D E S C R I P T I O N

METHOD FOR DETECTION OF TARGET NUCLEIC ACID AND DEVICE FOR DETECTION OF TARGET NUCLEIC ACID

Technical Field

The present invention relates to a method for detection of a target nucleic acid and a device for detection of a target nucleic acid. Background Art

Along with the rapid progress in genetic engineering, various nucleic acid detection methods have been invented (see, for example, Jpn. Pat. Appln. KOKAI Publication No. 2004-24035) . In particular, the detection of a nucleic acid with a target nucleic acid detection device (for example, DNA chip) is particularly superior because many kinds of target nucleic acids can be simultaneously detected.

The device for detection of a target nucleic acid is widely used in various fields, such as medicine, forensic medicine, agriculture, zootechnics, fishery and forestry. Particularly, a DNA chip is a powerful tool for genetic diagnosis in the medical field. For example, the analysis of SNPs of individual patients enables prediction of the pharmacological effects and side effects of drugs on such patients. By analysis of SNPs by DNA chips, tailor-made medical treatments for providing individuals with the most appropriate therapy

are being realized.

In a device for detection of a target nucleic acid, one kind of nucleic acid probe having a sequence complementary to a target sequence is immobilized on each of a plurality of different detection compartments in the device. When a nucleic acid sample is hybridized with the nucleic acid probe on a detection compartment, a signal derived from its hybridization chain is generated, so the presence or absence of the target nucleic acid in the nucleic acid sample is revealed by detection of the signal.

Major methods of detecting target nucleic acids by- using such devices for detection of target nucleic acids include fluorescent detection and electrochemical detection (see, for example, Jpn. Pat. Appln. KOKAI Publication No. 2004-011643) . By fluorescent detection, results can be visually recognized, and thus mistakes in judgment of detection results can be prevented. In electrochemical detection, on the other hand, a sample can be examined by a current value only, and thus the apparatus can be downsized, the examination cost can be reduced, and the examination time can be shortened.

As the role of the device for detection of a target nucleic acid in the medical field or the like is increasing, it is estimated that the detection of more kinds of target nucleic acids by the same device than

conventional is necessary. However, the number of detection compartments that can be arranged in the device of a predetermined area is limited. Hence, when many kinds of target nucleic acids are to be detected, a plurality of devices should be used, thus making the examination troublesome. Particularly, in the case of electrochemical detection, an electrode having an area larger than a certain size is necessary for obtaining a necessary current value, and thus the number of detection compartments that can be arranged in one device is inevitably limited.

It follows that when many kinds of target nucleic acids are to be detected, a plurality of devices should be used in detection, or the area of a device should be increased to increase the number of detection compartments therein, so there arises a problem that the examination operation is troublesome, the device is prevented from downsizing thus making it less convenient, etc. Disclosure of Invention

The present invention was arrived at to solve such problems of the existing devices, and the object of the present invention is to provide a device for detection of a target nucleic acid, - which can detect a large number of target nucleic acids simultaneously with a lower number of detection compartments, and a method of detecting a target nucleic acid which uses the device.

In a first aspect of the present invention, a target nucleic acid detection device having two or more kinds of nucleic acid probes immobilized in different amounts on the same detection compartment in the device is used. This device is used in hybridization with a nucleic acid sample in a conventional manner, and the amount of a signal derived from hybridization in each detection compartment is measured. At this time, the amount of a signal obtained from the detection compartment is correlated with the amount of each nucleic acid probe immobilized. Accordingly, which nucleic acid probe was hybridized with the nucleic acid sample can be judged from the amount of a signal obtained from the detection compartment. Two or more kinds of target nucleic acids can thereby be distinguished in one detection compartment without increasing the number of detection compartments.

In a second aspect of the present invention, a nucleic acid detection device having two or more kinds of nucleic acid probes showing different Tm values immobilized on the same detection compartment in the device is used. This device is used in hybridization with a nucleic acid sample plural times at different reaction times, and the amount of a signal derived from hybridization in the detection compartment is measured at each reaction temperature. At this time, the Tm value of each nucleic acid probe is correlated with the

amount of a signal obtained at each temperature from the detection compartment. Accordingly, which nucleic acid probe was hybridized with the nucleic acid sample can be judged from the amount of a signal obtained from the detection compartment. Two or more target nucleic acids can thereby be distinguished in one detection compartment, similarly to the first aspect.

That is, the present invention provides a method of detecting a target nucleic acid, comprising: a step of supplying a nucleic acid sample to a device for detection of a target nucleic acid including a support, a plurality of nucleic acid probes complementary to a plurality of target nucleic acids different from one another, and a detection compartment arranged on the support, the detection compartment having said plurality of nucleic acid probes immobilized in different amounts on the same region; a step of hybridizing the nucleic acid sample with said plurality of nucleic acid probes in the detection compartment to give a hybrid chain; a step of detecting the amount of a signal derived from the hybrid chain in the detection compartment; and a step of judging, from the signal amount, the presence or absence of the target nucleic acid in the nucleic acid sample. The present invention also provides a method of detecting a target nucleic acid, comprising: a step of supplying a nucleic acid sample to a device for

detection of a target nucleic acid including a support, plural kinds of nucleic acid probes complementary to different target nucleic acids and showing Tm values different from one another, and a detection compartment arranged on the support, the detection compartment having the plural kinds of nucleic acid probes immobilized on the same region; a step of hybridizing the nucleic acid sample with the plural kinds of nucleic acid probes at the temperature at which all kinds of the nucleic acid probes maintain formation of their hybrid chains with the corresponding target nucleic acids; a step of hybridizing the nucleic acid sample with the plural kinds of nucleic acid probes at the temperatures at which the plural kinds of nucleic acid probes are respectively dissociated from the target nucleic acid; a step of detecting the amount of a signal obtained in each hybridizing step at each of the temperatures; and a step of judging, from the signal amount obtained in the detection step, the presence or absence of the target nucleic acid in the nucleic acid sample.

The present invention further provides a device for detection of a target nucleic acid, comprising a support, a plurality of nucleic acid probes complementary respectively to a plurality of target nucleic acids different from one another, and a detection compartment arranged on the support and

having said plurality of nucleic acid probes immobilized in different amounts on the same region. The present invention further provides a device for detection of a target nucleic acid, comprising a support, first and second nucleic acid probes complementary respectively to a plurality of different target nucleic acids and showing Tm values different from each other, and a detection compartment arranged on the support and having the first and second nucleic acid probes immobilized on the same region.

According to the present invention, a large number of target nucleic acids can be simultaneously detected by a device even with a lower number of detection compartments. Accordingly, there is an advantage that the detection device can be downsized and the detection operation can be simplified.

Brief Description of Drawings

FIG. 1 shows a device for detection of nucleic acid in the first and second embodiments; FIG. 2 is a sectional view of FIG. 1 taken along the line A-A in the first embodiment;

FIG. 3 is a schematic view showing the amounts of signals in the first embodiment;

FIG. 4 is a sectional view of FIG. 1 taken along the line A-A in the second embodiment;

FIG. 5 is a schematic view showing the amounts of signals in the second embodiment;

FIG. 6 is a bar chart showing results of current values in the first embodiment; and

FIG. 7 is a bar chart showing results of current values in the second embodiment. Best Mode for Carrying Out the Invention

Hereinafter, the embodiments of the invention will be described by reference to the drawings.

