TECHNICAL FIELD

The present invention generally relates to retinal dystrophies, and in particular to inherited retinal dystrophies in dogs.

BACKGROUND

Inherited retinal dystrophies, also referred to as inherited retinal degenerations or retinal degenerative diseases, are a genetically and clinically heterogeneous group of eye diseases leading to severe visual impairment in both humans and dogs. These diseases include various forms of retinitis pigmentosa (RP), also referred to as progressive retinal atrophy (PRA) in cats and dogs, Leber congenital amaurosis (LCA), age-related macular degeneration (AMD), cone- rod dystrophies (CRD), and Stargardt disease (STGD) and are caused by many different mutations leading to deterioration of neuroretinal and retinal pigment epithelial (RPE) function. The shared phenotypic similarity of inherited retinal dystrophies in dogs and humans has made canine models attractive for gene discovery and for experimental treatments, including gene therapy, of inherited degenerative retinal disease. The development of gene therapy for RPE65- mediated LCA is an example where a canine comparative model has been instrumental for proof-of-principle trials. The identification of the p.C2Y mutation (OMIM: 610598.0001) in the progressive rod-cone degeneration ( PRCD ) gene is another illustrative example of the benefits of using canine genetics to find homologous candidate genes for human retinal dystrophies. The PRCD gene was initially mapped and identified in dogs and subsequently in a human family with RP. This mutation segregates in multiple dog breeds, including the Labrador retriever, where no other causative genetic variants for inherited retinal degenerations have been identified.

In children and young adults, STGD is the most common form of autosomal recessive inherited retinal degeneration, leading to visual impairment of 1 in 10,000 people. There are available mouse models for STGD, but they all have limitations as the mouse retina is lacking the cone- rich macula, which is the primarily affected area in humans. In addition, the very small size of the murine eye complicates experimental treatments and follow-up. There has, therefore, been an ongoing effort to develop a canine model for STGD, as the canine eye is morphologically more similar to the human eye. Today no such canine models for STGD are, however, available. SUMMARY

It is a general objective to provide methods and kits capable of detecting inherited retinal dystrophies in dogs.

This and other objectives are met by embodiments as disclosed herein.

The present invention is defined in the independent claims. Further embodiments of the present invention are defined in the dependent claims.

The present invention is based on detecting absence or presence of an ATP binding cassette subfamily A member 4 (. ABCA4 ) mutation causing an autosomal recessive retinal degenerative disease in dogs. The method comprises detecting, in nucleic acids present in a biological sample from a dog, the ABCA4 mutation comprises insertion of a nucleotide in connection with a cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene located on chromosome 6. Alternatively, the method comprises detecting, in a biological sample from a dog, a truncated ABCA4 protein coded by a canine ABCA4 gene comprising the ABCA4 mutation.

Further aspects include methods of diagnosing an autosomal recessive retinal degenerative disease, mutated ABCA4 nucleotide sequences, exon 28 of canine ABCA4 gene comprising the ABCA4 mutation.

The ABCA4 mutation is the first causative mutation in the canine ABCA4 gene for a canine inherited retinal degeneration. Accordingly, a canine subject homozygote for the ABCA4 mutation can be used as a canine model for a human autosomal recessive retinal degenerative disease. The invention also relates to provision of such a canine model.

BRIEF DESCRIPTION OF THE DRAWINGS

The embodiments, together with further objects and advantages thereof, may best be understood by making reference to the following description taken together with the accompanying drawings, in which: Fig. 1 shows retinal morphology and function in canine Stargardt disease (la) The tapetal fundus of an affected dog shows a reduced reflection of light, mottling (black arrows indicating three darker foci) and slight attenuation of the retinal blood vessels (white arrows) (lb) Optical coherence tomography (OCT) images along the visual streak in three age-matched dogs (white vertical arrows indicate where two images have been concatenated). Retinal layering and thickness of both outer and inner retinal layers appeared similar in an unaffected dog (top) and a carrier (middle). In the retina of an affected dog (bottom) a general neuroretinal thinning was observed (light gray oblique arrow) including patches of severe retinal atrophy (white hatched arrow) (lc) Histology of a wild-type dog and (ld) histology of an affected dog, where photoreceptor nuclei appeared less densely packed, cones (oblique arrows) were scarce and accumulation of lipofuscin was abundant in retinal epithelial cells (vertical black arrows) (le) Testing of retinal function showed that the inclination of the first part of the a-waves of the dark-adapted FERG in response to a bright flash (arrow) is less steep and the amplitude of the a-waves are lower in both a carrier (light gray tracing) and an affected (black) dog compared to the age-matched unaffected dog (dark gray). The a-wave of the affected dog is widened with longer implicit time. Furthermore, oscillatory potentials are less conspicuous and the first part of the b-wave is essentially lost. Light-adapted cone transient responses (lf) and cone flicker (lg) were profoundly abnormal in the affected dog, but considerably closer to normal in the carrier. FERG = flash-electroretinography; RPE = retinal pigment epithelium; OS = outer segments; OLM = outer limiting membrane; ONL = outer nuclear layer.

Fig. 2 shows loss-of-fimction mutation in the canine ABCA4 gene. (2a) Sanger sequencing traces spanning positions Chr6:55, 146,545-55, 146,564 (Canfam3. l) including the mononucleotide-repeat in exon 28 of the ABCA4 gene of a wild-type ABCA4 ^+/+ dog (top, SEQ ID NO: 11), a heterozygous ABCA4 ^+/~ dog (middle, SEQ ID NO: 12), and a homozygous ABCA4 ¹ dog (bottom, SEQ ID NO: 13). (2b) Predicted structure of canine full-length ABCA4 protein (based on the proposed human structure) highlighting the first extracellular domain (ECD1), first membrane-spanning region (TMD1), first nucleotide-binding domain (NBD1), second extracellular domain (ECD2), second membrane-spanning region (TMD2) and second nucleotide-binding domain (NBD2) and the putative truncated product as a result of the premature stop codon at amino acid position 1,395. (2c) Schematic representation of the region where the insertion of cytosine (C) is found showing the nucleotide sequences (top, SEQ ID NO: 14; bottom, SEQ ID NO: 13) and amino acid sequences (top, SEQ ID NO: 15; bottom, SEQ ID NO: 16) of a full-length (top) and truncated (bottom) protein. (2d) Predicted topological organization of ABCA4 and its domains with the insertion leading to a premature stop codon marked with an arrow. The topological organization is based on the proposed human topological organization.

Fig. 3 shows characterization of ABCA4 mRNA expression and Western blot analysis of ABCA4 protein levels in the canine retina. (3a) Relative ABCA4 mRNA expression levels by quantitative RT-PCR in three different regions. The retinal mRNA was extracted from three dogs with different genotypes (ABCA4 ^+/+ , ABCA4 ^+/ and ABCA4 ⁷ ), normalized to Glyceraldehyde 3-phosphate dehydrogenase ( GAPDH) expression. (3b) Western blot analyses of ABCA4 (above), GAPDH (middle), and RHO (below) protein levels in retinal tissue, showing absence of ABCA4 protein in the ABCA4 ⁷ retina and markedly reduced level of ABCA4 protein in the ABCA4 ^+/ retina. In contrast, the levels of the reference protein GAPDH and rod photoreceptor-specific protein RHO appeared to be similar between all three samples.

Fig. 4 show fluorescence histochemistry of ABCA4, cone photoreceptors, and autofluorescence in wild-type, heterozygous, and affected canine retinas. (4a-4c) Fluorescence micrographs showing ABCA4 expression (dark gray), FITC-conjugated peanut agglutinin (PNA, light gray) and DAPI nuclear staining (gray) in wild-type (ABCA4 ^+/+ ), heterozygous (ABCA4 ^+/ ), and affected (ABCA4 ^/_ ) retinas. PNA labels cone photoreceptors. Autofluorescence, indicative of lipofuscin accumulation, was seen in the ABCA4 RPE (4d) Bar graph with the average number of DAPI-stained nuclei within a given region of the ONL and the INL. (4e-4g) Fluorescence micrographs of RPE without immunohistochemistry show autofluorescence. (4h) Bar graph with background-corrected mean autofluorescence-intensity in the RPE. Note the reduction of ABCA4-immunoreactivity, PNA binding, higher autofluorescence, and fewer nuclei in the ONL in the ABCA4 ⁷ compared to ABCA4 ^+/+ or ABCA4 ^+/ retinas. All scale bars = 50 pm; RPE = retinal pigment epithelium; ONL = outer nuclear layer; INL = inner nuclear layer. Because there was only one individual per genotype, the statistics are valid for the technical replicates. ANOVA with Tukey’s post hoc test, n=6; **P < 0.01; ***P < 0.001; ****P < 0.0001; mean ± S.D.

Fig. 5 illustrates pedigree of the Labrador retriever dogs used in the study. Filled symbols indicate affected individuals, half-filled symbols represent obligate or genotyped carriers of the ABCA4 insertion. Individuals LAB1 to LAB4 were used in the whole-genome sequence (WGS) analysis. Numbered individuals were genotyped for the insertion in the ABCA4 gene (c.4l76insC) and for the non-synonymous substitution in the USH2A gene (c.7244C>T). In addition, five unrelated, unaffected dogs (not shown in the figure) were genotyped and found to be either wild-type or heterozygous for the variants in the ABCA4 and the USH2A gene (LAB21 to LAB25). Crosses intersecting the dashed lines indicate the number of generations between the individuals.

