FIBROSIS

The present invention regards a method for the in vitro diagnosis of idiopathic pulmonary fibrosis. More precisely, the invention regards a method for the in vitro diagnosis of a form of pulmonary fibrosis characterized by altered regulation of intracellular iron and by the consequential exaggerated generation of chelatable iron-dependent oxygen radicals. This is characterized in vitro by the presence of allelic variants of HFE, the gene for Type 1 hereditary hemochromatosis, by the abnormal expression in alveolar macrophages of SLC11A1/NRAMP1 gene transcripts, non coding for the full length protein, and by the quantity of intracellular free (chelatable) iron in pulmonary alveolar macrophages as compared to healthy subjects. This form of pulmonary fibrosis is included in the group of idiopathic interstitial pneumonias, preferably Idiopathic pulmonary fibrosis "IPF", not excluding nonspecific interstitial pneumonia or "NSIP", in its cellular (Cellular NSIP) or fibrosing (Fibrosing NSIP) forms, other fibrosing idiopathic interstitial pneumonias, even when associated with other diseases, in particular systemic illnesses. The idiopathic interstitial pneumonias also include cryptogenic organizing pneumonia or "COP", acute interstitial pneumonia or "AIP", respiratory bronchiolitis-associated interstitial lung disease or "RB-ILD", desquamative interstitial pneumonia or "DIP" and lymphocytic interstitial pneumonia or "LIP". Idiopathic pulmonary fibrosis (IPF) [histopathologically characterized by the usual interstitial pneumonia (UIP) pattern] or IPF/UIP differs from the other idiopathic interstitial pneumonias by its rapid progression, with an average survival of 2-4 years, in contrast to the higher mean survival of ten years in patients with NSIP or DIP.

The cause and the pathogenetic mechanism of idiopathic pulmonary fibrosis are presently unknown. Idiopathic pulmonary fibrosis is characterized by cell and tissue damage and interstitial inflammation and fibrosis affecting the pulmonary parenchyma: the pulmonary alveoli, the alveolar interstitium (the space between the pulmonary alveolar epithelium and the capillary endothelium), the peri-bronchial and the peri-vascular interstitium, leading to anatomic and functional damage.

The diagnosis, in the absence of a specific causal factor and specific biomarkers, is made on the basis of clinical criteria which include: the history, the physical exam, chest radiology, and, when the chest radiological findings are not sufficiently specific, the histopathology of lung tissue. Currently, there are no valid diagnosic tests based on the identification of genes for the susceptibility to the disease nor biomarkers specific for the disease. (An official ATS/ERS/JRS/ALAT statement: Idiopathic pulmonary fibrosis: evidence-based guidelines for diagnosis and management Am J Respir Crit Care Med. 201 1 Mar 15; 183(6):788-824.).

However, clinical studies have shown that the clinical, radiological and pathological criteria described above, used in the diagnosis of IPF/UIP, have low sensitivity and specificity in nonsmoking subjects, and are even less sensitive and specific in subjects with a history of smoking and emphysema (Akira M, Inoue Y, Kitaichi M, Yamamoto S, Arai T, Toyokawa K. Usual interstitial pneumonia and nonspecific interstitial pneumonia with and without concurrent emphysema: thin-section CT findings. Radiology. 2009 Apr;251 (1 ):271-9.).

It has been shown that one third of patients with NSIP present with histopatholoigical aspects of UIP in one or more lobes. These patients have a worse prognosis than patients with fibrosing NSIP without histological aspects of UIP. In addition, the observation that patients with NSIP associated with localized aspects of UIP, are 8-10 years older than patients with NSIP without localized aspects of UIP, suggests a connection - or a progression - from NSIP to IPF/UIP (Flaherty KR, Travis WD, Colby TV, Toews GB, Kazerooni EA, Gross BH, Jain A, Strawderman RL, Flint A, Lynch JP, Martinez FJ. Histopathologic variability in usual and nonspecific interstitial pneumonias. Am J Respir Crit Care Med. 2001 ; 164: 1722-7).

Is it therefore reasonable to think that patients who present with a radiological picture of pulmonary fibrosis that is not "possible" or not "confident" may in reality develop idiopathic pulmonary fibrosis of the type IPF/UIP.

IPF generally presents as a sporadic illness, but there are reported cases of familial aggregations which suggests an important component of genetic susceptibility. Certain genes have been associated with susecpitibility in the familial form of pulmonary fibrosis: in particular the genes that code for surfactant protein C (SFTPC), surfactant protein A (SFTPA2) or telomerase reverse transcriptase (TERT). These observations suggest the existence of genetic factors that may favor the susceptibility to noxious environmental substances, as in the case of tobacco smoke exposure (Lawson WE, Loyd JE, Degryse AL. Genetics in pulmonary fibrosis familial cases provide clues to the pathogenesis of idiopathic pulmonary fibrosis. Am J Med Sci. 2011 Jun;341(6):439-43).

Many studies have demonstrated that in idiopathic pulmonary fibrosis, pulmonary alveolar macrophages produce reactive oxygen species and are cytotoxic to pulmonary epithelial cells. (AM. Cantin, SL. North, GA. Fells, RC. Hubbard, and RG. Crystal Oxidant-mediated Epithelial Cell Injury in Idiopathic Pulmonary Fibrosis. J. Clin. Invest. 1987;79:1665-1673).

In the generation of oxygen radicals, in particular the hydroxyl radical which is the most toxic oxygen radical, iron plays an important role. Macrophagaes (i) phagocytize old and damaged red blood cells, thus recovering heme iron, (ii) return iron to the circulation, after binding it to transferrin, rendering it available for hemopoiesis and numerous vital cell processes, (iii) sequester iron in its inactive form in siderosomes, subcellular structures containing iron bound to ferritin, which reduces its toxic potential or (iv) use the iron for the production of oxygen radicals in order to destroy microorganisms. In this regard, it is known that the phagocytosis of mircroorganisms, for example air borne mircroorganisms, determines in the alveolar macrophages the activation of the production of superoxide anion (0 ₂ ^' ) [Saltini C, Brugni N., Magnani C, Capitolo S., Capelli O., Velluti G., Bisetti A. Chemiluminescence measurement of phagocytic activity of pulmonary macrophages in sarcoid alveolitis. Respiration 1984; 45: 291-295], a reactive compound of oxygen that can generate hydrogen peroxide (H2O2) by disproportionation on the part of the superoxide dismutase enzyme (SOD). Hydrogen peroxide can activate the production of the hydroxyl radical (ΉΟ), which is generated in the reaction between O ₂ ^" and H ₂ O ₂ , the Haber Weiss reaction, which produces ΉΟ + OH ^" + O2, or in the Fenton reaction which, in the presence of free iron, leads to the reduction of ferric iron (Fe ³⁺ ) to ferrous iron (Fe ²⁺ ) by O ₂ ^" , with the successive reduction of H ₂ O ₂ to ΉΟ + OH ^" on the part of Fe ²⁺ interaction with H2O2 and the consequent regeneration of Fe ³⁺ .

The normal regulation of iron transport permits the sequestration of iron by ferritin with a reduction in the risk of auto-toxicity by excessive ΉΟ radical production (Morris CJ, Earl JR, Trenam CW, Blake DR. Reactive oxygen species and iron-a dangerous partnership in inflammation. Int J Biochem Cell Biol. 1995 Feb;27(2):109-22).

In this context, according to the present invention, it has been hypothesized that a disturbance in the regulation of iron homeostasis in pulmonary macrophages is the basis of the exaggerated production of oxygen radicals and the cellular damage that characterizes idiopathic pulmonary fibrosis.

The movement of iron within the cell is finely regulated by specific proteins whose function is exemplified in the genetic alterations seen in the hereditary diseases of iron accumulation. Hereditary hemochromatosis is a disease characterized by exaggerated absorption of alimentary iron and the consequent appearance of tissue damage, including hepatic cirrhosis, cardiomyopathy, diabetes mellitus, hypogonadism andpigmentation of the skin, without involving the respiratory system. The disease is caused by allelic variants of four genes which code for proteins that regulate iron homeostasis and the level of iron absorption. The gene most frequently altered, which accounts for 80% of cases of hereditary hemochromatosis (HH), an autosomal recessive disease, is the HFE gene. In the presence of elevated concentrations of cellular iron, the HFE gene down-regulates transferrin receptor affinity for transferrin-bound iron, thus preventing the transport of iron, for example from plasma, into the cell, in order to maintain a stable level of intracellular iron. The pathogenetic mutations reduce the capacity of the HFE protein to regulate the activity of the transferrin receptor thereby leading to an increase in intracellular iron. The other genes, which constitute 20% of cases of HH (also called non- HFE HH) are (i) the gene for hepcidin (HAMP), a regulator of iron export from the cell (ii) the transferrin receptor 2 gene (TFR2) and (iii) the gene for ferroportin (SLC40A1), a transmembrane protein which transports iron from the inside to the outside of the cell. (Santos PC, Dinardo CL, Cancado RD, Schettert IT, Krieger JE, Pereira AC. Non-HFE hemochromatosis. Rev Bras Hematol Hemoter. 2012;34(4)-311-6).