1. First Embodiment

(1) Device for Detection of Target Nucleic Acid (Basic Structure)

FIG. 1 is a schematic view of the target nucleic acid detection device 1 in the first embodiment. The target nucleic acid detection device 1 is composed of a support 2 and detection compartments 3, and one or more detection compartments 3 are aligned on the support 2. In the case of electrochemical detection, one electrode is arranged in each of the detection compartments 3, and each electrode is connected to a pad 4 for drawing an electrochemical signal. The target nucleic acid detection device 1 may be enclosed in, for example, a plastic container into which a nucleic acid sample solution can be injected. The plastic container is provided with an injection opening through which a nucleic acid sample solution can be injected, and when a nucleic acid sample solution is injected through the injection opening, the target nucleic acid detection device 1 is soaked in the

nucleic acid sample solution in the plastic container.

In the support 2, an arbitrary material may be used, and preferably a silica-containing substrate such as silicon, glass, quartz glass or quartz, or a plastic substrate such as polyacrylamide, polystyrene, or polycarbonate is used. The support 2 may be of an arbitrary shape, including plate or spherical shapes, and is preferably a plate substrate also called an array or chip. The detection compartment 3 is one reaction system independent of another reaction system. Signals obtained from the respective detection compartments are completely independent, i.e., do not interfere with one another. In the case of fluorescence detection, one kind of fluorescent substance is used in one detection compartment 3, and one kind of fluorescence signal can be obtained in one reaction. In the case of electrochemical detection, one electrode is arranged in one detection compartment 3, and one current value can be obtained in one reaction. The number, shape and arrangement pattern of detection compartments can be freely designed and altered as necessary by those skilled in the art. The area of each detection compartment is not particularly limited, and is arbitrary. In the case of electrochemical detection, one electrode is arranged in

each detection compartment 3, as described above. As the area of the electrode is decreased, an obtained current value is decreased and the influence of noise is relatively increased. To circumvent this noise, measures such as shielding of a cord and arrangement of an enclosure for blocking the influence of circumjacent electromagnetic waves are conceivable, but there is a problem that the structure of the apparatus therefor is complicated. In the device in the first embodiment, on the other hand, two or more kinds of target nucleic acids are immobilized on a single electrode, and thus the number of detectable target nucleic acids can be increased without reducing the area of the electrode. Accordingly, more kinds of target nucleic acids than conventional can be detected without complicating the structure of the apparatus.

Specifically in the case of a circular electrode for example, an electrode having a diameter of 100 μm or more, preferably 200 μm or more, most preferably 500 μm or more, is used. However, the lower limit of the area of the electrode varies depending on the reaction system and detection environment, and thus the area of the electrode is not limited to the above- mentioned lower limit. In the case of electrochemical detection, the electrode arranged in each detection compartment is not particularly limited, but the electrode can be formed

of a carbon electrode such as graphite, glassy carbon, pyrolytic graphite, carbon paste, or carbon fiber; a noble metal electrode such as platinum, platinum black, gold, palladium, or rhodium; an oxide electrode such as titanium oxide, tin oxide, manganese oxide, or lead oxide; a semiconductor electrode such as Si, Ge, ZnO, CdS, Tiθ2, or GaAs; titanium or the like. These electrodes may be coated with a conducting polymer, may be coated with a single molecular membrane, or may be treated with another surface treating agent, if desired.

A counter electrode and/or a reference electrode may be arranged. When a reference electrode is arranged, a general reference electrode such as a silver/silver chloride electrode and a mercury/mercury chloride electrode can be used.

As the length of a nucleic acid probe immobilized on the detection compartment, a suitable length for the probe to be immobilized on the device to effect hybridization may be appropriately selected, and the length of the nucleic acid probe may be established to be shorter than that of the target nucleic acid. For example, the length may be about 3 to about 1000 bps, preferably about 10 to about 200 bps. The nucleotide sequence of the nucleic acid probe is established so as to have a sequence complementary to the nucleotide sequence of the target nucleic acid.

As used herein, the term "complementary" refers to being complementary in the range of 50% to 100%, preferably 70% to 100%, most preferably 80% to 100%.

In this specification, the term "nucleic acid" is a term comprehensively indicating nucleic acid and a nucleic acid analog and a nucleic acid derivative, more specifically any oligonucleotide and polynucleotide such as ribonucleic acid (RNA) , deoxyribonucleic acid (DNA) , peptide nucleic acid (PNA) , methylphosphonate nucleic acid, S-oligo, cDNA and cRNA. Such a nucleic acid may be naturally occurring or artificially synthesized.

Immobilization of the nucleic acid probe may be carried out by known means. The nucleic acid probe may be immobilized on the detection compartment directly or indirectly via a spacer. Alternatively, a previously prepared nucleic acid probe solution may be added to, and immobilized on, the detection compartment. When the nucleic acid probe is to be immobilized on an electrode in the detection compartment, a thiol group is desirably added to the terminus of the nucleic acid probe. The thiol group is covalently bound to the electrode arranged in the detection compartment, thereby immobilizing the nucleic acid probe on the detection compartment.

(Concrete Structure) Now, the device for detection of a target nucleic

acid in the first embodiment will be described.

FIG. 2 is a sectional view of FIG. 1 taken along the line A-A. Two or more kinds of nucleic acid probes are immobilized in different amounts on the same detection compartment 3.

The number of nucleic acid probes is not particularly limited, and preferably 2 to 10 kinds, more preferably 2 to 5 kinds, most preferably 2 to 3 kinds of nucleic acid probes are immobilized on the same detection compartment. For the sake of descriptive convenience, in FIG. 2, 3 different kinds of nucleic acid probes, a, b and c, are immobilized in different amounts on the detection compartment 3. The "different amounts" used herein mean that the amounts of the nucleic acid probes a, b and c immobilized are different from one another. When the amounts of the nucleic acid probes a, b and c immobilized are different, the amounts of signals obtained from the respective nucleic acid probes are different from one another. That is, the amount of a signal is increased as the amount of each nucleic acid probe immobilized is increased, while the amount of a signal is decreased as the amount of each nucleic acid probe immobilized is decreased. Therefore, by detecting the amount of signals obtained from one detection compartment, it is possible to determine which of the nucleic acid probes a, b and c yielded the amount of signals. As a result,

3 kinds of target nucleic acids can be detected in one detection compartment.

Similarly, when 3 kinds of nucleic acid probes are immobilized in different amounts on another detection compartment, three times as many target nucleic acids as those detectable by a conventional device can be simultaneously detected by the whole device in the first embodiment.

More specifically, when a conventional device having 40 detection compartments arranged therein is used, at least 3 devices should be used to detect 120 kinds of target nucleic acids. However, if the device in the first embodiment, particularly the device having 3 kinds of nucleic acid probes immobilized per detection compartment is used, 1 device having 40 detection compartments arranged therein can detect 120 kinds of target nucleic acids simultaneously.