DETAILED DESCRIPTION

The present invention generally relates to retinal dystrophies, and in particular to inherited retinal dystrophies in dogs.

Autosomal recessive retinal degenerative diseases cause visual impairment and sometimes blindness in both humans and dogs. Currently, no standard treatment is available but pioneering gene therapy based on canine models have been instrumental for clinical trials in humans. For ATP binding cassette subfamily A member 4 (. ABCA4 ) mediated diseases, such as Stargardt disease (STGD), no large animal models are available.

The present embodiments are based on the identification of a causative mutation in the canine ABCA4 gene for the canine inherited retinal degeneration. The ABCA4 gene encodes, in dogs and humans, the ABCA4 protein, which is a member of the ATP -binding cassette transporter gene sub-family A. The human orthologous gene was first cloned and characterized in 1997 as a gene that causes Stargardt disease (STGD), an autosomal recessive disease that causes macular degeneration. The ABCA4 gene transcribes a large retina-specific protein with two transmembrane domains (TMD), two glycosylated extracellular domains (ECD), and two nucleotide-binding domains (NBD), see Figs. 2b and 2d.

As is shown in Fig. 2d, one TMD spans across membranes with six units linked together to form a domain. The TMDs are usually not conserved across genomes due to its specificity and diversity in function as channels or ligand-binding controllers. However, NBDs are highly conserved across different genomes— an observation consistent with its function in binding and hydrolyzing adenosine triphosphate molecules (ATP). NBD binds ATP to utilize the high- energy inorganic phosphate to carry out change in conformation of the ABC transporter. When TMDs are situated in a membrane, they form a barrel-like structure permeable to retinoid ligands and control channel access to its binding sites. Once an ATP is hydrolized at the NBDs of the channel, NBDs are brought together to tilt and modify TMDs to modulate ligand binding to the channel.

The ABCA4 protein is almost exclusively expressed in retina localizing in outer segment disk edges of rod photoreceptors. ABCA4 may function as an inward-directed retinoid flippase. Flippase is a transmembrane protein that "flips" its conformation to transport materials across a membrane. In the case of ABCA4, the flippase facilitates transfer of A -retinyli dene- phosphatidyl ethanol amine (A-Ret-PE). A-Ret-PE is a reversible adduct spontaneously formed between d\\-tr ans-r etmdX and phosphatidylethanolamine (PE) and is unable to diffuse across the membrane by itself. Once transported by ABCA4, A-Ret-PE is dissociated and all-/ra//.s- retinal will re-enter the visual cycle. Defective ABCA4 leads to accumulation of A-Ret-PE, which together with all-/ra ^, -retinal, will form di-retinoid-pyridinium- phosphatidylethanolamine (A2PE) that is further hydrolyzed to phosphatidic acid (PA) and a toxic bis-retinoid, di-retinal-pyridinium-ethanolamine (A2E). This will lead to an accumulation of A2E in retinal pigment epithelium (RPE) cells when photoreceptor discs are circadially shed and phagocytosed by the RPE. A2E is a major component of RPE lipofuscin, accounts for a substantial portion of its autofluorescence, and has a potentially toxic effect on the RPE leading to photoreceptor degeneration. In ABCA4-mediated diseases, cone photoreceptors are typically affected prior to rods. The accumulation of lipofuscin and the degeneration of cones seen in this study of Labrador retrievers are also characteristic of STGD in humans.

In humans, mutations in the ABCA4 gene are known to cause the autosomal recessive disease STGD, which is a hereditary juvenile macular degeneration disease causing progressive loss of photoreceptor cells. STGD is characterized by reduced visual acuity and color vision, loss of central (macular) vision, delayed dark adaptation, and accumulation of autoflourescent RPE lipofuscin.

More than 500 putative mutations have been proposed for ABCA4 in humans, of which over 200 have been implicated with disease phenotypes, such as STDG. Additional diseases that are caused by mutations in the ABCA4 gene include macular dystrophy, fundus flavimaculatus, cone-rod dystrophy (CRD), retinitis pigmentosa (RP), Leber congenital amaurosis (LCA) and age-related macular degeneration (AMD). Thus, this heterogeneous group of diseases with overlapping phenotypes are often referred to as Af?C44-mediated or 4 /i( 4 -/-associated diseases. To date, there is no standard treatment for STDG and the mouse models are the only available animal models to study the disease. As a nocturnal animal, the morphology of the mouse eye differs from humans and, therefore, the mouse models are not ideal for developing methods for treatment. For this reason, over the last decades there has been an interest in finding a canine model for 6C44-mediated diseases. Zangerl et al, 2010 investigated the polymorphism of ABCA4 in dogs. However, none of the polymorphisms observed in that study were shown to be associated with any retinal degeneration.

The present invention is based on the identification of a loss-of-function mutation in the canine ABCA4 gene that causes a canine form of ABCA 4-mediated diseases, such as STGD. Hence, this loss-of-function mutation is the first mutation identified in the canine ABCA4 gene that has been associated with retinal degenerations in dogs.

The identified mutation in the canine ABCA4 gene involves a single base pair (bp) frameshift insertion of a cysteine (C) in a cytosine mononucleotide-repeat region in exon 28 of the ABCA4 gene resulting in a non- synonymous substitution at the first codon downstream of the repeat and subsequently leads to a premature stop codon, see Fig. 2c. The single base pair insertion, thus, occurs in a region where the canine reference sequence consists of seven cytosines (CanFam3. l Chr6:55, 146,550-55, 146,556). The identified insertion is thereby a loss-of- function mutation of the ABCA4 gene, resulting in a truncated and non-functional ABCA4 protein.

An aspect of the embodiments relates to a method of detecting an ABCA4 mutation causing an autosomal recessive retinal degenerative disease in a canine subject. The method comprises obtaining a biological sample comprising nucleic acids from a canine subject. The method also comprises detecting, in the nucleic acids present in the biological sample, the ABCA4 mutation comprising insertion of a nucleotide in connection with a cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene located on chromosome 6.

The ABCA4 mutation thereby involves, consists of or is in the form of insertion of a nucleotide in connection with the cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene. The above described method comprises detecting the ABCA4 mutation in nucleic acids in a biological sample taken from the canine subject. In an alternative approach, the detection of the ABCA4 mutation could instead be performed based on a biological sample comprising proteins from the canine subject.

Such a method of detecting an ABCA4 mutation causing an autosomal recessive retinal degenerative disease in a canine subject comprises obtaining a biological sample comprising proteins from a canine subject. The method also comprises detecting, in the biological sample, a truncated ABCA4 protein coded by a canine ABCA4 gene comprising the ABCA4 mutation comprising insertion of a nucleotide in connection with a cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene located on chromosome 6.

The full-length amino acid sequence of exon 28 of the canine ABCA4 protein coded by the wild-type ABCA4 gene is presented in SEQ ID NO: 19. The amino acid sequence of exon 28 of the truncated ABCA4 protein coded by the ABCA4 gene comprising the ABCA4 mutation is presented in SEQ ID: 20. As is further shown in Fig. 2c, the ABCA4 mutation causes a change in amino acids at positions 1,393 and 1,394 of the ABCA4 protein, i.e., from Phe and Glu into Leu and Trp, and a following stop of the amino acid chain resulting in the truncated ABCA4 protein with only 1,394 amino acids. The wild-type ABCA4 protein comprises 50 exons in dog with a total of 2,268 amino acids.

Another aspect of the embodiments relates to a method of diagnosing an autosomal recessive retinal degenerative disease in a canine subject. The method comprises obtaining a biological sample comprising nucleic acids from a canine subject. The method also comprises detecting, in the nucleic acids present in the biological sample, an ABCA4 mutation comprising insertion of a nucleotide in connection with a cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene located on chromosome 6. The method further comprises diagnosing the canine subject with the autosomal recessive retinal degenerative disease based on presence of the ABCA4 mutation in nucleic acids present in the biological sample.

Hence, the canine subject is diagnosed with the autosomal recessive retinal disease when presence of the insertion of the nucleotide in connection with the cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene is detected in the nucleic acids present in the biological sample. In an embodiment, the method comprises diagnosing the canine subject with the autosomal recessive retinal degenerative disease if the canine subject is homozygote for the ABCA4 mutation.

In an embodiment, the method according to any of the aspects above comprises determining whether the canine subject is homozygote for the ABCA4 mutation, heterozygote for the ABCA4 mutation, or lacks the A CA4 mutation.

The diagnosis of the autosomal recessive retinal degenerative disease can alternatively be performed by analyzing proteins in a biological sample from a canine subject. Such a method of diagnosing an autosomal recessive retinal degenerative disease in a canine subject comprises obtaining a biological sample comprising proteins from a canine subject. The method also comprises detecting, in the biological sample, a truncated ABCA4 protein coded by a canine ABCA4 gene comprising an ABCA4 mutation comprising insertion of a nucleotide in connection with a cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene located on chromosome 6. The method further comprises diagnosing the canine subject with the autosomal recessive retinal degenerative disease based on presence of the truncated ABCA4 protein in the biological sample.