Macrophages, and in particular the alveolar macrophages, are important in the homeostasis of pulmonary iron both through the increase in expression of the gene that codes for Ferritin H, the principal protein of the accumulation of intracellular iron, and through the reduction in the expression of the Ferroportin gene, coding for the protein that transports the iron outside of the cell, thus trapping the iron within the macrophage. An important role in the process of iron sequestration is also attributed to the gene SLC11A1 [solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1] previously named NRAMP1 [Natural resistance associated macrophage protein 1] which codes for a transporter of cations capable of transporting ferrous iron from phagolysosomes to the cytoplasm, depriving the phagocytized microbes of iron and favoring the acidification of the lysosome by the activation of the lysosomal lytic enzymes and vice versa, transporting ferrous iron into the phagolysosome hence activating the production of intra phagolysosomal hydroxyl radicals. Alterations in the function of the SLC11A1/NRAMP1 gene are associated with the susceptibility to infection by intracellular microorganisms in experimental animals. In humans, polymorphisms in the sequence of the SLC11A1/NRAMP1 gene have been associated with the susceptibility to pulmonary tuberculosis (Jabado N, Jankowski A, Dougaparsad S, Picard V, Grinstein S, Gros P. Natural resistance to intracellular infections: natural resistance-associated macrophage protein 1 (Nrampl) functions as a pH-dependent manganese transporter at the phagosomal membrane. J Exp Med. 2000 Nov 6; 192(9): 1237-48) and, in keeping with the capacity of the SLC1 1A1/NRAMP1 gene to up-regulate various innate immunity genes, to diseases linked to immune disorders.

According to the present invention, it has been shown that idiopathic interstitial pneumonia, identified as idiopathic pulmonary fibrosis IPF/UIP, is associated with genetic alterations in iron accumulation and transport in that patients afflicted with IPF/UIP present a higher frequency of heterozygosity for allelic variants of the HFE gene, in particular the allelic variants that code for H63D,C282Y and S65C and the non coding polimorphism IVS2+4 T>C as compared to healthy controls. In contrast, the same patients do not present an altered frequency of the allelic variants of the genes for Hepcidin (HAMP), the Transferrina 2 receptor (TFR2) and Ferroportin (SLC40A1 ).

The present invention has also shown that idiopathic interstitial pneumonia, identified as idiopathic pulmonary fibrosis IPF/UIP, is also associated with the dysregulation of the SLC1 1A1/NRAMP1 gene characterized by: (i) the missing expression of the isoform of messenger RNA capable of being translated into a protein of 550 amino acids (aa) in length (SLC1 1A1 -001 ) in the absence of expression of other transcriptis of the gene SLC1 1A1/NRAMP1 ; or (ii) the expression of some of the diverse truncated isoforms of mRNA, produced by alternate splicing of the pre- mRNA in particular SLC11A1_201 and SLC11A1_003, in the absence of the SLC1 1A1 -001 isoform coding for the protein of 550 aa in length; or (iii) the expression of a coding isoform for a truncated protein of 483 amino acids (GeneBank: D38171 ) missing the leader sequence necessary for anchoring to the lysosome, in the absence of the SLC1 1A1-001 isoform coding for the protein of 550 aa in length.

The SLC1 1A1/NRAMP1 gene expression abnormalities do not derive from a generalized disorder of the expression of mRNA of regulatory genes for cellular functions in macrophages, including homeostasis of iron and of oxidative stress, in the sense that the pulmonary alveolar phagocytes in patients with idiopathic pulmonary fibrosis express normal transcription levels for a number of genes coding for structural, iron-binding and anti-oxidant proteins. In addition, we have found that such an abnormality does not derive from a reduced efficiency of the system of amplification and revelation, in the sense that the presence/absence of the transcript for the "full length" protein of 550 aa is confirmed by an assay of "nested PCR" in which the amplification is at least 1000 times greater than with the RT-PCR PCR.

According to the present invention, it has also been shown that idiopathic interstitial pneumonia, identified as IPF/UIP, is associated with an abnormal concentration of iron not bound to ferritin [labile iron or lalbile iron pool (LIP)], capable of inducing the uncontrolled production of hydroxyl radical (ΉΟ), a highly toxic oxygen compound, by the Fenton reaction in which, in the presence of labile iron, hydrogen peroxide (H2O2) is reduced to hydroxyl radical, as measured by fluorometric and cytofluorometric assays.

It is important to remember that the carrier condition for allelic variants of the HFE gene is associated with, and represents, a factor of risk for the eccessive iron dependent generation of oxygen radicals, in particular hydroxyl radical, by pulmonary macrophages in these patients. It is important to note that the patients with interstitial pneumonia defined as IPF/UIP who carry allelic variants of the HFE gene, in particular H63D, C282Y and S65C and IVS2+4 T>C, and/or the abnormal expression of the SLC1 1A1/NRAMP1 gene, characterized by the lack of expression of the transcript coding for the "full length" protein, demonstrate a higher iron dependent production of oxygen radicals, inhibitable by iron chelators in vitro, in comparison with patients not carrying allelic variants of HFE and/or showing normal expression of SLC1 1A1/NRAMP1 , and healthy controls. Thus, these patients demonstrate an excessive concentration of intracellular free iron.

It is noteworthy that the carriage of allelic variants of the HFE gene in patients with pulmonary interstitial disease different from IPF/UIP is also associated with a more elevated iron dependent production of oxygen radicals. This condition, in the context of the observations that non fibrotic interstitial pneumonias, at the onset of the illness, may evolve into usual interstitial pneumonia, thus appears not only to be a diagnostic indicator of IPF/UIP, but also an indicator of progression towards pulmonary fibrosis in patients who present with a radiological picture of "possibile" IPF/UIP or of NSIP.

The present invention thus defines for the first time a form of pulmonary fibrosis characterized by the alterated regulation of cellular iron and consequent exaggerated generation of iron chelatable-dependent oxygen radicals, included, preferably but not exclusively, within the category of idiopathic interstitial pneumonias (MPs), which includes in particular idiopathic pulmonary fibrosis "IPF7UIP, and also non specific interstitial pneumonia or "NSIP", in its cellular form (Cellular NSIP) or fibrosing form (Fibrosing NSIP), even when associated with other diseases. This definition is provided on the basis of specific genetic characteristics and on the consequent metabolic alterations plausibily causing the damage, as demonstrated by the altered expression of regulatory genes for the importation of iron into the cells (HFE) and the intralysosomal traffic of iron (SLC11A1/NRAMP1) in the macrophages, and the consequent elevated concentration of labile iron and ensuing elevated iron-dependent generation of oxygen radicals in these cells. It is important to note that the above mentioned alterations are demonstrable ex vivo, that is in alveolar macrophages immediately extracted from the lungs by means of broncho-alveolar lavage, not manipulated nor stimulated in culture, and thus representing, most reliably, the activity of these cells in vivo in the pulmonary alveolar milieu of subjects afflicted with IPF/UIP.

On the basis of the above information, the present invention demonstrates for the first time that in the category of fibrosing interstitial pneumonias there is an identifiable pulmonary fibrosis/idiopathic interstitial pneumonia, currently identified, but not exclusively, as idiopathic pulmonary fibrosis IPF/UIP and characterized by the conditions i-iii listed below:

(i) the presence of coding allelic variants, in particular but not exclusively, C282Y, S65C and H63D and of non coding polymorphisms, in particular but not exclusively, IVS2+4 T>C of the HFE gene (OMIM*613609, localized on the 6p21.3 chromosome), in heterozygotes and homozygotes;

(ii) the lack of expression, in pulmonary macrophages in the major part of patients with idiopathic interstitial pneumonias, of the mRNA isoform of the SLC1 1A1/NRAMP1 gene (OMIM*600266 localized on chromosome 2q35) coding for the "full length" protein of 550 amino acids, or in the absence of expression of some isoforms of mRNA or in the presence of expression of the isoforms of mRNA non coding for the SLC1 1A1/NRAMP1 protein or coding for SLC1 1A1/NRAMP1 truncated proteins;

(iii) an abnormal concentration of intracellular free iron in pulmonary phagocytes, demonstrated in vitro with a semi-quantitative fluorometric assay, as fluorescence induced by the iron dependent generation of oxygen radicals, in particular the OH radical, inhibitable with iron chelators. The elevated concentration of chelatable iron characterizes the alveolar macrophages in patients with IPF/UIP in whom it is significantly higher as compared to healthy controls, both smokers and non smokers, and to patients with pulmonary illnesses other than idiopathic interstitial pneumonias, in particular other than IPF/UIP.

The excessive concentration of intracellular free iron can be revealed by measuring the spontaneous generation, non stimulated in culture, of oxygen radicals, in particular the OH radical, and by quantification of the inhibition with iron chelators, which is significantly higher than normal and is proportional to the concentration of free intracellular iron.