The ratio of the amounts of nucleic acid probes immobilized on each detection compartment is not particularly limited, but it is necessary that the presence of each nucleic acid probe be determinable from the obtained signal amount. For example, when the respective nucleic acid probes are immobilized in amounts that are different from one another by at least 1.5-fold, preferably at least 2-fold, most preferably 3-fold, the presence or absence of the respective nucleic acid probes can be accurately determined from

the obtained signal amount. The difference between the amount of the nucleic acid probe immobilized in the maximum amount and the amount of the nucleic acid probe immobilized in the minimum amount is regulated to be up to 100-fold, preferably up to 20-fold, most preferably up 10-fold, whereby the minimum current value obtained from the nucleic acid probe immobilized in the minimum amount can be accurately distinguished.

For allowing the amounts of 2 or more kinds of nucleic acid probes contained in one detection compartment to be made different, a mixture solution containing the respective nucleic acid probes at different concentrations is prepared and added onto a detection compartment to immobilize the nucleic acid probes thereon, in a step of immobilizing the nucleic acid probes. For achieving the state of the bound nucleic acid probes in FIG. 2 for example, a mixture solution containing the nucleic acid probes a, b and c at concentrations in the ratio of 3:2:1 is prepared and added onto a detection compartment, whereby the nucleic acid probes a, b and c can be immobilized in amounts in a ratio of 3:2:1 on the detection compartment.

(2) Method for Detection of Target Nucleic Acid in the First Embodiment Hereinafter, the method of detecting target nucleic acids by using the device for target nucleic acid detection in the first embodiment will be

described.

First, a target nucleic acid-containing nucleic acid sample solution is supplied onto the device. The target nucleic acids supplied onto the device are hybridized with nucleic acid probes immobilized previously on each detection compartment to form a hybrid chain between the target nucleic acid and the nucleic acid probe. At this time, a signal derived from the hybrid chain is obtained. In the case of fluorescence detection for example, the target nucleic acid is previously labeled with a fluorescent substance. The target nucleic acid that has formed a hybrid chain with the nucleic acid probe remains in the detection compartment even after washing, thus giving fluorescence (which is hereinafter referred to for example as a signal from the nucleic acid probe) . In the case of electrochemical detection, on the other hand, an electrochemically active molecule is added after hybridization, whereby the molecule is bound to the hybrid chain between each nucleic acid probe and the target nucleic acid, and upon application of an electric potential, a current derived from the molecule flows through the electrode (hereinafter, this current is referred to, for example, as a signal from the nucleic acid probe) . The presence or absence of the target nucleic acid corresponding to each nucleic acid probe can be determined from the obtained signal

amount .

The nucleic acid sample is collected from an object to be examined. For example, human blood is collected and subjected to the required treatment to prepare a nucleic acid sample solution. A nucleic acid colleted from a sample may be used as it is, but the collected nucleic acid may be subjected to treatment such as reverse transcription, elongation, amplification and/or enzyme treatment thereby securing a sufficient amount of the target nucleic acid relative to the amount of the nucleic acid probes immobilized on the detection compartment and simultaneously- decomposing and removing substances that adversely affect the reaction. The amplification includes techniques such as PCR, LAMP, and ICAN. The amount of the respective target nucleic acids contained in the nucleic acid sample solution should be sufficiently larger than the amount of the nucleic acid probes. The length of the target nucleic acid can be designed to be arbitrary by designing primers appropriately. Specifically, the target nucleic acid may be established to be for example about 10 to 1000 bps in length, preferably about 20 to 700 bps, most preferably about 30 to 500 bps. The target nucleic acid may have an arbitrary structure such as a linear structure or a loop structure. By suitably selecting the length and

structure of the target nucleic acid, the efficiency of hybridization thereof with the nucleic acid probe can be increased.

After the nucleic acid sample is added onto the device, the reaction conditions are regulated so as to enable suitable hybridization. The suitable reaction conditions can be selected appropriately by those skilled in the art, depending on various conditions such as the type of a base contained in a base sequence of the target nucleic acid or the type of a nucleic acid probe immobilized on the device.

The hybridization reaction can be carried out, for example, under the following conditions. The hybridization reaction is carried out in a buffer solution with an ionic strength in the range of 0.01 to 5 and in the range of pH 5 to 10. A hybridization promoter such as dextran sulfate or salmon sperm DNA, bovine thymus DNA, EDTA and a surfactant may be added to this solution. A nucleic acid sample solution is added to this solution and thermally denatured at 90°C or more. Just after denaturation of the nucleic acid or after quenching, this solution is added to the device for detection of a target nucleic acid.

During the hybridization reaction, the reaction rate may be increased by operations such as stirring or shaking. The hybridization reaction temperature and reaction time are appropriately selected. The

hybridization step in the first embodiment may comprise a washing step. After the hybridization step, the hybridization solution is removed, and the device while being shaken as necessary is washed by newly adding a washing solution to the detection compartment, whereby its detection accuracy can be improved. The washing solution used is, for example, a buffer with an ionic strength of 0.01 to 5 with pH in the range of 5 to 10. By the washing step, impurities are removed, and only the target nucleic acid in the nucleic acid sample is hybridized with the corresponding nucleic acid probe to maintain formation of a hybrid chain between the target nucleic acid and the nucleic acid probe.

In the case of fluorescence detection, the nucleic acid sample is previously labeled with a fluorescent substance. For example, a primer labeled with a fluorescent substance is used to amplify the target nucleic acid by PCR. Alternatively, a second probe may be used to detect the target nucleic acid. The fluorescent substance may be an arbitrary fluorescent substance known in the art, and for example, FITC, Cy3, Cy5 or rhodamine is used. The emission of the fluorescent substance can be detected with a fluorescence detector. The amount of the obtained fluorescence is correlated with the amount of each nucleic acid immobilized, and thus the presence or absence of the target nucleic acid corresponding to

each nucleic acid probe can be determined from the amount of the obtained fluorescence.

In the case of electrochemical detection, on the other hand, an electrochemically active molecule is used. The electrochemically active molecule refers to a molecule which binds to a hybrid chain and emits an electron upon application of an electric potential. An arbitrary electrochemically active molecule known in the art may be used. Examples of electrochemically active molecules that can be used are Hoechst 33258® (available from CALBIOCHEM) , Acridine Orange, quinacrine, daumonycin, a metallo-intercalator, a bis- intercalator such as bisacridine, a tris-intercalator or a poly-intercalator may be used. Particularly, Hoechst 33258 is preferably used. Hoechst 33258 is a molecule composed of a chemical substance p- (5- (5- (4-methylpiperazin-l-yl) benzimidazol-2-yl) benzimidazol-2-yl) phenol. Moreover, these intercalators may be modified with an electrochemically active metal complex such as ferrocene

(dicyclopentadienyl iron) or viologen. The concentration of the molecule is selected appropriately, and is generally in the range of from 1 ng/ml to 1000 ng/ml . At this time, a buffer solution having an ionic strength ranging from 0.001 to 5 and a pH ranging from 5 to 10 can be used.