In an embodiment, detecting the truncated ABCA4 protein comprises detecting, in the biological sample, a truncated ABCA4 protein comprising 1394 amino acids coded by the canine ABCA4 gene comprising the ABCA4 mutation.

In an embodiment, diagnosing the canine subject comprises diagnosing the canine subject with the autosomal recessive retinal degenerative disease when presence of the truncated ABCA4 protein is detected in the biological sample but no full-length ABCA4 protein is detected in the biological sample.

In an embodiment, the methods also comprise extracting the nucleic acids or proteins from the biological sample obtained from the canine subject.

Any extraction method involving extraction of nucleic acids or proteins from a biological sample can be used according to the embodiments. In an embodiment, the nucleic acids in the biological sample are DNA. In another embodiment, the nucleic acids in the biological sample are RNA, such as mRNA.

In an embodiment, the biological sample is a biological fluid sample, such as a blood sample or a plasma sample. In another embodiment, the biological sample is a tissue sample, such as a hair sample. A further example is a biological sample from a mouth swab.

In an embodiment, the canine subject is a Labrador retriever. However, the present embodiments are not limited to Labrador retriever but may also involve other dog breeds.

In an embodiment, the autosomal recessive retinal degenerative disease is an 6C4 -mediated disease. In a particular embodiment, the ABCA ^-mediated disease is selected from the group consisting of macular dystrophy, fundus flavimaculatus, CRD, RP, LCA, AMD and STGD. In a particular embodiment, the autosomal recessive retinal degenerative disease is STGD. In another particular embodiment, the autosomal recessive retinal degenerative disease is a canine form or variant of the autosomal recessive retinal degenerative disease selected from the group consisting of macular dystrophy, fundus flavimaculatus, CRD, RP, LCA, AMD and STGD, and preferably a canine form or variant of STGD.

In an embodiment, the ABCA4 mutation comprising insertion of the nucleotide in connection with the cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene located on chromosome 6 is an insertion of a single nucleotide.

In an embodiment, the ABCA4 mutation involves insertion of the nucleotide at the beginning of the cytosine mononucleotide repeat region. In another embodiment, the ABCA4 mutation involves insertion of the nucleotide at the end of the cytosine mononucleotide repeat region. In a further embodiment, the ABCA4 mutation involves insertion of the nucleotide inside the cytosine mononucleotide repeat region.

In an embodiment, the ABCA4 mutation involves insertion of a cytosine (C) in connection with the cytosine mononucleotide repeat region. The cytosine mononucleotide repeat region is preferably a sequence consisting of seven cytosines.

The canine ABCA4 gene is located on chromosome 6 between position 55,058,361 and position 55, 186,217 (CanFam3. l). In an embodiment, the cytosine mononucleotide repeat region is located on chromosome 6 between position 55,146,550 and position 55, 146,556 (CanFam3. l). The insertion in this region results in a non-synonymous substitution at the first codon downstream of the cytosine mononucleotide repeat region and subsequently leads to a premature stop codon (p.Fl393Lfs* l395).

In an embodiment, the methods comprises detecting the presence or absence of the loss-of- function mutation in the nucleic acids from the biological sample, i.e., detecting the presence or absence of the insertion of the nucleotide in connection with the cytosine mononucleotide repeat region in the canine ABCA4 gene located on chromosome 6.

Hence, the ABCA4 mutation comprises, in an embodiment, insertion of the single nucleotide resulting in a non-synonymous substitution at a first codon downstream of the cytosine mononucleotide repeat region and leading to a premature stop codon in exon 28 of the canine ABCA4 gene, see Fig. 2c.

The present invention is based on the identification of the causative mutation in the canine ABCA4 gene for the canine inherited retinal degeneration and the development of a genetic test in predicting the genetic constitution of a dog with regards to the presence or absence of the said mutation. Such test has a major utility in the breeding of healthy Labrador retrievers, one of the most numerous dog breeds in Sweden, Europe and the U.S.

The method can comprise extracting a nucleic acid from a sample, e.g., a blood sample or hair sample, obtained from dogs, e.g., Labrador retrievers. The method comprises detecting in the nucleic acid the presence or absence of the mutations in the canine ABCA4 gene at chromosome 6, preferably the presence or absence of an insertion of a single base pair insertion of a cytosine (C) in a cytosine mononucleotide-repeat region in exon 28, where the canine reference sequence consists of seven cytosines (CanFam3. l Chr6:55, 146,550-55, 146,556). The insertion in this region results in a non-synonymous substitution at the first codon downstream of the repeat, and subsequently leads to a premature stop codon (p.Fl393Lfs*l395). The identified insertion is a loss-of function mutation of the ABCA4 gene.

More specifically, the method comprises detecting in the nucleic acid the presence or absence of an insertion of a single base pair insertion of a cytosine (C) in a cytosine mononucleotide- repeat region in exon 28 of the canine ABCA4 gene, where the canine reference sequence consists of seven cytosines (CanFam3. l Chr6:55, 146,550-55, 146,556).

Hence, in an embodiment the canine ABC A 4 gene comprising th eABCA4 mutation has an exon 28 as defined in CanFAm3. l with coordinates or positions 55,136,497 - 55,146,621 and having a cytosine (C) within the cytosine mononucleotide repeat region having coordinates or positions 55,146,550 - 55,146,556.

In a particular embodiment, the canine ABCA4 gene comprising the ABCA4 mutation has an exon 28 as defined in SEQ ID NO: 18. The corresponding wild-type sequence of exon 28 of the canine ABCA4 gene is presented in SEQ ID NO: 17.

In a particular embodiment, the method comprises detecting in the nucleic acid the presence or absence of the above mentioned ABCA4 mutation to identify or determine whether the canine subject is homozygote for the ABC A4 mutation, denoted ABCA4 ^~/~ herein; heterozygote for the ABCA4 mutation, denoted ABCA4 ^+/~ herein; or wild type, i.e., lacks the ABCA4 mutation, denoted ABCA4 ^+/+ herein. In the case of a canine subject being ABCA4 ^~/~ , then only the mutated variant or allele oiABCA4 is present in the nucleic acid. In the case of a canine subject being ABCA4 ^+/+ , then only the wild type variant or allele of ABCA4 is present in the nucleic acid (absence of the ABCA4 mutation), whereas an ABCA4 ^+/~ canine subject has both the mutated and wild type variant or allele of the ABCA4 gene.

The expression“detecting (the presence or absence of) an insertion” as used herein involves the determination or identification whether a particular nucleotide sequence comprising the above mentioned ABCA4 mutation is present in the biological sample. There are several methods known by those skilled in the art for determining whether such nucleotide sequence is present in a biological sample. Such methods may optionally include the amplification of a nucleic acid segment, such as DNA or cDNA segment, encompassing the genetic marker by means of the polymerase chain reaction (PCR) or any other amplification method and then interrogate the genetic marker. The interrogation of the genetic marker can be done in various ways including, but not limited to the following methods, allele-specific hybridization, the 3’ exonuclease assay (Taqman assay), fluorescent dye and quenching agent-based PCR assay, the use of allele-specific restriction enzyme (RFLP -based technique), direct sequencing, the oligonucleotide ligation assay (OLA), pyrosequencing, the invader assay, mini sequencing, DHPLC-based techniques, single strand conformational polymorphism (SSCP), allele-specific PCR, denaturating gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), chemical mismatch cleavage (CMC), heteroduplex analysis based system, technique based on mass spectroscopy, invasive cleavage assay, polymorphism ratio sequencing (PRS), microarrays, a rolling circle extension assay, HPLC-based technique, extension based assay, amplification refractory mutation system (ARMS), amplification refractory mutation linear extension (ALEX), single base chain extension (SBCE), molecular beacon assay, invader (third wave technologies), ligase chain reaction assay, 5’ nuclease assay-based technique, hybridization capillary array electrophoresis (CAE), protein truncation assay (PTT), immunoassay, and solid phase hybridization (dot blot, reverse blot, chips). This list of methods is not meant to be exclusive, but just to illustrate the diversity of available methods. Some of these methods can be performed in accordance with methods of the present invention as PCR and Sanger sequencing methods or by any NGS methodology.

Detection of the truncated ABCA4 protein can be performed according to various embodiments. For instance, a size based assay, such as Western blot, can be used together with an anti-ABCA4 antibody for ABCA4 protein detection. In such a case, the anti-ABCA4 antibody preferably has specificity for the N-terminal portion of the ABCA4 protein ranging from exon 1 up to exon 28, preferably from exon 1 up to exon 27. The difference in amino acid length between the truncated ABCA4 protein and the full-length ABCA4 protein can thereby be used to detect presence of any truncated ABCA4 protein and any full-length ABCA4 protein in the biological sample.

Another technique could be based on using two anti-ABCA4 antibodies having specificity for different portions of the ABCA4 protein with one of the anti-ABCA4 antibodies having specificity for the N-terminal portion mentioned above and the other anti-ABCA4 antibody having specificity for a C-terminal portion of the ABCA4 protein ranging from exon 29 up to exon 50. In such a case, both anti-ABCA4 antibodies will bind to the full-length ABCA4 protein, whereas only one of the anti-ABCA4 antibodies will bind to the truncated ABCA4 protein.