The above described conditions i-iii may all be present in the subject affected by the form of pulmonary fibrosis according to the present invention or in subjects at risk for developing the disease. Alternatively, only one of the above conditions may by present, either i or ii or iii. In other cases, the subject may present a combination of the above conditions, i.e. i and ii, ii and iii, i and iii.

On the basis of the above mentioned observations it is thus possibile to design a new diagnostic strategy. This consists of an in vitro diagnostic assay for the diagnosis of pulmonary fibrosis associated with iron dysregulation in subjects with suspected interstitial pulmonary fibrosis and a clinical presentation compatible with "confident" or "possible" IPF/UIP, NSIP (cellular or fibrosing NSIP), other fibrosing idiopathic interstitial pneumonias and fibrosing interstitial pneumonias associated with other systemic and pulmonary illnesses, without the necessity of performing biopsies, endoscopy or surgery, based on the in vitro demonstration of abnormal regulation of iron homeostasis in pulmonary alveolar macrophages, and in circulating mononuclear phagocytes, associated with the condition of carrier of variant alleles and/or polymorphisms, and abnormal expression of regulatory genes of cellular iron homeostasis. This assay may be carried out on samples of peripheral venous blood and on samples of pulmonary alveolar macrophages obtained ex vivo from bronchoscopy and bronchoalveolar lavage (BAL), with experiments employing moleculare and cellular biology as listed below.

The present invention concerns, thus, a method for the in vitro diagnosis of pulmonary fibrosis characterized by a greater quantity of free intracellular iron in pulmonary alveolar macrophages than that in healthy subjects, or for the identification of the risk of developing said pulmonary fibrosis, said pulmonary fibrosis being defined also as idiopathic pulmonary fibrosis, usual interstitial pneumonia, non specific interstitial pneumonia, preferably fibrosing, preferably idiopathic pulmonary fibrosis, said method comprising or consisting of the identification of one or more allelic variants and/or one or more polymorphisms of the HFE gene (OMIM 613609, localized onl chromosom 6p21.3) of DNA from a biological sample.

The particular form of pulmonary fibrosis according to the present invention, as described above, is characterized by a greater quantity of intracellular free iron in pulmonary alveolar macrophages as compared to a healthy subject. The quantity of intracellular free iron can be determined using known methods. For example, it is possibile to determine said quantity of iron using an indirect method based on the measure of oxygen radical production, preferably hydroxyl radical, produced in a sample of alveolar macrophages with and without iron chelators and a fluorescent indicator of oxygen radicals. The decrease in the quantity of oxygen radicals produced in the presence of iron chelators, as compared to the control sample without iron chelators, represents the quantity of chelatable free intracelluar iron.

Preferably, the above mentioned allelic variants are chosen from the group consisting of V53M, V59M, H63D, S65C, Q127H, E168Q, E168X, W169X, C282Y Q283P, P160 DEL C, preferably H63D, C282Y e/o S65C and the polymorphism is IVS2+4 T>C. According to a particular embodiment, the method includes the revelation of H63D, C282Y, S65C e IVS2+4 T>C.

The method can be carried out on a biological sample chosen from the group consisting of blood, pulmonary alveolar cells or lung tissue.

According to a particular embodiment, the method uses the following couples of primers respectively for the amplification and, but not exclusively, the sequencing in two directions of the exons 1, 2A, 2B, 3, 4, 5 of the HFE gene.:

Exon 1

Forward sequence 5'-TGCGAAGCTACTTTCCCCAATC (SEQ ID

NO:12)

Reverse sequence 5'-TAGCAAACTCCCAAGCGCAAAG (SEQ ID NO: 13)

Exon 2A

Forward sequence 5'-GGACTGCAACTCACCCTTCACAAA (SEQ

ID NO:14)

Reverse sequence 5'-GTGTGTCAGGGCAGAATTCAAGGT (SEQ ID NO:15)

Exon 2B

Forward sequence 5'-AGGAAACAGCTGGAAGTCTGAGGT (SEQ

ID NO:16)

Reverse sequence 5'- AGGGCCATAGACACTTCCCTTTGA (SEQ ID NO:17) Exon 3

Forward sequence 5'-GATCTGACTGCTCTCCAAGTGACA (SEQ ID NO:18)

Reverse sequence 5'-AGCAGATCCTCATCTCACTGCCAT (SEQ ID O:19)

Exon 4

Forward sequence 5'-TGTGATCTGGGGTATGTGACTG (SEQ ID NO:20)

Reverse sequence 5'-GCTGGTGTCCCCAAAGAATA (SEQ ID NO:21)

Exon 5

Forward sequence 5'-GAAGAGGCAAGATGGTGCCTAGGT (SEQ ID NO:22)

Reverse sequence 5'- CGTCCCAGGGTTCAAAGCTTTTCT (SEQ ID O:23).

The present invention concerns, in addition, a method for the in vitro diagnosis of pulmonary fibrosis characterized by a greater quantity of intracellulare free iron in pulmonary alveolar macrophages as compared to that of a healthy subject, or for the identification of risk of developing said pulmonary fibrosis, said pulmonary fibrosis being defined also as idiopathic pulmonary fibrosis, usual interstitial pneumonia, non specific interstitial pneumonia, preferably fibrosing, preferably idiopathic pulmonary fibrosis, said method comprising or consisting of the evaluation of the expression of the SLC11A1/NRAMP1 gene in a biological sample which consists of cells from the alveolar bronchial tract obtained by bronchoscopy and BAL, in particular pulmonary alveolar macrophages, wherein said expression in a subject affected with said pulmonary disease is dysregulated with respect to a healthy subject and characterized by the absence of expression of SLC11A1/NRAMP1 gene mRNA isoform which codes for the mature protein of 550 amino acids.

The above mentioned method may further comprise the evaluation, on cDNA reverse transcribed from mRNA, for the expression of isoforms of cDNA reverse transcribed from mRNA of the SLC11A1/NRAMP1 gene, said isoforms coding for truncated proteins or non coding.

The method according to the invention can be carried out using Reverse Transcriptase-PCR, RT-PCR. In particular, the following primers can be used for the amplification of cDNA reverse transcribed from mRNA from the SLC11A1/NRAMP1 gene for the identification of said isoforms:

P for 5'-CGACTGGCTGCACGTCTGGG-3' (SEQ ID NO:3)

P rev 5'-GGTGATGAGGACGCCACCCC-3' (SEQ ID NO:4)

In addition, the method can use the following couples of primers for the amplification of said isoforms of cDNA reverse transcribed from mRNA from the SLC11A1/NRAMP1 gene:

P for 5'UTR 5'-GAAAATGTTTCACAACGCCCC-3' (SEQ ID NO:9)

P rev 5'-GGTGATGAGGACGCCACCCC-3' (SEQ ID NO:4);

P forB 5'-CTTACTTGCACCAGTGCCC-3' (SEQ ID NO: 10)

P rev 5'-GGTGATGAGGACGCCACCCC-3' (SEQ ID NO:4);

P for 5'-CGACTGGCTGCACGTCTGGG-3' (SEQ ID NO:3)

P rev3 5'-ATGCAATGGCCGTGCC-3' (SEQ ID NO: 11);

P forB 5 -CTTACTTGCACCAGTGCCC-3' (SEQ ID NO: 10)

P rev3 5'-ATGCAATGGCCGTGCC-3' (SEQ ID NO:11).

The invention further regards a method for the in vitro diagnosis of pulmonary fibrosis characterized by an increased quantity of intracellular free iron in the pulmonary alveolar macrophages as compared to healthy subjects, for the identification of the risk of developing pulmonary fibrosis, or for monitoring the biological response to the antifibrotic treatment with one or more iron chelators or antioxidant drugs, said pulmonary fibrosis being defined also as idiopathic pulmonary fibrosis, usual interstitial pneumonia, non specific interstitial pneumonia, preferably fibrosing, preferably idiopathic pulmonary fibrosis, said method comprising o consisting of the measure of the quantity of an oxygen radical, preferably the hydroxyl radical, produced by pulmonary alveolar macrophages and/or by the quantity of intracellular free iron not bound to ferritin in the pulmonary alveolar macrophages, wherein said quantity of hydroxyl radical and/or intracellular free iron not bound to ferritin in pulmonary alveolar macrophages in a subject affected with said pulmonary illness is higher with respect to the intracellular quantity of hydroxyl radical and/or free iron not bound to ferritin in pulmonary alveolar macrophages in a healthy subject. The normal values of free iron are less than 31.2 and less than 42 units of fluorescence, respectively, in the assay with the iron chelator deferiprone and in the one with the iron chelator deferoxamine.

The present invention also regards a method for the in vitro diagnosis of pulmonary fibrosis characterized by an increased quantity of intracellular free iron in the pulmonary alveolar macrophages as compared to healthy subjects, or for the identification of the risk of developing pulmonary fibrosis, said pulmonary fibrosis also being defined as idiopathic pulmonary fibrosis, usual interstitial pneumonia, non specific interstitial pneumonia, preferably fibrosing, preferably idiopathic pulmonary fibrosis, said method comprising or consisting of the combination of two or more methods as defined above.

