The following specification particularly describes the invention and the manner in which it is to be performed:

Field of the invention:

The present invention relates to a set of universal primers useful for detection and identification of fungal pathogens.

The pathogen detection system developed in this study will be useful in distinguishing fungal pathogens, detecting fungal pathogens present in orchards even during asymptotic stage, specifying the need base spray of fungicides and also predicting the estimates of crop productions as severe yield losses are caused by various fungal diseases Furthermore, it will be useful for quarantine departments for routine monitoring of samples being imported and exported.

Background and Prior art of the invention:

There are several methodologies available to detect fungal pathogens of plants and animals. Most of these methodologies had explored conservation and variability of fungal rDNA sequences for detecting the pathogens. The rDNA is comprised of coding 18S, 5.8S and 28S RNAs; interspersed with two non-coding ITS sequences namely ITS1 and ITS2 (White et al. 1990; PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., San Diego Pages 315-322). Specific primer pairs targeting ITS regions had been used to detect a particular pathogen and such primers in combination with group specific universal primers had been used to distinguish a limited group of pathogens. Reference may be made to the US patent 6080543 which has exploited this variability in the ITS region to distinguish Eutypella vitis, Eutypa lata, Phomopsis viticola and Diplodia gossypina fungal pathogens of grape plant. The specific primers had been used to distinguish presence of Pyrenophora tritici-repentis and Pyrenophora teres (US Patent 6358680) and Monilinia laxa and Monilinia fructicola (US Patent 6221595). US Patent application 20030099975 describes a PCR assay for detection of Alternaria spp., Cladosporium carpophilum and Colletotrichum acutatum wherein specific primers are used to distinguish these pathogens. The detection of a pathogen by use of specific primer had also been explored to detect contamination in food products. For example, WTPO Patent application Wo/2000/046397 describes a technique to specifically detect Alternaria in food products. The US Patent 6858387 describes use of combination of species specific primers and universal primers to detect several fungal species. In US patent application 20080227108, the inventors distinguish different species of Aspergillus present in the sample by calculating the sequence variability in the PCR amplified region of the ITS region. The drawbacks of the above mentioned techniques are that they are dependent on pathogen specific primers for identification of pathogens. Several studies had focused on designing pathogen specific probes and explored them in hybridization and microarray based assays to detect and distinguish various fungal pathogens present in the sample. Reference may be made to the following patents US Patent 6372430, EP0422872A2, EP0422873B1, WO/1998/055649A1, WO/1996/021741A1, US Patent 5519127, US Patent 5707802, US Patent 5426027 etc. in this regard. Sholberg et al. 2005 {Plant Dis. 89:1143-1150) have developed a DNA macroarray wherein oligonucleotides corresponding to the spacer regions of ITS sequences of the fungal pathogens Penicillium expansum, Botrytis cinerea, Podosphaera leucotricha, Venturia inaequalis and Erwinia amylovora (a bacterial pathogen) of apple were fabricated on a nylon membrane. The authors have successfully detected these pathogens and differentiated them from closely related species. Although the hybridization and microarray based techniques allow user to detect several pathogens at a time, however the major drawbacks are that these techniques are technically sensitive, time consuming, costly and dependent on the availability of specific probe for each of the pathogen to be detected.