The molecule recognizes the hybrid chain and

intercalates it. Upon application of a potential, the redox reaction of the molecule occurs to release an electron therefrom, thus bringing about passage of a current. Thereupon, the potential may be swept at a constant rate or applied by pulsation, or a constant potential may be applied. The potential sweeping rate is in the range of 10 to 1000 mV/sec. For measurement, the electricity and voltage may be regulated by using a device such as potentiostat, a digital multimeter and a function generator. Because the current value derived from the molecule is correlated with the amount of the nucleic acid probe immobilized, the presence or absence of the target nucleic acid corresponding to each nucleic acid probe can be determined from the obtained current value.

FIG. 3 shows the amount of a signal from a nucleic acid probe, obtained by using the device in the first embodiment. As described above, the obtained signal amount corresponds to the amount of each nucleic acid probe immobilized in the detection compartment, and the obtained signal amount is increased as the amount of the probe is increased. In FIG. 3, it is assumed for the sake of descriptive convenience that the amount of a signal from the nucleic acid probe a immobilized in the largest amount is 1.0, the amount of a signal from the nucleic acid probe b immobilized in the second- largest amount is 0.6, and the amount of a signal from

the nucleic acid probe c immobilized in the smallest amount is 0.3.

First, when a sample solution does not contain a nucleic acid hybridizing with the nucleic acid probe a, b or c, no signal is detected.

When 1 of 3 target nucleic acids is present, the amount of a signal corresponding to each nucleic acid probe is detected. That is, when the target nucleic acid a is present, the signal amount is 1.0; when the target nucleic acid b is present, the signal amount is

0.6; and when the target nucleic acid c is present, the signal amount is 0.3.

When 2 of 3 target nucleic acids are present in a nucleic acid sample solution, the signal amount is equal to the total sum of signals from the 2 target nucleic acids. That is, when the target nucleic acids a and b are present (a + b) , the signal amount is 1.6; when the target nucleic acids b and c are present

(b + c) , the signal amount is 0.9; and when the target nucleic acids a and c are present (a + c) , the signal amount is 1.3.

When all 3 target nucleic acids are present in a nucleic acid sample solution, the signal amount is equal to the total sum of signals from the 3 target nucleic acids. That is, when the target nucleic acids a, b and c are present (a + b + c) , the signal amount is 1.9.

When the presence or absence of each target nucleic acid contained in a nucleic acid sample to be examined is actually judged, a standard signal amount should be previously established. For establishing a standard signal amount, a nucleic acid sequence of a known sequence having a sequence complementary to each target nucleic acid probe immobilized on the detection compartment is used. A nucleic acid sequence of a known sequence is supplied to the device for detection of the target nucleic acid and subjected to hybridization, and the amount of a signal obtained from the detection compartment is used as the "standard signal amount". When each kind of target nucleic acid is present and when a plurality of target nucleic acids are present, all standard signal amounts are obtained. Information on these standard signal amounts and on the presence or absence of the target nucleic acid corresponding to each standard signal amount is specified to complete a "table of correspondence between target nucleic acid and standard signal".

A nucleic acid sample to be examined is supplied to the device for detection of the target nucleic acid and subjected to hybridization, and then the amount of a first signal obtained from the detection compartment is compared with each of the standard signal amounts shown in the "table of correspondence between target nucleic acid and standard signal", and out of the

respective standard signal amounts shown in the "target-standard signal table", the standard signal amount that is most similar to the amount of the first signal is determined, thereby judging the presence or absence of each target nucleic acid.

(3) Modification to the First Embodiment For improving the reliability of examination results, the types of the nucleic acid probes immobilized may be common among a plurality of detection compartments. For example, 3 kinds of nucleic acid probes are immobilized commonly on 2 detection compartments in a device. In this case, the respective target nucleic acids can be examined in duplicate in the device as a whole, and thus many target nucleic acids can be detected simultaneously and accurately.

In this case, the judgment step is conducted in duplicate. That is, the 2 detection compartments (hereinafter, the first detection compartment and the second detection compartment) are compared with each of the standard signals shown in the "table of correspondence between target nucleic acid and standard signal", and the most similar standard signal amount thereto is determined. When the standard signal amount determined in the first detection compartment is the same as in the second detection compartment, the result can be evaluated as highly reliable. If the standard

signal amount determined in the first detection compartment is different from that in the second detection compartment, the result can be judged as highly false positive. To further increase the accuracy of the duplicate test, the amount of each nucleic acid probe may vary from detection compartment to detection compartment. For example, when 2 detection compartments, each of which has the nucleic acid probes a, b and c in FIG. 2 immobilized thereon, are to be prepared, the ratio of the nucleic acid probes immobilized on the first detection compartment is made different from that on the second detection compartment. For example, the ratio of the nucleic acid probes a, b and c immobilized on the first detection compartment is regulated to be

1:3:10, while the ratio of the nucleic acid probes a, b and c immobilized on the second detection compartment is regulated to be 10:3:1.

In this case, the information obtained from each standard signal amount varies, and thus it is necessary to prepare a first "table of correspondence between target nucleic acid and standard signal" corresponding to the first detection compartment and a second "table of correspondence between target nucleic acid and standard signal" corresponding to the second detection compartment, respectively. The most approximate signal amounts to the signal amounts obtained in the first and

second detection compartments are determined respectively using the first and second "tables of correspondence between target nucleic acid and standard signal", and the presence or absence of the target nucleic acids is judged in each of the detection compartments. When the judgment results are the same, the results can be evaluated as highly reliable, while when the judgment results are different, the results can be judged as highly false positive. The device wherein the ratio of the nucleic acid probes immobilized on the first detection compartment is different from that on the second detection compartment further enhances the reliability of examination results. It follows that even in examinations with a high possibility of false positivity for example because a nucleic acid sample to be examined contains many polymorphic sequences or because homology in sequence among the nucleic acid probes immobilized on the detection compartment is high, it is possible without overlooking the result of false positivity to take measures such as reexamination and redesigning of nucleic acid probes, thus bringing about an extremely excellent effect in the medical field, which strictly entails very high reliability of examination results.

As a matter of course, the device may have immobilized nucleic acid probes that are common among 3

or more compartments so that the device is compatible with testing in triplicate, quadruplicate, etc.

In another embodiment not falling under the first embodiment, two or more kinds of nucleic acid probes may be immobilized in a similar amount on the same compartment if mere detection of the presence or absence of certain target nucleic acids suffices. The "similar amount" means that from the obtained signal, the target nucleic acid cannot be distinguished from other nucleic acids. In this case, whether at least one target nucleic acid corresponding to each nucleic acid probe is present or not can be judged from the presence or absence of the signal. 2. Second Embodiment (1) Device for Detection of Target Nucleic Acid

Hereinafter, the device for detection of a target nucleic acid in the second embodiment and a method of detecting target nucleic acids by using the device will be described. The basic structure and working effects are the same as those of the device for detection of a target nucleic acid in the first embodiment, and only features different from those of the first embodiment will be described. Unless otherwise noted, each member, substance, reaction solution, etc. used in the second embodiment are as described in the first embodiment .