It is further object of the present invention a kit for the in vitro diagnosis of pulmonary fibrosis characterized by an increased quantity of intracellulare free iron in the pulmonary alveolar macrophages as compared to healthy subjects, or for the identification of the risk of developing said pulmonary fibrosis, said pulmonary fibrosis also being defined as idiopathic pulmonary fibrosis, usual interstitial pneumonia, non specific interstitial pneumonia, preferably fibrosing, preferably idiopathic pulmonary fibrosis, said kit comprising or consisting of the following primers respectively for the amplification and, but not exclusively, the sequencing in two directions of the exons 1 , 2A, 2B, 3, 4, 5 of the HFE gene:

Exon 1

Forward sequence 5'-TGCGAAGCTACTTTCCCCAATC (SEQ ID NO:12)

Reverse sequence 5 -TAGCAAACTCCCAAGCGCAAAG (SEQ ID NO:13)

Exon 2A

Forward sequence 5'-GGACTGCAACTCACCCTTCACAAA (SEQ ID NO: 14)

Reverse sequence 5'-GTGTGTCAGGGCAGAATTCAAGGT (SEQ ID NO:15)

Exon 2B

Forward sequence 5'-AGGAAACAGCTGGAAGTCTGAGGT (SEQ ID NO:16)

Reverse sequence 5'- AGGGCCATAGACACTTCCCTTTGA (SEQ ID NO:17)

Exon 3

Forward sequence 5 -GATCTGACTGCTCTCCAAGTGACA (SEQ ID NO:18)

Reverse sequence 5 -AGCAGATCCTCATCTCACTGCCAT (SEQ ID NO: 19)

Exon 4

Forward sequence 5'-TGTGATCTGGGGTATGTGACTG (SEQ ID NO:20)

Reverse sequence 5'-GCTGGTGTCCCCAAAGAATA (SEQ ID NO:21)

Exon 5

Forward sequence 5'-GAAGAGGCAAGATGGTGCCTAGGT (SEQ ID NO:22)

Reverse sequence 5'- CGTCCCAGGGTTCAAAGCTTTTCT (SEQ ID NO:23)

In addition, the present invention concerns a kit for the in vitro diagnosis of pulmonary fibrosis characterized by an increased quantity of intracellular free iron in the pulmonary alveolar macrophages as compared to healthy subjects, or for the identification of the risk of developing pulmonary fibrosis, said pulmonary fibrosis also being defined as idiopathic pulmonary fibrosis, usual interstitial pneumonia, non specific interstitial pneumonia, preferably fibrosing, preferably idiopathic pulmonary fibrosis, said kit comprising or consisting of the following primers for the amplification of cDNA of the SLC1 1A1/NRAMP1 gene coding for the mature protein of 550 amino acids:

P for, 5'-CGACTGGCTGCACGTCTGGG-3'(SEQ ID NO:3) P rev 5'-GGTGATGAGGACGCCACCCC-3'(SEQ ID NO:4) In addition, the above mentioned kit can futher comprise the following primers for the amplification of the SLC1 1A1/NRAMP1 gene isoform of cDNA, said isoforms coding for truncated proteins or non coding, for the identification of the isoforms:

P for 5'UTR, 5'-GAAAATGTTTCACAACGCCCC-3' (SEQ ID NO:9)

P for B, 5'-CTTACTTGCACCAGTGCCC-3' (SEQ ID NO: 10) P rev 3, 5'-ATGCAATGGCCGTGCC-3' (SEQ ID NO: 1 1 )

In addition, the present invention concerns a kit for the in vitro diagnosis of pulmonary fibrosis characterized by an increased quantity of intracellular free iron in the pulmonary alveolar macrophages as compared to healthy subjects, for the identification of the risk of developing pulmonary fibrosis, or for monitoring the biological response to the antifibrotic treatment with one or more iron chelators or antioxidant drugs, said pulmonary fibrosis also being defined as idiopathic pulmonary fibrosis, usual interstitial pneumonia, non specific interstitial pneumonia, preferably fibrosing, preferably idiopathic pulmonary fibrosis, said kit comprising or consisting of at least one iron chelator, at least one fluorescent indicator of intracellular reactive oxygen species.

According to a particular embodiment said kit may comprise or consist of the following components:

Buffer A: NaCL 137 mM, KCI 2.7 mM, Na2HP04 7.8 mM, KH2P04 1.5 mM, pH 7.2

Buffer B: RPMI without pheol red or glutamine, with NaHC03 Reagent A: deferoxamine (DFO) 10 mM, or deferiprone 5 mM (DFP), in Buffer B REAGENT B: solution of 500 μ M CM-H2DCFDA in dimethylformamide (DMF)

Reagent C: 2% solution of auto-fluorescent spheres (FluoSpheres Sulfate Microspheres, 1 m yellow-green, Invitrogen, Molecular Probes, Carlsbad, CA, USA)

Use of the above described kit requires the following procedure:

Obtain cells of interest (at least 200,000 cells)

Carry out the cell count and transfer 200,000 cells in a 15 ml tube.

Resuspend the cells of interest in Buffer A, final volume 10 ml, and centrifuge for 5 minutes at 500g. After removing the supernatant, repeat the lavage in 0 ml Buffer A

Remove the supernatant and resuspend the cells in 2 ml of Buffer

B.

Transfer the cells to the bottom of two 50 ml tubes (1 ml in each tube)

Add 10 μΙ_ di Reagent A only to one of the two tubes containing cells (sample B) and incubate at 37°C, CO2 5% for one hour. DO NOT add Reagent A to the other tube containing cells of interest (sample A)

Remove the tubes from the incubator, add 10 di Reagent B to all the samples, resuspend the cells delicately and incubate for one hour

At the end of the incubation and immediately before the fluorometric reading, carefully resuspend Reagent C and suspend 10 μΙ_ of the reagent (auto-flurescent spheres) in 1 ml of Buffer B in an appropriate tube (sample C).

· Trasfer 800 μΙ_ of sample A, sample B and sample C in 1 ml cuvettes and record the fluorometric data (excitation 485 nM, emission 535 nM).

For the calculation use the following formula:

Chelatable Fluorescence Units = (Sample A Fluorescence Units - Sample B Fluorescence Units) x (160/ Sample C Fluorescence Units). Pathological values > 31 .2 FU in the assay with deferiprone and >42 in the assay with deferoxamine.

The present invention concerns as well one or more iron chelators for the use in the prevention of the progression and in the treatment of pulmonary fibrosis characterized by a quantity of intracellular free iron in pulmonary alveolar macrophages as compared to healthy subjects, said pulmonary fibrosis being defined also as idiopathic pulmonary fibrosis, usual interstitial pneumonia, non specific interstitial pneumonia, preferably fibrosing, preferably idiopathic pulmonary fibrosis, wherein said one or more iron chelators are chosen from the group that consists of deferiprone, deferoxamine, deferasirox, ethylenediaminotetracetic acid (EDTA), dimercaptopropanol (dimercaprol), dimercaptosuccinic acid (DMSA), trientine hydrochloride, curcumin - a polyphenol derived from cucurma (Cucurma longa), baicalein - a flavone glucuronide extracted from Scutellaria - and its metabolite baicalensis β-Ο-β-d- Glucopyranuronoside, silybin- extract from Silybum marianum, extract from Terminalia chebla, extract from the fruit of Emblica officinalis, silymarin, preferably deferoxamine.

The present invention now will be described by illustrative but not limitative way according to preferred embodiment thereof with particular reference to the enclosed drawings, wherein:

Figure 1 . Demonstrates the intracellular accumulation of free iron in patients with pulmonary fibrosis/idiopathic pulmonary fibrosis measured with 5-(and-6)-chloromethyl-2',7'-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA), by the use of chelators capable of being accumulated in lysosomes, such as deferoxamine (100 mcM) and of permeating the cell membrane such as deferiprone (50 mcM). The fluorometric assay permits the measurement of free iron by the reduction of the emission of fluorescence due to inihibiton by the chelators. The study demonstrates that the alveolar macrophages of patients with pulmonary fibrosis/idiopathic pulmonary fibrosis (n=15), examined ex vivo after aspiration from the lower respiratory tract by BAL without being stimulated in culture, present a significantly greater accumulation of free iron as compared to alveolar macrophages of healthy controls (n=1 1), also examined ex vivo after aspiration from the lower respiratory tract, without stimulation in culture (Mann Whitney u test, p<0.0001 Figure 2. Figure 2A shows the quantity of deferoxamine chelatable fluorescence produced by the iron-dependent generation of oxygen radicals by cells recovered from BAL, not stimulated in vitro, from normal control subjects and patients with idiopathic pulmonary fibrosis, and demonstrates that the patients with idiopathic pulmonary fibrosis produce a greater quantity of free iron-dependent oxygen radicals compared to controls (p<0.0001). The same values, stratified for the presence of variant alleles of the HFE gene are shown in Figure 2B. The healthy controls and the patients with IPF, homozygous for the HFE "wild type" sequence are shown as empty circles (HFE-) while the controls and the subjects afflicted with IPF (HFE+) who express variant alleles for HFE are shown as closed circles. The figure shows that the patients with idiopathic pulmonary fibrosis carrying allelic variants of the HFE genes produce a greater quantity of iron-dependent oxygen radicals as compared to patients homozygous for the wild type alleles (HFE-) of the gene (p<0.05), who in turn produce a greater quantity of iron-dependent oxygen radicals as compared to healthy subjects (p<0.005).