Further aspects of the embodiments relates to a kit that can be used in the methods of detecting the ABCA4 mutation or of diagnosing an autosomal recessive retinal degenerative disease. The kit then comprises constituents, equipment, chemicals and/or reagents, etc. that can be used for detecting presence or absence of the ABCA4 mutation and optionally extracting the nucleic acids or proteins from the biological sample and/or optionally amplifying the extracted nucleic acids.

For instance, the kit can comprise the above describe anti- ABC A4 antibody having specificity for the N-terminal portion of the ABCA4 protein and optionally also the anti-ABCA4 antibody having specificity for the C-terminal portion of the ABCA4 protein. Examples of anti-ABCA4 antibodies having specificity for the C-terminal portion of the ABCA4 protein include, but are not limited to, anti-ABCA4 antibodies from United States Biological (catalogue number A0004-02D3-l00ug), Antibodies-Online (catalogue number ABIN263229), Novus Biologicals (catalogue number NB 100-93468) and MyBioSource.com (catalogue number MBS421967) having specificity for the epitope KQQTESHDLPLHPR (SEQ ID NO: 21) at the C-terminal portion of the ABCA4 protein and anti-ABCA4 antibodies from Novus Biologicals (catalogue number NBP1-30032) and Antibodies-Online (catalogue number ABIN2560857) having specificity for a C-terminal region of the ABCA4 protein. Anti-ABCA4 antibodies having specificity for a central region of the ABCA4 protein may be used to detect the truncated ABCA4 protein. Examples of such anti-ABCA4 antibodies binding to a central region of the ABCA4 protein include LifeSpan BioSciences (catalogue number LS-C354507- 100), Biorbyt (catalogue number orb234987), Antibodies-Online (catalogue number ABIN2705367) and MyBioSource.com (catalogue number MBS8219199).

Alternatively, the kit can comprise a sequencing primer that can be used to sequence at least the portion of exon 28 of the canine ABCA4 gene that includes the cytosine mononucleotide repeat region and thereby the potential ABCA4 mutation. Non-limiting, but illustrative, examples of such sequencing primers include ABCA4 (intron 27-28) F (SEQ ID NO: 7) and ABCA4 (intron 28-29) R (SEQ ID NO: 8) listed in Table 5, possibly lacking the Ml 3 sequencing tails. The kit may optionally also include primers useful in amplifying at least the portion of exon 28 of the canine ABCA4 gene that includes the cytosine mononucleotide repeat region. Non-limiting, but illustrative, examples of such amplifying primers include ABCA4 (exon 27) F (SEQ ID NO: 3) and ABCA4 (exon 28) R (SEQ ID NO: 4) listed in Table 5.

The present invention can help to select breeding dogs to prevent homozygosity in the offspring and consequently reduce the incidence of the autosomal recessive retinal degenerative disease and breeding of healthier dogs and improving animal welfare. The invention will also reduce costs for dog owners related to veterinary treatments of affected dogs. Further advantages of the invention is to provide new insights to the characterization of genetic variation of the ABCA4 gene in dogs and humans as well as to provide a model for gene therapy aimed at curing both human and canine patients.

Further aspects of the embodiments relates to nucleic acid sequences or molecules and vectors that can be used in gene therapy to treat canine subject suffering from the autosomal recessive retinal degenerative disease. The nucleic acid sequences or molecules and vectors can thereby be used in a gene therapy method to replace at least a portion of ABCA4 gene in chromosome 6, and in particular a portion comprising the cytosine mononucleotide-repeat region and the above described insertion mutation. In such a case, the portion with the ABCA4 mutation is preferably replaced by the wild-type nucleic acid sequence lacking the insertion mutation.

The vector could be a viral vector, such as a retrovirus, adenovirus, herpes simplex virus, or adeno-associated virus. Alternatively, non-viral vectors could be used to introduce the nucleotide acid sequences, including the injection of naked DNA, electroporation, the gene gun, sonoporation, magnetofection, the use of oligonucleotides, lipoplexes, dendrimers, and inorganic nanoparticles.

More recently, increased understanding of nuclease function has led to more direct DNA editing, using techniques, such as zinc finger nucleases and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/ CRISPR associated protein 9 (Cas9). CRISPR/Cas9 can be used for genome editing in order to treat or inhibit the autosomal recessive retinal degenerative disease. Such CRISPR/Cas9 genome editing may be performed with a Type II CRISPR system comprising Cas9, CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA) along with an optional section of DNA repair template that is utilized in either non- homologous end joining (NHEJ) or homology directed repair (HDR). crRNA contains the guide RNA that locates the correct section of host DNA along with a region that binds to tracrRNA (generally in a hairpin loop form) forming an active complex. tracrRNA binds to crRNA and forms an active complex. sgRNA, or single guide RNA, is a combined RNA consisting of a tracrRNA and at least one crRNA. Cas9 is a protein whose active form is able to modify DNA. Many variants exist with differing functions, i.e., single strand nicking, double strand break, DNA binding, due to the DNA site recognition function of Cas9. Repair template is DNA that guides the cellular repair process allowing insertion of a specific DNA sequence. CRISPR/Cas9 may employs a plasmid as a vector to transfect the target cells.

CRISPR/Cas9 offers a high degree of fidelity and relatively simple construction. It depends on two factors for its specificity: the target sequence and the protospacer adjacent motif (PAM). The target sequence is typically 20 bases long as part of each CRISPR locus in the crRNA array. A typical crRNA array has multiple unique target sequences. Cas9 proteins select the correct location on the host's genome by utilizing the sequence to bond with base pairs on the host DNA. The sequence is not part of the Cas9 protein and as a result is customizable and can be independently synthesized. Once these have been assembled into a plasmid and transfected into cells the Cas9 protein with the help of the crRNA finds the correct sequence in the host cell's DNA and - depending on the Cas9 variant - creates a single or double strand break in the DNA.

Properly spaced single strand breaks in the host DNA can trigger homology directed repair, which is less error prone than the non-homologous end joining that typically follows a double strand break. Providing a DNA repair template allows for the insertion of a specific DNA sequence at an exact location within the genome. The repair template preferably extend 40 to 90 base pairs beyond the Cas9 induced DNA break. The goal is for the cell's HDR process to utilize the provided repair template and thereby incorporate the new sequence into the genome. Once incorporated, this new sequence is now part of the cell's genetic material.

Further aspects of the present embodiments relates to the use of a canine subject that is homozygous for the ABCA4 mutation in a canine ABCA4 gene as a canine model for a human autosomal recessive retinal degenerative disease. The ABCA4 mutation comprises insertion of a nucleotide in connection with a cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene located on chromosome 6.

The human autosomal recessive retinal degenerative disease is preferably an ri 7> ( A -/-mediated disease, such as any of the previously described ABCA 7-mediated diseases, for instance human Stargardt disease.

Yet another aspect relates to a method of providing a canine model for a human autosomal recessive retinal degenerative disease. The method comprises identifying a canine sire that is heterozygote or homozygote for an ABCA4 mutation in a canine ABCA4 gene. The ABCA4 mutation comprises insertion of a nucleotide in connection with a cytosine mononucleotide repeat region in exon 28 of the canine ABCA4 gene located on chromosome 6. The method also comprises identifying a canine dam that is heterozygote or homozygote for the ABCA4 mutation. The method further comprises providing, as the canine model for the human autosomal recessive retinal degenerative disease, a pup that is homozygote for the ABCA4 mutation and originating from fertilization of an egg from the identified canine dam with sperm from the identified canine sire.

In an embodiment, the method further comprises inseminating the identified canine dam with the sperm from the identified canine sire.

In another embodiment, the method further comprises mating the identified canine dam and the identified canine sire.

Alternatively, the canine model for the human autosomal recessive retinal degenerative disease can be provided by utilizing new breeding techniques, such as CRISPR, Zinc finger nucleases, etc., in order to obtain a canine subject that is homozygote for the ABCA4 mutation. For instance, CRISPR/Cas can be used for genome editing in dogs to provide such a canine model.

As an example, such a canine subject can be provided by introducing, such as via electroporation, at least one polynucleotide into a gamete, such as an ovum or an egg, or a preimplantation stage embryo of a dog to modify the genome of the dog. Such a method may further comprise fusing the gamete with a gamete of the opposite gender, and allowing development into a live-bom genetically modified dog that is homozygote for the ABCA4 mutation.

In an embodiment, the preimplantation stage embryo is a l-cell embryo, i.e., a zygote, a 2-cell embryo, a 4-cell embryo, an early morula, or a late morula.

In an embodiment, the at least one polynucleotide comprises at least one of a coding sequence for a Type-II Cas9 protein and a CRISPR/Cas system. The at least one polynucleotide preferably also comprises a donor polynucleotide comprising the ABCA4 mutation.

The at least one polynucleotide may also, or in addition, comprise coding sequences for a Transcription Activator-Like Effector Nuclease (TALEN) specific for a target sequence in exon 28 of the canine ABCA4 gene, a coding sequence for a Zinc-finger Nuclease (ZFN) specific for the target sequence and/or a coding sequence for a BuD-derived nuclease (BuDN) specific for the target sequence.