Beside these methodologies, the robustness of PCR-RFLP had also been explored in various studies to distinguish fungal pathogens. ITS specific PCR followed by RFLP analysis had been shown to accurately distinguish the Colletotrichem gloeosporioides from C. capsici (Tapia-Tussell et al. 2008; Mol Biotechnol. 40:293-8.) and Venturia nashicola from V. pirina (Le Cam et al. 2001; Phytopathology 91:900-904). RFLP analysis of PCR products obtained using combination of ITS specific universal primer and basiodiomycetes specific primer could differentiate basiodiomycetes causing spruce wood white rot and brown rot diseases (Jasalavich et al. 2000; Applied and environmental microbiology. 4725-4734). PCR-RFLP analysis could distinguish Eutypa lata (vascular cancer pathogen) from the grapevine wood trunk pathogens (Phomopsis viticola, Botryodiplodia sp., Phaeoacremonium aleophilum and Phaeomoniella chlamydospora) and several other Eutypa sp (Rolshausen et al. 2004; Plant Dis. 88:925-929). The technique had also been used to distinguish Botrytis species causing neck rot disease of onion (Nielsen et al. 2002; Plant Dis. 86:682-686), differentiate some Eucalyptus foliar diseases causing Mycoshaerella species (Kularatne et al. 2004; Mycol. Res. 108:1476-1493) identify variations (both inter and intra species) in Eucalyptus associated ectomycorrhizal fungi (Glen et al. 2001; Mycological re.searcA.105:843-858) and also detect six medically important Candida species (Mirhendi et al. 2006;. J. Med. Mycol. 47:225-229). Reference may be made to US patent 5780271 which describe use of PCR-RFLP to distinguish phytophthora species. The 600 bp PCR amplicon indicates the presence of phytophthora species in the sample which upon digestion with HaeUI restriction enzyme generates polymorphism to distinguish the P. cactorum from P. infestans. Using the fungal ITS specific universal primer along with the SBFS (Apple sooty blotch and Flyspeck complex) primers, Duttweiler et al. 2008 ( Plant Dis. 92: 794-799) could obtain PCR amplicons which upon digestion with HaeUI restriction enzyme could differentiate the SBSF associated pathogenic fungi upto genus level. Similarly, PCR amplification of ITS region followed by RFLP analysis could distinguish Penicillium species which causes blue mold disease of apple (Pianzzola et al. 2004; Plant Dis. 88:23-28). The major existing drawback of the available PCR-RFLP based techniques is that they are mostly detecting limited number/groups of pathogens.

Patents References:

EP0422872A2 Nucleic acid probes and Apr,2006 Weisburg et al.

methods for detecting fungi

EP0422873B1 Nucleic acid probes and May,2000 Weisburg et al.

methods for detecting

Cryptococcus neoformans

US 6858387 Nucleic acid probes and Feb,2005 Smith et al.

methods for detecting

clinically important fungal

pathogens US 5426027 Nucleic acid probes and June, 1995 Lott

methods for detecting Candida

DNA cells in blood

US 5519127 Nucleic acid probes for the May, 1996 Shah et al.

detection of Pneumocystis

Carnii

US 5707802 Nucleic acid probes for the detec Jan, 1998 Sandhu et a/.

and identification of fungi

US 5780271 PCR assays for Phytophthora Jul, 1998 Ristaino

species

US 6080543 Detection of fungal pathogens Jun,2000 Engel et al. US 6221595 Detection of Monilinia spp. Apr,2001 Beck et al.

Using polymerase chain

reaction

US 6358680 Detection of wheat and barley Mar,2002 Beck et al.

fungal pathogens using the

PCR

US 6372430 Nucleic acids for detecting Apr,2002 Morrison et al.

Aspergillus species and other

filamentous fungi

US application Detection of fungal pathogens May, 2003 Barnett et al. 20030099975 using the polymerase chain

reaction

US application Molecular identification of

20080227108 Aspergillus species

WO/1996/021741A1 Nucleic acid probes for the Jul, 1996 Sandh et al.

detection and identification of

fungi

WO/1998/055649A1 Nucleic acid probes for the Dec, 1998 Sandhu et al.

detection and identification of

fungi

WO/2000/046397 Nucleic acid based assay and Aug,2000 Kashi et al. kit for the detection of

alternaria contamination in

food products

Objects of the invention:

The main object of the patent invention is to design and provide a set of universal primers which amplifies ITS region of fungal rDNA sequences useful for detecting fungal pathogens.

Another object of the present invention is to provide a method for detection and identification of fungal pathogen comprising isolation of DNA from the fungal mycelium(s) and/or infected tissue(s), PCR amplification of their ITS2 regions using designed universal primer pairs, suitable restriction digestion enzyme, resolution of polymorphic bands by gel electrophoresis and analysis of obtained RFLP bands by PathDec Tool which compares the obtained RFLP banding pattern with the prestored pathogen specific banding patterns obtained through insilico analysis to detect and distinguish various fungal pathogens. Novelty and inventive step(s) of the present invention with respect to the prior art:

