSC did not express CD271 (bmMSC marker) whether incubated with or without A83-01. There was a significant increase in the percentage of SUSD2+ (94%, p<0.05) and CD140b+ (83%, p<0.05) cells when the P6 cells were treated with ΙμΜ A83-01 for at least 7 days. There was also an increase in the mean fluorescence intensity for the SUSD2 marker on the SUSD2+ cells (Figure 6B, C), indicating an increase in the number of SUSD2 molecules per cell (p<0.05). This was also evident by immunofluorescence (Figure 6D). However, A83-01 had no effect on the CD 146 expression, which was downregulated during culture expansion (Figure 6 A).

EXAMPLE 6

A83-01 maintained functional properties of late passage eMSC

[0154] It was investigated whether inhibition of the TGF-βΚ signaling pathway in late passage eMSC cultures altered their MSC functional properties. The cloning efficiency of P6 A83-01 pre-treated eMSC was significantly greater (p<0.05) than control cells (Figure 7A, B). The A83-01 pre-treated eMSC also generated larger colonies than untreated eMSC. Next, it was tested whether A83-01 pre-treated eMSC retained MSC multilineage differentiation capacity. P6 eMSC pre-treated with or without Ι μΜ A83-01 were cultured in differentiation induction media or 1% v/v FCS growth medium (control) to assess differentiation into adipocytes, osteocytes and chondrocytes (Figure 7C). A83-01 pre- treated and untreated cells showed similar phenotype changes in adiopogenic medium with similar numbers of cells containing Oil Red O stained lipid droplets. Similarly for osteogenic differentiation, the amount of Alizarin Red stained calcium deposits was comparable. In contrast, chondrogenic differentiation of the cell pellets was greater for the A83-01 pre-treated cells, as a strong Alcian Blue stained matrix in a cartilage-like organoid was observed, while the untreated eMSC pellet disintegrated easily with little evidence of chondroitin sulphate matrix deposition (Figure 7C). There was no differentiation in non- induction medium.

EXAMPLE 7

A83-01 effect on pluripotency and stem cell gene expression

[0155] The expression of pluripotency and MSC genes suggested to have a role in maintaining MSC self-renewal was examined. Quantitative RT-PCR of A83-01 treated and untreated cells failed to detect pluripotency genes OCT4, SOX2 and NANOG in either group although they were demonstrated in the human iPS cells positive control. Consistent with the flow cytometry data, SUSD2 was downregulated in the control group and highly expressed in the A83-01 treated cells (p=0.0078). The expression of CD146 and MMP3 genes was reduced in A83-01 treated cells (p=0.04 and p=0.0078, respectively). There was also an increase in the expression of AOC3 (p=0.031), a marker of SUSD2+ cells (Murakami et al. (2014) Endocrinology 755:4542-4553) and FRZB (p=0.015), a gene encoding for a Wnt ligand binding protein, in A83-01 treated group while no difference was observed in the expression of NOTCH2, NOTCH3 and DKK genes.

EXAMPLE 8

A83-01 blocks apoptosis and senescence in P6 eMSC

[0156] To identify the mechanism of action of A83-01 in increasing eMSC proliferation (Figure 5), cell cycle analysis (Figure 9A) was undertaken with propidium iodide to label DNA. Figure 9A and B shows that A83-01 treatment increased the proportion of cells in G2/M phase (p<0.05) indicative of an increased rate of cell division. There were also significantly fewer A83-01 treated cells in the sub G1/G0 phase of the cycle compared with control cells indicating fewer apoptotic cells with fragmented DNA content in the A83-01 treated cells (Figures 9A, B). The apoptotic cells were quantitated using Annexin V flow cytometry to assess early phase apoptosis. The inclusion of PI was to detect late apoptotic and necrotic cells. Culture expanded P6 eMSC significantly reduced the percentage of live cells and increased the proportion of apoptotic cells as shown by the increased binding of Annexin V to exposed phosphatidylserine (PS) on the outer leaflet of the plasma membrane (Figure 9C, D). The increased PI staining in the untreated eMSC also indicated increased necrotic cells. These changes were mitigated by pre-treatment with Ι μΜ A83-01 (p<0.05) [Figure 9C, D]. To further understand the action of A83-01, unstained P6 eMSC from treated and control groups was measured by UV light to quantify autofluorescence, as a measure of senescence. As shown in Figure 9E, control P6 eMSC were significantly more autofluorescent than the A83-01 treated P6 eMSC (p=0.001). Therefore, we measured senile associated β-Gal (SAP-Gal) activity by incubating cells with X-Gal. As shown in Figure 9F, A83-01 treated P6 eMSC showed little β-Gal staining whereas the untreated control eMSC displayed blue staining indicative of senescent cells. Furthermore the A83 -01 -treated cells were smaller and more numerous, in agreement with the findings above. EXAMPLE 9