FIG. 4 is a schematic view showing an immobilized

state of nucleic acid probes in the second embodiment, which is a sectional view of FIG. 1 taken along the line A-A. Two or more kinds of nucleic acid probes showing different Tm values are immobilized on the detection compartment.

The number of nucleic acid probes is not particularly limited, and preferably 2 to 10 kinds, more preferably 2 to 5 kinds, most preferably 2 to 3 kinds of nucleic acid probes are immobilized on the same detection compartment. In FIG. 4, for the sake of descriptive convenience, 3 kinds of different nucleic acid probes, a, b and c, are immobilized on the detection compartment 3. Unlike the first embodiment, the amounts of the respective nucleic acid probes are almost the same.

The nucleic acid probes a, b and c show Tm values different from one another. The "different" Tm values mean those Tm values by which hybridization of the target nucleic acid with the corresponding nucleic acid probe can be distinguished by regulating the reaction temperature .

The Tm value is an indicator of the stability of a double-stranded nucleic acid, and refers to the temperature at which 50% of all hybridized double strands are dissociated in an environment with a certain ionic strength. The Tm value is calculated for example by the nearest neighbor method, Wallace method,

GC% method or the like. Those skilled in the art can freely design a nucleic acid probe having an arbitrary Tm value by using a known technical means. The Tm value varies depending on various conditions, such as the length of a hybridizing nucleic acid sequence, the GC content, and the composition of a reaction solution. The Tm value of the nucleic acid probe of the invention immobilized on the detection compartment is • significantly different from Tm value of a nucleic acid floating in solution. Accordingly, the Tm value as used herein does not indicate the dissociation temperature and is an indicator merely showing the relative stability of a plurality of different double- stranded nucleic acids. Because the Tm values of the nucleic acid probes a, b and c are different from one another, the hybridization reaction of the respective nucleic acid probes with the target nucleic acids at different reaction temperatures and/or washing is carried out, and the amounts of signals at the respective reaction temperatures are combined with each other, whereby the presence or absence of the target nucleic acid corresponding to each nucleic acid probe can be determined. This device, similar to the device in the first embodiment, can distinguish a plurality of nucleic acids in one detection compartment, so that more target nucleic acids than conventional can be

detected by the device as a whole.

More specifically, when a conventional device having 40 detection compartments arranged thereon is used, at least 3 devices should be used in detection of 120 kinds of target nucleic acids. However, when the device in the second embodiment, particularly the device having 3 kinds of nucleic acid probes immobilized in each of the detection compartments, is used, 1 device having 40 detection compartments arranged therein can detect 120 kinds of target nucleic acids simultaneously by carrying out the detection reaction 3 times at reaction temperatures corresponding to the Tm values of the respective nucleic acid probe. The second embodiment should be carried out plural times at different reaction temperatures and thus requires a longer time than in the first embodiment capable of detecting target nucleic acids by one reaction, but is nevertheless useful because of higher detection sensitivity. (2) Method of Detecting Target Nucleic Acid in the Second Embodiment

Hereinafter, a method of detecting target nucleic acids by using the device for detection of the target nucleic acid in the second embodiment will be described. The fundamental method is the same as the method of detecting target nucleic acids in the first embodiment, and only features different from those of

the first embodiment will be described.

First, a nucleic acid sample is supplied to the device (feeding step) . The target nucleic acids in the nucleic acid sample supplied to the device are hybridized at a first temperature with plural kinds of nucleic acid probes immobilized previously on each detection compartment, to form hybrid chains between the target nucleic acids and the corresponding nucleic acid probes (first reaction step) . The first temperature is a temperature at which all plural kinds of nucleic acid probes can maintain formation of hybrid chains with the target nucleic acids. The first temperature can be determined through verification experiments based on the Tm value of each nucleic acid probe. The Tm value serves merely as an indicator of the relative stability of a plurality of different double-stranded nucleic acids as described above, and thus the first temperature cannot indiscriminately be determined from the Tm value. However, the Tm value of each nucleic acid probe clearly shows a relative ability of each nucleic acid probe to maintain hybridization, and those skilled in the art can easily determine the first temperature through verification experiments based on the Tm value as an indicator.

The first reaction step refers to a hybridization step and/or a washing step. When the hybridization

step is carried out, the detection compartment may be left at the first temperature.

When the washing step is carried out, the first reaction step is composed of a hybridization step and a washing step. That is, the hybridization step is first carried out at the temperature (temperature Tg) at which all target nucleic acids contained in a nucleic acid sample added in the feeding step can hybridize with the corresponding nucleic acid probes. Thereafter, the hybridization solution in the detection compartment is removed, and the device is shaken if necessary at the first temperature, and a washing solution is newly added to the detection compartment, whereby impurities in a free state are removed from the detection compartment. Both the temperature Tg and the first temperature are temperatures at which all hybrid chains can be maintained, but the 2 temperatures are different from each other because the hybridization step and washing step are different in respect of the composition of the reaction solution.

At the first temperature, all target nucleic acids are bound to the nucleic acid probes, and thus the first washing step is carried out mainly for removing unbound target nucleic acids added in excess and other impurities. The impurities are non-nucleic acid materials not involved in the reaction and remains of nucleic acids. When the washing step is carried out in

the first reaction step, an excess of target nucleic acids not involved in the reaction, and impurities, can be previously removed, thus preventing pseudo-bonding etc. and improving accuracy in the subsequent detection steps.

Then, the amount of a signal obtained in the first reaction step is detected (first detection step) . The first detection step is carried out at the first temperature, and thus all target nucleic acids corresponding to the respective nucleic acid probes can maintain hybrid chains with the nucleic acid probes. Accordingly, when all kinds of target nucleic acids corresponding to the respective nucleic acid probes are contained in the nucleic acid sample, signals from all nucleic acid probes are obtained. On the other hand, when signals are not obtained from all nucleic acid probes, it can be found that, out of the target nucleic acids corresponding to the respective nucleic acid probes, at least one target nucleic acid is not contained in the nucleic acid sample. The signal can be obtained as the sum total of signals from the respective nucleic acid probes, so in the first detection step, the target nucleic acid(s) not contained in the nucleic acid sample cannot be identified.

Subsequently, the reaction is carried out at the second temperature (second reaction step) . The second

temperature is a temperature at which, out of the plural kinds of nucleic acid probes, one specific kind of nucleic acid probe is dissociated. Similarly to the first temperature, the second temperature can also be easily determined by those skilled in the art through verification experiments based on the Tm value of each nucleic acid probe. The second reaction step refers to a hybridization step and/or a washing step. When the hybridization step is carried out, the detection compartment may be left at the second temperature.