The invention also relates to a mutated ABCA4 nucleotide sequence comprising the sequence ATTGTCCCCCCCTTTGGTGA (SEQ ID NO: 11) with a nucleotide inserted in connection with a cytosine mononucleotide repeat region.

In an embodiment, the mutated ABCA4 nucleotide sequence comprises the sequence ATTGTCCCCCCCCTTTGGTGA (SEQ ID NO: 13).

A further aspect of the invention relates to an exon 28 of canine ABCA4 gene, preferably an isolated exon 28 of canine ABCA4 gene, comprising an ABCA4 mutation comprising insertion of a nucleotide in connection with a cytosine mononucleotide repeat region of exon 28 of the canine ABCA4 gene.

In an embodiment, the (isolated) exon 28 of canine ABCA4 gene has the sequence as defined in CanFam3. l with coordinates or positions 55,146,497 - 55,146,621 and has a cytosine (C) within the cytosine mononucleotide repeat region having coordinates or positions 55,146,550 - 55,146,556. In a particular embodiment, the (isolated) exon 28 of canine ABCA4 gene has the sequence as defined in SEQ ID NO: 18.

EXAMPLES

To study a novel form of retinal degeneration in Labrador retriever dogs with clinical signs indicating cone and rod degeneration, we used whole genome sequencing of an affected sib- pair and their unaffected parents. A frameshift insertion in the ATP binding cassette subfamily A member 4 ( ABCA4 ) gene, leading to a premature stop codon in exon 28 (p.Fl393Lfsl395) was identified. In contrast to unaffected dogs, no full-length ABCA4 protein was detected in the retina of an affected dog. The discovery of a canine homozygous ABCA4 null mutation can be utilized in the development of dog as a large animal model for human STGD.

The strength of this study is that the effect of the mutation on the protein as well as RNA- expression could be investigated as retinal tissues were collected from the affected dog when it later was euthanized due to unrelated reasons (hemangiosarcoma in the spleen). Tissues from non-affected dogs were also available for comparison. These were used in Western blot analysis, fluorescence histochemistry and the RNA expression. In genetic studies of human retinal diseases, tissue samples are often unavailable. This makes it difficult to assess the functional effects of identified mutations. In addition to biochemical and functional of the mutation, we have used optical coherence tomography (OCT) and flash-electroretinography for careful clinical evaluation of photoreceptor function.

Taken together, we believe that the identification and careful molecular and phenotypic characterization of canine STGD will be of comparative value for human medicine, and improved treatment for Stargardt patients.

A Labrador retriever sib-pair, one male and one female, was diagnosed with a novel form of retinal disease; both cases, as well as their parents, were negative for the p.C2Y mutation. The affected dogs were visually impaired under both daylight and dim light conditions. Ophthalmoscopy revealed abnormal mottling of both central and peripheral retina (Fig. la), as well as subtle retinal vascular attenuation. An outer retinal atrophy was observed with optical coherence tomography (OCT) (Fig. lb). Compared to a retina of a normal dog (Fig. lc), loss of cones, increased lipofuscin accumulation in the RPE, as well as multifocal RPE hyperplasia and hypertrophy with focal atrophy of the overlying neuroretina were observed with light- microscopy in the affected male (Fig. ld). Flash-electroretinography demonstrated loss of cone function and abnormal rod responses, including abnormally slow dark-adaptation in affected dogs (Figs le-lg). Taken together, clinical features were atypical for PRA, but showed similarities to human STGD.

To identify genetic variants associated with this novel canine retinal disease, we performed whole genome sequencing (WGS) of the two affected individuals and their unaffected parents. This resulted in an average coverage of 18.2x (Table 1) and the identification of 6. Ox 10 ⁶ single nucleotide variants (SNVs) and 1.9* 10 ⁶ insertions/deletions (INDELs), of which 48,299 SNVs and 5,289 INDELs were exonic. We used conditional filtering to identify 322 SNVs (of which 117 were nonsynonymous) and 21 INDELs that were consistent with an autosomal recessive pattern of inheritance (Table 2). To further reduce the number of candidate variants, we compared the positions of the variants to 23 additional dog genome sequences to identify 18 nonsynonymous SNVs in 13 different genes and four INDELs in four genes that were private to the Labrador retriever family (Table 2 and Table 3). Fourteen of these genes were not strong candidates based on reported function and predicted effect and were not considered further. The remaining three genes, KIAA1549, Usherin (USH2A), and ATP binding cassette subfamily A member 4 (ABCA4) are listed in the Retinal Information Network (RetNet) database as associated with human retinal diseases and, thus, considered as causative candidates for canine retinal degeneration. However, the variant at the KIAA1549 gene was predicted to have a neutral effect on the protein structure (PROVEAN score -2.333, Polyphen-2 score 0.065) and was therefore discarded. The genetic variants in the USH2A (exon 43; c.7244C>T) and ABCA4 (exon 28; c.4l76insC) genes were validated by Sanger sequencing. Mutations in the USH2A gene are associated with Usher syndrome and RP, resulting in hearing loss and visual impairment. The identified nonsynonymous substitution in the USH2A was scored as “probably damaging” using Polyphen-2 (score of 0.97) and as“deleterious” using PROVEAN (score of -4.933) (Table 3). Next, we evaluated if the genetic variants of USH2A and ABCA4 were concordant with the disease by genotyping eight additional clinically affected and thirteen unaffected Labradors. Out of these dogs, 16 were related to the family quartet used in the WGS (Fig. 5). The USH2A variant was discordant with the disease phenotype and was therefore excluded from further analysis (Table 4). In contrast, all eight affected individuals were homozygous for the ABCA4 insertion and the 13 unaffected individuals were either heterozygous or homozygous for the wild-type allele (Table 4). Table 1 - Summary of the whole genome sequencing runs 1 and 2

Trimmed Reads Aligned

Sample Raw Reads Genome Coverage

(PE) Reads

Sire 87774533 170220526 167459818 6.89x

Dam 93481858 180868380 178187113 7.3 l x c

2 Offspring 1 90477985 173042946 170123976 6.97x

Offspring 2 86606183 159116462 155742221 6.36x

Total 358310559 683248314 671513128 6.88X ¹

Sire 97403683 190631228 190139797 l l .45x

( Dam 105820150 207496348 207180231 12.39 ^c

C

2 Offspring 1 97332856 189530524 188970159 l l .28x

Offspring 2 88190346 169699990 168707631 10.04 ^c

Total 388747035 757358090 754997818 11.29X ¹

¹ Average coverage across the samples

PE Paired-end

Table 2 - Number of exonic variants following autosomal recessive inheritance pattern

Trio 1 Trio 2 Quartet ETnique

Exonic variant AR AR Total AR

Frameshift

insertion 17 20 1679

Frameshift

deletion 30 14 1692

Frameshift

substitution 5

Stopgain 8 355

Stoploss 65

Nonframeshift

insertion 9 14 689

Nonframeshift

deletion 10 21 804

Nonsynonymous

SNY 534 461 22320 1 18

Table 2 illustrates the number of exonic variants following autosomal recessive inheritance pattern (AR) in Triol and Trio2, each consisting of the parents and one of the two offspring. The total number of exonic variants in the family quartet including all inheritance patterns and the number of AR variants shared between the two trios. The "unique" column represents the number of AR variants, which were shared between the two trios and not found to be homozygous in 23 additional investigated canine genome sequences.

Table 3 - List of coding sequence variants identified as private for the Labrador retriever family and the predicted effect of the variants based on Polyphen-2 and PRO YEAN scores