Various PCR based methodologies had been devised to detect various fungal pathogens of the plant and the animals. Most of these techniques have been developed to detect a particular pathogen or a limited number of pathogens at a time. Specific primer pairs targeting the ITS regions of pathogens had been used to detect a particular pathogen and such primers in combination with group specific universal primers had been used to distinguish a small number of pathogens. Our innovation of designing ITRRFl and ITRRRl universal primers, PCR amplification using these primers, restriction digestion of the PCR products with HinFl enzyme, visualization of gel, and analysis of the restriction fragments through PathDec, PERL based Tool leads to identification and detection of most of fungal pathogens, even before visual appearance of disease symptoms in less than 6 hours time. The PathDec assists users to analyze complex RFLP banding pattern even without use of specific image processing Tool instrument to identify and differentiate fungal pathogens present in the sample. Brief description of figures:-

Figure 1 represents PCR amplification using ITRRFl and ITRRRl universal fungal primers. Lane 1: Alternaria alternata; Lane 2: Venturia inaequalis; Lane 3: Glomerrella cingulata; Lane 4 : Colletotrichum acutatum; Lane 5: Botrytis cinerea. Lane 6: Endophytic fungus; Lane 7: lOObp ladder.

Figure 2 represents PCR-RFLP analysis with HinFl restriction enzyme. Lane I:20bp ladder; Lane 2: Alternaria alternata; Lane 3: Venturia inaequalis; Lane 4: Glomerella cingulata; Lane 5: Colletotrium acutatum Lane 6: Botrytis cinerea.

Figure 3 represents PCR-RFLP analysis to distinguish mixture of three different fungal pathogens of apple. Lane 1: 20bp ladder; Lane 2: Mixture of Alternaria alternata, Venturia inaequalis, Glomerella leaf spot pathogen

Figure 4 represents PCR-RFLP analysis to distinguish mixture of four different fungal pathogens of apple. Lane 1: 20bp ladder; Lane 2: Mixture of Alternaria alternata, Venturia inaequalis, Glomerella leaf spot pathogen and Botrytis cinerea.

Figure 5 represents PCR-RFLP analysis of Alternaria alternata infected leaf during asymptotic stage. Lane 1: lOObp ladder; Lane 2: Mock infected apple leaf; Lane 3: Alternaria alternata infected leaf.

Figure 6 Flowchart of PathDec VI.O

Table 1 represents Insilico restriction analysis of ITRRFl & ITRRRl primer amplifiable rDNA sequences of apple fungal pathogens with HinFl enzyme.

Table 2 represents Fungal pathogens used for validating the methodology developed in this study.

Summary of the invention:

Accordingly the present invention provides a set of universal primers and a method for detection and identification of fungal pathogens. The method comprises DNA isolation either from fungal mycelium or symptomatic/asymptotic tissues, PCR amplification of fungal rDNA by universal fungal specific ITRRFl and ITRRRl primers, restriction digestion of PCR products by suitable enzyme, resolution of obtained bands by gel electrophoresis, visualization of the gel and interpretation of results by PathDec Tool but not limited to it for revealing the presence/absence of the pathogens in sample and provide their percentage probability. In an embodiment of the present invention a set of universal primer having SeqID No.1 and SeqID No.2 useful for detection of fungal pathogen.

In another embodiment of the present invention a set of primer having the following characteristics:

i. length of the said forward primer is 21 mer and for the reverse primer is 23 mer, ii. G+C content is in range of 43-48%,

iii. Tm is in range of 53°C,

iv. Annealing temperature is preferably in the range of 50-60°C, optimum at 54°C.

In another embodiment of the present invention a set of primer wherein their length varies by addition or deletion of 5 nucleotides both in the forward and reverse primer in either 5 ' or 3' direction of the primer pair.

In another embodiment of the present invention a set of primers useful for identifying unculturable fungi.

In yet another embodiment of the present invention a method for identifying fungal pathogen comprising steps of:

a. designing universal primers having SeqID No.1 and SeqID No.2 b. PCR amplification of fungal rDNA by using primers obtained in step a,

c. restriction digestion of PCR products obtained in step b using restriction enzymes selected from the group comprising of Rsal, EcoRl, Hind , HaeU, Haelll, HinFl, Phol, Mspl, Taql etc to generate Restriction Fragment Length Polymorphism,

d.resolution of bands obtained in step c by gel electrophoresis, e. feeding the PCR-RFLP band information obtained in step d to

PathDec tool,

f. comparing the input band information obtained in step e with the insilico obtained banding pattern for each of the pathogen using the algorithm wherein the database has a standard banding pattern stored for fungal pathogens

g. identifying the fungal pathogen present in the sample

In yet another embodiment of the present invention a method for identifying fungal pathogens of apple. In yet another embodiment of the present invention a kit for detecting fungal pathogens wherein the kit comprises of:

a. Primer set having Seq. ED 1 and 2,

b. Suitable reagents for PCR,

c. Suitable restriction enzyme,

d. PathDec tool,

e. Instruction manual.