When the washing step is carried out, the hybridization solution in the detection compartment is removed, and the device is shaken if necessary at the second temperature, and a washing solution is newly added to the detection compartment, whereby impurities in a free state are removed from the detection compartment. In the washing step, target nucleic acids in a free state are removed from the detection compartment, thus reducing the possibility of pseudo-bonding. Then, the signal amount obtained in the second reaction step is detected (second detection step) . The second detection step is carried out at the second temperature, so that out of the plural kinds of nucleic acids, one kind of specific nucleic acid probe cannot maintain a hybrid chain with the target nucleic acid, so the target nucleic acid is dissociated from the nucleic acid probe. As a result, a signal from this

nucleic acid probe cannot be detected.

When 3 or more kinds of nucleic acid probes are immobilized on one region of each detection compartment, the second reaction step and the second detection step are repeated (referred to hereinafter as the n-th reaction step and the n-th detection step respectively provided that n is a natural number) . At this time, the n-th reaction step is carried out at the n-th temperature, which is higher than the (n - 1) temperature. This is because the n-th temperature, similarly to the second temperature, is a temperature at which out of the plural kinds of nucleic acid probes, one specific kind of nucleic acid probe is dissociated from the target nucleic acid, but in the (n - l)-th reaction step, such probe is one of the nucleic acid probes maintaining formation of hybrid chains .

When n kinds of nucleic acid probes are immobilized on one region of each detection compartment, the 1st to n-th reaction steps and the 1st to n-th detection steps should be carried out. In the n-th reaction step at the n-th temperature, only the nucleic acid probe showing the highest Tm value can maintain formation of a hybrid chain with the target nucleic acid. It is not necessary to conduct the n+l-th reaction step at the n+l-th temperature at which the nucleic acid probe showing the highest Tm value

cancels formation of a hybrid chain with the target nucleic acid. However, the n+l-th reaction step and the n+l-th detection step may be carried out to dissociate all the target nucleic acids in order to confirm that finally no signal is detected.

As the reaction step and the detection step are progressed by one step, one kind of target nucleic acid, which starts from the nucleic acid probe having the lowest Tm value among the nucleic acid probes maintaining formation of hybrid chains, is dissociated in each step, and thus the amounts of signals obtained in the detection steps in the respective stages are finally combined, whereby the presence or absence of the target nucleic acids corresponding to the respective nucleic acid probes can be judged (judgment step) .

Hereinafter, the second embodiment will be described in more detail by reference to FIG. 5.

FIG. 5 shows the amount of a signal obtained at each reaction temperature in the second embodiment. The signal is obtained where the target nucleic acid corresponding to each of the nucleic acid probes is present, that is, a hybrid chain between the nucleic acid probe and the corresponding target nucleic acid is formed. In FIG. 5, for the sake of descriptive convenience, the nucleic acid probe showing the highest Tm value is nucleic acid probe c, the nucleic acid

probe showing the second-highest Tm value is nucleic acid probe b, and the nucleic acid probe showing the lowest Tm value is nucleic acid probe a.

The nucleic acid probe a has the lowest Tm value, so that the target nucleic acid corresponding to the nucleic acid probe a will be dissociated from the nucleic acid probe at the second and third reaction temperatures that are higher than the first reaction temperature. As a result, the signal of nucleic acid probe a is detected at the first reaction temperature only (a in FIG. 5) . The target nucleic acid corresponding to the nucleic acid probe b will be dissociated from the nucleic acid probe at the highest, third reaction temperature only, so that signals are detected at the first and second reaction temperatures (b in FIG. 5) . The target nucleic acid corresponding to the nucleic acid probe c having the highest Tm value can maintain formation of its hybrid chain at each of the first to third reaction temperatures, and as a result, signals are detected at each of the first to third reaction temperatures (c in FIG. 5) .

When 2 of 3 target nucleic acids are present, the obtained signal is almost the same as the total sum of signals from the 2 target nucleic acids. For example, the target nucleic acids (referred to hereinafter as the target nucleic acid a and the target nucleic acid b) corresponding to the nucleic acid probes a and b

form hybrid chains at the first reaction temperature with the target nucleic acids a and b, to give signals from the respective hybrid chains, and thus the obtained signal amount approximates the sum total of the target nucleic acids a and b. At the second reaction temperature, however, the target nucleic acid a is dissociated from the nucleic acid probe a, so that only a signal of the target nucleic acid b is detected. Then, at the third reaction temperature, both the target nucleic acid a and b have been dissociated from the nucleic acid probes, and thus no signal is detected (a + b in FIG. 5) .

Similarly, when target nucleic acids corresponding to the nucleic acid probes b and c are present (b + c in FIG. 5) , or when target nucleic acids corresponding to the nucleic acid probes a and c are present (a + c in FIG. 5) , the signal as shown in FIG. 5 is obtained. Finally, when 3 kinds of target nucleic acids, a, b and c, are present, all target nucleic acids, a, b and c form hybrid chains at the first reaction temperature, and the obtained signal amount approximates the sum total of the target nucleic acids a, b, and c. At the second reaction temperature, the target nucleic acid a is dissociated from the nucleic acid probe a, and the obtained signal approximates the total sum of the target nucleic acids b and c. At the third reaction temperature, the target nucleic acid b

is dissociated from the nucleic acid probe b, so that only the target nucleic acid c will maintain its hybrid chain with the nucleic acid probe c, and thus a signal of only the target nucleic acid c is obtained (a + b + c in FIG. 5) .

When the presence or absence of each target nucleic acid contained in a nucleic acid sample to be examined is actually judged, it is necessary previously to prepare a "table of correspondence between target nucleic acid and standard signal". In the second embodiment, the detection reaction should be carried out plural times at different reaction temperatures, and thus a "table of correspondence between a target nucleic acid and standard signal" should be prepared separately at each reaction temperature. As shown in FIG. 5, the information on a standard signal amount at each reaction temperature and on the presence or absence of the target nucleic acid corresponding to each standard signal amount is specified in the "table of correspondence between target nucleic acid and standard signal".

For example, when the "table of correspondence between target nucleic acid and standard signal" as shown in FIG. 5 is used, the target nucleic acids in the nucleic acid sample can be identified as the target nucleic acids a + b, b + c, or a + c, from the most similar standard signal amount of 2.0. Then, when a

signal amount of 0.9 is obtained at the second reaction temperature, the target nucleic acids in the nucleic acid sample can be identified as the target nucleic acids a + b or a + c, from the most approximate standard signal amount of 1.0 and the judgment result at the first reaction temperature. Finally, when a signal amount of 0.8 is obtained at the third reaction temperature, the target nucleic acids in the nucleic acid sample can be unambiguously identified as the target nucleic acids a + c, from the most similar standard signal amount of 1.0 and the judgment results at the first and second reaction temperatures. (3) Modification to the Second Embodiment In a modification to the second embodiment, similarly to the first embodiment, the types of the nucleic acid probes immobilized may be common among a plurality of detection compartments in order to improve reliability in examination results. For further increasing the reliability in testing in duplicate, the Tm value of each nucleic acid probe may vary from detection compartment to detection compartment. For example, when 2 detection compartments, each of which has the nucleic acid probes a, b and c in FIG. 2 immobilized thereon, are to be prepared, the Tm value of the first detection compartment is made different from the Tm value of the second detection compartment. For example, the Tm values of the nucleic acid probes

a, b and c immobilized on the first detection compartment are regulated at 60°C, 50°C and 40°C, respectively, while the Tm values of the nucleic acid probes a, b and c immobilized on the second detection compartment are regulated at 40°C, 50°C and 60°C, respectively. By testing in duplicate (that is, in the first and second detection compartments that are different in Tm value) , the reliability of detection results is further improved so that very accurate detection results can be obtained.