Role ofA83-01

[0157] The main findings from these Examples are that A83-01, a small molecule TGF-PR inhibitor, prevented the typical loss of undifferentiated MSC during culture expansion. Specifically, we showed that A83-01 treatment prevented loss of SUSD2+ eMSC in late passage cultures by promoting the mitosis and proliferation of P6 SUSD2+eMSC and by preventing their apoptosis and senescence. A83-01 treated SUSD2+ cells in late passage culture retained their MSC properties, showing greater clonogenicity then untreated cells. In particular, there were greater numbers of large colonies which undergo serial cloning and are more proliferative than those initiating small colonies (Gargett et al. (2009) supra). Their multilineage differentiation capacity was maintained as well as expression of key MSC genes; SUSD2, AOC3 (Murakami et al. (2014) supra) and FRZB (Spitzer et al. (2012) Biol. Reprod. 5(5: 1-16). It was further identified that the signaling pathway blocked by A83-01 was TGF-βΡν mediated apoptosis via SMAD2/3 phosphorylation. Since multiple pathways work together in regulating MSC fate and TGF-βΡν pathway signaling is pleiotropic, targeting this pathway provides an ideal method for maintaining undifferentiated MSC in cell production protocols for clinical use.

[0158] Culture expansion of eMSC lead to a loss of clonogenicity and expression of SUSD2, CD 140b and CD 146 surface markers while CD90, a standard ISCT MSC marker does not change. This was also shown by loss of SUSD2+-expressing eMSC when induced by TGF-βΙ to differentiate into smooth muscle cells (Su et al. (2014) Acta biomateriala 70:5012-5020). These properties support the concept that eMSC spontaneously differentiate into fibroblasts lacking the expression of perivascular markers, clonogenicity, and osteogenic and chondrogenic differentiation capacity. Further molecular characterization of differentiation at the transcript and protein levels is feasible with qRT- PCR and western blotting respectively. TGF-PR signaling is necessary for chondrogenic differentiation (Ng et al. (2008) Blood 772:295-307). However, while the experimental medium for eMSC culture expansion contained A83-01, the chondrogenic differentiation medium contained TGF-βΙ without A83-01 to assess chondrogenic differentiation potential of A83-01 treated and untreated cells. One advantage of using small molecules rather than siRNA to modulate receptor activity is that their inhibitory effect is reversed as soon as the small molecules are removed. It is shown here that chondrogenic differentiation was enhanced in A83-01 pre-treated cells. A83-01 not only increased the expression of SUSD2 proteins but also CD140b. In contrast, CD146 gene expression was greater in the untreated group but did not appear to be translated into protein as it was not detected by flow cytometry. Furthermore, expression of CD146 on cultured MSC is regulated by factors such as hypoxia, growth factors, and metalloproteases (Rawdanowicz et al. (1994) J. Clin. Ednocrinol. Metab. 79:530-536; Boneberg et al. (2009) Microvasc. Res. 75:325-331). Culture expanded MSC are more autofluorescent than the primary cells indicating replicative senescence and loss of proliferative ability (Wagner et al. (2008) PloS one 3:e2213; Constantinescu et al. (2007) J. Neural transm. Suppl. : \7-2&) an effect observed in P6 control eMSC which was mitigated by A83-01 treatment.