Detailed description of the invention:

Various PCR based methodologies had been devised to detect various fungal pathogens of plants and animals. Most of these techniques have been developed to detect a particular pathogen or a limited number of pathogens. Our innovation of designing universal primers to PCR amplify the highly polymorphic region of the fungal rDNA sequences, restriction digestion of PCR products with HinFl enzyme and analysis of the restriction fragments through PathDec tool which compares the obtained RFLP banding pattern with the prestored pathogen specific banding patterns obtained through insilico analysis leads identification and detection of almost all the fungal pathogens of apple in less than 6 hours even before the visual appearance of the disease symptoms. As the primers designed in this study are universal in nature, hence it is expected that this methodology would be able to detect and distinguish fungal pathogens of other plant/animal species. However, the suitable restriction enzyme has to be identified which could generate polymorphisms and the PathDec database need to be updated for the pathogens of other plant/animals. The various process steps involved in the present innovation are as follows: DNA isolation: The DNA from Apple tissues and fungal mycelium were isolated by following commonly used CTAB method (Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19: 11-15) or using any commercial DNA isolation kit. Designing of Universal PCR primers: All available rDNA sequences of fungal pathogens of apple were downloaded from NCBI (http://www.ncbi.nlm.nih.gov). Multiple sequence alignment was performed using CLUSTALW2 (http://www.ebi.ac.uk/Tools/cliistalw2/index.html) to find conserved regions in these sequences. One conserved stretch in 5.8S rDNA region was used for designing forward primer (ITRRF1; 5' CGATGAAGAACGCAGCGAAAT) while the reverse primer (ITRRR1: TATGCTTAAGTTCAGCGGGTATC) was designed from the second conserved stretch in such a way that the primer binding sites flank ITS2 region of the fungal rDNA sequences. Insilico restriction digestion analysis to identify polymorphism amongst apple fungal pathogens: The PCR amplifiable regions of rDNA sequences were demarcated in the downloaded rDNA sequences of apple fungal pathogens. The sequences of these regions were subjected to insilico restriction digestion analysis using online tool; NEB cutter V2.0 (http://tools.neb.com/NEBcutter2). Custom digestion was performed on each of these sequences using several common restriction enzymes (Rsal, EcoRI, HindlU, HaeU, HinFl, Phol, Mspl, Taql) (Table 1). Out of these, HinFl digestion could reveal polymorphism in the banding pattern for 13 out of 19 apple fungal pathogens whose sequences were available in NCBI (Table 1). However, due to highly conserved nature of the rDNA sequences, the Alternaria alternata, Botryosphaeria berengeriana and Marssonina mali (having similar RFLP pattern: 150, 116, 53, 8) and also Bottyotinia fiickeliana, Monilinia fructicola and Sclerotinia sclerotiorum (having similar RFLP pattern: 165, 89, 53, 8) could not be distinguished by the methodology developed in this innovation.