Variant nr Gene nr Ensembl gene id Gene name Description

Nonsynonymous SNV

C2 calcium dependent domain

1 1 ENSCAFG00000010228 C2CD2

containing 2

2 2 ENSCAFG00000004574 GIMAP1 GTPase, IMAP family member 1

3 3 ENSCAFG00000011011 HEPACAM hepatic and glial cell adhesion molecule

4 4 ENSCAFG00000002519 ITGB8 integrin subunit beta 8

5 5 ENSCAFG00000004115 KIAA1549 KIAA1549

6 6 ENSCAFG00000006103 NEK 11 NIMA related kinase 11

7 7 ENSCAFG00000009907 NTM neurotrimin

7 (isoform2) 7 ENSCAFG00000009907 NTM neurotrimin

olfactory receptor family 2 subfamily A

8 8a ENSCAFG00000029932 OR2A12

member 12

olfactory receptor family 2 subfamily A

9 8b ENSCAFG00000029932 OR2A12

member 12

olfactory receptor family 2 subfamily A

10 8c ENSCAFG00000029932 OR2A12

member 12

olfactory receptor family 2 subfamily A

11 8d ENSCAFG00000029932 OR2A12

member 12

12 9 ENSCAFG00000003800 PPFIA3 PTPRF interacting protein alpha 3

13 10 ENSCAFG00000002511 TWISTNB TWIST neighbor

13 (isoform2) 10 ENSCAFG00000002511 TWISTNB TWIST neighbor

14 11a ENSCAFG00000010731 USH2A usherin 15 l ib ENSCAFG00000010731 USH2A usherin

16 11c ENSCAFG00000010731 USH2A usherin

17 12 ENSCAFG00000011242 novel gene olfactory receptor

18 13 ENSCAFG00000011258 novel gene cOR8C4, olfactory receptor

Nonframeshift deletion

1 1 ENSCAFG00000003597 SCAF1 SR-related CTD associated factor 1

1 (isoform2) 1 ENSCAFG00000003597 SCAF1 SR-related CTD associated factor 1

Frameshift deletion

2 2 ENSCAFG00000003812 TRBV13 T Cell Receptor Beta Variable 13

2 (isoform2) 2 ENSCAFG00000003812 TRBV13 T Cell Receptor Beta Variable 13

Frameshift insertion

retinal-specific ATP-binding cassette

3 3 ENSCAFG00000020121 ABCA4

transporter

retinal-specific ATP-binding cassette

13 (isoform2) 3 ENSCAFG00000020121 ABCA4

transporter

4 4 ENSCAFG00000030298 novel gene uncharacterized protein

Variant nr Chr Position start Position end Reference nt Variant nt

Nonsynonymous SNV

1 31 36295441 36295441 C T

2 16 14793960 14793960 C A

3 5 9531601 9531601 A G

4 14 34436048 34436048 A T

5 16 9755342 9755342 C T

6 23 28355231 28355231 G T

7 5 2895430 2895430 T G

7 (isoform2) 5 2895430 2895430 T G

8 16 5809808 5809808 T G

9 16 5809737 5809737 T A

10 16 5809905 5809905 G A

11 16 5809827 5809827 G T

12 1 107316134 107316134 G A

13 14 33846199 33846199 T G

13 (isoform2) 14 33846199 33846199 T G

14 38 11342066 11342066 G A

15 38 11244630 11244630 C T

16 38 11207434 11207434 C T

17 5 9872669 9872669 A G

18 5 9976398 9976398 A G

Nonframeshift deletion

1 1 106883624 106883629 CTCCTC 1 (isoform2) 1 106883624 106883629 CTCCTC

Frameshift deletion

2 16 6895920 6895920 G

2 (isoform2) 16 6895920 6895920 G

Frameshift insertion

3 6 55146549 55146549 C

13 (isoform2) 6 55146549 55146549 C

4 5 2655617 2655617 AT

Variant nr Ensembl transcript id Exon Variant (c.) Variant (p.)

Nonsynonymous SNV

1 ENSCAFT00000016235 exon 14 G1991A R664Q

2 ENSCAFT00000007373 exon2 G805T V269L

3 ENSCAFT00000017511 exon2 A104G N35S

4 ENSCAFT00000003980 exon 10 A1481T N494I

5 ENSCAFT00000006593 exon2 C2579T S860L

6 ENSCAFT00000009895 exon 13 G1289T R430L 7 ENSCAFT00000015815 exonl A196C N66H

7 (isoform2) ENSCAFT00000043886 exon2 A232C N78H

8 ENSCAFT00000045310 exonl A794C H265P

9 ENSCAFT00000045310 exonl A865T N289Y

10 ENSCAFT00000045310 exonl C697T R233C 11 ENSCAFT00000045310 exonl C775A L259M 12 ENSCAFT00000006161 exon21 C2453T S818L 13 ENSCAFT00000003964 exon4 A832C K278Q

13 (isoform2) ENSCAFT00000045053 exon4 A913C K305Q

14 ENSCAFT00000017072 exon43 C7244T P2415L

15 ENSCAFT00000017072 exon54 G9652A A3218T

16 ENSCAFT00000017072 exon61 G10844A S3615N

17 ENSCAFT00000017860 exonl A877G K293E

18 ENSCAFT00000017883 exon2 T218C F73S

Nonframeshift deletion

1 ENSCAFT00000005794 exon8 3130 3135 del 1044_l045del

1 (isoform2) ENSCAFT00000047520 exon6 3133 _ 3 l38del l045_l046del

Frameshift deletion

2 ENSCAFT00000047863 exon2 283delC L95fs

2 (isoform2) ENSCAFT00000042775 exon2 3 l3delC Ll05fs

Frameshift insertion 3 ENSCAFT00000005367 exon28 4l70dupC* Vl390fs

13 (isoform2) ENSCAFT00000032029 exon28 4l70dupC* Vl390fs

4 ENSCAFT00000045921 exonl 84 85insAT S28fs

Variant nr Polyphen2_score PROVEAN score

Nonsynonymous SNV

1 BENIGN 0.396 -2.243 Neutral

2 Unknown 0.099 Neutral

3 PROBABLY DAMAGING 0.988 -2.222 Neutral

4 BENIGN 0.108 -2.569 Deleterious

5 BENIGN 0.065 -2.333 Neutral

6 BENIGN 0.004 0.104 Neutral

7 BENIGN 0.054 -0.681 Neutral

7 (isoform2) BENIGN 0.054 -0.673 Neutral

8 BENIGN 0.001 -4.946 Deleterious

9 BENIGN 0 7.440 Neutral

10 POSSIBLY DAMAGING 0.705 -6.912 Deleterious

11 BENIGN 0.003 1.622 Neutral

12 BENIGN 0.068 -0.323 Neutral

13 Unknown -1.269 Neutral

13 (isoform2) POSSIBLY DAMAGING 0.816 -1.269 Neutral

14 PROBABLY DAMAGING 0.97 -4.933 Deleterious

15 BENIGN 0.001 0.394 Neutral

16 BENIGN 0 -0.269 Neutral

17 POSSIBLY DAMAGING 0.858 -2.827 Deleterious

18 BENIGN 0.304 -5.881 Deleterious

Nonframeshift deletion

1 NA -1.789 Neutral

1 (isoform2) NA -2.088 Neutral

Frameshift deletion

2 NA NA

2 (isoform2) NA NA

Frameshift insertion

3 NA NA

13 (isoform2) NA NA

4 NA NA

*The insertion is found in a cytosine mononucleotide-repeat region and it is arbitrary at what position the actual insertion occurs. In the text we have denoted the insertion as c.4l76insC, p.Fl393Lfs*l395). Table 4 - Validation of variants c.4l76insC in ABC4 gene and C.C7244T in USH2A gene by

Sanger sequencing

Clinical status ABCA4 USH2A No. of indv.

Affected -/- +/- 7

Affected -/- +/+ 1

Healthy +/- -/- 3

Healthy +/- +/- 3

Healthy +/- +/+ 1

Healthy +/+ +/+ 2

Healthy +/+ +/- 3

Healthy +/+ -/- 1

Wild-type allele is indicated with“+” and the variant allele with In the ABCA4 gene, we identified a single base pair insertion of a cytosine (C) in a cytosine mononucleotide-repeat region in exon 28, where the canine reference sequence consists of seven cytosines (CanFam3. l Chr6:55, 146,550-55, 146,556) (Fig. 2a). The insertion in this region results in a non-synonymous substitution at the first codon downstream of the repeat, and subsequently leads to a premature stop codon (p.Fl393Lfs*l395) (Fig. 2c). If translated, this would result in a truncation of the last 874 amino acids of the wild-type ABCA4 protein (Figs. 2b-2c). Both the human and the dog ABCA4 gene consists of 50 exons and encodes a -250 kDa ABC transporter protein (human and dog ABCA4 consists of 2,273 and 2,268 amino acid residues, respectively). ABCA4 is localized to the disc membranes of photoreceptor outer segments and facilitates the clearance of all-/ra -retinal from the photoreceptor discs.

To compare retinal ABCA4 gene expression in an affected, a carrier, and a wild-type dog, we performed quantitative RT-PCR (qPCR). Primers were designed to amplify three different regions of the gene. The amplicons spanned the 5 '-end (exons 2-3), the identified insertion (exons 27-28) and the 3 '-end of the ABCA4 gene (exons 47-48) (Table 5). Each of the three primer pairs amplified a product of expected size in all three individuals. This suggests that despite the insertion leading to a premature stop codon in exon 28, the transcripts are correctly spliced. Relative levels of ABCA4 mRNA were lower for the allele with the insertion in comparison to the wild-type allele (Fig. 3a). This is consistent with nonsense-mediated decay (NMD) degrading a fraction of the transcripts with premature translation stop codon. Transcripts not targeted by NMD could potentially be translated into a truncated protein of only 1,394 amino acid residues including the first extracellular domain (ECD1), the first nucleotide-binding domain (NBD1) and two membrane-spanning regions (Fig. 2b) but lacking the second extracellular domain (ECD2) and the second nucleotide-binding domain (NBD2) (Figs. 2b-2d). The NBDs are conserved across species and the NBD2, which is also referred to as the ATP -binding cassette of the ABCA4 protein, has been shown to be particularly critical for its function as a flippase.