Figure 3. Shows a schematic representation comparing the functional domains identified in the amino acid sequences of four isoforms of the SLC1 1A1/NRAMP1 protein by Smart Modular Architecture Research Tool (SMART) analysis. Three amino acid sequences of SLC1 1A1/NRAMP1 splice variant proteins published in Ensembl (http.7/www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG0000 00 18280; r=2:219246752-219261617), and the amino acid sequence of the isoform of the SLC1 1A1/NRAMP1 protein deposited in GenBank (ACCESS N°D38171 ) were analyzed with SMART (http://smart.embl- heidelberg.de/), for the identification of the conserved protein domains. This analysis demonstrated the presence of all domains in the SLC1 1A1/NRAMP1 full length isoform (SLC1 1A1_001 , 550aa), an N- terminal "truncated" domain in the SLC11A1/NRAMP1 432aa isoform (SLC1 1A1_201 , 432aa), and a C-terminal "truncated" domain in the SLC1 1A1/NRAMP1 isoform of 163aa (SLC1 1A1_003, 163aa) described as a protein probably subjected to a nonsense-mediated decay. The analysis also demonstrated an N-terminal partially truncated domain in the fourth SLC1 1A1/NRAMP1 isoform of 483 aa. This isoform was found in the cell line U937 and the sequence deposited in GeneBank. It is interesting to note in the fourth isoform the presence of a leader sequence, or signal peptide, in the first 36 aa, that may insert the protein into the membrane of the lysosome.

Figure 4. Demonstrates schematically the method for the execution of the Nested RT-PCR. The nested RT-PCR which consists in a first reaction of the cDNA with the primers Pfor5'UTR-Prev (called external or "outer", which produces a PCR product of 744 base pairs) and a second reaction (called internal or "inner", which produces a PCR product of 570 base pairs) with the primers PforB-Prev3, using 0.5 microliters of the "outer" reaction. The figure shows a schematic of the reaction of Nested PCR constructed on the messenger RNA of SLC1 1A1/Nramp1. The primers for the external or outer RT-PCR are located in the region 5'UTR (Pfor5'UTR) and on Exon 6 (P rev), respectively. The primers for the internal or inner RT-PCR reaction are located in the region 5'UTR (Pfor B) and on Exon 5 (Prev 3), respectively.

Figure 5. Demonstrates the quantity of deferoxamine-chelatable fluorescence produced by the iron-dependent generation of oxygen radicals by the cells obtained from BAL, not stimulated in vitro, in subjects with IPF/UIP. The values of deferoxamine- chelatable fluorescence are stratifiied by the presence of allelic variants of the HFE gene and for the the lack of expression of the SLC1 1A1/NRAMP1 gene transcript coding for the "full length" protein of 550 aa. The patients who are carriers of HFE variant alleles and/or are lacking expression of the SLC1 1A1/NRAMP1 gene transcript coding for the full length protein of 550 aa were found to have significantly higher capacity to generate iron chelatable dependent oxygen radicals (p<0.05).

EXAMPLE 1 : Study on the prevalence of allelic variants of the HFE gene, on the expression of the SCL11A1/NRAMP1 gene and on the dysregulation of iron in alveolar macrophages in patients with idiopathic pulmonary fibrosis/usual interstitial pneumonia and on the effect of iron chelators used for the diagnosis of pulmonary fibrosis.

MATERIALS and METHODS

Biological samples

Cellular and non cellular pulmonary samples from patients with idiopathic interstitial pneumonia, in particular con IPF/UIP, were obtained by bronchoalveolar lavage (BAL), performed for the diagnosis of interstitial disease, using the portion of lavage recovered not utilized for the routine diagnostic tests, after informed consent was obtained. The control samples were obtained from healthy smoking subjects, with more than 10 pack years of smoking history, and from non smoking subjects, enrolled in an interventional study, approved by the Independent Ethics Committee of the University of Tor Vergata Medical Center (Rome, Italy), after informed consent was obtained.

Peripheral venous blood was obtained.

The BAL was performed according to standard protocol, by instilling three aliquots of physiological saline solution, throught the operative channel of a fiberoptic bronchoscope, Olympus BF 1T 189, (Olympus, Hamburg, Germany), in the right middle lobe, the lingula and the antero-basal segment of the left lower lobe (Saltini C, Hance A.J., Ferrans V.J., Basset F., Bitterman P.B., Crystal R.G. Accurate quantification of cells recovered by bronchoalveolar lavage. Am. Rev. Respir. Dis. 1984; 130: 650-658.).

Bronchoavleolar lavage samples were first filtered through sterile gauze to eliminate the mucus and then transferred to 50 ml tubes. The cells were counted and the cell viability evaluated by Tryptan blue uptake. The differential cell count was carried out by staining cytopreps prepared using cytocentrifugation (Cytospin Shandon, Thermo Scientific, Waltham, MA, USA) with May Grumwald Giemsa Quick Stain (Bio-Optica, Milan, Italy). Sample contamination by epithelial cells was assessed and only samples containing <5% epithelial cells were used thereafter.

The cell fraction of the BAL was separated from the liquid fraction by centrifugation for 5 minutes, at 170 g, in a refrigerated centrifuge (ALC 4237R, ALC International SRL, Cologno Monzese, Italy), and washed two times in buffered saline solution (PBS, Sigma-Aldrich, St Louis, MO, USA). In order to normalize the concentration of cells and soluble iron in the epithelial lining fluid (ELF) of the lung, the volume of ELF recovered was calculated using the concentration of urea in the BAL liquid recovered (Urea QuantiChrom Assay Kit, BioAssay Systems, Hayward, CA, USA)as a marker of dilution as described by Rennard et al. (Rennard S.I, Basset G, Lecossier D, O'Donnell KM, Pinkston P, Martin P, and Crystal RG. Estimation of volume of epithelial lining fluid recovered by lavage using urea as marker of dilution J. Appl. Physiol.60(2): 532438, 1986). The cell count and the measure of total iron are reported in terms of alveolar epithelial lining fluid or ELF.

Fluorometric measure of the production of hydroxy! radical as a measure of free iron in alveolar macrophages.

For the measurement of the production of reactive oxygen species (ROS), and in particular for the measurement of the generation of hydroxyl radicals (ΉΟ), 5-(and-6)-chloromethyl-2' ,7' -dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA) was used an intracellular indicator of reactive oxygen species. The CM-H2DCFDA is a fluorochrome characterized by the capacity to pass through the cell membrane into the cell where it becomes trapped by the formation of covalent bonds between the chloromethyl group and intracellular macromolecules. The hydrolysis of the acetate group of CM-H2DCFDA by the cellular esterases produces a non fluorescent deacetylated compound that rapidly generates a fluorescent product (CM-DCF) in the presence of hydroxyl radical (ΉΟ). The intensity of fluorescence produced is proportional to the quantity of intracellular ROS, and in particular to hydroxyl radical (ΉΟ).

The CM-H2DCFDA (Invitrogen, Molecular Probes, Carlsbad, CA, USA) was stored at -20°C in the dark, to prevent photo oxidation, and reconstituted immediately before the experiment (0,5 mM CM-H2DCFDA in dimethylformamide [DMF]). The fluorescence was measured by the fluorometer Luminescence Spectrometer LS50B (Perkin Elmer, Waltham, Massachusetts, USA) with an excitation length of 485 nm and an emission length of 535 nm, using a window of 2.5 nm. The stability of the instrument and the subsequent reproducibility of the fluorometric measurement in time was evaluated by serial readings with auto-fluoresecent speheres (FluoSpheres Sulfate Microspheres, Invitrogen, Molecular Probes, Carlsbad, CA, USA).

For the evaluation of the effect of iron chelators on the production of hydroxyl radical (ΉΟ) in alveolar macrophages, cells were pretreated with deferiprone, (DFP) (Sigma Aldrich, St Louis, MO, USA), deferoxamine (DFO) (Sigma Aldrich, St Louis, MO, USA) or deferasirox (Swapnroop Drugs PVT Ltd Aurangabad-431004, India) at a final concentration of 50 μ M, 100 μ M e 500 μ M, respectively.

For the assay, the alveolar macrophages (AM) obtained from BAL, after washing in buffered saline solution as described above, were suspended in 1 ml of culture medium (RPMI without phenol red, Sigma- Aldrich, St Louis, MO, USA) in a 50 ml tube at a concentration of 1 x10 ⁵ cells/ml. The assay was conducted in the absence of pH indicators (phenol red) and serum in order to avoid the consequent alteration in the fluorochrome CM-DCF signal. In the assay, the cells were incubated for 1 hour at 37°C, 5% CO ₂ , (NAPCO Model 5410), in the dark. The CM- H2DCFDA was added at a final concentration of 5 μ M.