In order to verify that strain specific variations does not alter RFLP pattern of a particular pathogen, at least 4-5 rDNA sequences corresponding to different strains of each of these pathogens were downloaded from NCBI, PCR amplifiable regions were demarcated and were subjected to insilico restriction digestion analysis. The analysis revealed that the banding patterns are same in all the strains of particular pathogens and no strain specific variations was detected. PCR amplification by designed universal primers: The DNA from cultures of four different fungal pathogens of apple (Table 2) obtained from MTCC, Chandigarh (India) isolated following methodology described above was subjected to PCR amplifications using the ITRRFl and ITRRRl primers. 50 μΐ of PCR reaction was set by mixing 5 μΐ of 10X PCR buffer, 5 μΐ of 10X MgCl ₂ , 4 μΐ of dNTP mix, 0.4 μΐ of Taq (5υ/μ1) and 1 μΐ (3pm) each of ITRRFl and ITRRRl primers with final volume adjusted by addition of autoclaved deionized water. After initial denaturation at 95°C for 5mins, the sample was subjected to 35 thermal cycles of 94°C for 1 min, 54°C for 30 sec and 72°C for 30 sec. The final extension was performed at 72°C for 10 min. Figure 1, depicts that approximately 320bp of PCR amplicons are produced in all these cases. RFLP analysis of the PCR products: 1 μg of the PCR products obtained from different apple fungal pathogens as described above were subjected to RFLP analysis by digestion with 1 μΐ of fast digest HinFl (Fermentas International Inc, Ontario, Canada) at 37°C for 15 min as per the manufacturer's instructions. The digested bands were resolved by gel electrophoresis on 3% agarose gel by running at 60V for 90 mins and imaged by Gel Documentation system (Figure 2). The banding pattern was found to be similar to that obtained through insilico restriction analysis. Furthermore, we accessed whether the present innovation could distinguish various pathogens if present together as a mixture. In order to analyze this, mixture of genomic DNA of three and four different pathogens in equal proportions was made and subjected to PCR-RFLP analysis as described above. As shown in Figure 3 and Figure 4, PCR-RFLP could distinguish all these pathogens. Furthermore to check the efficiency of this innovation in detecting pathogens even before appearance of visual symptoms, apple leaves infected with 10 μΐ of Alternaria alternata conidia were monitored following the methodology presented in this innovation. As shown in Figure 5, the methodology could detect presence of pathogen in the sample having no visual symptom. Interpretation of the RFLP banding pattern by PathDec Tool: The RFLP patterns can be interpreted by using PERL based Tool, PathDec to detect and distinguish various pathogens present in the sample. The PathDec Tool could successfully distinguish the mixture of apple fungal pathogens once the obtained PCR-RFLP band sizes (as shown in Figure 4) were provided as input to the Tool.

Analysis of RFLP bands to distinguish the pathogens is tedious especially when a number of pathogens are present in the sample. A PERL based software PathDec had been developed in this innovation to interpret the PCR-RFLP banding patterns and to assist users in identifying the fungal pathogens present in the sample. Overall the detection system developed in this study had been successfully validated to distinguish several apple pathogens individually and in mixtures. Flow chart

Input the PCR-RFLP band information

The algorithm compares the input band information with the insilico obtained banding pattern fo each of the pathogen

Provides the name of the pathogen along with percentage probability of their presence in the sample.

The following examples are given by way of illustration and therefore should not be construed to limit the scope of present invention

EXAMPLE- 1

Culturing of fungal pathogens used in this study: The following are the growth condition used for culturing fungal pathogens of apple.

Alternaria alternata

Growth medium -PDA (Potato Dextrose Agar; Himedia); Growth condition- Aerobic Temperature: 28°C; Incubation time : 5 days

Glomerella cingulata

Growth medium -PDA (Potato Dextrose Agar; Himedia); Growth condition- Aerobic Temperature: 25°C; Incubation time : 5 days

Colletotrichum acutatum

Growth medium -PDA (Potato Dextrose Agar; Himedia); Growth condition- Aerobic Temperature: 25°C; Incubation time : 5 days

Botrytis cinerea

Growth medium -PDA (Potato Dextrose Agar; Himedia); Growth condition- Aerobic Temperature: 25°C; Incubation time : 5 days Venturia inaequalis

Growth medium -M-98 (malt extract lOgm/L; peptone 3gm/L and agar 15gm/L;

Himedia); Growth condition- Aerobic; Temperature: 20°C; Incubation time : 14 days EXAMPLE-2

Designing of universal fungal specific primers: The rDNA sequences of various apple fungal pathogens were downloaded from NCBI (http://www.ncbi.nlm.nih.gov). In order to fetch a conserved region in these sequences, a multiple sequence alignment using CLUSTALW2 (http://www.ebi.ac.uk/Tools/clustalw2/index.html) was performed. Both forward (ITRRF1: 5' CGATGAAGAACGCAGCGAAAT) and reverse primers (ITRRRI: TATGCTTAAGTTCAGCGGGTATC) were designed from the conserved regions which flanks the ITS2 region of the fungal rDNA sequences.

EXAMPLE-3

Analyzing the universality of the designed primers: In order to find whether the primers designed in this study could amplify the rDNA sequences of other fungi, we downloaded the rDNA sequences of various randomly selected fungi [Debaryomyces hansenii strain W4682 (GQ913348); Fungal endophyte isolate 5724 (DQ979775); Cladosporium cladosporioides strain STE-U (AY251074); Cladosporium cladosporioides isolate GG6(EF 104249); Athelia bombacina isolate AFTOL-ID 347(DQ449026); Chaetomium globosum isolate B221(GQ365152); Microsphaeropsis sp. HLS303(FJ770074 ; Microsphaeropsis arundinis strain PMBMDF049(FJ798603); Dothideomycetes sp. 11313(GQ153229); Aspergillus flavus strain ATCC 11497(GU256760) ; Aspergillus terreus strain ATCC 20542(GU256759) Aspergillus niger strain ATCC 64973(GU256750); Aspergillus versicolor strain ATCC 26644(GU256744) ; Debaryomyces hansenii strain W4682(GQ913348) ; Neurospora crassa strain ATCC MYA-4619(GU327635) ; Neurospora discreta strain ATCC MYA-4616(GU327632); Neurospora tetrasperma strain ATCC MYA- 4615(GU327631); Neurospora sitophila(GU 192459); Neurospora crassa strain ATCC YA-4614(GU327630); Penicillium sp. GG-2009a (GQ418173,); Magnaporthe grisea strain ATCC MYA-4617 (GU327633); Botryosphaeria obtusa strain SDAU07159 (FJ171717); Penicillium expansum strain NRRL 6069 (DQ339562); Cladosporium herbarum isolate wb317 (AF455479); Schizothyrium pomi (FJ425206); Mycosphaerella pyri strain CBS 100.86(EU167606); Venturia pirina strain ICMP (AF333439); Podosphaera leucotricha voucher BPI 878262 (EU148597)] and look for the presence of the both forward and reverse primer binding site. The primer binding sites were present in all these sequences suggesting the fungal specific universal nature of these primers.

EXAMPLE-4

Insilico approach to distinguish various fungal pathogens: All available rDNA sequences of fungal pathogens of apple were downloaded from NCBI (http://www.ncbi.nlm.nih.gov). Insilico restriction digestion analysis using online tool; NEB cutter V2.0 (http://tools.neb.corn NEBcutter2 ^' ) was explored to study polymorphism amongst apple fungal pathogens. The PCR amplifiable regions of rDNA sequences were demarcated in the downloaded rDNA sequences of apple fungal pathogens and were subjected to custom digestion analysis using several common restriction enzymes (Rsal, EcoRl, HincflU, HaeU, HinFl, Phol, Mspl, Taql). The analysis revealed that HinFl digestion could provide length polymorphism in the PCR amplicons of different apple pathogens (Table 1).

Table 1 represents Insilico restriction analysis of ITRRFl & ITRRRl primer amplifiable rDNA sequences of apple fungal pathogens with HinFl enzyme

Pathogen Disease caused Accession Amplicon Fragments

ID Size

Alternaria Alternaria blotch 15209127 327bp 150,116,53,8 mali'

Armillaria Armillaria root rot 37785994 535bp 384,90,53,8 mellea

Armillaria Clitocybe root rot 37785996 528bp 125,109,92,89,53, tabescens 20,20,12,8

Botryosphaeria Black rot, frogeye 198448293 334bp 273,53,8 obtusa leafspot and canker

Botryosphaeria Apple ring rot and 189162092 328bp 151,116,53,8 berengeriana ¹ canker

Botryotinia Gay mold rot = dry 240129528 315bp 165,89,53,8 fuckeliana' eye rot, blossom- end rot

Butlerelfia Fisheye rot 4235188 361bp 171,129,53,8 eustacei

Colletotrium Glomerella leaf spot 154125153 328bp 187,80,53,8 gloeosporioides ²

Glomerella Glomerella leafspot 217314830 328bp 187,80,53,8 cingulata ²

Grovesinia Zonate leaf spot 2809016 282bp* 132,89,53,8 pyramidalis

Marssonina Marssonina blotch 169672298 288bp* 227,53,8 coronariae Marssonina Marssonina blotch 189162088 327bp 150,116,53,8 mali ¹

Monilinia American brown rot 212675236 313bp 163,89,53,8 fructicola'

Monilinia Monilia leaf blight 48927615 266bp* 205,53,8 mali

Peltaster Sooty blotch complex 218963779 336bp 275,53,8 fructicola

Sclerotinia Calyx-end rot 170280297 315bp 165,89,53,8 sclerotiorum'

Podospharea Powdery mildew 26417854 293bp* 189,53,43,8 leutricha

Venturia Apple scab 167460230 320bp 259,53,8 inaequalis

Xylaria mali Black root rot 8809739 323bp 134,128,53,8

: reverse primer binding sites are not present in the available sequences at

NCBI.