Table 5 - Canine primer Sequences used in the analysis Target PCR primer sequence 5' to 3' SEQ ID NO:

Real-Time qPCR primers

ABCA4 (exon 2) F ATTCGCTTTGTGGTGGAACT 1

ABCA4 (exon 3) R ATTCTCCCGGGGTAGGATTT 2

ABCA4 (exon 27) F CAAGCGATTCCACCACACTA 3

ABCA4 (exon 28) R TACTGCTGCCCATACATCCA 4

ABCA4 (exon 47) F GC ACC ATT C AGC ACCTC AAG 5

ABCA4 (exon 48) R GGC T AGGG A AG AGG AGG AG A 6

Sequencing primers with Ml 3 sequencing tails

ABCA4 (intron 27-28) F tgtaaaacgacggccagtCACCCACATTGCCATGTTTA 7

ABCA4 (intron 28-29) R caggaaacagctatgaccAACACATGGGGGTGAATGAT 8

USH2A (exon 43) F tgtaaaacgacggccagtACAAGTCATGCACAGTGGT 9

USH2 A (intron 43-44) R caggaaacagctatgaccGGAGACTTAGTAGCGAGGCA 10

To investigate the presence of full-length protein, we performed Western blot analysis using an anti-ABCA4 antibody recognizing a C-terminal epitope and detecting a protein product with an approximate size of -250 kDa. We observed a single, correctly-sized band in samples prepared from both wild-type and heterozygous dogs. The intensity of staining in retinal protein samples from the heterozygous individual was markedly lower in comparison to the samples from the wild-type retina (Fig. 3b). In contrast, no band was detected in the retinal sample from the affected dog. To confirm the presence of photoreceptor cells, we used an anti-RHO antibody and detected similar levels of rhodopsin in all three samples (Fig. 3b). These results suggest that no full-length protein product is produced as a result of the insertion leading to a frameshift and a premature stop codon. Fluorescence histochemistry was used to analyze the ABCA4 protein expression and peanut agglutinin (PNA)-binding in retinas from three dogs with different ABCA4 genotypes. PNA binds selectively to cones in the retina. ABCA4 immunoreactivity (IR) was seen in the outer part of the neural retina and the RPE. The pattern corresponded to photoreceptor outer segments and overlapped partially with the PNA label. PNA stained cone-shaped cells spanning both the inner and outer segments (Fig. 4a). ABCA4 IR was also seen on PNA- negative outer segments, likely to be rod photoreceptors and RPE. The ABCA4 IR and PNA patterns were similar in wild-type and heterozygous retinas. In sharp contrast, no ABCA4 IR was found in the affected retina (Figs. 4a-4c). In addition, no evident PNA-staining was observed, implying loss of cones. We therefore counted photoreceptor nuclei in the three genotypes and compared the outer and inner nuclear layers. The photoreceptor nuclei are positioned in the outer nuclear layer but not in the inner nuclear layer and there were fewer nuclei in the affected outer nuclear layer in the affected retina than in the wild-type or heterozygous retina (Fig. 4d). The corresponding reduction of nuclei was not seen in the inner nuclear layer, suggesting that photoreceptors were affected but not neurons in the inner nuclear layer. The loss of ABCA4 protein, loss of cone outer segment-PNA-staining, and the reduction of photoreceptor nuclei in the affected retina strongly imply that photoreceptors degenerate in the ABCA4 ^_/ retina.

The RPE layer of the affected retina was autofluorescent (Fig. 4c), indicating accumulation of lipofuscin. We analyzed autofluorescence in RPE from retinas of three dogs with different ABCA4 genotypes. The autofluorescence in the affected retina was higher than in that of the retinas in the other genotypes (Figs. 4g-4h). The higher autofluorescence indicates an increased accumulation of lipofuscin in the affected retina compared to the retinas from wild-type or heterozygous individuals.

The ABCA4 protein functions as an ATP-dependent flippase in the visual cycle, transporting A-retinylidene-phophatidyl ethanol amine (A-Ret-PE) from the photoreceptor disc lumen to the cytoplasmic side of the disc membrane. A-Ret-PE is a reversible adduct spontaneously formed between all-/ra«5-retinal and phophatidylethanolamine (PE), and is unable to diffuse across the membrane by itself. Once transported by ABCA4, A-Ret-PE is dissociated and all-//-< v- retinal will re-enter to the visual cycle. Defective ABCA4 leads to accumulation of A-Ret-PE, which together with all-/ra ^, -retinal, will form di-retinoid-pyridinium-phosphatidylethanolamine (A2PE) that is further hydrolyzed to phosphatidic acid (PA) and a toxic bis-retinoid, di-retinal- pyridinium-ethanolamine (A2E). This will lead to an accumulation of A2E in RPE cells when photoreceptor discs are circadially shed and phagocytosed by the RPE. A2E is a major component of RPE lipofuscin, accounts for a substantial portion of its autofluorescence, and has a potentially toxic effect on the RPE leading to photoreceptor degeneration. In ABCA4- mediated diseases, cone photoreceptors are typically affected prior to rods. The accumulation of lipofuscin and the degeneration of cones seen in this study of Labrador retrievers are also characteristic of STGD in humans.

Mutations in the human ABCA4 (. ABCR ) gene cause autosomal recessive STGD, autosomal recessive forms of CRD and RP. The gene was first cloned and characterized in 1997, and 873 missense and 58 loss-of-function variants have been reported in the ExAC database, many of which are associated with visual impairment. Currently, there is no standard treatment for STGD in humans and Abca4 ^~/~ mouse is the only available animal model. Mice, however, lack the macula, which is primarily the area affected in STGD, and although mouse models have provided insight into genesis of the lipofuscin fluorophore A2E, Abca4 ^~/~ mice do not exhibit a significant retinal degeneration phenotype. Unlike the mouse retina, the dog has a cone rich fovea-like area functionally similar to human fovea centralis. The canine eye is also similar in size to the human eye, and dog has successfully been used for experimental gene therapy for retinal degenerations, such as LCA, RP, rod-cone dysplasia type 1 (rcdl). For over a decade there has been interest in finding a canine model for ABCA4 mediated diseases. The loss-of- function mutation identified here can be used to develop large animal model for human STGD.

Materials and Methods

Animals and samples

A family quartet of Labrador retrievers (sire, dam, and two affected offspring numbered LAB1, LAB2, LAB3 and LAB4 respectively) were used in the whole genome sequencing (WGS). In addition, 16 related individuals (LAB5 to LAB20, see Fig. 5) as well as five unrelated Labradors (LAB21 to LAB25) were used to validate the WGS findings. Whole blood samples from these dogs were collected in EDTA tubes and genomic DNA was extracted using 1 ml blood on a QIAsymphony SP instrument and the QIAsymphony DSP DNA Kit (Qiagen). We obtained eyes from the affected male (LAB4) and his unaffected sibling (LAB6) at the age of 12, as well as from one unrelated, unaffected l l-year-old female Labrador retriever (LAB24) and one lO-y ear-old male German spaniel (GS) after their euthanization with sodium pentobarbithal (Pentobarbithal 100 mg/ml, Apoteket Produktion & Laboratorier AB) for unrelated reasons. All samples were obtained with informed dog owner consent. Ethical approval was granted by the regional animal ethics committee.

Ophthalmic exam and optical coherence tomography (OCT)

Ophthalmic examination included reflex testing, testing of vision with falling cotton balls under dim and daylight conditions, indirect ophthalmoscopy and slit-lamp biomicroscopy. The affected male (LAB4), his unaffected sibling (LAB6) and an unaffected, age-matched, female Labrador (LAB 22) were examined with spectral-domain OCT (Topcon 3D OCT-2000, Topcon Corp.). The examination was done after pupillary dilation, but without sedation, using repeated horizontal single line scans (6 mm, 1024 A-scans) (Topcon 3D OCT-2000, Topcon Corp.) along the visual streak area.

Flash-electroretinography (FERG)

We recorded FERG bilaterally from the three dogs examined with OCT under general anaesthesia. Sedation with intramuscular acepromazine 0.03 mg/kg (Plegicil vet., Pharmaxim Sweden AB) was followed by induction with propofol 10 mg/kg IV (Propovet, Orion Pharma Animal Health AB). After intubation, inhalation anaesthesia was maintained with isoflurane (Isoflo vet., Orion Pharma Animal Health AB). Corneal electrodes (ERG- JET, Cephalon A/S) were used with isotonic eye drops (Comfort Shield, i.com medical GmbH) as coupling agent. Gold plated, cutaneous electrodes served as ground and reference electrodes (Grass, Natus Neurology Inc.) at the vertex and approximately 3 cm caudal to the lateral canthi, respectively. Light stimulation, calibration of lights and processing of signals were performed as described by Karlstam et al., 2011. We used a slightly modified ECVO protocol (Ekesten et al., 2013), where the process of dark-adaptation was monitored for 1 hour before a dark-adapted response intensity series was performed.

Histopathology

Sectioned eyes from the affected male (LAB4) and the unaffected male GS were immersed in Davidson’s Solution. The eyes were dehydrated in ethanol, paraffin embedded, cut into 4 pm thick sections and stained with haematoxylin and eosin (H&E).