The concentration of free, chelatable intracellular iron was estimated in fluorescent units of CM-H2DCFDA as the amount of fluorescence inhibited by deferoxamine (DFO) in comparison to the DFO untreated control and expressed as CM-H2DCFDA[DFO] FU/10 ⁵ BAL cells.

Assay for the identification of allelic variants and mutations of the genes for hereditary hemochromatosis.

The identification of the variant alleles and mutations was performed on genomic DNA, extracted and purified blood cells, lung cells and tissue samples (purification kit EZ1 DNA Blood 200μΙ [Qiagen, GmbH, Germany]. The coding regions and the intron/exon junction regions of the HFE gene were amplified in six amplification reactions using six specific copies of primers, followed by the sequence specific hybridization of the hybrid to identify the allelic variants of the HFE gene. This experiemt was conducted using commercial reagents (kit AC066, Nuclear Laser Medicine, Milan, Italy) and by sequencing in both directions using six copies of primers for the identification of allelic variants and for coding and noncoding polymorphisms. The six copies of primers are the following:

Exon 1

Forward sequence 5'-TGCGAAGCTACTTTCCCCAATC (SEQ ID

NO: 12)

Reverse sequence 5'-TAGCAAACTCCCAAGCGCAAAG (SEQ ID NO: 13)

Exon 2A

Forward sequence 5'-GGACTGCAACTCACCCTTCACAAA (SEQ

ID NO: 14)

Reverse sequence 5'-GTGTGTCAGGGCAGAATTCAAGGT (SEQ ID NO: 15)

Exon 2B

Forward sequence 5'-AGGAAACAGCTGGAAGTCTGAGGT (SEQ

ID NO: 16)

Reverse sequence 5'- AGGGCCATAGACACTTCCCTTTGA (SEQ ID NO: 17)

Exon 3

Forward sequence 5'-GATCTGACTGCTCTCCAAGTGACA (SEQ

ID NO: 18)

Reverse sequence 5'-AGCAGATCCTCATCTCACTGCCAT (SEQ ID NO: 19)

Exon 4

Forward sequence 5'-TGTGATCTGGGGTATGTGACTG (SEQ ID

NO:20)

Reverse sequence 5'-GCTGGTGTCCCCAAAGAATA (SEQ ID NO:21 )

Exon 5

Forward sequence 5'-GAAGAGGCAAGATGGTGCCTAGGT (SEQ

ID NO:22)

Reverse sequence 5'- CGTCCCAGGGTTCAAAGCTTTTCT (SEQ ID NO:23) Sequencing was carried out using a sequence kit (Applied Biosystem Big Dye Terminator v3.1 Cycle) for the identification of variant alleles and for coding and noncoding mutations. The variants identified are V53M, V59M, H63D, S65C, Q127H, E168Q, E168X, W169X, C282Y Q283P, P160 DEL C, and the noncoding polymorphism IVS2+4 T>C.

The identification of the allelic variants or mutations of the TFR2 gene was carried out by amplification of the sequences of interest, followed by the sequence-specific hybridization revealing 4 mutations of the TFR2 gene: Y250X, E60X, M172K, AVA Q 594-597 del, using a commercial kit for the diagnosis of hereditary hemochromatosis (Nuclear Laser Medicine, Milan, Italy).

The identification of allelic variants or mutations of the ferroportin gene (SLC40A1 , FPN) was carried out by amplification of the sequences of interest, followed by sequence-specific hybridization revealing 2 mutations: N144H, V162 del. A commercial kit for the diagnosis of hereditary hemochromatosis was used (Nuclear Laser Medicine, Milan, Italy).

Assay for the measurement of the transcription of the SLC11A 1/NRAMP1 gene, by RT-PCR, on total RNA of alveolar macrophages.

The design of the primers for the SLC11 A1/NRAMP1 gene was based on the gene structure, composed of 15 exons, and on the techniques of splicing described in the literature (Gene Cards, Ensembl). Table 1 shows the isoforms of the SLC11A1/NRAMP1 gene as described on Ensembl (http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG0000 00 18280;r=2:219246752-219261617) on which the primer couples were designed. Listed in table 1 are the 14 SLC11A1/NRAMP1 isoforms (Ensembl Database) detected using the primers designed as above. Table 1

Name length (bp) length (aa) Biotype

SLC11A1-001 3852 550 Coded protein SLC11A1-201 2043 432 Coded protein

SLC11A1-003 2136 163 Nonsense mediated decay

SLC11A1-014 421 No protein Transcript processed

product

SLC11A1-002 1602 No protein Intron conserved

product

SLC11A1-004 2548 No protein Intron conserved

product

SLC11A1-007 525 No protein Transcript processed

product

SLC11A1-006 975 No protein Intron conserved

product

SLC11A1-009 5772 No protein Intron conserved

product

SLC1 1A1-010 1781 No protein Intron conserved

product

SLC1 1A1-011 2435 No protein Inron conserved

product

SLC11A1-015 573 No protein Intron conserved

product

SLC11A1-016 695 No protein Intron conserved

product

SLC11A1-017 498 No protein Intron conserved

product

Table 2 shows the coding and noncoding isoforms, identified in data banks (GeneBank and GeneCards in addition to Ensembi Database).

An additional isoform (GeneBank number D38171.1) is detected using the same primers. This isoform that codes for a protein of 483 aa, also "truncated" at the N-terminal extremity, was found in the cell line U937. This sequence, not present in the Ensembi Database was deposited in GeneBank (GeneBank: D38171), see Figure 3.

Table 2 Isoforms of SCLC11 A1/NRAMP1 described in Ensembi, GeneCards and GeneBank

SLC11A1_001 550 aa

SLC11A1_003 163 aa

SLC11A1_201 432 aa

XM005246794.1 432 aa

XM_006712710.1 432 aa

XM_006712709.1 432 aa

D38171.1 483 aa

XM005246793.1 483 aa

XM005246792.1 483 aa

AK303398 483 aa

AK298667.1 426 aa

XM_006712711.1 401 aa

AB209650.1 343 aa

SLC11A1_014, non coding

SLC11A1_004, non coding

SLC11A1_010 non coding

SLC11A1_002, non coding

SLC11A1_011 , non coding

SLC11A1_007, non coding

SLC11A1_015, non coding

SLC11A1_006, non coding

SLC11A1_017, non coding

SLC11A1_016, non coding

SLC11A1_009, non coding

In particular, the SPV_001 of the mRNA SLC11A1/Nramp1 gives rise to the complete protein of 550 aa, the SPV_201 (432 aa) gives rise to a truncated protein from a deletion at the N-terminal, while the SPV_003 (163 aa) gives rise to a truncated protein at the C-terminal extremity that, supposedly, becomes degraded (nonsense-mediated decay) (see Figure 3).

The demonstration of the alterations of the expression of the SLC11A1/NRAMP1 gene, is obtained by the identification of the isoforms of messenger RNA using amplification of cDNA with a panel of five couples of primers, described in Tables 3 and 4, that specifically identify the presence/absence of coding and non coding isoforms (see Table 5).

For the identification of the expression of the SLC11A1/NRPA 1 gene in alveolar macrophages, the total RNA of alveolar macrophages was extracted from 5 million cells with the kit RNA/DNA/Protein Purification Kit (Norgen Biotech Corp., Thorold, ON, Canada). Two micrograms of total RNA were reverse transcribed with Superscript III (Invitrogen, Milano, Italy) in a final volume of 50 microliters, at 50°C for 1 hour. For each of the Real time RT-PCR reactions , 2,5 microliters of cDNA were used, corresponding to 100 nanograms of total RNA. Each sample of cDNA also underwent amplification with primers specific for the"housekeeping" gene, L34 ribosomal, in duplicate.

The Amplification Program used with the ABIPRISM SDS 7000 Thermal Cycler was the following : 95°C 45 secondi, 60°C 1 minute, 15 seconds, 40 cycles, with a Dissociation Curve at the end.

The sequence of primers used for the amplification of the "housekeeping" gene L34, for other regulatory genes employed as positive controls and for the SLC11A1/NRAMP1 gene are shown in Table 3.