1 :. These pathogens could not be distinguished by this method

2 :. Both are anamorphic.

EXAMPLE-5

Isolation of genomic DNA from fungal mycelium and plant tissues: lOOmg of tissue (mycelium, leaves, fruits etc) were used for DNA isolation as per CTAB DNA isolation protocol (Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11-15).

EXA PLE-6

PCR-RFLP analysis to reveal polymorphisms amongst fungal pathogens on agarose gel: 50 μΐ of PCR reaction was set by mixing 5 μΐ of 10X PCR buffer, 5 μΐ of 10X MgCl ₂ , 4 μΐ of dNTP mix, 0.4μ1 of Taq (5υ/μ1) and Ιμΐ (3pm) each of ITRRF1 and ITRRRl primers with final volume adjusted by addition of autoclaved deionized water. After initial denaturation at 95°C for 5 mins, the sample was subjected to 35 thermal cycles of 94°C for 1 min, 54°C for 30 sec and 72°C for 30 sec. The final extension was performed at 72°C for 10 min. 1 μg of the PCR products (Figure 1) were subjected to RFLP analysis by digestion with Ιμΐ of fast digest HinFl (Fermentas International Inc, Ontario, Canada) at 37°C for 15 min as per the manufacturer's instructions. The digested bands were resolved by gel electrophoresis on 3% agarose gel by running at 60V for 90 mins and imaged by Gel Documentation system (Figure 2).

EXAMPLE-7

Distinguishing different fungal pathogens of apple cultured on laboratory medium: The PCR was performed on the isolated DNA of different fungal pathogens (Table 2) and RFLP analysis followed by agarose gel electrophoresis as per Example 5. The analysis revealed that the methodology could distinguish all these fungal pathogens of apple (Figure 2).

Table 2: Fungal pathogens used for validating the methodology developed in this study

EXAMPLE-8

Distinguishing fungal pathogens present in a mixture: Mixture of genomic DNA of three or four different apple fungal pathogens in equal proportions was made and subjected to PCR-RFLP analysis as described in Example 5. As shown in Figure 3 and Figure 4; PCR-RFLP could distinguish all these pathogens.

EXAMPLE-9

Use of Tool to analyze the PCR-RFLP banding patterns: analysis of PCR RFLP patterns is cumbersome specifically when number of bands has to be analyzed. PERL based Tool PathDec has been used for this purpose (Copyright protected) however the application is not limited to PathDec. The PathDec Tool could successfully distinguish the mixture of apple fungal pathogens once the obtained PCR-RFLP band sizes as described were provided as input to the Tool. EXAMPLE-10

Detecting fungal pathogens even before appearance of visual symptoms: Apple leaves infected with ΙΟμΙ of Alternaria alternata conidia were monitored following the methodology as described in Example 5. The Figure 5 shows that our methodology could detect presence of pathogen in the sample having no visual symptom.

Inference/Conclusions/Summary of observations

The present innovation describes a PCR based methodologies to detect various fungal pathogens of the plant. Our innovation of designing universal primer to PCR amplify fungal rDNA sequences, restriction digestion of PCR products with HinFl enzyme and analysis of obtained restriction fragments through PathDec Tool leads identification and detection of the majority of fungal pathogens of apple but not limited to apple even before visual appearance of the disease symptoms in less than 6 hours.

The main advantages of the present invention are:

1. Designing of universal primer pair to amplify fungal rDNA sequences.

2. Use of Tool to analyze and interpret PCR-RFLP data to identify and distinguish fungal pathogens.

3. Simple, robust and single protocol to detect and distinguish most of the fungal pathogens in a mixture in less than 6hr time.

4. Simple, robust and single protocol to detect and distinguish in less than 6hr time most of the fungal pathogens present in the sample even before visual appearance of disease symptoms.

5. Simple, robust and single protocol to detect and distinguish in less than 6hr time most of the fungal pathogens of apple present in the sample even before visual appearance of disease symptoms.