Whole-genome sequencing Genomic DNA from four Labrador retriever dogs (LAB1, LAB2, LAB3 and LAB4) was fragmented using the Covaris M220 instrument (Covaris Inc.) according to the manufacturer’s instructions. To obtain sufficient sequence depth, we constructed two biological replicates of libraries with insert sizes of 350 bp and 550 bp following TruSeq DNA PCR-Free Library Prep protocol. The libraries were multiplexed and sequenced on aNextSeq500 instrument (Illumina) for 100 x 2 and 150 x 2 cycles using the High Output Kit and High Output Kit v2, respectively. The raw base calls were de-multiplexed and converted to fastq files using bcl2fastq n.2.15.0 (Illumina). The two sequencing runs from each individual were merged, trimmed for adapters and low-quality bases using Trimmomatic v.0.32 (Bolger et al., 2014), and aligned to the canine reference genome CanFam3. l using Burrows- Wheeler Aligner (BWA) v.0.7.8 (Li & Durbin, 2009). Aligned reads were sorted and indexed using Samtools v. l .3 (Li et al., 2009) and duplicates were marked using Picard n.2.0.1. The BAM files were realigned and recalibrated with GATK v.3.7 (McKenna et al, 2010). Multi-sample variant calling was done following GATK Best Practices (DePristo et al., 2011) using publicly available genetic variation Ensembl Variation Release 88 in dogs ( Canis lupus familiaris). We filtered the variants found by GATK using the default values defining two groups of analyses: trio 1 and 2, both consisting of the same sire and dam, and one of their affected offspring. Variants annotated in the exonic region with ANNOVAR v.2017.07.16 (Wang & Hakonarson, 2010), presenting an autosomal recessive inheritance pattern and shared between the two trios were selected for further evaluation. To predict the effects of amino acid changes on protein function, we evaluated SNVs using PolyPhen-2 v2.2.2r398 (Adzhubei et al, 2010) and PROVEAN v. l . l .3 (Choi et al, 2012) and nonframeshift INDELS using PROVEAN v. l . l .3. Frameshift INDELs were manually inspected using The Integrative Genomics Viewer (IGV) (Robinson et al., 2011; Thorvaldsdottir et al., 2013).

Validation of the variants

To validate the WGS results, we designed primers amplifying the variants c.7244C>T in USH2A gene and c.4l76insC in ABCA4 gene with Primer3 (Koressar & Remm, 2007; Untergasser et al, 2012) (Table 5) and sequenced the family quartet using Applied Biosystems 3500 Series Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific). To test if the variants were concordant with the disease, 21 additional ophthalmologically evaluated Labrador retrievers were genotyped by Sanger sequencing. Eight of these dogs were clinically affected and thirteen showed no signs of retinal degeneration by the age of seven years. Quantitative RT-PCR (qPCR)

Neuroretinal samples were collected from the affected dog (LAB4), the heterozygous sibling (LAB6), and the unaffected female (LAB24). The samples were immediately preserved in RNAlater (SigmaAldrich), homogenized with Precellys homogenizer (Bertin Instruments) and total RNA was extracted with RNAeasy mini kit (Qiagen) according to the manufacturer’s instructions. RNA integrity and quality was inspected with Agilent 6000 RNA Nano kit with the Agilent 2100 Bioanalyzer system (Agilent Technologies). cDNA was synthesized using RT ² First Strand kit (Qiagen) with random hexamers provided in the kit. cDNA concentration was inspected with Qubit ssDNA Assay kit (Life Technologies). RT ² qPCR Primer Assay (Qiagen) was used to amplify the reference gene GAPDH. To amplify the target gene ABCA4 , we designed custom primers with Primer3 targeting three different regions spanning exons 2 to 3, 27 to 28, and 47 to 48 (Table 5). We amplified the cDNA fragments encoding regions of interest using RT ² SYBR Green ROX qPCR Mastermix (Qiagen) with StepOnePlus Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific), according to the manufacturer’s instructions. Target gene expression was normalized to expression of GAPDH , and shown relative to a control ABCA4 ^+/+ sample (DD('t method). The results were confirmed in two independent experiments.

SDS-Gel Electrophoresis and Western Blotting

We extracted protein from the neuroretinal samples of the individuals used in qPCR (see above) by homogenization in Pierce RIPA lysis buffer (Thermo Scientific) supplemented with phosphatase inhibitor cocktail (Sigma, P8340) using the Precellys homogenizer (Bertin Instruments). Protein concentration was determined using the Pierce BSA Protein Assay kit (Thermo Fischer Scientific). 50 pg of protein samples were resolved by SDS-PAGE, transferred to nitrocellulose membrane, and immunoblotted with the following primary antibodies: ABCA4 (Novus Biologicals, NBP1-30032, 1 : 1000), GAPDH (Thermo Scientific, MA5-15738, 1 : 1000), Rhodopsin (Novus Biologicals, NBP2-25160SS, 1 :5000), followed by Anti-Mouse IgG horseradish peroxidase-conjugated secondary antibody (R&D Systems, HAF007, 1 : 5000). Binding was detected using the Clarity western ECL substrate (Bio-Rad).

Fluorescence histochemistry

Tapetal fundus from the affected male (LAB4), his heterozygous sibling (LAB6), and the unaffected GS were fixed in 4% PFA in lx PBS on ice for 15 minutes, washed in l x PBS for 10 minutes on ice, and cryoprotected in 30% sucrose overnight at 4°C. The central part of the fundus was embedded in Neg-50™ frozen section medium (Thermo Scientific), and 10 pm sections were collected on Superfrost Plus slides (J1800AMNZ, Menzel-Glaser). The sections were re-hydrated in lx PBS for 10 minutes, incubated in blocking solution (1% donkey serum, 0.02% thimerosal, and 0.1% Triton X-100 in l x PBS) for 30 minutes at room temperature, and incubated in primary antibody ABCA4 (1 :500, NBP1-30032, Novus Biologicals) and FITC- conjugated lectin PNA (1 :400, L21409, Molecular Probes) solution at 4°C overnight. Following overnight incubation, the slides were washed 3 x 5 minutes in 1 x PBS and incubated in Alexa 568 secondary antibody (1 :2000, A10037, Invitrogen) solution for at least 2 hours at room temperature, and washed 3 x 5 minutes in l x PBS. The slides were mounted using ProLong® Gold Antifade Mountant with DAPI (P36931, Molecular Probes). Fluorescence images were captured using a Zeiss Axioplan 2 microscope equipped with an AxioCam HRc camera.

Counting nuclei

Ten micrometer retinal sections were mounted as described under Fluorescence histochemistry , and the number of nuclei within a region with a width of 67 pm that was perpendicular to and covered both the outer and inner nuclear layers were counted. Nuclei in the outer and inner nuclear layers were counted separately. We analysed six images from each of the three animals (LAB4, LAB6, and GS). Bar graphs were generated and statistical analysis of the technical replicates (one-way ANOVA with Tukey’s post hoc multiple comparison analysis) was performed in GraphPad Prism 7.

Autofluorescence

Retinal sections were washed, incubated in blocking solution, and mounted as described under Fluorescence histochemistry. The exposure times for the excitation at 488 nm and 568 nm were fixed for all images taken (150 ms and 80 ms, respectively). Outlines of the retinal pigment epithelium (RPE), as well as adjacent background regions, were drawn using the polygon selection tool in ImageJ (vl .5 l, NIH), and the area and mean fluorescence intensity were measured. The mean intensity of the autofluorescence in the RPE was calculated by subtracting the background intensity from the adjacent regions. We analysed six images from each of the three individuals used in the fluorescence histochemistry. Bar graph generation and statistical analysis were performed as described under Counting nuclei. The embodiments described above are to be understood as a few illustrative examples of the present invention. It will be understood by those skilled in the art that various modifications, combinations and changes may be made to the embodiments without departing from the scope of the present invention. In particular, different part solutions in the different embodiments can be combined in other configurations, where technically possible.

REFERENCES

Adzhubei, I. A. et al. A method and server for predicting damaging missense mutations. Nat Methods 7, 248-249 (2010).

Bolger, A.M., et al. Trimmomatic: a flexible trimmer for Illumina sequence data.

Bioinformatics 30, 2114-2120 (2014).

Choi, Y., et al. Predicting the functional effect of amino acid substitutions and indels. PLoS One 7, e46688 (2012).

DePristo, M.A. et al. A framework for variation discovery and genotyping using next- generation DNA sequencing data. Nat Genet 43, 491-498 (2011).

Ekesten, B., et al. Guidelines for clinical electroretinography in the dog: 2012 update. Doc Ophthalmol 127, 79-87 (2013).

Karlstam, L. et al. A slowly progressive retinopathy in the Shetland Sheepdog. Vet Ophthalmol

14, 227-238 (2011).

Koressaar, T. & Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 23, 1289-91 (2007).

Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform.

Bioinformatics 25, 1754-1760 (2009).

Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078- 2079 (2009).

McKenna, A. et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20, 1297-1303 (2010).

Robinson, J.T. et al. Integrative genomics viewer. Nature Biotechnology 29, 24 (2011).

Thorvaldsdottir, H., et al. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in Bioinformatics 14, 178-192 (2013). Untergasser, A. et al. Primer3— new capabilities and interfaces. Nucleic Acids Research 40, el l 5-el 15 (2012).

Wang, K., et al. H. ANNOVAR: functional annotation of genetic variants from high- throughput sequencing data. Nucleic Acids Res 38, el64 (2010). Zangerl, B. et al. Identification fo genetic variation and haplotype structure of the canine ABCA4 gene for retinal disease association studies. Mol Genet Genomics 284, 243-250 (2010).