Table 3

Gene Primer Sequenza SEQ ID

Sequence

L34 Forward 5'-GGCCCTGCTGCATGTTTCTT-3' NO:1

Reverse 5'-GTCCCGAACCCCTGGTAATAGA-3' NO:2

Nrampl P for 5'-CGACTGGCTGCACGTCTGGG-3' NO:3 P rev 5'-GGTGATGAGGACGCCACCCC-3' NO:4

P for 5'UTR 5'-GAAAATGTTTCACAACGCCCC-3' NO.9

P for B 5'-CTTACTTGCACCAGTGCCC-3' NO.10

P rev 3 5'-ATGCAATGGCCGTGCC-3 ^* NO: 11

FerrH Forward 5'-CATGACGACCGCGTCCACCTC-3' NO:5

Reverse 5'-TCAAAGCCACATCATCGCGGTC-3' NO:6

H-OX1 Forward 5'-CCAGGTGACCCGAGACGGCT-3' NO:7

Reverse 5 -AGAGCTGGGCAGGTCCAGGG-3' NO:8

Using the primers described in Table 3, cDNA reverse transcribed from total mRNA, obtained from alveolar macrophages removed from the lower respiratory tract of control subjects and from patients, was amplified using five couples of primer (primers NO:3, NO:4, NO:9, NO: 10, NO:11 , Table 3). Usando i primer descritti nella tabella 3, sono pertanto state eseguite amplificazioni del cDNA retro-trascritto dello mRNA totale ottenuto da macrofagi alveolari prelevati dal tratto respiratorio inferiore dei soggetti di controllo e dei pazienti usando cinque coppie di primer ( descritti nella tabella 3 con le ID di sequenza: SEQ ID 3, 4, 9, 10, 11).

The couples of primers employed are shown in detail in Table 4.

Table 4

1 2 3 4 5

Primer for/ P for 5'UTR/ P for B/ P for/ P for B/

P rev P rev P rev P rev 3 P rev 3

SEQ ID 3-4 9-4 10-4 3-11 10-11 Table 5 shows, for the combination of primers listed in Table 4, the size of the expected amplification product for each isoform. The electrophoretic bands specifically produced by each couple of primers are shown in Table 5. They allow to identify 15 different isoforms the of SLC11A1/NRAMP1 gene (14 of the 19 described in Ensembi and 1 described in GenBank) in the samples examined. The isoforms not identifiable with these primer combinations are shown in bold print (Table 5).

Table 5

Isoform Pfor- Pfor5'UTR- Pfor B- Pfor B- Pfor- Prev Prev Prev Prev 3 Prev 3

SLC11A1_001 210 744 623 570 157 550 aa

SLC11A1_003 284 No 697 644 231 163 aa

SLC11A1_201 284 No No No 231 432 aa

XM005246794.1 284 No 697 644 231 432 aa

XM_006712709.1 284 675 554 501 231 432 aa

D38171.1 210 No No No 157 483 aa

XM005246793.1 210 601 481 427 157 483 aa

XM005246792.1 210 712 591 538 157 483 aa

AK303398 210 No 591 538 157 483 aa

AK298667.1 210 No 623 570 157 426 aa XM_006712711.1 210 No 357 304 157 401 aa

AB209650.1 210 No 2544 2491 157 343 aa

SLC1 1A1_014 210 No 357 303 157 non coding

SLC1 1A1_004 627 No 918 447 157 non coding

SLC1 1A1_002 627 No No No 157 non coding

SLC1 1A1_010 210 No 623 570 157 non coding

SLC1 1A1_007 solo No solo 427 157 non coding Pfor PforB

SLC1 1A1_015 Solo No Solo P 520 157 non coding Pfor forB

SLC1 1A1_006 No No No No 157 non coding

SLC1 1A1_017 No No No No 157 non coding

SLC1 1A1_016 Solo No Solo P 302 157 non coding Pfor for B

SLC11A1_013 Solo No Solo P No No non coding Pfor for B

SLC11A1_018 Solo P No No No No non coding for

SLC11A1_012 No No No No No non coding

SLC11A1_019 No No No No No non coding

SLC11A1_005 No No No No No non coding In order to confirm the absence of the SLC1 1A1/NRAMP1 gene isoform coding for the full length protein of 550 amino acids, cDNA was amplified by "Nested" RT-PCR, with which the sensibility of the assay is increased by at least 1000 times, as is the specificity.

Specifically, the Nested RT-PCR protocol consisted of an initial reaction of cDNA amplification using the Pfor5'UTR-Prev primers (defined as "outer") and a second reaction (defined as "inner") with the PforB- Prev3 primers, using 0.5 microliters from the outer reaction product (see Figure 3).

The results of this Nested RT-PCR reaction were analyzed using the file of the Sequence Detection System 7000 (ABI SDS 7000) to verify the melting temperature of the obtained amplicon and electrophoresis in agar gel to verify the molecular weight of the reaction product to detect the possible presence of different splicing variants.

RESULTS

(A1) Demonstration of the increased frequency of the allelic variants and mutations of the HFE gene associated with hereditary emochromatosis.

The research of the allelic variants and mutations associated with hereditary emochromatosis was conducted on a population of 89 patients with confident IPF/UIP as compared to 107 healthy controls and 54 patients with other pathology. Three HFE gene coding allelic variants, in particular H63D, S65C and C282Y, and a non-coding polymorphism, IVS2+4 T>C, were identified in the population of patients with idiopathic pulmonary fibrosis. The frequency of the allelic variant of the HFE gene found in the patients with idiopathic pulmonary fibrosis was higher than that observed in normal subjects. The study showed that the allelic variants were found in 36 (40.4%) of the patients with IPF/UIP and in 24 (22.4%) of healthy controls (Fisher's exact test p=0.0008; OR 2.58 [1.39- 4.78], Figure 1 ). In a subpopulation of patients not presenting with coding allelic variants, 60% of the cases were found to have the non coding polymorphism IVS2+4 T>C. In the population of patients with IPF/UIP, H63D represented almost the total of the HFE gene allelic variants identified (Table 6).

In the 35 patients with other interstitial pulmonary pathology, the frequency of carriers for variant alleles of the HFE gene was 14% (p=0.0057, OR 4.075: as compared to patients with IPF/UIP).

Table 6 shows the results of the analysis of the frequency of the variant alleles of the gene in the population of patients with IPF/UIP. None of the patients was a carrier for the mutation of the TFR2 gene or the SLC40A1 gene.

Table 6

Controls IPF/UIP patients

WT WT 83 77,6% 53 59,5%

H63D WT 19 17,8% 32 36,0%

C282Y WT 4 3,7% 1 1 ,1%

S65C WT 0 0,0% 2 2,2%

H63D H63D 0 0,0% 1 1 ,1%

H63D C282Y 1 0,9% 0 0,0%

Any variant ^* 24 22,4% 36 40,4%

^* Any genotype includes non "wild type" variant alleles

The results indicate that in idiopathic pulmonary fibrosis/usual interstitial pneumonia there is a prevalence of HFE gene allelic variants, associated with hereditary hemochromatosis, capable of conferring an elevated susceptibility for the accumulation of iron with an excess of free iron and generation of excessive oxygen radicals, in particular hydroxyl radical, capable of inducing cell/tissue damage and fibrosis. The damage and fibrosis are manifested in these patients with pulmonary fibrosis without apparent causal exposure.

(A2) Demonstration of the abnormal accumulation of free iron in alveolar macrophages in subjects afflicted with pulmonary fibrosis/idiopathic interstitial pneumonia

For the measurement of cellular free iron, an assay was developed in which the free iron was measured using fluorimetry with 5-(and-6)- chloromethyl-2' ,7' -dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA), an intracellular indicator of reactive oxygen species, in particular the hydroxyl radical ( OH), which permits the measurement of the intracellular oxygen radical produced in the Fenton reaction, catalyzed by ferrous iron.

By using this method, it is demonstrated that alveolar macrophages of patients with IPF/UIP (n=31 ) contain significantly higher concentrations of free iron revealed on fluorimetry with the fluorescent CM-H2DCFDA probe, as compared to healthy smoking and non smoking subjects (n=1 1). The fluorimetry with the fluorescent CM-H2DCFDA probe, which reveals the production of hydroxyl radical in the Fenton reaction catalyzed by free iron, represents the indirect measure of cellular free iron. Non stimulated alveolar macrophages of control subjects (n=1 1) spontaneously produce free iron-dependent hydroxyl radical. The experiment allows the estimation of the size of the pool of iron inhibitable by chelators to be 14 and 16 fluorescent units, respectively, with deferoxamine and deferiprone. In the experiment, the median spontaneous fluorescence was 35 units (25 ^Λ and 75 ^Λ percentiles: 27-56 units) which was reduced to 21 units of fluorescence (median, 25 ^Λ and 75 ^Λ percentiles: 17.8-31 ) after incubation with the iron chelator deferoxamine and 19 units of fluorescence (25 ^Λ and 75 ^Λ percentiles: 15-30) after incubation with the iron chelator deferiprone (50mcM). Instead, the subjects afflicted with IPF/UIP (n=15) spontaneously produced, without stimulation, a quantity of oxygen radicals, in particular, hydroxyl radical, signiticantly higher than that found in healthy controls [mean fluorescence 138.0 units (25 ^Λ e 75 ^Λ percentiles: 93-21 1 )]. The measure of the fluorescence induced by the production of free iron-dependent hydroxyl radical permitted the estimation of the pool of intracellular free iron in alveolar macrophages in patients with IPF/UIP to be 89 and 71 units of fluorescence, respectively with deferoxamine and deferiprone. In fact, the spontaneous fluorescence was reduced to 49 units (mean fluorescence, 25 ^Λ and 75 ^Λ percentiles: 40-6) after incubation with deferoxamine (l OOmcM ad) and to 67 units (mean fluorescence, 25 ^Λ and 75 ^Λ percentili 40-87) after incubation with deferiprone (50 mcM). The described experiment indicates that the cellular free iron pool in alveolar macrophages of patients with IPF/UIP is approximately six times greater than that measured in the healthy subject (Mann Whithney u test, p<0.0001 ). (Figure 1 )

The chelator deferasirox in the same assay demonstrated an inhibition of 53 + 7 % of the spontaneous production of ( OH).