In this case, the information obtained from each standard signal amount varies, and thus it is necessary to prepare a first "table of correspondence between target nucleic acid and standard signal" corresponding to the first detection compartment and a second "table of correspondence between target nucleic acid and standard signal" corresponding to the second detection compartment, respectively. As described above, the information on a standard signal amount at each reaction temperature and on the presence or absence of the target nucleic acid corresponding to each standard signal amount is specified in the "table of correspondence between target nucleic acid and standard signal". Then, the presence or absence of the target nucleic acid is judged in each detection compartment, and when the judgment results in the respective detection compartments are the same, the results can be

judged as highly reliable, while when the judgment results are different, the results can be judged as highly false positive.

It follows that even in examinations with a high possibility of false positivity, for example, because a nucleic acid sample to be examined contains many polymorphic sequences or because homology in sequence among the nucleic acid probes immobilized on the detection compartment is high, it is possible without overlooking the result of false positivity to take measures such as reexamination and redesigning of nucleic acid probes, thus bringing about an extremely excellent effect in the medical field, which strictly entails very high reliability of examination results. As a matter of course, the device may have immobilized nucleic acid probes that are common among 3 or more compartments, thus making the device compatible with testing in triplicate, quadruplicate etc.

EXAMPLES [Example 1 (First Embodiment) ]

Hereinafter, the first embodiment is shown wherein 3 kinds of target nucleic acids are detected. A device having an electrode arranged in each detection compartment was used as the device for detection of target nucleic acids, and the target nucleic acids were electrochemically detected.

<Nucleic Acid Samples>

As the nucleic acid samples, the following target nucleic acids 1 to 3 were prepared.

Target Nucleic Acid 1 (5'→3') TCTGATGCCCAAATATTCAATAAACCTTATTGGT

Target Nucleic Acid 2 (5'→3') TCCCAATTATTTAATAAACCGTACTGGTTACAA

Target Nucleic Acid 3 (5'->3') TGCCCAGGTACAGGAGACTGTGTAGAAGCA First, nucleic acid samples 1 to 7 were prepared respectively. The nucleic acid sample 1 is a nucleic acid sample containing the target nucleic acid 1, the nucleic sample 2 is a nucleic acid sample containing the target nucleic acid 2, the nucleic sample 3 is a nucleic acid sample containing the target nucleic acid 3, the nucleic sample 4 is a nucleic acid sample containing the target nucleic acids 1 and 2, the nucleic sample 5 is a nucleic acid sample containing the target nucleic acids 1 and 3, the nucleic sample 6 is a nucleic acid sample containing the target nucleic acids 2 and 3, and the nucleic sample 7 is a nucleic acid sample containing the target nucleic acids 1, 2 and 3. As the control, a target nucleic acid-free nucleic acid sample 8 was prepared. <Nucleic Acid Probes>

As the nucleic acid probes, the following nucleic acid probes were prepared.

Nucleic Acid Probe 1 (5'→3') ACCAATAAGGTTTATTGAATATTTGGGCATCAGA (Tm value: 71.5°C)

Nucleic Acid Probe 2 (5'→3')

TTGTAACCAGTACGGTTTATTAAATAATTGGGA (Tm value: 68.0°C) Nucleic Acid Probe 3 (5'→3')

TGCTTCTACACAGTCTCCTGTACCTGGGCA (Tm value: 75.6°C)

The nucleic acid probes 1, 2 and 3 have sequences complementary to the target nucleic acids 1, 2 and 3, respectively. The nucleic acid probes 1, 2 and 3 were established to have a similar Tm value to eliminate the influence of reaction temperature on detection results. The Tm value of the nucleic acid probe was calculated by using a Na ⁺ concentration of 50 mM (Na ⁺ = 50xl0 ^~ 3) and an oligonucleotide concentration of 0.5 μM (Ct = 0.5xl0 ^~ 6) according to the nearest neighbor method.

The nucleic acid probes 1, 2 and 3 were compounded at the ratio of 1:3:9 to prepare a mixed solution of the nucleic acid probes. The mixed solution was added to a single electrode arranged in the detection compartment, to prepare one detection compartment wherein the nucleic acid probes 1, 2 and 3 were immobilized in amounts in a ratio of 1:3:9.

<Detection of Target Nucleic Acids> Each of the nucleic acid samples was added to each of the detection compartments and subjected to hybridization at 50°C for 20 minutes. Thereafter, a

washing step was carried out at 30°C for 20 minutes. Because the Tm value is a relative indicator, there is no problem in the difference of this Tm value from that determined under actual temperature conditions.

After washing, Hoechst 33258 was added to the detection compartment, and a potential was swept through the electrode arranged in the detection compartment. Hoechst 33258 recognizes a hybrid chain between the nucleic acid probe immobilized on the detection compartment and the corresponding target nucleic acid, and intercalated into the hybrid chain. When the potential is swept through the electrode, a current flows due to the redox reaction of Hoechst 33258 intercalated into the hybrid chain. This current can be detected as current value (nA) .

<Experiment Results>

The results are shown in Table 1 below.

Table 1

* Increase in Current Value: Difference between each current value and background current value

** Neg: negligible

The results are also shown in the bar chart in FIG. 6.

When the target nucleic acid-free nucleic acid sample 8 (negative control) was added, no current value could be detected.

When the nucleic acid samples 1, 2 and 3 containing the target nucleic acid 1, 2 and 3 respectively were added, current values of 6.1 nA, 28.2 nA and 41.5 nA were detected respectively. This result reveals that the target nucleic acids are bound to the nucleic acid probes immobilized in different amounts on the single detection compartment, to give a current value depending on the amounts of the nucleic acid probes, and 3 kinds of different target nucleic acids could be distinguished from one another in the single detection compartment. Similarly, current values were detected when the nucleic acid samples 4 to 7 contained a plurality of target nucleic acids among from the target nucleic acids 1, 2 and 3. When a current value of 34.3 nA was obtained when the nucleic acid sample 4 was added; 45.9 nA was obtained when the nucleic acid sample 5 was added; 71.7 nA was obtained when the nucleic acid sample 6 was added; and 77.9 nA was obtained when the nucleic acid sample 7 was added. Each of the current values had a numerical value almost the same as the sum of current values obtained from the respective target nucleic acids. This result reveals

that even if a plurality of target nucleic acids among the target nucleic acid 1, 2 and 3 are present, their discrimination is feasible.

From the foregoing result, the device wherein nucleic acid probes having different sequences were immobilized on the same detection compartment could be used to distinguish a plurality of target nucleic acids rapidly and accurately in the same detection compartment . [Example 2 (Second Embodiment) ]

Hereinafter, the second embodiment is shown wherein 2 kinds of target nucleic acids were detected. A device having an electrode arranged in each detection compartment was used as the device for detection of target nucleic acids, and the target nucleic acids were electrochemically detected.