[0159] Endometrial MSC are an attractive source of cells for tissue engineering and cell- based therapies because they can be harvested with minimal discomfort to patients, have standard MSC properties in vitro and in vivo and they can be cultured in serum free conditions, offering a readily available cell source for allogeneic as well as autologous use. The necessity to expand MSC for clinical use due to their rarity and their subsequent spontaneous differentiation limits the full potential of eMSC and MSC in general.

[0160] Hence, TGF-PR signaling is involved in eMSC cell fate in vitro. A83-01, a small molecule TGF-PR inhibitor, enhanced the expression of SUSD2 and CD 140b, maintaining eMSC clonogenic phenotype during prolonged culturing, promoting cell proliferation and preventing apoptosis and senescence. Small molecules such as A83-01 that promote eMSC proliferation in the undifferentiated state provide an approach for the expansion of undifferentiated MSC for use in tissue engineering and cell-based therapies. EXAMPLE 10

Generation of Placental MSC

[0161] Placental cells were obtained and prepared as described in the Materials and Methods and Examples 1 and 2. The cells were immuno-selected with W5C5 antibody at passage 1 and cultured in serum free medium until passage 6 when they were grouped into untreated and treated with Ι μΜ A83-01 and subjected to flow cytometry generating a percentage of cells expressing the individual markers CD146, CD90, W5C5 and CD140b (percent positive cells). The percentage range of W5C5 ⁺ cells was large in untreated compared to treated cells (Table 5; Figure 11). This indicates that A83-01 treatment served as a significant quality management system to control the expanded cell population.

Table 5

Flow cytometry data of eMSC from postmenopausal women

(% of positive cells)

[0162] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure contemplates all such variations and modifications. The disclosure also enables all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features or compositions or compounds. BIBLIOGRAPHY

Aivarez et al. (2012) J. Mol. Endocrinol 49(2) R&9-\ 11 Battula et al. (2009) Haematol ogica 94: 173-184 Boneberg et al. (2009) Microvasc. Res. 75:325-33 1 Buhring et al. (2001) Ann. N.Y. Acad. Sci. 1106:262-211 Chan et al. (2004) Biol. Reprod. 70(^: 1738-1750 Constantinescu et al. (2007) J. Neural transm. Suppl. : 17-28 de la Garza-Rodea et al. (201 1) Cell Transplant 20:271-231 Eckfeldt et a/. (2005) Nat. Rev. Mol. Cell Biol. 6(9) :126-131 Friedenstein et al. (1976) Exp. Hematol. 4(5):261-214 Gargett et al. (2009) Biol. Reprod. 80(6): 1136-1 145 Gargett et a/. (2010) Mol. Hum. Reprod. 7<5(77j:818-834

Greene and Wuts (1999), Protective Groups in Organic Synthesis, 3 ^rd Ed., Jon Wiley & Sons, New York, N.Y.

Gronthos et a/. (2003) J. Cell Sci. 776: 1827-1835

Kim and Vacanti (1999) Semin Pediatr Surg. 8: 119 Masuda et al. (2012) Cell Transplant 27:2201-2214

Murakami et al. (2014) Endocrinology 755:4542-4553

Ng et al. (2008) Blood 112:295-301

Prokhorova et al. (2009) Stem Cells Dev. 18(1) ΑΊ -54

Rajaraman et al. (2013) Tissue Engineering 79(7^ :80-92

Rawdanowicz et al. (1994) J. Clin. Ednocrinol. Metab. 79:530-536

Spitzer et a/. (2012) Biol. Reprod. 5(5: 1-16

Su et al. (2014) Acta biomateriala 70:5012-5020

Szpalski et al. (2012) Tissue Eng. Part B Rev. 75:258-269

Tuan et al. (2003) Arthritis Res. Ther. 5:32-45

Ulrich et «/. (2013) Expert Opin. Biol. Ther. 73(70j: 1387-1400

Ulrich et a/. (2014) Human Reproduction 29: 1895-1905

Ulrich et al. (2014) Ce/7 Transplant 27:2201-2214

Vaananen (2005) ,4m. ed. 370:469-479

Wagner et al. (2008) PloS one 3:e2213

Xue et al. (2012) Biomaterials 33:5832-5840