(A3) Demonstration of the correlation between the HFE genotype variant allele and the excessive generation of iron chelatable-dependent oxygen radical.

The patients with IPF/UIP, carriers of allelic variants of the HFE gene, generated in an iron-dependent mode, and without stimulation in vitro, a significantly higher level of oxygen radical, inhibitable by the iron chelator deferoxamine (DFO) (l OOmcM), (mean 107.4+ 56.0 DC FDA/ DFO-FU/10 ⁵ BAL cells) as compared to patients with IPF/UIP carrying of the "wild-type" HFE gene (59.1 ± 36.4 DCFDA/DFO-FU/10 ⁵ BAL cells; p=0.028). (Figure 2)

(A4) Demonstration of the lack of expression of the SLC11A 1/NRAMP1 gene transcript coding for the mature SLC11A 1/NRAMP1 protein of 550 aminoacids in alveolar macrophages in patients with idiopathic pulmonary fibrosis/usual interstitial pneumonia

The ex vivo analysis in RT-PCR of the expression of the SLC1 1A1/NRAMP1 gene in healthy non smoking controls (NSM n=4) , healthy smoking controls (SM n=6), patients with IPF/UIP (n=37) and patients with non fibrosing pulmonary disease (n=54) shows a significant dysregulation in the SCL1 1A1/NRAMP1 gene of alveolar macrophages. While 100% of healthy smoking and non smoking subjects espress the isoform of mRNA containing the entire "open reading frame" coding for the mature SLC1 1A1/NRAMP1 protein of 550 amino acids, 69.2% of patients with idiopathic pulmonary fibrosis do not express the isoform of mRNA coding for the mature SLC1 1A1/NRAMP1 protein, in fact, 48.7% express isoforms coding for truncated proteins or noncoding isoforms and 20.5% do not express any message. In addition, 53.7% of patients with non fibrosing pulmonary disease express the message for the mature SLC11A1/NRAMP1 protein of 550 amino acids, while 37% express isoforms of mRNA coding for truncated proteins or noncoding isoforms and only 9.3% do not express any message. Since these findings were obtained on pulmonary alveolar cells recovered by alveolar lavage and not mainipulated in vitro, the data indicate that in patients with fibrosing idiopathic interstitial pneumonia, the SLC11A1/NRAMP1 gene is transcribed in vivo in non-coding isoforms (Table 7

Table 7

Table 7 shows the results of the analysis in RT-PCR for the SLC11A1/Nramp1 gene in healthy non smoking controls (NSM n=4) , healthy smoking controls (SM n=6), patients with IPF/UIP (n=37). A panel of primers was used, capable of specifically identifying the 7 isoforms of the mRNA of the SLC11A1/NRAMP1 gene coding for protein and the 11 non coding isoforms of the same gene. The table shows the percentage of samples that express the coding isoform for the complete SLC11A1/NRAMP1 protein of 550 amino acids (100% of healthy non smoking and smoking subjects versus 30% of subjects afflicted with IPF/UIP). The table also shows the results of the analysis carried out for the presence of non "wild type" variant genotypes of the HFE gene and for the expression of non "full length" isoforms of the SLC11A1/NRAMP1 gene. This analysis demonstrates that, including the non coding variants of HFE, a mere 10% of the population of patients with idiopathic pulmonary fibrosis normally express the most important genes in the accumulation and intracellular trsnsport of iron, in particular HFE and SLC1 1A1/NRAMP1 , versus 91 % of normal subjects tested.

In order to exclude that the lack of amplification of messenger RNA coding for the mature isoform of 550 aa may be due to the low sensibility of the RT-PCR, a group of samples underwent additional Nested RT-PCR, as described in the methods. Using this technique, 20 samples, previously analyzed with normal RT-PCR, were retested and the Nested RT-PCR confirmed the previous result obtained with single amplifications, as described in Table 8.

Table 8

The results of 5 samples containing truncated isoforms are consistent with the presence of diverse sequences in the 5'UTR region and with varying relative quantities of each of them, so that they were difficult to amplify with a single reaction of RT-PCR. The nested RT-PCR was able to reveal them, giving rise to PCR products compatibile with the mRNA coding for truncated proteins of 483, 432 and 401 aa (see Tables 2 and 5).

It is equally important to note that 14% of the population of 35 patients with interstitial disease not diagnosed as idiopathic pulmonary fibrosis, who underwent diagnostic bronchoscopy and BAL, were identified as carriers of a variant allele of the HFE gene. When patients who presented both with HFE gene allelic variants and alterations in the expression of the SLC1 1A1/NRAMP1 gene were evaluated, it was found that their alveolar macrophages showed greater capacity for production of iron chelatable- dependent oxygen radicals as compared to subjects without genetic alterations (subjects with HFE variant and/or SLC1 1A1/NRAMP1 001 - missing: 98.89 + 75.58 (mean + SD) DC FDA/ DFO-FU/10 ⁵ BAL cells; subjects with HFE "wild type" and/or SLC1 1A1/NRAMP1 001 , 37.12 + 46.26 DCFDA/DFO-FU/ 0 ⁵ BAL cells; t test p<0.05) and were similar to those of subjects with idiopathic pulmonary fibrosis (Figure 5).

It has been noted that nonspecific interstitial pneumonia, not apparently fibrotic at the onset, can progess to usual interstitial pneumonia (UIP) (Schneider F, Hwang DM, Gibson K, Yousem SA. Nonspecific interstitial pneumonia: a study of 6 patients with progressive disease. Am j surg pathol. 2012;36:89-93). This finding indicates that the carrier condition for an allelic variant of the HFE gene is associated with the risk of developing pulmonary fibrosis and is an prognostic risk indicator for this condition in the subject who presents at the onset of disease with a radiological picture of "confident UIP" or possibile UIP or non specific interstitial pneumonia, fibrosing type (NSIP).

In conclusion, the experiments described define a new pathogenetic mechanism for pulmonary fibrosis/idiopathic interstitial fibrosis characterized by the non functioning allelic variants of the hereditary hemochromatosis HFE gene and the absent expression of the isoform of mRNA coding for the mature form of the 550 amino acid protein coded by the SCL11A1/NRAMP1 gene, divalent metal homeostasis regulator gene, in particular iron, selectively expressed by cells of the myeloid line. These abnormalities, in the presence of exaggerated accumulation of intracellular iron secondary to abnormal and increased function of the transferrin receptor caused by the mutation of the HFE gene, or to exposure to toboacco smoke and industrial fumes or to pulmonary microhemorrhages, lead to an increase of the levels of free iron in the lower respiratory tract capable of activating the Fenton reaction. In the context of constant exposure of alveolar macrophages to "irritating agents" such as aerosolized microbes, dusts or smoke, the abnormal presence of free iron leads, as an invevitalbie consequence, to the exaggerated production of oxygen radicals, the hydroxyl radical ( OH) in particular. Since it is known that the production of hydroxyl radical is primarily dependent on the reaction of H2O2 with ferrous iron, it can potentially be prevented by the administration of iron chelators.

The experimental data support the present invention demonstrating that, in alveolar macrophages in patients with idiopathic pulmonary fibrosis, the exaggerated production of hydroxyl radicals is mediated by intracellular free iron, is inhibitable by iron chelators and is associated with the expression of allelic variants of the HFE gene associated with hereditary emochromatosis.

Consequently, the new pathogenetic model of disease permits a new diagnostic approach to be designed based on the demonstration, using specific molecular and cell biology assays, of the expression of allelic variants and mutations of the HFE gene for hereditary hemochromatosis, of the dysregulation of the SCL11A1/NRAMP1 gene with expression of splicing isoforms which do not code for the "full length" SCL11A1/NRAMP1 protein, or of the complete lack of expression of the SCL11A1/NRAMP1 gene isoforms of coding messenger RNA and of the exaggerated production of oxygen radicals, in particular OH, associated with the altered expression of the HFE and SLC11A1/NRAMP1 genes.

In addition, the new pathogenetic model of disease permits new protocols to be designed for the prevention of idiopathic pulmonary fibrosis/usual interstitial pneumonia based on the identification of genetic and functional alterations in individuals with, or at risk for, non fibrotic interstittal diseases. This disease model allows for the rational application of protocols of therapy in humans, already experimented in animals, based on the use of iron chelators, which the data of the present invention demonstrate to be capable of reducing the production of hydroxyl radical to the point of interrupting the chain of pathological events that leads to the activation of fibrogenesis induced by the oxygen radical, OH in particular.