<Nucleic Acid Samples>

The following nucleic acids 1 and 2 were prepared as nucleic acid samples. Target Nucleic Acid 1 (5'→3') TACCACATCATCCATATAACTGAAAGC

Target Nucleic Acid 2 (5'→3') TACCACATCATCTATATAACTGAAAGC

The target nucleic acids 1 and 2 are identical except for only the base 13 (corresponding to C in the target nucleic acid 1 and T in the target nucleic acid 2, both of which are underlined) from the 5' -terminus.

Such target nucleic acids 1 and 2 are a combination of nucleic acids that are the most difficult to be distinguished from each other.

A nucleic acid sample containing the target nucleic acid 1, a nucleic acid sample containing the target nucleic acid 2, and a nucleic acid sample containing the target nucleic acids 1 and 2 were prepared. As the control, a target nucleic acid-free nucleic acid sample was prepared. <Nucleic Acid Probes>

As the nucleic acid probes, the following nucleic acid probes were prepared.

Nucleic Acid Probe 1 (5'→3') GCTTTCAGTTATATGGATGATGTGGTA (Tm value: 64.6°C) Nucleic Acid Probe 2 (5'→3') AGTTATATAGATGAT (Tm value: 49.0°C)

The nucleic acid probes 1 and 2 are complementary to the target nucleic acids 1 and 2, respectively. The different base between the two nucleotide sequences is underlined. The Tm value of the nucleic acid probe 1 was made different from that of the nucleic acid probe 2 by making the nucleic acid probe 2 shorter, so that the Tm value (49.0°C) of the nucleic acid probe 2 was lower than the Tm value (64.6°C) of the nucleic acid probe 1. The Tm values of the nucleic acid probes 1 and 2 were calculated by using an Na ⁺ concentration of 50 mM (Na ⁺ = 50xl0 ^~ 3) and an oligonucleotide

concentration of 0.5 μM (Ct = 0.5x10 ^" ^) according to the nearest neighbor method.

A mixed solution containing equal amounts of the target nucleic acids 1 and 2 was prepared, and the mixed solution was added to the single electrode arranged in the detection compartment, thereby preparing one detection compartment having the nucleic acid probes 1 and 2 immobilized thereon.

<Reaction under Reaction Conditions 1 and 2> The nucleic acid sample was added to the detection compartment to carry out hybridization at 50°C for 20 minutes. Thereafter, a washing step was carried out either at 30°C for 20 minutes under reaction condition 1 or at 40°C for 20 minutes under reaction condition 2. Hereinafter, the respective reaction conditions are shown below:

[Reaction Condition 1] Hybridization: 20 minutes at 50°C Washing: 20 minutes at 30°C [Reaction Condition 2]

Hybridization: 20 minutes at 50°C Washing: 20 minutes at 40°C

In Example 2, the respective washing steps are carried out independently under the reaction conditions 1 and 2. When the washing steps are carried out independently, the second washing step, similar to the first washing step, is carried out after hybridization,

and thus impurities which may bring about false bonding etc. are contained in a large amount in the reaction solution. Accordingly, the possibility of false bonding etc. should also be considered after the second washing step. On the other hand, when the washing steps are carried out successively, the second washing step is carried out after the first washing step so that at the stage where the second washing step is conducted, impurities which may bring about false bonding etc. have already been removed from the reaction solution. Accordingly, the necessity for considering the possibility of false bonding etc. is lower after the second washing step than where the washing steps are independently conducted. In other words, the second embodiment, wherein the washing steps are independently conducted, is estimated to be under severer conditions. Example 2 was carried out under such severer conditions in order to strictly evaluate the operability of the present invention. That is, if the presence of the target nucleic acids 1 and 2, that is, a combination of nucleic acids most indistinguishable from each other, are successfully distinguishable in the second embodiment where the washing steps are independently conducted, then the second embodiment can be proven to be sufficiently operable.

The hybridization temperature is made higher than

the washing temperature because the concentration of the nucleic acid sample solution and the composition of the reaction solution in hybridization are different from those in washing, and, at the hybridization temperature, all target nucleic acids in the nucleic acid sample can be hybridized with the nucleic acid probes. Because the Tm value is a relative indicator, there is no problem in the difference of this Tm value from that determined under actual temperature conditions.

After washing, Hoechst 33258 was added to the detection compartment, and a potential was swept through the electrode arranged in the detection compartment. Hoechst 33258 recognizes a hybrid chain between the nucleic acid probe immobilized on the detection compartment and the corresponding target nucleic acid, and intercalated into the hybrid chain. When the potential is swept through the electrode, a current flows due to the redox reaction of Hoechst 33258 intercalated into the hybrid chain. This current can be detected as current value (nA) . Experimental Results>

An increase in the current value when the respective target nucleic acids were reacted is shown in Table 2. The increase in the current value refers to a difference between the obtained current value and the background current value.

Table 2

Target Target Target

Control Nucleic Nucleic Nucleic Acid 1 Acid 2 Acid 1+2

Reaction

Neg* 17.0 16.5 26.3 Condition 1 (nA)

Reaction

Neg 17.0 0.8 18.8 Condition 2 (nA)

* Neg: negligible

The results are shown in a bar chart in FIG. 7. When a target nucleic acid-free nucleic acid sample (control) was added, no increase in the current value was detected under either the reaction conditions 1 or 2.

When the nucleic acid sample containing the target nucleic acid 1 was added, an increase of 17.0 nA in electric current was detected under both the reaction conditions 1 and 2. This result means that a hybrid chain between the nucleic acid probe 1 having a high Tm value and the target nucleic acid 1 was maintained under both the reaction conditions.

When the nucleic acid sample containing the target nucleic acid 2 was added, an increase of 16.5 nA in current value was detected under the reaction condition 1, but an increase was hardly detected under the reaction condition 2. This result means that, under the reaction condition 2 at a higher temperature, the target nucleic acid 2 was dissociated from the nucleic aid probe 2 having a low Tm value.

When the nucleic acid sample containing the target

nucleic acids 1 and 2 was added, an increase of 26.3 nA in current value was detected under the reaction condition 1, while an increase of 18.8 nA in electric current was detected under the reaction condition 2. This result means that under the reaction condition 1, both the target nucleic acids 1 and 2 maintained their hybrid chains with the corresponding nucleic acid probes, so a current value resembling the sum total of the current values of the target nucleic acids 1 and 2 was detected. The result also means that, under the reaction condition 2, the target nucleic acid 2 was dissociated from the nucleic acid probe 2 having a low Tm value, and the current value derived from the target nucleic acid 2 was hardly obtained. From the foregoing results, the presence or absence of the target nucleic acids 1 and 2 in the nucleic acid sample can be accurately determined by using a combination of electric values obtained under the reaction conditions 1 and 2 respectively. Additional advantages and modifications will readily occur to those skilled in the art. Therefore, the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein. Accordingly, various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents.