TITLE: Method of Modulating Flowering Time and Shoot Branching

FIELD OF THE INVENTION

The present invention relates to methods for modulating flowering time and/or shoot branching in plants by modulating the expression of the AtMBD9 gene. BACKGROUND OF THE INVENTION

Improvement of the agronomic characteristics of crop plants has been ongoing since the beginning of agriculture. Most of the land suitable for crop production is currently being used. As human populations continue to increase, improved crop varieties will be required to adequately provide our food and feed (Trewavas (2001) Plant Physiol. 125: 174-179). To avoid catastrophic famines and malnutrition, future crop cultivars will need to have improved yields with equivalent farm inputs. These cultivars will need to more effectively withstand adverse conditions such as drought, soil salinity or disease, which will be especially important as marginal lands are brought into cultivation. Finally, we will need cultivars with altered nutrient composition to enhance human and animal nutrition, and to enable more efficient food and feed processing. For all these traits, identification of the genes controlling phenotypic expression of traits of interest will be crucial in accelerating development of superior crop germplasm by conventional or transgenic means.

Modifying flowering time of crops, such as cereal crops, can be an important improvement in agriculture. Flowering time is an important trait in that its timing is an important determinant of the geographic region that a particular cultivar can be grown. For example, one needs lines that flower earlier in more Northerly latitudes like Ontario than one needs further south. Being able to control this with a single gene would allow for the movement of cultivars (of particular genetics) to be used in different geographic conditions which is very useful. Altering plant architecture (like modifying stature and lateral growth in this case) can be useful in a variety of circumstances. One example is the use of semi-dwarfs in rice and wheat.

A number of highly-efficient approaches are available to assist identification of genes playing key roles in expression of agronomically- important traits. These include genetics, genomics, bioinformatics, and functional genomics. Genetics is the scientific study of the mechanisms of inheritance. By identifying mutations that alter the pathway or response of interest, classical (or forward) genetics can help to identify the genes involved in these pathways or responses. For example, a mutant with enhanced susceptibility to disease may identify an important component of the plant signal transduction pathway leading from pathogen recognition to disease resistance. Genetics is also the central component in improvement of germplasm by breeding. Through molecular and phenotypic analysis of genetic crosses, loci controlling traits of interest can be mapped and followed in subsequent generations. Knowledge of the genes underlying phenotypic variation between crop accessions can enable development of markers that greatly increase efficiency of the germplasm improvement process, as well as open avenues for discovery of additional superior alleles.

Genomics is the system-level study of an organism's genome, including genes and corresponding gene products - RNA and proteins. At a first level, genomic approaches have provided large datasets of sequence information from diverse plant species, including full-length and partial cDNA sequences, and the complete genomic sequence of a model plant species, Arabidopsis thaliana. Recently, the first draft sequence of a crop plant's genome, that of rice (Oryza sativa), has also become available. Availability of a whole genome sequence makes possible the development of tools for system-level study of other molecular complements, such as arrays and chips for use in determining the complement of expressed genes in an organism under specific conditions. Such data can be used as a first indication of the potential for certain genes to play key roles in expression of different plant phenotypes. Bioinformatics approaches interface directly with first-level genomic datasets in allowing for processing to uncover sequences of interest by annotative or other means. Using, for example, similarity searches,

alignments and phylogenetic analyses, bioinformatics can often identify homologs of a gene product of interest. Very similar homologs (eg. > -90% amino acid identity over the entire length of the protein) are very likely orthologs, i.e. share the same function in different organisms. Functional genomics can be defined as the assignment of function to genes and their products. Functional genomics draws from genetics, genomics and bioinformatics to derive a path toward identifying genes important in a particular pathway or response of interest. Expression analysis, for example, uses high density DNA microarrays (often derived from genomic-scale organismal sequencing) to monitor the mRNA expression of thousands of genes in a single experiment. Experimental treatments can include those eliciting a response of interest, such as the disease resistance response in plants infected with a pathogen. To give additional examples of the use of microarrays, mRNA expression levels can be monitored in distinct tissues over a developmental time course, or in mutants affected in a response of interest. Proteomics can also help to assign function, by assaying the expression and post-translational modifications of hundreds of proteins in a single experiment.

Proteomics approaches are in many cases analogous to the approaches taken for monitoring mRNA expression in microarray experiments. Protein- protein interactions can also help to assign proteins to a given pathway or response, by identifying proteins that interact with known components of the pathway or response. For functional genomics, protein-protein interactions are often studied using large-scale yeast two-hybrid assays. Another approach to assigning gene function is to express the corresponding protein in a heterologous host, for example the bacterium Escherichia coli, followed by purification and enzymatic assays.

Ultimately, demonstration of the ability of a gene-of-interest to control a given trait must be derived from experimental testing in plant species of interest. The generation and analysis of plants transgenic for a gene of interest can be used for plant functional genomics, with several advantages. The gene can often be both overexpressed and underexpressed ("knocked

out"), thereby increasing the chances of observing a phenotype linking the gene to a pathway or response of interest. Two aspects of transgenic functional genomics help lend a high level of confidence to functional assignment by this approach. First, phenotypic observations are carried out in the context of the living plant. Second, the range of phenotypes observed can be checked and correlated with with observed expression levels of the introduced transgene. Transgenic functional genomics is especially valuable in improved cultivar development. Only genes that function in a pathway or response of interest, and that in addition are able to confer a desired trait- based phenotype, are promoted as candidate genes for crop improvement efforts. In some cases, transgenic lines developed for functional genomics studies can be directly utilized in initial stages of product development.

Another approach towards plant functional genomics involves first identifying plant lines with mutations in specific genes of interest, followed by phenotypic evaluation of the consequences of such gene knockouts on the trait under study. Such an approach reveals genes essential for expression of specific traits.

Genes identified through functional genomics can be directly employed in efforts towards germplasm improvement by transgenic means, as described above, or used to develop markers for identification of tracking of alleles-of-interest in mapping and breeding populations. Knowledge of such genes may also enable construction of superior alleles non-existent in nature, by any of a number of molecular methods.

In plants, one of the most common and well characterized epigenetic phenomena is DNA methylation, which frequently occurs as 5-methylcytosine (m ⁵ C) in symmetrical CpG and CpNpG sequences (Gruenbaum et al., 1981; Matzke et al., 1989). Gruenbaum et al. (1981) found that 5-methylcytosine may account for more than 30% of the total cytosine residues. DNA Methylation levels in Arabidopsis have been modulated in several ways including treatment with 5-azacytidine (Burn et al., 1993), expression of an antisense RNA to inhibit MET1 (a methytransferase gene) expression (Finnegan et al., 1996; Ronenus et al., 1996), or through mutations in the

DDM1 gene which encodes a chromatin remodelling protein (Jeddeloh et al., 1999). In each of these cases, Arabidopsis plants had a genome-wide reduction in DNA methylation, and simultaneously displayed a wide spectrum of heritable developmental abnormalities in whole plant morphology, flowering time, and fertility. At the molecular level, DNA methylation has been proposed to be associated with the repression of gene expression, for which two molecular mechanisms have been suggested (Bird and Wolffe, 1999; Bird, 2002). One mechanism is that DNA methylation directly inhibits gene transcription by methylating promoter regions, which blocks the binding of transcription factors to their cognate c/s-elements in promoters. Alternatively, DNA methylation has been proposed to prevent gene transcription indirectly through altering DNA secondary and tertiary structures and recruiting various transcription repressors to form an inactive chromatin conformation.

The best evidence for this latter indirect mechanism comes from the discovery and characterization of a group of mammalian CpG-binding domain (MBD) containing proteins, including MeCP2, MBD1 , MBD2 and MBD3 (Ballestar and Wolffe, 2001 ; Meehan, 2003). These mammalian MBD proteins have been shown to selectively bind methylated CpG through their MBD, and physically recruit distinct transcription repressor complexes, which contain histone deacetylases, chromatin remodelling proteins and transcription repressors, to cause global silencing of gene expression. One exception to this histone deacetylase-dependent model of mammalian MBD proteins is that MeCP2 was found to associate with histone H3K9 methyltransferase activity to achieve repression of gene transcription (Fuks et al., 2003). Mutations in these mammalian MBD proteins were found to severely impair animal development (Meehan, 2003). For instance, X chromosome-linked MeCP2 mutations in humans result in the occurrence of Rett syndrome (RTT), a neurodevelopmental disease (Amir and Zoghbi, 2000). Mice without functional MeCP2 develop RTT-like neurological symptoms (Guy et al., 2001) and mouse female parents with mutations in MBD2 have reduced body sizes and defective nurturing capacity (Hendrich et al., 2001).

In contrast to the considerable data on the role of mammalian MBD proteins, the knowledge of plant MBD proteins is very limited. A pea DNA- binding protein was identified and later partially purified which can recognize m ⁵ C (Zhang et al., 1989; Ehrlick, 1993). In carrot, two groups of methylated DNA-binding proteins, dcMBPI and dcMBP2 were detected (Pitto et al., 2000). However, the molecular identities of these proteins have not been determined. In the Arabidopsis genome, 13 putative MBD genes, called AtMBDI - AtMBD13 were identified through a bioinformatics analysis (Zemach and Grafi, 2003; Berg et al., 2003; lto et al., 2003; Scebba et al., 2003; Springer and Kaeppler, 2005), and the transcripts of these AtMBD genes except for AtMBDZ and AtMBDM were detected in different tissues (Berg et al., 2003). The in vitro methyl CpG binding capacity of some AtMBDs has been analyzed and Zemach and Grafi (2003) demonstrated that AtMBD5, 6 and 7 could bind specifically to symmetrically methylated CpG sites, lto et al. (2003) confirmed that AtMBDδ had the capacity to bind symmetrical methyl CpG, and showed that AtMBD4 and 6 could bind both methyl and unmethyl CpG sites. Nevertheless, there is little knowledge of the in planta biological function of these proteins. The expression of AtMBDH was decreased in Arabidopsis using RNA interference (RNAi) technology, and these transgenic plants exhibited a number of aberrant morphological and developmental traits, including extra rosettes, serrated leaves, low fertility, reduced apical dominance, and delayed flowering (Berg et al., 2003). Although these results indicate the importance of AtMBDH to Arabidopsis development, the pleiotropic phenotype of Z5S::AtMBD11 -RHA\ Arabidopsis plants makes it very difficult to define any specific in planta physiological function for AtMBDH. SUMMARY OF THE INVENTION

The present inventors have demonstrated that the in planta physiological function of the AtMBD9 locus is to regulate Arabidopsis flowering time and shoot branching. The most striking feature of AtMBD9 is that, contrary to its mammalian counterparts, it maintains or activates, rather than represses, gene expression. AtMBD9 is the largest member in the

AtMBD family, and encodes a MBD protein of 2167 amino acids having four other chromatin-associated domains besides MBD. Three atmbdθ mutant alleles resulting from T-DNA insertions in AtMBD9 exons were isolated, and each exhibited the early flowering and enhanced shoot branching phenotype. The acetylation level in the histone H3 and H4 of FLOWERING LOCUS C (FLC, a major repressor of Arabidopsis flowering) chromatin in the atmbdθ mutants was significantly decreased. Consequently the expression of FLC was markedly attenuated by the mutations in AtMBD9 gene which would explain the early flowering phenotype. Further, auxin levels and the MAX pathway, which have been defined as the two major factors in controlling Arabidopsis shoot branching, were not affected in the atmbd9 mutants, suggesting that AtMBD9 may regulate a novel pathway to control Arabidopsis shoot branching.

The present invention provides a method of modulating flowering time and/or shoot branching in a plant cell comprising modulating the expression of the AtMBD9 gene in the plant cell. The expression of the AtMBD9 gene can be modulated by administering an effective amount of an agent that can modulate the expression levels of the AtMBD9 gene or the activity of the AtMBD9 protein. Modulating flowering is useful in agriculture and horticulture. In food crops, the product is often the flowers or the result of flowering. Increasing the onset of flowering is useful in countries where the growing season is short. Accelerating the onset of flowering may also permit the planting of multiple crops. In one aspect, the present invention provides a method of inducing early flowering and enhanced shoot branching comprising administering an effective amount of an agent that can inhibit the expression oiAtMBD9 gene.

In one embodiment, the agent that can inhibit the expression of the AtMBD9-gene is an AtMBD9 mutant gene that can induce early flowering and enhanced shoot branching when expressed in a plant cell. The mutant is preferably a T-DNA insertion mutant including, but not limited to, the three mutants described herein, namely AtMBD9-1, AtMBD9-2 and AtMBD9-3.

In anther embodiment, the agent that can inhibit the expression of the AtMBD9 gene is an antisense oligonucleotide that is complementary to a sequence of the wild type AtMBD9 gene. In a preferred embodiment, the antisense oligonucleotide is complementary to a portion of the sequence shown in SEQ ID NO:1 which is the wild type AtMBD9 CDNA sequence. SEQ ID NO:2 which is a rice MBD9-like genomic sequence and/or SEQ ID NO:3 which is a maize MBD9-like partial genomic sequence. Modifying these sequences may also be useful in the methods of the invention.

Other methods to modulate AtMBD9 gene expression are described in "Section Vl. Alteration of Expression of Nucleic Acid Molecules" including but not limited to, using aptamers, RNA interference and mutagenesis.

It may also be useful to delay flowering for crops in which the non- flowering part is useful. Delaying flowering may increase the yield of the useful parts of the plant. In another aspect, the present invention provides a method of delaying flowering and reducing shoot branching comprising administering and effective amount of an agent that can increase the expression of the AtMBD9 gene.

In one embodiment, the agent is a nucleic acid molecule encoding the AtMBD9 protein, for example as shown in SEQ ID NO:1 , SEQ ID NO:2 or SEQ ID NO:3. In another embodiment, the agent is one that increases the activity of the AtMBD9 protein.

The plant cell can be any cell wherein one wishes to modify the flowering time or shoot branching. In one embodiment, the plant cell is a dicot. In another preferred embodiment, the plant is a gymnosperm. In another preferred embodiment, the plant is a monocot. In a more preferred embodiment, the monocot is a cereal. In a more preferred embodiment, the cereal may be, for example, maize, wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt, emmer, teff, milo, flax, gramma grass, Tripsacum sp., or teosinte. In one embodiment the nucleic acid is expressed in a specific location or tissue of a plant. The location or tissue is for example, but not limited to,

epidermis, root, vascular tissue, meristem, cambium, cortex, pith, leaf, and flower. In an alternative embodiment, the location or tissue is a seed.

Embodiments of the present invention also relate to use of a shuffled nucleic acid for controlling flowering time and/or shoot branching, said shuffled nucleic acid containing a plurality of nucleotide sequence fragments, wherein at least one of the fragments corresponds to a region of a nucleotide sequence of SEQ ID NO:1 , SEQ ID NO:2 or SEQ ID NO:3 and wherein at least two of the plurality of sequence fragments are in an order, from 5' to 3' which is not an order in which the plurality of fragments naturally occur in a nucleic acid. In a more preferred embodiment, all of the fragments in a shuffled nucleic acid containing a plurality of nucleotide sequence fragments are from a single gene. In a more preferred embodiment, the plurality of fragments originates from at least two different genes. In a more preferred embodiment, the shuffled nucleic acid is operably linked to a promoter sequence. Another more preferred embodiment is a use of a chimeric polynucleotide for controlling flowering time and/or shoot branching, said chimeric polynucleotide including a promoter sequence operably linked to the shuffled nucleic acid. In a more preferred embodiment, the shuffled nucleic acid is contained within a host cell. Embodiments of the present invention also contemplate a use of an expression cassette for controlling flowering time and/or shoot branching including a promoter sequence operably linked to an isolated nucleic acid.

Further encompassed within the invention is use of a recombinant vector for controlling flowering time and/or shoot branching comprising an expression cassette including a promoter sequence operably linked to an isolated nucleic acid.

Also encompassed are uses of plant cells, which contain expression cassettes, according to the present disclosure, and uses of plants, containing these plant cells. In a preferred embodiment, the plant is a dicot. In another preferred embodiment, the plant is a gymnosperm. In another preferred embodiment, the plant is a monocot. In a more preferred embodiment, the monocot is a cereal. In a more preferred embodiment, the cereal may be, for

example, maize, wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt, emmer, teff, milo, flax, gramma grass, Tripsacum and teosinte. In one embodiment, the expression cassette is expressed throughout the plant. In another embodiment, the expression cassette is expressed in a specific location or tissue of a plant. In a preferred embodiment, the location or tissue may be, for example, epidermis, root, vascular tissue, meristem, cambium, cortex, pith, leaf, and flower. In an alternative preferred embodiment, the location or tissue is a seed.

Embodiments of the present invention also provide the use of seed and isolated product from plants for controlling flowering time and/or shoot branching, which contain an expression cassette including a promoter sequence operably linked to an isolated nucleic acid.

In a preferred embodiment, the expression vector includes one or more elements such as, for example, but not limited to, a promoter-enhancer sequence, a selection marker sequence, an origin of replication, an epitope- tag encoding sequence, or an affinity purification-tag encoding sequence. In a more preferred embodiment, the promoter-enhancer sequence may be, for example, the CaMV 35S promoter, the CaMV 19S promoter, the tobacco PR- la promoter, ubiquitin and the phaseolin promoter. In another embodiment, the promoter is operable in plants, and more preferably, a constitutive or inducible promoter. In another preferred embodiment, the selection marker sequence encodes an antibiotic resistance gene. In another preferred embodiment, the epitope-tag sequence encodes V5, the peptide Phe-His-His- Thr-Thr (SEQ ID NO:4), hemagglutinin, or glutathione-S-transferase. In another preferred embodiment the affinity purification-tag sequence encodes a polyamino acid sequence or a polypeptide. In a more preferred embodiment, the polyamino acid sequence is polyhistidine. In a more preferred embodiment, the polypeptide is chitin binding domain or glutathione- S-transferase. In a more preferred embodiment, the affinity purification-tag sequence comprises an intein encoding sequence.

In a preferred embodiment, the expression vector is a eukaryotic expression vector or a prokaryotic expression vector. In a more preferred

embodiment, the eukaryotic expression vector includes a tissue-specific promoter. More preferably, the expression vector is operable in plants.

Embodiments of the present invention also relate to a plant modified by a method that includes introducing into a plant a nucleic acid where the nucleic acid is expressible in the plant in an amount effective to effect the modification. The modification can be increased or decreased flowering time or increased or decreased shoot branching. The modification may include overexpression, underexpression, antisense modulation, sense suppression, inducible expression, inducible repression, or inducible modulation of a gene. Other features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows early flowering and long petiole phenotype caused by T-DNA insertions at AtMBD9. (A) Comparing atmbd9-1 (SALK_054659), atmbd9-2 and atmbd9-3 with Columbia (CoI) for flowering time. (B) Rosette leaf number at bolting of atmbdθ mutants and CoI. Bars represent mean values ± standard deviation (n = 20). (C) Rosettes of two-week-old atmbd9-1 (SALK_054659) and CoI, showing longer petioles and leaf blades in atmbd9-1. Figure 2 shows the enhanced shoot branching phenotype of atmbd9 mutants. (A) Comparison of atmbd9-1 (SALK_054659), atmbd9-2 and atmbd9-3 with Columbia (CoI) for shoot branching occurrence six weeks after seed sowing. (B) and (C) were six-weeks-old rosettes of CoI and atmbd9-2, respectively, showing the outgrowth of new flower buds from rosette leaf axils. (D) Quantitative analysis of shoot branching occurrence in CoI, three atmbd9 mutants, max1, max4-1 and axr1-12. (E) Length of primary inflorescences of CoI, three atmbd9 mutants, max1, max4-1 and axr1-12. Bars represent mean values ± standard deviation (n = 20).

Figure 3 shows AtMBD9 T-DNA insertion mutants and the modular organization of AtM BD9 protein. (A) AtMBD9 gene structure and T-DNA positions of the three atmbdθ mutants. Exons and introns are represented by filled boxes and lines, respectively. (B) Comparing atmbd9-1, atmbd9-2 and atmbd9-3 with Columbia (CoI) for AtMBD9 expression determined by RT- PCR, showing no detectable AtMBD9 transcript in atmbd9 mutants. (C). Schematic diagram of the modular organization of AtMBD9 protein, displaying the locations of conserved domains. MBD: methyl-CpG-binding domain; PHD: plant homeodomin finger; BROMO: bromodomain; FYRN: N-terminal phenylalanine/tyrosine rich domain; FYRC: C-terminal phenylalanine/tyrosine rich domain.

Figure 4 shows the effect of AtMBD9 mutations on the expression of four important genes controlling Arabidopsis flowering time. (A) Comparing atmbd9-1, atmbd9-2 and atmbd9-3 with Columbia (CoI) for FLC, CO, SOC1 and LFY expression determined by RT-PCR. The number of PCR cycles for each gene is listed in parentheses. (B) Quantitative RT-RCR analysis of FLC expression in atmbdθ mutants and CoI. Bars represent mean values ± standard deviation (n = 5). Figure 5 shows ChIP analysis of the acetylation state of FLC chromatin in atmbdθ mutants and CoI plants. (A) Genomic structure of FLC gene, showing the regions examined by ChIP assays and T-DNA positions in flc-1 and flc-2 mutants. Filled boxes represent exons, and lines represent promoter and introns. (B) Comparing atmbd9-1, atmbd9-2 and atmbd9-3 with Columbia (CoI) for the acetylation level at different regions of FLC chromatin determined by ChIP-PCR. For ChIP assays, acetyl-histone H3 antibody (left panel) and acetyl-histone H4 antibody (right panel) were used to immunoprecipitate DNA, which was then quantified by PCR.

Figure 6 shows the effects from alteration of FLC expression in atmbd9-2 and CoI plants. (A), (C) and (E) show FLC expression level determined by RT- PCR, flowering phenotype and shoot branching occurrence in FLC- transformed atmbd9-2 plants, atmbd9-FLC1 and atmbd9-FLC2, respectively. (B), (D) and (F) exhibit RT-PCR analysis of FLC expression, flowering

phenotype and shoot branching occurrence in flc-1 and flc-2 mutants, respectively.

Figure 7 shows the response of atmbd9 mutants to auxin. (A) RT-PCR analysis of the expression of AXR1 and AXR3 in atmbd9 mutants and CoI. (B) Dose-response of CoI, atmbd9-2, and axr1-12 to IAA for their root growth. (C)

Effect of 0.1 μM IAA on the root growth of CoI, three atmbd9 mutants and axr1-12. (D) Effect of the synthetic auxin NAA on the outgrowth of lateral buds from the excised nodes of CoI, atmbd9-2, and axr1-12. Bars and points represent mean values ± standard deviation (n=20 in B & C, 10 in D). Figure 8 shows RT-PCR analysis of the expression of MAX genes in CoI and atmbdθ mutants. The number of PCR cycles for each gene is listed in parentheses.

Figure 9 shows the localization of AtMBD9-GOS expression in Arabidopsis plants. (A) and (B) Detection of AtMBD9-G[JS activity in seven- and fourteen- day-old plants, respectively. (C) High AtMBD9-GOS activity in old inflorescence and the junctions where lateral inflorescences are produced. (D)

AtMBD9-GUS staining in old cauline leaf. (E) and (F) Analysis of AtMBD9-

GUS activity in flower and siliques, respectively.

BREIF DESCRIPTION OF THE TABLES Table 1 shows the Arabidopsis AtMBD9 (At3g01460) cDNA full sequence

(6531 bp) (SEQ ID NO:1).

Table 2 shows a rice MBD9-like gene full length genomic sequence (4970 bp)

(SEQ ID NO:2).

Table 3 shows a maize MBD9-like gene partial genomic sequence (2508 bp) (SEQ ID NO:3).

DETAILED DESCRIPTION OF THE INVENTION

I. DEFINITIONS

For clarity, certain terms used in the specification are defined and presented as follows: "Associated with / operatively linked" refer to two nucleic acid sequences that are related physically or functionally. For example, a promoter or regulatory DNA sequence is said to be "associated with" a DNA

sequence that codes for an RNA or a protein if the two sequences are operatively linked, or situated such that the regulator DNA sequence will affect the expression level of the coding or structural DNA sequence.

A "chimeric construct" is a recombinant nucleic acid sequence in which a promoter or regulatory nucleic acid sequence is operatively linked to, or associated with, a nucleic acid sequence that codes for an mRNA or which is expressed as a protein, such that the regulatory nucleic acid sequence is able to regulate transcription or expression of the associated nucleic acid sequence. The regulatory nucleic acid sequence of the chimeric construct is not normally operatively linked to the associated nucleic acid sequence as found in nature.

A "co-factor" is a natural reactant, such as an organic molecule or a metal ion, required in an enzyme-catalyzed reaction. A co-factor is e.g. NAD(P), riboflavin (including FAD and FMN), folate, molybdopterin, thiamin, biotin, lipoic acid, pantothenic acid and coenzyme A, S-adenosylmethionine, pyridoxal phosphate, ubiquinone, menaquinone. Optionally, a co-factor can be regenerated and reused.

A "coding sequence" is a nucleic acid sequence that is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA. Preferably the RNA is then translated in an organism to produce a protein.

Complementary: "complementary" refers to two nucleotide sequences that comprise antiparallel nucleotide sequences capable of pairing with one another upon formation of hydrogen bonds between the complementary base residues in the antiparallel nucleotide sequences. Enzyme activity: means herein the ability of an enzyme to catalyze the conversion of a substrate into a product. A substrate for the enzyme comprises the natural substrate of the enzyme but also comprises analogues of the natural substrate, which can also be converted, by the enzyme into a product or into an analogue of a product. The activity of the enzyme is measured for example by determining the amount of product in the reaction after a certain period of time, or by determining the amount of substrate remaining in the reaction mixture after a certain period of time. The activity of

the enzyme is also measured by determining the amount of an unused co- factor of the reaction remaining in the reaction mixture after a certain period of time or by determining the amount of used co-factor in the reaction mixture after a certain period of time. The activity of the enzyme is also measured by determining the amount of a donor of free energy or energy-rich molecule (e.g. ATP, phosphoenolpyruvate, acetyl phosphate or phosphocreatine) remaining in the reaction mixture after a certain period of time or by determining the amount of a used donor of free energy or energy-rich molecule (e.g. ADP, pyruvate, acetate or creatine) in the reaction mixture after a certain period of time.

Expression Cassette: "Expression cassette" as used herein means a nucleic acid molecule capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operatively linked to the nucleotide sequence of interest which is operatively linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence. The coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction. The expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. Typically, however, the expression cassette is heterologous with respect to the host, i.e., the particular DNA sequence of the expression cassette does not occur naturally in the host cell and must have been introduced into the host cell or an ancestor of the host cell by a transformation event. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus. In the case of a multicellular

organism, such as a plant, the promoter can also be specific to a particular tissue or organ or stage of development.

Gene: the term "gene" is used broadly to refer to any segment of DNA associated with a biological function. Thus, genes include coding sequences and/or the regulatory sequences required for their expression. Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.

Heterologous/exogenous: The terms "heterologous" and "exogenous" when used herein to refer to a nucleic acid sequence (e.g. a DNA sequence) or a gene, refer to a sequence that originates from a source foreign to the particular host cell or, if from the same source, is modified from its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified through, for example, the use of DNA shuffling. The terms also include non-naturally occurring multiple copies of a naturally occurring DNA sequence. Thus, the terms refer to a DNA segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides.

A "homologous" nucleic acid (e.g. DNA) sequence is a nucleic acid (e.g. DNA) sequence naturally associated with a host cell into which it is introduced.

Hybridization: The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be

accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.

Inhibitor: a chemical substance that inactivates the enzymatic activity of a protein such as a biosynthetic enzyme, receptor, signal transduction protein, structural gene product, or transport protein. The term "herbicide" (or "herbicidal compound") is used herein to define an inhibitor applied to a plant at any stage of development, whereby the herbicide inhibits the growth of the plant or kills the plant.

Interaction: quality or state of mutual action such that the effectiveness or toxicity of one protein or compound on another protein is inhibitory (antagonists) or enhancing (agonists).

A nucleic acid sequence is "isocoding with" a reference nucleic acid sequence when the nucleic acid sequence encodes a polypeptide having the same amino acid sequence as the polypeptide encoded by the reference nucleic acid sequence.

Isogenic: plants that are genetically identical, except that they may differ by the presence or absence of a heterologous DNA sequence.

Isolated: in the context of the present invention, an isolated DNA molecule or an isolated enzyme is a DNA molecule or enzyme that, by the hand of man, exists apart from its native environment and is therefore not a product of nature. An isolated DNA molecule or enzyme may exist in a purified form or may exist in a non-native environment such as, for example, in a transgenic host cell.

Mature protein: protein from which the transit peptide, signal peptide, and/or propeptide portions have been removed.

Minimal Promoter: the smallest piece of a promoter, such as a TATA element, that can support any transcription. A minimal promoter typically has greatly reduced promoter activity in the absence of upstream activation. In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription.

Modified Enzyme Activity: enzyme activity different from that which naturally occurs in a plant (i.e. enzyme activity that occurs naturally in the

absence of direct or indirect manipulation of such activity by man), which is tolerant to inhibitors that inhibit the naturally occurring enzyme activity.

Native: refers to a gene that is present in the genome of an untransformed plant cell. Naturally occurring: the term "naturally occurring" is used to describe an object that can be found in nature as distinct from being artificially produced by man. For example, a protein or nucleotide sequence present in an organism (including a virus), which can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory, is naturally occurring.

Nucleic acid: the term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides which have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences and as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., MoI. Cell. Probes 8: 91-98 (1994)). The nucleic acids of the present invention (for example, antisense oligonucleotides and nucleic acids encoding AtMBD-9 and fragments thereof) may be ribonucleic or deoxyribonucleic acids and may contain naturally occurring bases including adenine, guanine, cytosine, thymidine and uracil. The oligonucleotides may also contain modified bases such as xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiouracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine,

8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8- halo guanines, 8-amino guanine, 8-thiol guanine, 8-thiolalkyl guanines, 8- hydroxyl guanine and other 8-substituted guanines, other aza and deaza uracils, thymidines, cytosines, adenines, or guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine.

Other nucleic acids of the invention may contain modified phosphorous, oxygen heteroatoms in the phosphate backbone, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. For example, the nucleic acid may contain phosphorothioates, phosphotriesters, methyl phosphonates, and phosphorodithioates. In an embodiment of the invention there are phosphorothioate bonds links between the four to six 3'-terminus bases. In another embodiment phosphorothioate bonds link all the nucleotides.

The nucleic acid of the invention may also comprise nucleotide analogs that may be better suited as therapeutic or experimental reagents. An example of a nucleotide analogue is a peptide nucleic acid (PNA) wherein the deoxyribose (or ribose) phosphate backbone in the DNA (or RNA) ₁ is replaced with a polyamide backbone which is similar to that found in peptides (P. E. Nielsen, et al Science 1991 , 254, 1497). PNA analogues have been shown to be resistant to degradation by enzymes and to have extended lives in vivo and in vitro. PNAs also bind stronger to a complimentary DNA sequence due to the lack of charge repulsion between the PNA strand and the DNA strand. Other nucleic acids may contain nucleotides containing polymer backbones, cyclic backbones, or acyclic backbones. For example, the nucleotides may have morpholino backbone structures (U.S. Patent No. 5,034,506). Nucleic acids may also contain groups such as reporter groups, a group for improving the pharmacokinetic properties of a nucleic acid, or a group for improving the pharmacodynamic properties of a nucleic acid. Nucleic acids may also have sugar mimetics. The terms "nucleic acid" or "nucleic acid sequence" may also be used interchangeably with gene, cDNA, and mRNA encoded by a gene. "ORF" means open reading frame.

Percent identity: the phrases "percent identical" or "percent identical," in the context of two nucleic acid or protein sequences, refers to two or more sequences or subsequences that have for example 60%, preferably 70%, more preferably 80%, still more preferably 90%, even more preferably 95%, and most preferably at least 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. Preferably, the percent identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the percent identity exists over at least about 150 residues. In an especially preferred embodiment, the percent identity exists over the entire length of the coding regions.

For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. MoI. Biol. 48: 443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl), or by visual inspection (see generally, Ausubel et al., infra).

One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is

described in Altschul et al., J. MoI. Biol. 215: 403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., 1990). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11 , an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1989)).

In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90: 5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid

sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1 , more preferably less than about 0.01, and most preferably less than about 0.001.

Pre-protein: protein that is normally targeted to a cellular organelle, such as a chloroplast, and still comprises its native transit peptide.

Purified: the term "purified," when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It is preferably in a homogeneous state although it can be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified. The term "purified" denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. Particularly, it means that the nucleic acid or protein is at least about 50% pure, more preferably at least about 85% pure, and most preferably at least about 99% pure. Two nucleic acids are "recombined" when sequences from each of the two nucleic acids are combined in a progeny nucleic acid. Two sequences are "directly" recombined when both of the nucleic acids are substrates for recombination. Two sequences are "indirectly recombined" when the sequences are recombined using an intermediate such as a cross-over oligonucleotide. For indirect recombination, no more than one of the sequences is an actual substrate for recombination, and in some cases, neither sequence is a substrate for recombination.

"Regulatory elements" refer to sequences involved in controlling the expression of a nucleotide sequence. Regulatory elements comprise a promoter operatively linked to the nucleotide sequence of interest and termination signals. They also typically encompass sequences required for proper translation of the nucleotide sequence.

Significant Increase: an increase in enzymatic activity that is larger than the margin of error inherent in the measurement technique, preferably an increase by about 2-fold or greater of the activity of the wild-type enzyme in the presence of the inhibitor, more preferably an increase by about 5-fold or greater, and most preferably an increase by about 10-fold or greater.

Significantly less: means that the amount of a product of an enzymatic reaction is reduced by more than the margin of error inherent in the measurement technique, preferably a decrease by about 2-fold or greater of the activity of the wild-type enzyme in the absence of the inhibitor, more preferably an decrease by about 5-fold or greater, and most preferably an decrease by about 10-fold or greater.

Specific Binding/lmmunological Cross-Reactivity: An indication that two nucleic acid sequences or proteins are substantially identical is that the protein encoded by the first nucleic acid is immunologically cross reactive with, or specifically binds to, the protein encoded by the second nucleic acid. Thus, a protein is typically substantially identical to a second protein, for example, where the two proteins differ only by conservative substitutions. The phrase "specifically (or selectively) binds to an antibody," or "specifically (or selectively) immunoreactive with," when referring to a protein or peptide, refers to a binding reaction which is determinative of the presence of the protein in the presence of a heterogeneous population of proteins and other biologies. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein and do not bind in a significant amount to other proteins present in the sample. Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. For example, antibodies raised to the protein with the amino acid sequence encoded by any of the nucleic acid sequences of the invention can be selected to obtain antibodies specifically immunoreactive with that protein and not with other proteins except for polymorphic variants. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays, Western blots, or immunohistochemistry are routinely used to

select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York "Harlow and Lane"), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity. Typically a specific or selective reaction will be at least twice background signal or noise and more typically more than 10 to 100 times background.

"Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York. Generally, highly stringent hybridization and wash conditions are selected to be about 5 ⁰ C lower than the thermal melting point (T _m ) for the specific sequence at a defined ionic strength and pH. Typically, under "stringent conditions" a probe will hybridize to its target subsequence, but to no other sequences.

The T _m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to the T _m for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42 ⁰ C, with the hybridization being carried out overnight. An example of highly stringent wash conditions is 0.1 5M NaCI at 72 ⁰ C for about 15 minutes. An example of stringent wash conditions is a 0.2x SSC wash at 65 ⁰ C for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a

duplex of, e.g., more than 100 nucleotides, is 1x SSC at 45 ⁰ C for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6x SSC at 4O ⁰ C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 3O ⁰ C. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. The following are examples of sets of hybridization/wash conditions that may be used to clone nucleotide sequences that are homologues of reference nucleotide sequences of the present invention: a reference nucleotide sequence preferably hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 5O ⁰ C with washing in 2X SSC, 0.1% SDS at 50 ⁰ C ₁ more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 5O ⁰ C with washing in 1X SSC, 0.1% SDS at 50 ⁰ C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1% SDS at 50°C, preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50 ⁰ C with washing in 0.1X SSC ₁ 0.1% SDS at 5O ⁰ C, more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50 ⁰ C with washing in 0.1 X SSC, 0.1% SDS at 65°C.

A "subsequence" refers to a sequence of nucleic acids or amino acids that comprise a part of a longer sequence of nucleic acids or amino acids (e.g., protein) respectively.

Substrate: a substrate is the molecule that an enzyme naturally recognizes and converts to a product in the biochemical pathway in which the

enzyme naturally carries out its function, or is a modified version of the molecule, which is also recognized by the enzyme and is converted by the enzyme to a product in an enzymatic reaction similar to the naturally-occurring reaction. Transformation: a process for introducing heterologous DNA into a plant cell, plant tissue, or plant. Transformed plant cells, plant tissue, or plants are understood to encompass not only the end product of a transformation process, but also transgenic progeny thereof.

"Transformed," "transgenic," and "recombinant" refer to a host organism such as a bacterium or a plant into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome of the host or the nucleic acid molecule can also be present as an extrachromosomal molecule. Such an extrachromosomal molecule can be auto-replicating. Transformed cells, tissues, or plants are understood to encompass not only the end product of a transformation process, but also transgenic progeny thereof. A "non-transformed," "non- transgenic," or "non-recombinant" host refers to a wild-type organism, e.g., a bacterium or plant, which does not contain the heterologous nucleic acid molecule. Viability: "viability" as used herein refers to a fitness parameter of a plant. Plants are assayed for their homozygous performance of plant development, indicating which proteins are essential for plant growth. II. General Description of Trait Functional Genomics

The goal of functional genomics is to identify genes controlling expression of organismal phenotypes, and employs a variety of methodologies, including but not limited to bioinformatics, gene expression studies, gene and gene product interactions, genetics, biochemistry and molecular genetics. For example, bioinformatics can assign function to a given gene by identifying genes in heterologous organisms with a high degree of similarity (homology) at the amino acid or nucleotide level. Expression of a gene at the mRNA or protein levels can assign function by linking expression of a gene to an environmental response, a developmental process or a

genetic (mutational) or molecular genetic (gene overexpression or underexpression) perturbation. Expression of a gene at the mRNA level can be ascertained either alone (Northern analysis) or in concert with other genes (microarray analysis), whereas expression of a gene at the protein level can be ascertained either alone (native or denatured protein gel or immunoblot analysis) or in concert with other genes (proteomic analysis). Knowledge of protein/protein and protein/DNA interactions can assign function by identifying proteins and nucleic acid sequences acting together in the same biological process. Genetics can assign function to a gene by demonstrating that DNA lesions (mutations) in the gene have a quantifiable effect on the organism, including but not limited to: its development; hormone biosynthesis and response; growth and growth habit (plant architecture); mRNA expression profiles; protein expression profiles; ability to resist diseases; tolerance of abiotic stresses; ability to acquire nutrients; photosynthetic efficiency; altered primary and secondary metabolism; and the composition of various plant organs. Biochemistry can assign function by demonstrating that the protein encoded by the gene, typically when expressed in a heterologous organism, possesses a certain enzymatic activity, alone or in combination with other proteins. Molecular genetics can assign function by overexpressing or underexpressing the gene in the native plant or in heterologous organisms, and observing quantifiable effects as described in functional assignment by genetics above. In functional genomics, any or all of these approaches are utilized, often in concert, to assign genes to functions across any of a number of organismal phenotypes. It is recognized by those skilled in the art that these different methodologies can each provide data as evidence for the function of a particular gene, and that such evidence is stronger with increasing amounts of data used for functional assignment: preferably from a single methodology, more preferably from two methodologies, and even more preferably from more than two methodologies. In addition, those skilled in the art are aware that different methodologies can differ in the strength of the evidence for the assignment of gene function. Typically, but not always, a datum of

biochemical, genetic and molecular genetic evidence is considered stronger than a datum of bioinformatic or gene expression evidence. Finally, those skilled in the art recognize that, for different genes, a single datum from a single methodology can differ in terms of the strength of the evidence provided by each distinct datum for the assignment of the function of these different genes.

The objective of crop trait functional genomics is to identify crop trait genes, i.e. genes capable of conferring useful agronomic traits in crop plants. Such agronomic traits include, but are not limited to: enhanced yield, whether in quantity or quality; enhanced nutrient acquisition and enhanced metabolic efficiency; enhanced or altered nutrient composition of plant tissues used for food, feed, fiber or processing; enhanced utility for agricultural or industrial processing; enhanced resistance to plant diseases; enhanced tolerance of adverse environmental conditions (abiotic stresses) including but not limited to drought, excessive cold, excessive heat, or excessive soil salinity or extreme acidity or alkalinity; and alterations in plant architecture or development, including changes in developmental timing. The deployment of such identified trait genes by either transgenic or non-transgenic means could materially improve crop plants for the benefit of agriculture. III. Traits of Interest

The present invention encompasses methods for modulating flowering time and shoot branching. Altering the expression of genes related to these traits can be used to improve or modify plants and/or grain, as desired. Examples describe the isolated genes of interest and methods of analyzing the alteration of expression and their effects on the plant characteristics.

One aspect of the present invention provides uses and methods for altering (i.e. increasing or decreasing) the level of AtMBD-9 nucleic acid molecules and polypeptides in plants. In particular, the nucleic acid molecules and polypeptides are expressed constitutively, temporally or spatially, e.g. at developmental stages, in certain tissues, and/or quantities, which are uncharacteristic of non-recombinantly engineered plants. Therefore, the

present invention provides utility in such exemplary applications as altering the specified characteristics identified above.

IV. Controlling Gene Expression in Transgenic Plants

The invention relates to transformed cells and methods for controlling flowering time and/or shoot branching and methods of modifying phenotypic traits of interest by altering the expression of the AtMBD-9 gene. A. Modification of Coding Sequences and Adjacent Sequences

The transgenic expression in plants of genes derived from heterologous sources may involve the modification of those genes to achieve and optimize their expression in plants. In particular, bacterial ORFs which encode separate enzymes but which are encoded by the same transcript in the native microbe are best expressed in plants on separate transcripts. To achieve this, each microbial ORF is isolated individually and cloned within a cassette which provides a plant promoter sequence at the 5' end of the ORF and a plant transcriptional terminator at the 3' end of the ORF. The isolated ORF sequence preferably includes the initiating ATG codon and the terminating STOP codon but may include additional sequence beyond the initiating ATG and the STOP codon. In addition, the ORF may be truncated, but still retain the required activity; for particularly long ORFs, truncated versions which retain activity may be preferable for expression in transgenic organisms. By "plant promoter" and "plant transcriptional terminator" it is intended to mean promoters and transcriptional terminators that operate within plant cells. This includes promoters and transcription terminators that may be derived from non-plant sources such as viruses (an example is the Cauliflower Mosaic Virus).

In some cases, modification to the ORF coding sequences and adjacent sequence is not required. It is sufficient to isolate a fragment containing the ORF of interest and to insert it downstream of a plant promoter. For example, Gaffney et al. (Science 261 : 754-756 (1993)) have expressed the Pseudomonas nahG gene in transgenic plants under the control of the CaMV 35S promoter and the CaMV tml terminator successfully without modification of the coding sequence and with nucleotides of the

Pseudomonas gene upstream of the ATG still attached, and nucleotides downstream of the STOP codon still attached to the nahG ORF. Preferably, as little adjacent microbial sequence as possible should be left attached upstream of the ATG and downstream of the STOP codon. In practice, such construction may depend on the availability of restriction sites.

In other cases, the expression of genes derived from microbial sources may provide problems in expression. These problems have been well characterized in the art and are particularly common with genes derived from certain sources such as Bacillus. These problems may apply to the nucleotide sequence of this invention and the modification of these genes can be undertaken using techniques now well known in the art. The following problems may be encountered:

1. Codon Usage.

The preferred codon usage in plants differs from the preferred codon usage in certain microorganisms. Comparison of the usage of codons within a cloned microbial ORF to usage in plant genes (and in particular genes from the target plant) will enable an identification of the codons within the ORF that should preferably be changed. Typically plant evolution has tended towards a strong preference of the nucleotides C and G in the third base position of monocotyledons, whereas dicotyledons often use the nucleotides A or T at this position. By modifying a gene to incorporate preferred codon usage for a particular target transgenic species, many of the problems described below for GC/AT content and illegitimate splicing will be overcome.

2. GC/AT Content. Plant genes typically have a GC content of more than 35%. ORF sequences which are rich in A and T nucleotides can cause several problems in plants. Firstly, motifs of ATTTA are believed to cause destabilization of messages and are found at the 3' end of many short-lived mRNAs. Secondly, the occurrence of polyadenylation signals such as AATAAA at inappropriate positions within the message is believed to cause premature truncation of transcription. In addition, monocotyledons may recognize AT-rich sequences as splice sites (see below).

3. Sequences Adjacent to the Initiating Methionine.

Plants differ from microorganisms in that their messages do not possess a defined ribosome-binding site. Rather, it is believed that ribosomes attach to the 5' end of the message and scan for the first available ATG at which to start translation. Nevertheless, it is believed that there is a preference for certain nucleotides adjacent to the ATG and that expression of microbial genes can be enhanced by the inclusion of a eukaryotic consensus translation initiator at the ATG. Clontech (1993/1994 catalog, page 210, incorporated herein by reference) have suggested one sequence as a consensus translation initiator for the expression of the E. coli uidA gene in plants. Further, Joshi {N.A.R. 15: 6643-6653 (1987), incorporated herein by reference) has compared many plant sequences adjacent to the ATG and suggests another consensus sequence. In situations where difficulties are encountered in the expression of microbial ORFs in plants, inclusion of one of these sequences at the initiating ATG may improve translation. In such cases the last three nucleotides of the consensus may not be appropriate for inclusion in the modified sequence due to their modification of the second AA residue. Preferred sequences adjacent to the initiating methionine may differ between different plant species. A survey of 14 maize genes located in the GenBank database provided the following results: Position Before the Initiating ATG in 14 Maize Genes:

=10 -9 Z - z6 ^■ A :3 2 - A

C 3 8 4 6 2 5 6 0 10 7

T 3 0 3 4 3 2 1 1 1 0

A 2 3 1 4 3 2 3 7 2 3

G 6 3 6 0 6 5 4 6 1 5

This analysis can be done for the desired plant species into which the nucleotide sequence is being incorporated, and the sequence adjacent to the ATG modified to incorporate the preferred nucleotides.

4. Removal of Illegitimate Splice Sites.

Genes cloned from non-plant sources and not optimized for expression in plants may also contain motifs which may be recognized in plants as 5' or

3' splice sites, and be cleaved, thus generating truncated or deleted messages. These sites can be removed using the techniques well known in the art.

Techniques for the modification of coding sequences and adjacent sequences are well known in the art. In cases where the initial expression of a microbial ORF is low and it is deemed appropriate to make alterations to the sequence as described above, then the construction of synthetic genes can be accomplished according to methods well known in the art. These are, for example, described in the published patent disclosures EP 0 385 962 (to Monsanto), EP 0 359 472 (to Lubrizol) and WO 93/07278 (to Ciba-Geigy), all of which are incorporated herein by reference. In most cases it is preferable to assay the expression of gene constructions using transient assay protocols (which are well known in the art) prior to their transfer to transgenic plants. B. Construction of Plant Expression Cassettes

Coding sequences intended for expression in transgenic plants are first assembled in expression cassettes behind a suitable promoter expressible in plants. The expression cassettes may also comprise any further sequences required or selected for the expression of the transgene. Such sequences include, but are not restricted to, transcription terminators, extraneous sequences to enhance expression such as introns, vital sequences, and sequences intended for the targeting of the gene product to specific organelles and cell compartments. These expression cassettes can then be easily transferred to the plant transformation vectors described below. The following is a description of various components of typical expression cassettes.

1. Promoters The selection of the promoter used in expression cassettes will determine the spatial and temporal expression pattern of the transgene in the transgenic plant. Selected promoters will express transgenes in specific cell

types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example) and the selection will reflect the desired location of accumulation of the gene product. Alternatively, the selected promoter may drive expression of the gene under various inducing conditions. Promoters vary in their strength, i.e., ability to promote transcription. Depending upon the host cell system utilized, any one of a number of suitable promoters can be used, including the gene's native promoter. The following are non-limiting examples of promoters that may be used in expression cassettes. a. Constitutive Expression, the Ubiquitin Promoter:

Ubiquitin is a gene product known to accumulate in many cell types and its promoter has been cloned from several species for use in transgenic plants (e.g. sunflower - Binet et al. Plant Science 79: 87-94 (1991); maize - Christensen et al. Plant Molec. Biol. 12: 619-632 (1989); and Arabidopsis - Callis et al., J. Biol. Chem. 265:12486-12493 (1990) and Norris et al., Plant MoI. Biol. 21:895-906 (1993)). The maize ubiquitin promoter has been developed in transgenic monocot systems and its sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP 0 342 926 (to Lubrizol) which is herein incorporated by reference. Taylor et al. (Plant Cell Rep. 12: 491-495 (1993)) describe a vector (pAHC25) that comprises the maize ubiquitin promoter and first intron and its high activity in cell suspensions of numerous monocotyledons when introduced via microprojectile bombardment. The Arabidopsis ubiquitin promoter is ideal for use with the nucleotide sequences of the present invention. The ubiquitin promoter is suitable for gene expression in transgenic plants, both monocotyledons and dicotyledons. Suitable vectors are derivatives of pAHC25 or any of the transformation vectors described in this application, modified by the introduction of the appropriate ubiquitin promoter and/or intron sequences. b. Constitutive Expression, the CaMV 35S Promoter:

Construction of the plasmid pCGN1761 is described in the published patent application EP 0 392 225 (Example 23), which is hereby incorporated

by reference. pCGN1761 contains the "double" CaMV 35S promoter and the tml transcriptional terminator with a unique EcoRI site between the promoter and the terminator and has a pUC-type backbone. A derivative of pCGN1761 is constructed which has a modified polylinker which includes Notl and Xhol sites in addition to the existing EcoRI site. This derivative is designated pCGN1761 ENX. pCGN1761 ENX is useful for the cloning of cDNA sequences or coding sequences (including microbial ORF sequences) within its polylinker for the purpose of their expression under the control of the 35S promoter in transgenic plants. The entire 35S promoter-coding sequence-fm/ terminator cassette of such a construction can be excised by Hindlll, Sphl, Sail, and Xbal sites 5' to the promoter and Xbal, BamHI and BgII sites 3' to the terminator for transfer to transformation vectors such as those described below. Furthermore, the double 35S promoter fragment can be removed by 5' excision with Hindlll, Sphl, Sail, Xbal, or Pstl, and 3' excision with any of the polylinker restriction sites (EcoRI, Notl or Xhol) for replacement with another promoter. If desired, modifications around the cloning sites can be made by the introduction of sequences that may enhance translation. This is particularly useful when overexpression is desired. For example, pCGN1761ENX may be modified by optimization of the translational initiation site as described in Example 37 of U.S. Patent No. 5,639,949, incorporated herein by reference. c. Constitutive Expression, the Actin Promoter: Several isoforms of actin are known to be expressed in most cell types and consequently the actin promoter is a good choice for a constitutive promoter. In particular, the promoter from the rice Actl gene has been cloned and characterized (McElroy et al. Plant Cell 2: 163-171 (1990)). A 1.3kb fragment of the promoter was found to contain all the regulatory elements required for expression in rice protoplasts. Furthermore, numerous expression vectors based on the Actl promoter have been constructed specifically for use in monocotyledons (McElroy et al. MoI. Gen. Genet. 231 : 150-160 (1991)). These incorporate the Actl-\ntron 1 , Adhl 5' flanking sequence and Adhl- ^' mtron 1 (from the maize alcohol dehydrogenase gene)

and sequence from the CaMV 35S promoter. Vectors showing highest expression were fusions of 35S and Actl intron or the Actl 5' flanking sequence and the Actl intron. Optimization of sequences around the initiating ATG (of the GUS reporter gene) also enhanced expression. The promoter expression cassettes described by McElroy et al. (MoI. Gen. Genet. 231 : 150- 160 (1991)) can be easily modified for gene expression and are particularly suitable for use in monocotyledonous hosts. For example, promoter- containing fragments is removed from the McElroy constructions and used to replace the double 35S promoter in pCGN1761 ENX, which is then available for the insertion of specific gene sequences. The fusion genes thus constructed can then be transferred to appropriate transformation vectors. In a separate report, the rice Actl promoter with its first intron has also been found to direct high expression in cultured barley cells (Chibbar et al. Plant Cell Rep. 12: 506-509 (1993)). d. Inducible Expression, PR-1 Promoters:

The double 35S promoter in pCGN 1761 ENX may be replaced with any other promoter of choice that will result in suitably high expression levels. By way of example, one of the chemically regulatable promoters described in U.S. Patent No. 5,614,395, such as the tobacco PR-Ia promoter, may replace the double 35S promoter. Alternately, the Arabidopsis PR-1 promoter described in Lebel et al., Plant J. 16:223-233 (1998) may be used. The promoter of choice is preferably excised from its source by restriction enzymes, but can alternatively be PCR-amplified using primers that carry appropriate terminal restriction sites. Should PCR-amplification be undertaken, the promoter should be re-sequenced to check for amplification errors after the cloning of the amplified promoter in the target vector. The chemically/pathogen regulatable tobacco PR-Ia promoter is cleaved from plasmid pCIB1004 (for construction, see example 21 of EP 0 332 104, which is hereby incorporated by reference) and transferred to plasmid pCGN1761ENX (Uknes et al., Plant Cell 4: 645-656 (1992)). pCIB1004 is cleaved with Ncol and the resultant 3' overhang of the linearized fragment is rendered blunt by treatment with T4 DNA polymerase. The fragment is then

cleaved with Hindlll and the resultant PR-Ia promoter-containing fragment is gel purified and cloned into pCGN1761ENX from which the double 35S promoter has been removed. This is accomplished by cleavage with Xhol and blunting with T4 polymerase, followed by cleavage with Hindlll, and isolation of the larger vector-terminator containing fragment into which the pCIB1004 promoter fragment is cloned. This generates a pCGN1761 ENX derivative with the PR-Ia promoter and the tml terminator and an intervening polylinker with unique EcoRI and Notl sites. The selected coding sequence can be inserted into this vector, and the fusion products {i.e. promoter-gene- terminator) can subsequently be transferred to any selected transformation vector, including those described infra. Various chemical regulators may be employed to induce expression of the selected coding sequence in the plants transformed according to the present invention, including the benzothiadiazole, isonicotinic acid, and salicylic acid compounds disclosed in U.S. Patent Nos. 5,523,311 and 5,614,395. e. Inducible Expression, an Ethanol-lnducible Promoter: A promoter inducible by certain alcohols or ketones, such as ethanol, may also be used to confer inducible expression of a coding sequence of the present invention. Such a promoter is for example the alcA gene promoter from Aspergillus nidulans (Caddick et al. (1998) Nat. Biotechnol 16:177-180). In A. nidulans, the alcA gene encodes alcohol dehydrogenase I, the expression of which is regulated by the AIcR transcription factors in presence of the chemical inducer. For the purposes of the present invention, the CAT coding sequences in plasmid palcA:CAT comprising a alcA gene promoter sequence fused to a minimal 35S promoter (Caddick et al. (1998) Nat. Biotechnol 16:177-180) are replaced by a coding sequence of the present invention to form an expression cassette having the coding sequence under the control of the alcA gene promoter. This is carried out using methods well known in the art. f. Inducible Expression, a Glucocorticoid-Inducible Promoter:

Induction of expression of a nucleic acid sequence of the present invention using systems based on steroid hormones is also contemplated.

For example, a glucocorticoid-mediated induction system is used (Aoyama and Chua (1997) The Plant Journal 11: 605-612) and gene expression is induced by application of a glucocorticoid, for example a synthetic glucocorticoid, preferably dexamethasone, preferably at a concentration ranging from 0.1mM to 1mM, more preferably from 1OmM to 10OmM. For the purposes of the present invention, the luciferase gene sequences are replaced by a nucleic acid sequence of the invention to form an expression cassette having a nucleic acid sequence of the invention under the control of six copies of the GAL4 upstream activating sequences fused to the 35S minimal promoter. This is carried out using methods well known in the art. The trans-acting factor comprises the GAL4 DNA-binding domain (Keegan et al. (1986) Science 231 : 699-704) fused to the transactivating domain of the herpes viral protein VP16 (Triezenberg et al. (1988) Genes Devel. 2: 718-729) fused to the hormone-binding domain of the rat glucocorticoid receptor (Picard et al. (1988) Cell 54: 1073-1080). The expression of the fusion protein is controlled either by a promoter known in the art or described here. This expression cassette is also comprised in the plant comprising a nucleic acid sequence of the invention fused to the 6xGAL4/minimal promoter. Thus, tissue- or organ-specificity of the fusion protein is achieved leading to inducible tissue- or organ-specificity of the insecticidal toxin. g. Root Specific Expression:

Another pattern of gene expression is root expression. A suitable root promoter is the promoter of the maize metallothionein-like (MTL) gene described by de Framond (FEBS 290: 103-106 (1991)) and also in U.S. Patent No. 5,466,785, incorporated herein by reference. This "MTL" promoter is transferred to a suitable vector such as pCGN1761ENX for the insertion of a selected gene and subsequent transfer of the entire promoter-gene- terminator cassette to a transformation vector of interest. h. Wound-lnducible Promoters: Wound-inducible promoters may also be suitable for gene expression.

Numerous such promoters have been described (e.g. Xu et al. Plant Molec. Biol. 22: 573-588 (1993), Logemann et al. Plant Cell V. 151-158 (1989),

Rohrmeier & Lehle, Plant Molec. Biol. 22: 783-792 (1993), Firek et al. Plant Molec. Biol. 22: 129-142 (1993), Warner et al. Plant J. 3: 191-201 (1993)) and all are suitable for use with the instant invention. Logemann et al. describe the 5' upstream sequences of the dicotyledonous potato wunl gene. Xu et al. show that a wound-inducible promoter from the dicotyledon potato (pin2) is active in the monocotyledon rice. Further, Rohrmeier & Lehle describe the cloning of the maize Wipl cDNA which is wound induced and which can be used to isolate the cognate promoter using standard techniques. Similar, Firek et al. and Warner et al. have described a wound-induced gene from the monocotyledon Asparagus officinalis, which is expressed at local wound and pathogen invasion sites. Using cloning techniques well known in the art, these promoters can be transferred to suitable vectors, fused to the genes pertaining to this invention, and used to express these genes at the sites of plant wounding. i. Pith-Preferred Expression:

Patent Application WO 93/07278, which is herein incorporated by reference, describes the isolation of the maize trpA gene, which is preferentially expressed in pith cells. The gene sequence and promoter extending up to -1726 bp from the start of transcription are presented. Using standard molecular biological techniques, this promoter, or parts thereof, can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a foreign gene in a pith- preferred manner. In fact, fragments containing the pith-preferred promoter or parts thereof can be transferred to any vector and modified for utility in transgenic plants. j. Leaf-Specific Expression:

A maize gene encoding phosphoenol carboxylase (PEPC) has been described by Hudspeth & Grula (Plant Molec Biol 12: 579-589 (1989)). Using standard molecular biological techniques the promoter for this gene can be used to drive the expression of any gene in a leaf-specific manner in transgenic plants.

k. Pollen-Specific Expression:

WO 93/07278 describes the isolation of the maize calcium-dependent protein kinase (CDPK) gene which is expressed in pollen cells. The gene sequence and promoter extend up to 1400 bp from the start of transcription. Using standard molecular biological techniques, this promoter or parts thereof, can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a nucleic acid sequence of the invention in a pollen-specific manner.

2. Transcriptional Terminators A variety of transcriptional terminators are available for use in expression cassettes. These are responsible for the termination of transcription beyond the transgene and correct rriRNA polyadenylation. Appropriate transcriptional terminators are those that are known to function in plants and include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator and the pea rbcS E9 terminator. These can be used in both monocotyledons and dicotyledons. In addition, a gene's native transcription terminator may be used.

3. Sequences for the Enhancement or Regulation of Expression Numerous sequences have been found to enhance gene expression from within the transcriptional unit and these sequences can be used in conjunction with the genes of this invention to increase their expression in transgenic plants.

Various intron sequences have been shown to enhance expression, particularly in monocotyledonous cells. For example, the introns of the maize Adhl gene have been found to significantly enhance the expression of the wild-type gene under its cognate promoter when introduced into maize cells. Intron 1 was found to be particularly effective and enhanced expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis et al., Genes Develop. 1: 1183-1200 (1987)). In the same experimental system, the intron from the maize bronzel gene had a similar effect in enhancing expression. Intron sequences have been routinely incorporated into plant transformation vectors, typically within the non-translated leader.

A number of non-translated leader sequences derived from viruses are also known to enhance expression, and these are particularly effective in dicotyledonous cells. Specifically, leader sequences from Tobacco Mosaic Virus (TMV, the "W-sequence"), Maize Chlorotic Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMV) have been shown to be effective in enhancing expression (e.g. GaIMe et al. Nucl. Acids Res. 15: 8693-8711 (1987); Skuzeski et al. Plant Molec. Biol. 15: 65-79 (1990)). Other leader sequences known in the art include but are not limited to: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein, O., Fuerst, T. R., and Moss, B. PNAS USA 86:6126-6130 (1989)); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Allison et al., 1986); MDMV leader (Maize Dwarf Mosaic Virus); Virology 154:9-20); human immunoglobulin heavy-chain binding protein (BiP) leader, (Macejak, D. G., and Sarnow, P., Nature 353: 90-94 (1991); untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4), (Jobling, S. A., and Gehrke, L., Nature 325:622-625 (1987); tobacco mosaic virus leader (TMV), (GaIMe, D. R. et al., Molecular Biology of RNA, pages 237-256 (1989); and Maize Chlorotic Mottle Virus leader (MCMV) (Lommel, S. A. et al., Virology 81 :382-385 (1991). See also, Della-Cioppa et al., Plant Physiology 84:965- 968 (1987).

In addition to incorporating one or more of the aforementioned elements into the 5' regulatory region of a target expression cassette of the invention, other elements peculiar to the target expression cassette may also be incorporated. Such elements include but are not limited to a minimal promoter. By minimal promoter it is intended that the basal promoter elements are inactive or nearly so without upstream activation. Such a promoter has low background activity in plants when there is no transactivator present or when enhancer or response element binding sites are absent. One minimal promoter that is particularly useful for target genes in plants is the Bz1 minimal promoter, which is obtained from the bronzel gene of maize. The Bz1 core promoter is obtained from the "myc" mutant Bz1-luciferase construct pBz1LucR98 via cleavage at the Nhel site located at -53 to -58. Roth et al.,

Plant Cell 3: 317 (1991). The derived Bz1 core promoter fragment thus extends from -53 to +227 and includes the Bz1 intron-1 in the 5 ¹ untranslated region. Also useful for the invention is a minimal promoter created by use of a synthetic TATA element. The TATA element allows recognition of the promoter by RNA polymerase factors and confers a basal level of gene expression in the absence of activation (see generally, Mukumoto (1993) Plant MoI Biol 23: 995-1003; Green (2000) Trends Biochem Sc/ 25: 59-63). 4. Targeting of the Gene Product Within the Cell Various mechanisms for targeting gene products are known to exist in plants and the sequences controlling the functioning of these mechanisms have been characterized in some detail. For example, the targeting of gene products to the chloroplast is controlled by a signal sequence found at the amino terminal end of various proteins which is cleaved during chloroplast import to yield the mature protein (e.g. Comai et al. J. Biol. Chem. 263: 15104-15109 (1988)). These signal sequences can be fused to heterologous gene products to effect the import of heterologous products into the chloroplast (van den Broeck, et al. Nature 313: 358-363 (1985)). DNA encoding for appropriate signal sequences can be isolated from the 5' end of the cDNAs encoding the RUBISCO protein, the CAB protein, the EPSP synthase enzyme, the GS2 protein and many other proteins which are known to be chloroplast localized. See also, the section entitled "Expression With Chloroplast Targeting" in Example 37 of U.S. Patent No. 5,639,949.

Other gene products are localized to other organelles such as the mitochondrion and the peroxisome (e.g. Unger et al. Plant Molec. Biol. 13: 411-418 (1989)). The cDNAs encoding these products can also be manipulated to effect the targeting of heterologous gene products to these organelles. Examples of such sequences are the nuclear-encoded ATPases and specific aspartate amino transferase isoforms for mitochondria. Targeting cellular protein bodies has been described by Rogers et al. (Proc. Natl. Acad. Sci. USA 82: 6512-6516 (1985)).

In addition, sequences have been characterized which cause the targeting of gene products to other cell compartments. Amino terminal

sequences are responsible for targeting to the ER, the apoplast, and extracellular secretion from aleurone cells (Koehler & Ho, Plant Cell 2: 769- 783 (1990)). Additionally, amino terminal sequences in conjunction with carboxy terminal sequences are responsible for vacuolar targeting of gene products (Shinshi et al. Plant Molec. Biol. 14: 357-368 (1990)).

By the fusion of the appropriate targeting sequences described above to transgene sequences of interest it is possible to direct the transgene product to any organelle or cell compartment. For chloroplast targeting, for example, the chloroplast signal sequence from the RUBISCO gene, the CAB gene, the EPSP synthase gene, or the GS2 gene is fused in frame to the amino terminal ATG of the transgene. The signal sequence selected should include the known cleavage site, and the fusion constructed should take into account any amino acids after the cleavage site which are required for cleavage. In some cases this requirement may be fulfilled by the addition of a small number of amino acids between the cleavage site and the transgene ATG or, alternatively, replacement of some amino acids within the transgene sequence. Fusions constructed for chloroplast import can be tested for efficacy of chloroplast uptake by in vitro translation of in vitro transcribed constructions followed by in vitro chloroplast uptake using techniques described by Bartlett et al. In: Edelmann et al. (Eds.) Methods in Chloroplast

Molecular Biology, Elsevier pp 1081-1091 (1982) and Wasmann et al. MoI.

Gen. Genet. 205: 446-453 (1986). These construction techniques are well known in the art and are equally applicable to mitochondria and peroxisomes.

The above-described mechanisms for cellular targeting can be utilized not only in conjunction with their cognate promoters, but also in conjunction with heterologous promoters so as to effect a specific cell-targeting goal under the transcriptional regulation of a promoter that has an expression pattern different to that of the promoter from which the targeting signal derives. C. Construction of Plant Transformation Vectors Numerous transformation vectors available for plant transformation are known to those of ordinary skill in the plant transformation arts, and the AtMBD-9 genes and antisense oligonucleotides pertinent to this invention can

be used in conjunction with any such vectors. The selection of vector will depend upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers may be preferred. Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra. Gene 19: 259-268 (1982); Bevan et al., Nature 304:184-187 (1983)), the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., Nucl. Acids Res 18: 1062 (1990), Spencer et al. Theor. Appl. Genet 79: 625-631 (1990)), the hph gene, which confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann, MoI Cell Biol 4: 2929-2931), and the dhfr gene, which confers resistance to methatrexate (Bourouis et al., EMBO J. 2(7): 1099-1104 (1983)), the EPSPS gene, which confers resistance to glyphosate (U.S. Patent Nos. 4,940,935 and 5,188,642), and the mannose-6-phosphate isomerase gene, which provides the ability to metabolize mannose (U.S. Patent Nos. 5,767,378 and 5,994,629).

1. Vectors Suitable for Agrobacterium Transformation Many vectors are available for transformation using Agrobacterium tumefaciens. These typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, Nucl. Acids Res. (1984)). Below, the construction of two typical vectors suitable for Agrobacterium transformation is described. a. pCIB200 and pCIB2001:

The binary vectors pCIB200 and pCIB2001 are used for the construction of recombinant vectors for use with Agrobacterium and are constructed in the following manner. pTJS75kan is created by Narl digestion of pTJS75 (Schmidhauser & Helinski, J. Bacteriol. 164: 446-455 (1985)) allowing excision of the tetracycline-resistance gene, followed by insertion of an Accl fragment from pUC4K carrying an NPTII (Messing & Vierra, Gene 19: 259-268 (1982): Bevan et al., Nature 304: 184-187 (1983): McBride et al., Plant Molecular Biology 14: 266-276 (1990)). Xhol linkers are ligated to the EcoRV fragment of PCIB7 which contains the left and right T-DNA borders, a

plant selectable nos/nptll chimeric gene and the pUC polylinker (Rothstein et al., Gene 53: 153-161 (1987)), and the Xλo/-digested fragment are cloned into Sa//-digested pTJS75kan to create pCIB200 (see also EP 0 332 104, example 19). pCIB200 contains the following unique polylinker restriction sites: EcoRI, Sstl, Kpnl, BgIII, Xbal, and Sail. pCIB2001 is a derivative of pCIB200 created by the insertion into the polylinker of additional restriction sites. Unique restriction sites in the polylinker of pCIB2001 are EcoRI, Sstl, Kpnl, BgIII, Xbal, Sail, MIuI, BcII, Avrll, Apal, Hpal, and Stul. pCIB2001 , in addition to containing these unique restriction sites also has plant and bacterial kanamycin selection, left and right T-DNA borders for Agrobactehum- mediated transformation, the RK2-derived trfA function for mobilization between E. coli and other hosts, and the OriT and OriV functions also from RK2. The pCIB2001 polylinker is suitable for the cloning of plant expression cassettes containing their own regulatory signals. b. pCIBIO and Hygromycin Selection Derivatives thereof:

The binary vector pCIBIO contains a gene encoding kanamycin resistance for selection in plants and T-DNA right and left border sequences and incorporates sequences from the wide host-range plasmid pRK252 allowing it to replicate in both E. coli and Agrobacterium. Its construction is described by Rothstein et al. (Gene 53: 153-161 (1987)). Various derivatives of pCIBIO are constructed which incorporate the gene for hygromycin B phosphotransferase described by Gritz et al. (Gene 25: 179-188 (1983)). These derivatives enable selection of transgenic plant cells on hygromycin only (pCIB743), or hygromycin and kanamycin (pCIB715, pCIB717). 2. Vectors Suitable for non-Agrobacterium Transformation

Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation) and microinjection. The choice of

vector depends largely on the preferred selection for the species being transformed. Below, the construction of typical vectors suitable for non- Agrobacterium transformation is described. a. pCIB3064: pCIB3064 is a pUC-derived vector suitable for direct gene transfer techniques in combination with selection by the herbicide basta (or phosphinothricin). The plasmid pCIB246 comprises the CaMV 35S promoter in operational fusion to the E. coli GUS gene and the CaMV 35S transcriptional terminator and is described in the PCT published application WO 93/07278. The 35S promoter of this vector contains two ATG sequences 5' of the start site. These sites are mutated using standard PCR techniques in such a way as to remove the ATGs and generate the restriction sites Sspl and Pvull. The new restriction sites are 96 and 37 bp away from the unique Sail site and 101 and 42 bp away from the actual start site. The resultant derivative of pCIB246 is designated pCIB3025. The GUS gene is then excised from pCIB3025 by digestion with Sail and Sacl, the termini rendered blunt and religated to generate plasmid pCIB3060. The plasmid pJIT82 is obtained from the John lnnes Centre, Norwich and the a 400 bp Smal fragment containing the bar gene from Streptomyces viridochromogenes is excised and inserted into the Hpal site of pCIB3060 (Thompson et al. EMBO J 6: 2519-2523 (1987)). This generated pCIB3064, which comprises the bar gene under the control of the CaMV 35S promoter and terminator for herbicide selection, a gene for ampicillin resistance (for selection in E. coli) and a polylinker with the unique sites Sphl, Pstl, Hindlll, and BamHI. This vector is suitable for the cloning of plant expression cassettes containing their own regulatory signals. b. pSOG19 and pSOG35: pSOG35 is a transformation vector that utilizes the E. coli gene dihydrofolate reductase (DFR) as a selectable marker conferring resistance to methotrexate. PCR is used to amplify the 35S promoter (-800 bp), intron 6 from the maize Adh1 gene (-550 bp) and 18 bp of the GUS untranslated leader sequence from pSOG10. A 250-bp fragment encoding the E. coli

dihydrofolate reductase type Il gene is also amplified by PCR and these two PCR fragments are assembled with a Sacl-Pstl fragment from pB1221 (Clontech) which comprises the pUC19 vector backbone and the nopaline synthase terminator. Assembly of these fragments generates pSOG19 which contains the 35S promoter in fusion with the intron 6 sequence, the GUS leader, the DHFR gene and the nopaline synthase terminator. Replacement of the GUS leader in pSOG19 with the leader sequence from Maize Chlorotic Mottle Virus (MCMV) generates the vector pSOG35. pSOG19 and pSOG35 carry the pUC gene for ampicillin resistance and have Hindlll, Sphl, Pstl and EcoRI sites available for the cloning of foreign substances. 3. Vector Suitable for Chloroplast Transformation For expression of a nucleotide sequence of the present invention in plant plastids, plastid transformation vector pPH143 (WO 97/32011, example 36) is used. The nucleotide sequence is inserted into pPH143 thereby replacing the PROTOX coding sequence. This vector is then used for plastid transformation and selection of transformants for spectinomycin resistance. Alternatively, the nucleotide sequence is inserted in pPH143 so that it replaces the aadH gene. In this case, transformants are selected for resistance to PROTOX inhibitors. D. Transformation

Once a AtMBD-9 nucleic acid sequence or antisense sequence has been cloned into an expression system, it is transformed into a plant cell. The receptor and target expression cassettes of the present invention can be introduced into the plant cell in a number of art-recognized ways. Methods for regeneration of plants are also well known in the art. For example, Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake, liposomes, electroporation, microinjection, and microprojectiles. In addition, bacteria from the genus Agrobacterium can be utilized to transform plant cells. Below are descriptions of representative techniques for transforming both dicotyledonous and monocotyledonous plants, as well as a representative plastid transformation technique.

1. Transformation of Dicotyledons

Transformation techniques for dicotyledons are well known in the art and include Agrobacterium-based techniques and techniques that do not require Agrobacterium. Uon-Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This can be accomplished by PEG or electroporation mediated uptake, particle bombardment-mediated delivery, or microinjection. Examples of these techniques are described by Paszkowski et a/., EMBO J 3: 2717-2722 (1984), Potrykus et a/., MoI. Gen. Genet. 199: 169-177 (1985), Reich et a/., Biotechnology 4: 1001-1004 (1986), and Klein et a/., Nature 327: 70-73 (1987). In each case the transformed cells are regenerated to whole plants using standard techniques known in the art.

Agro&actera/m-mediated transformation is a preferred technique for transformation of dicotyledons because of its high efficiency of transformation and its broad utility with many different species. Agrobacterium transformation typically involves the transfer of the binary vector carrying the foreign DNA of interest (e.g. pCIB200 or pCIB2001) to an appropriate Agrobacterium strain which may depend of the complement of vir genes carried by the host Agrobacterium strain either on a co-resident Ti plasmid or chromosomally (e.g. strain CIB542 for pCIB200 and pCIB2001 (Uknes et a/. Plant Cell 5: 159-169 (1993)). The transfer of the recombinant binary vector to Agrobacterium is accomplished by a triparental mating procedure using E. coli carrying the recombinant binary vector, a helper E. coli strain which carries a plasmid such as pRK2013 and which is able to mobilize the recombinant binary vector to the target Agrobacterium strain. Alternatively, the recombinant binary vector can be transferred to Agrobacterium by DNA transformation (Hδfgen & Willmitzer, Nucl. Acids Res. 16: 9877 (1988)).

Transformation of the target plant species by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with explants from the plant and follows protocols well known in the art. Transformed tissue is regenerated on selectable medium carrying the

antibiotic or herbicide resistance marker present between the binary plasmid T-DNA borders.

Another approach to transforming plant cells with a gene involves propelling inert or biologically active particles at plant tissues and cells. This technique is disclosed in U.S. Patent Nos. 4,945,050, 5,036,006, and 5,100,792 all to Sanford et al. Generally, this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and afford incorporation within the interior thereof. When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the desired gene. Alternatively, the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle. Biologically active particles (e.g., dried yeast cells, dried bacterium or a bacteriophage, each containing DNA sought to be introduced) can also be propelled into plant cell tissue.

2. Transformation of Monocotyledons

Transformation of most monocotyledon species has now also become routine. Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, and particle bombardment into callus tissue. Transformations can be undertaken with a single DNA species or multiple DNA species (i.e. co-transformation) and both these techniques are suitable for use with this invention. Co-transformation may have the advantage of avoiding complete vector construction and of generating transgenic plants with unlinked loci for the gene of interest and the selectable marker, enabling the removal of the selectable marker in subsequent generations, should this be regarded desirable. However, a disadvantage of the use of co-transformation is the less than 100% frequency with which separate DNA species are integrated into the genome (Schocher et a/. Biotechnology 4: 1093-1096 (1986)). Patent Applications EP 0 292 435, EP 0 392 225, and WO 93/07278 describe techniques for the preparation of callus and protoplasts from an elite inbred line of maize, transformation of protoplasts using PEG or

electroporation, and the regeneration of maize plants from transformed protoplasts. Gordon-Kamm et al. (Plant Cell 2: 603-618 (1990)) and Fromm et al. (Biotechnology 8: 833-839 (1990)) have published techniques for transformation of A188-derived maize line using particle bombardment. Furthermore, WO 93/07278 and Koziel et al. (Biotechnology IJ; 194-200 (1993)) describe techniques for the transformation of elite inbred lines of maize by particle bombardment. This technique utilizes immature maize embryos of 1.5-2.5 mm length excised from a maize ear 14-15 days after pollination and a PDS-1000He Biolistics device for bombardment. Transformation of rice can also be undertaken by direct gene transfer techniques utilizing protoplasts or particle bombardment. Protoplast-mediated transformation has been described for Japoπ/ca-types and /nd/ca-types (Zhang et al. Plant Cell Rep 7: 379-384 (1988); Shimamoto et al. Nature 338: 274-277 (1989); Datta et al. Biotechnology 8: 736-740 (1990)). Both types are also routinely transformable using particle bombardment (Christou et al. Biotechnology 9: 957-962 (1991)). Furthermore, WO 93/21335 describes techniques for the transformation of rice via electroporation.

Patent Application EP 0 332 581 describes techniques for the generation, transformation and regeneration of Pooideae protoplasts. These techniques allow the transformation of Dactylis and wheat. Furthermore, wheat transformation has been described by Vasil et al. (Biotechnology Ij): 667-674 (1992)) using particle bombardment into cells of type C long-term regenerable callus, and also by Vasil et al. (Biotechnology IJ.: 1553-1558 (1993)) and Weeks et al. (Plant Physiol. 102: 1077-1084 (1993)) using particle bombardment of immature embryos and immature embryo-derived callus. A preferred technique for wheat transformation, however, involves the transformation of wheat by particle bombardment of immature embryos and includes either a high sucrose or a high maltose step prior to gene delivery. Prior to bombardment, any number of embryos (0.75-1 mm in length) are plated onto MS medium with 3% sucrose (Murashiga & Skoog, Physiologia Plantarum 15: 473-497 (1962)) and 3 mg/l 2,4-D for induction of somatic embryos, which is allowed to proceed in the dark. On the chosen day of

bombardment, embryos are removed from the induction medium and placed onto the osmoticum (i.e. induction medium with sucrose or maltose added at the desired concentration, typically 15%). The embryos are allowed to plasmolyze for 2-3 hours and are then bombarded. Twenty embryos per target plate is typical, although not critical. An appropriate gene-carrying plasmid (such as pCIB3064 or pSG35) is precipitated onto micrometer size gold particles using standard procedures. Each plate of embryos is shot with the DuPont Biolistics® helium device using a burst pressure of ~1000 psi using a standard 80 mesh screen. After bombardment, the embryos are placed back into the dark to recover for about 24 hours (still on osmoticum). After 24 hrs, the embryos are removed from the osmoticum and placed back onto induction medium where they stay for about a month before regeneration. Approximately one month later the embryo explants with developing embryogenic callus are transferred to regeneration medium (MS + 1 mg/liter NAA, 5 mg/liter GA), further containing the appropriate selection agent (10 mg/l basta in the case of pCIB3064 and 2 mg/l methotrexate in the case of pSOG35). After approximately one month, developed shoots are transferred to larger sterile containers known as "GA7s" which contain half- strength MS, 2% sucrose, and the same concentration of selection agent. Tranformation of monocotyledons using Agrobacterium has also been described. See, WO 94/00977 and U.S. Patent No. 5,591 ,616, both of which are incorporated herein by reference. See also, Negrotto et al., Plant Cell Reports 19: 798-803 (2000), incorporated herein by reference.

For this example, rice (Oryza sativa) is used for generating transgenic plants. Various rice cultivars can be used (Hiei et al., 1994, Plant Journal 6:271-282; Dong et al., 1996, Molecular Breeding 2:267-276; Hiei et al., 1997, Plant Molecular Biology, 35:205-218). Also, the various media constituents described below may be either varied in quantity or substituted. Embryogenic responses are initiated and/or cultures are established from mature embryos by culturing on MS-CIM medium (MS basal salts, 4.3 g/liter; B5 vitamins (200 x), 5 ml/liter; Sucrose, 30 g/liter; proline, 500 mg/liter; glutamine, 500 mg/liter; casein hydrolysate, 300 mg/liter; 2,4-D (1 mg/ml), 2 ml/liter; adjust pH to 5.8

with 1 N KOH; Phytagel, 3 g/liter). Either mature embryos at the initial stages of culture response or established culture lines are inoculated and co- cultivated with the Agnobacterium tumefaciens strain LBA4404 (Agrobacterium) containing the desired vector construction. Agrobacterium is cultured from glycerol stocks on solid YPC medium (100 mg/L spectinomycin and any other appropriate antibiotic) for ~2 days at 28 ⁰ C. Agrobacterium is re-suspended in liquid MS-CIM medium. The Agrobacterium culture is diluted to an OD600 of 0.2-0.3 and acetosyringone is added to a final concentration of 200 uM. Acetosyringone is added before mixing the solution with the rice cultures to induce Agrobacterium for DNA transfer to the plant cells. For inoculation, the plant cultures are immersed in the bacterial suspension. The liquid bacterial suspension is removed and the inoculated cultures are placed on co-cultivation medium and incubated at 22°C for two days. The cultures are then transferred to MS-CIM medium with Ticarcillin (400 mg/liter) to inhibit the growth of Agrobacterium. For constructs utilizing the PMI selectable marker gene (Reed et al., In Vitro Cell. Dev. Biol.-Plant 37:127-132), cultures are transferred to selection medium containing Mannose as a carbohydrate source (MS with 2%Mannose, 300 mg/liter Ticarcillin) after 7 days, and cultured for 3-4 weeks in the dark. Resistant colonies are then transferred to regeneration induction medium (MS with no 2,4-D, 0.5 mg/liter IAA, 1 mg/liter zeatin, 200 mg/liter timentin 2% Mannose and 3% Sorbitol) and grown in the dark for 14 days. Proliferating colonies are then transferred to another round of regeneration induction media and moved to the light growth room. Regenerated shoots are transferred to GA7 containers with GA7-1 medium (MS with no hormones and 2% Sorbitol) for 2 weeks and then moved to the greenhouse when they are large enough and have adequate roots. Plants are transplanted to soil in the greenhouse (T ₀ generation) grown to maturity, and the Ti seed is harvested.

3. Transformation of Plastids Seeds of Nicotiana tabacum c.v. 'Xanthi nc' are germinated seven per plate in a 1" circular array on T agar medium and bombarded 12-14 days after sowing with 1 μm tungsten particles (M10, Biorad, Hercules, CA) coated with

DNA from plasmids pPH143 and pPH145 essentially as described (Svab, Z. and Maliga, P. (1993) PNAS 90, 913-917). Bombarded seedlings are incubated on T medium for two days after which leaves are excised and placed abaxial side up in bright light (350-500 μmol photons/m ² /s) on plates of RMOP medium (Svab, Z., Hajdukiewicz, P. and Maliga, P. (1990) PNAS 87, 8526-8530) containing 500 μg/ml spectinomycin dihydrochloride (Sigma, St. Louis, MO). Resistant shoots appearing underneath the bleached leaves three to eight weeks after bombardment are subcloned onto the same selective medium, allowed to form callus, and secondary shoots isolated and subcloned. Complete segregation of transformed plastid genome copies (homoplasmicity) in independent subclones is assessed by standard techniques of Southern blotting (Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor). BamHI/EcoRI-digested total cellular DNA (Mettler, I. J. (1987) Plant MoI Biol Reporter 5, 346-349) is separated on 1% Tris-borate (TBE) agarose gels, transferred to nylon membranes (Amersham) and probed with ³² P-labeled random primed DNA sequences corresponding to a 0.7 kb BamHI/Hindlll DNA fragment from pC8 containing a portion of the rps7/12 plastid targeting sequence. Homoplasmic shoots are rooted aseptically on spectinomycin- containing MS/IBA medium (McBride, K. E. et al. (1994) PNAS 91 , 7301- 7305) and transferred to the greenhouse. V. Breeding and Seed Production A. Breeding

The plants obtained via transformation with an AtMBD-9 nucleic acid sequence can be any of a wide variety of plant species, including those of monocots and dicots; however, the plants used in the method of the invention are preferably selected from the list of agronomically important target crops set forth supra. The expression of an AtMBD-9 gene in combination with other characteristics important for production and quality can be incorporated into plant lines through breeding. Breeding approaches and techniques are known in the art. See, for example, Welsh J. R., Fundamentals of Plant Genetics and Breeding, John Wiley & Sons, NY (1981); Crop Breeding, Wood

D. R. (Ed.) American Society of Agronomy Madison, Wisconsin (1983); Mayo O., The Theory of Plant Breeding, Second Edition, Clarendon Press, Oxford (1987); Singh, DP., Breeding for Resistance to Diseases and Insect Pests, Springer-Verlag, NY (1986); and Wricke and Weber, Quantitative Genetics and Selection Plant Breeding, Walter de Gruyter and Co., Berlin (1986).

The genetic properties engineered into the transgenic seeds and plants described above are passed on by sexual reproduction or vegetative growth and can thus be maintained and propagated in progeny plants. Generally said maintenance and propagation make use of known agricultural methods developed to fit specific purposes such as tilling, sowing or harvesting. Specialized processes such as hydroponics or greenhouse technologies can also be applied. As the growing crop is vulnerable to attack and damages caused by insects or infections as well as to competition by weed plants, measures are undertaken to control weeds, plant diseases, insects, nematodes, and other adverse conditions to improve yield. These include mechanical measures such a tillage of the soil or removal of weeds and infected plants, as well as the application of agrochemicals such as herbicides, fungicides, gametocides, nematicides, growth regulants, ripening agents and insecticides. Use of the advantageous genetic properties of the transgenic plants and seeds according to the invention can further be made in plant breeding, which aims at the development of plants with improved properties. The various breeding steps are characterized by well-defined human intervention such as selecting the lines to be crossed, directing pollination of the parental lines, or selecting appropriate progeny plants. Depending on the desired properties, different breeding measures are taken. The relevant techniques are well known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, multiline breeding, variety blend, interspecific hybridization, aneuploid techniques, etc. Hybridization techniques also include the sterilization of plants to yield male or female sterile plants by mechanical, chemical, or biochemical means. Cross pollination of a male sterile plant with pollen of a different line assures that the genome of the male

sterile but female fertile plant will uniformly obtain properties of both parental lines. Thus, the transgenic seeds and plants according to the invention can be used for the breeding of improved plant lines, that for example, increase the effectiveness of conventional methods such as herbicide or pesticide treatment or allow one to dispense with said methods due to their modified genetic properties. Alternatively new crops with improved stress tolerance can be obtained, which, due to their optimized genetic "equipment", yield harvested product of better quality than products that were not able to tolerate comparable adverse developmental conditions. B. Seed Production

In seed production, germination quality and uniformity of seeds are essential product characteristics. As it is difficult to keep a crop free from other crop and weed seeds, to control seedborne diseases, and to produce seed with good germination, fairly extensive and well-defined seed production practices have been developed by seed producers, who are experienced in the art of growing, conditioning and marketing of pure seed. Thus, it is common practice for the farmer to buy certified seed meeting specific quality standards instead of using seed harvested from his own crop. Propagation material to be used as seeds is customarily treated with a protectant coating comprising herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides, or mixtures thereof. Customarily used protectant coatings comprise compounds such as captan, carboxin, thiram (TMTD ^® ), methalaxyl (Apron ^® ), and pirimiphos-methyl (Actellic ^® ). If desired, these compounds are formulated together with further carriers, surfactants or application-promoting adjuvants customarily employed in the art of formulation to provide protection against damage caused by bacterial, fungal or animal pests. The protectant coatings may be applied by impregnating propagation material with a liquid formulation or by coating with a combined wet or dry formulation. Other methods of application are also possible such as treatment directed at the buds or the fruit.

Vl. Alteration of Expression of Nucleic Acid Molecules

The alteration in expression of the nucleic acid molecules for use in the present invention is achieved in one of the following ways:

A. "Sense" Suppression Alteration of the expression of a nucleotide sequence used in the present invention, preferably reduction of its expression, is obtained by "sense" suppression (referenced in e.g. Jorgensen et al. (1996) Plant MoI. Biol. 31 , 957-973). In this case, the entirety or a portion of a AtMBD-9 nucleotide sequence is comprised in a DNA molecule (See for example, SEQ ID NO:1). The DNA molecule is preferably operatively linked to a promoter functional in a cell comprising the target gene, preferably a plant cell, and introduced into the cell, in which the nucleotide sequence is expressible. The nucleotide sequence is inserted in the DNA molecule in the "sense orientation", meaning that the coding strand of the nucleotide sequence can be transcribed. In a preferred embodiment, the nucleotide sequence is fully translatable and all the genetic information comprised in the nucleotide sequence, or portion thereof, is translated into a polypeptide. In another preferred embodiment, the nucleotide sequence is partially translatable and a short peptide is translated. In a preferred embodiment, this is achieved by inserting at least one premature stop codon in the nucleotide sequence, which bring translation to a halt. In another more preferred embodiment, the nucleotide sequence is transcribed but no translation product is being made. This is usually achieved by removing the start codon, e.g. the "ATG", of the polypeptide encoded by the nucleotide sequence. In a further preferred embodiment, the DNA molecule comprising the nucleotide sequence, or a portion thereof, is stably integrated in the genome of the plant cell. In another preferred embodiment, the DNA molecule comprising the nucleotide sequence, or a portion thereof, is comprised in an extrachromosomally replicating molecule. In transgenic plants containing one of the DNA molecules described immediately above, the expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA molecule is preferably

reduced. Preferably, the nucleotide sequence in the DNA molecule is at least 70% identical to the nucleotide sequence the expression of which is reduced, more preferably it is at least 80% identical, yet more preferably at least 90% identical, yet more preferably at least 95% identical, yet more preferably at least 99% identical.

B. "Anti-sense" Suppression

In another preferred embodiment, the alteration of the expression of an AtMBD-9 nucleotide sequence, preferably the reduction of its expression is obtained by "anti-sense" suppression. The entirety or a portion of a AtMBD-9 nucleotide sequence is comprised in a DNA molecule. The DNA molecule is preferably operatively linked to a promoter functional in a plant cell, and introduced in a plant cell, in which the nucleotide sequence is expressible. The nucleotide sequence is inserted in the DNA molecule in the "anti-sense orientation", meaning that the reverse complement (also called sometimes non-coding strand) of the nucleotide sequence can be transcribed. In a preferred embodiment, the DNA molecule comprising the nucleotide sequence, or a portion thereof, is stably integrated in the genome of the plant cell. In another preferred embodiment the DNA molecule comprising the nucleotide sequence, or a portion thereof, is comprised in an extrachromosomally replicating molecule. Several publications describing this approach are cited for further illustration (Green, P. J. et al., Ann. Rev. Biochem. 55:569-597 (1986); van der Krol, A. R. et al, Antisense Nuc. Acids & Proteins, pp. 125-141 (1991); Abel, P. P. et al., PNASroc. Natl. Acad. Sci. USA 86:6949-6952 (1989); Ecker, J. R. et al., Proc. Natl. Acad. Sci. USANAS 83:5372-5376 (Aug. 1986)).

In transgenic plants containing one of the DNA molecules described immediately above, the expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA molecule is preferably reduced. Preferably, the nucleotide sequence in the DNA molecule is at least 70% identical to the nucleotide sequence the expression of which is reduced, more preferably it is at least 80% identical, yet more preferably at least 90%

identical, yet more preferably at least 95% identical, yet more preferably at least 99% identical.

C. Homologous Recombination

In another preferred embodiment, at least one genomic copy corresponding to an AtMBD-9 nucleotide sequence is modified in the genome of the plant by homologous recombination as further illustrated in Paszkowski et al., EMBO Journal 7:4021-26 (1988). This technique uses the property of homologous sequences to recognize each other and to exchange nucleotide sequences between each by a process known in the art as homologous recombination. Homologous recombination can occur between the chromosomal copy of a nucleotide sequence in a cell and an incoming copy of the nucleotide sequence introduced in the cell by transformation. Specific modifications are thus accurately introduced in the chromosomal copy of the nucleotide sequence. In one embodiment, the regulatory elements of the nucleotide sequence of the present invention are modified. Such regulatory elements are easily obtainable by screening a genomic library using the nucleotide sequence of the present invention, or a portion thereof, as a probe. The existing regulatory elements are replaced by different regulatory elements, thus altering expression of the nucleotide sequence, or they are mutated or deleted, thus abolishing the expression of the nucleotide sequence. In another embodiment, the nucleotide sequence is modified by deletion of a part of the nucleotide sequence or the entire nucleotide sequence, or by mutation. Expression of a mutated polypeptide in a plant cell is also contemplated in the uses of the present invention. More recent refinements of this technique to disrupt endogenous plant genes have been described (Kempin et al., Nature 389:802-803 (1997) and Miao and Lam, Plant J., 7:359-365 (1995).

In another preferred embodiment, a mutation in the chromosomal copy of an AtMBD-9 nucleotide sequence is introduced by transforming a cell with a chimeric oligonucleotide composed of a contiguous stretch of RNA and DNA residues in a duplex conformation with double hairpin caps on the ends. An additional feature of the oligonucleotide is for example the

presence of 2'-O-methylation at the RNA residues. The RNA/DNA sequence is designed to align with the sequence of a chromosomal copy of a nucleotide sequence of the present invention and to contain the desired nucleotide change. For example, this technique is further illustrated in US patent 5,501,967 and Zhu et al. (1999) Proc. Natl. Acad. Sci. USA 96: 8768- 8773.

D. Ribozymes

In a further embodiment, the RNA coding for an AtMBD-9 polypeptide is cleaved by a catalytic RNA ₁ or ribozyme, specific for such RNA. The ribozyme is expressed in transgenic plants and results in reduced amounts of RNA coding for the polypeptide of the present invention in plant cells, thus leading to reduced amounts of polypeptide accumulated in the cells. This method is further illustrated in US patent 4,987,071. E. Dominant-Negative Mutants In another preferred embodiment, the activity of the polypeptide encoded by the AtMBD-9 nucleotide sequences is changed. This is achieved by expression of dominant negative mutants of the proteins in transgenic plants, leading to the loss of activity of the endogenous protein. F. Aptamers In a further embodiment, the activity of AtMBD-9 polypeptide is inhibited by expressing in transgenic plants nucleic acid ligands, so-called aptamers, which specifically bind to the protein. Aptamers are preferentially obtained by the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method. In the SELEX method, a candidate mixture of single stranded nucleic acids having regions of randomized sequence is contacted with the protein and those nucleic acids having an increased affinity to the target are partitioned from the remainder of the candidate mixture. The partitioned nucleic acids are amplified to yield a ligand enriched mixture. After several iterations a nucleic acid with optimal affinity to the polypeptide is obtained and is used for expression in transgenic plants. This method is further illustrated in US patent 5,270,163.

G. Zinc finger proteins

A zinc finger protein that binds an AtMBD-9 nucleotide sequence or to its regulatory region is also used to alter expression of the nucleotide sequence. Preferably, transcription of the nucleotide sequence is reduced or increased. Zinc finger proteins are for example described in Beerli et al. (1998) PNAS PNAS 95:14628-14633., or in WO 95/19431 , WO 98/54311, or WO 96/06166, all incorporated herein by reference in their entirety.

H. dsRNA Alteration of the expression of an AtMBD-9 nucleotide sequence is also obtained by dsRNA interference as described for example in WO 99/32619, WO 99/53050 or WO 99/61631, all incorporated herein by reference in their entirety. In another preferred embodiment, the alteration of the expression of an AtMBD-9 nucleotide sequence, preferably the reduction of its expression, is obtained by double-stranded RNA (dsRNA) interference. The entirety or, preferably a portion of a nucleotide sequence of the present invention is comprised in a DNA molecule. The size of the DNA molecule is preferably from 100 to 1000 nucleotides or more; the optimal size to be determined empirically. Two copies of the identical DNA molecule are linked, separated by a spacer DNA molecule, such that the first and second copies are in opposite orientations. In the preferred embodiment, the first copy of the DNA molecule is in the reverse complement (also known as the non-coding strand) and the second copy is the coding strand; in the most preferred embodiment, the first copy is the coding strand, and the second copy is the reverse complement. The size of the spacer DNA molecule is preferably 200 to 10,000 nucleotides, more preferably 400 to 5000 nucleotides and most preferably 600 to 1500 nucleotides in length. The spacer is preferably a random piece of DNA, more preferably a random piece of DNA without homology to the target organism for dsRNA interference, and most preferably a functional intron which is effectively spliced by the target organism. The two copies of the DNA molecule separated by the spacer are operatively linked to a promoter functional in a plant cell, and introduced in a plant cell, in which the nucleotide sequence is expressible. In a preferred embodiment, the DNA

molecule comprising the nucleotide sequence, or a portion thereof, is stably integrated in the genome of the plant cell. In another preferred embodiment the DNA molecule comprising the nucleotide sequence, or a portion thereof, is comprised in an extrachromosomally replicating molecule. Several publications describing this approach are cited for further illustration (Waterhouse et al. (1998) PNAS 95:13959-13964; Chuang and Meyerowitz (2000) PNAS 97:4985-4990; Smith et al. (2000) Nature 407:319-320). Alteration of the expression of a nucleotide sequence by dsRNA interference is also described in, for example WO 99/32619, WO 99/53050 or WO 99/61631, all incorporated herein by reference in their entirety.

In transgenic plants containing one of the DNA molecules described immediately above, the expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA molecule is preferably reduced. Preferably, the nucleotide sequence in the DNA molecule is at least 70% identical to the nucleotide sequence the expression of which is reduced, more preferably it is at least 80% identical, yet more preferably at least 90% identical, yet more preferably at least 95% identical, yet more preferably at least 99% identical.

I. Insertion of a DNA molecule (Insertional mutagenesis) In another preferred embodiment, a DNA molecule is inserted into a chromosomal copy of an AtMBD-9 nucleotide sequence, or into a regulatory region thereof. Preferably, such DNA molecule comprises a transposable element capable of transposition in a plant cell, such as e.g. Ac/Ds, Em/Spm, mutator. Alternatively, the DNA molecule comprises a T-DNA border of an Agrobacterium T-DNA. The DNA molecule may also comprise a recombinase or integrase recognition site which can be used to remove part of the DNA molecule from the chromosome of the plant cell. Methods of insertional mutagenesis using T-DNA, transposons, oligonucleotides or other methods known to those skilled in the art are also encompassed. Methods of using T- DNA and transposon for insertional mutagenesis are described in Winkler et al. (1989) Methods MoI. Biol. 82:129-136 and Martienssen (1998) PNAS 95:2021-2026, incorporated herein by reference in their entireties.

J. Deletion mutagenesis

In yet another embodiment, a mutation of an AtMBD-9 nucleic acid molecule is created in the genomic copy of the sequence in the cell or plant by deletion of a portion of the nucleotide sequence or regulator sequence. Methods of deletion mutagenesis are known to those skilled in the art. See, for example, Miao et al, (1995) Plant J. 7:359.

In yet another embodiment, this deletion is created at random in a large population of plants by chemical mutagenesis or irradiation and a plant with a deletion in a gene of the present invention is isolated by forward or reverse genetics. Irradiation with fast neutrons or gamma rays is known to cause deletion mutations in plants (Silverstone et al, (1998) Plant Cell, 10:155-169; Bruggemann et al., (1996) Plant J., 10:755-760; Redei and Koncz in Methods in Arabidopsis Research, World Scientific Press (1992), pp. 16-82). Deletion mutations in a gene of the present invention can be recovered in a reverse genetics strategy using PCR with pooled sets of genomic DNAs as has been shown in C. elegans (Liu et al., (1999), Genome Research, 9:859-867.). A forward genetics strategy would involve mutagenesis of a line displaying PTGS followed by screening the M2 progeny for the absence of PTGS. Among these mutants would be expected to be some that disrupt a gene of the present invention. This could be assessed by Southern blot or PCR for a gene of the present invention with genomic DNA from these mutants. K. Overexpression in a plant cell

In yet another preferred embodiment, an AtMBD-9 nucleotide sequence encoding a polypeptide is over-expressed. Examples of nucleic acid molecules and expression cassettes for over-expression of an AtMBD-9 nucleic acid molecule are described above. Methods known to those skilled in the art of over-expression of nucleic acid molecules are also encompassed by the present invention.

In a preferred embodiment, the expression of the AtMBD-9 nucleotide sequence is altered in every cell of a plant. This is for example obtained though homologous recombination or by insertion in the chromosome. This is also for example obtained by expressing a sense or antisense RNA, zinc

finger protein or ribozyme under the control of a promoter capable of expressing the sense or antisense RNA, zinc finger protein or ribozyme in every cell of a plant. Constitutive expression, inducible, tissue-specific or developmentally-regulated expression are also within the scope of the present invention and result in a constitutive, inducible, tissue-specific or developmentally-regulated alteration of the expression of a nucleotide sequence of the present invention in the plant cell. Constructs for expression of the sense or antisense RNA, zinc finger protein or ribozyme, or for over- expression of a nucleotide sequence of the present invention, are prepared and transformed into a plant cell according to the teachings of the present invention, e.g. as described infra. VII. Polypeptides

The present invention further relates to use of isolated polypeptides for controlling flowering time and/or shoot branching. One skilled in the art will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide or protein sequence which alters, adds or deletes a single amino acid or a small percent of amino acids in the encoded sequence is a "conservative modification" where the modification results in the substitution of an amino acid with a chemically similar amino acid. Conservative modified variants provide similar biological activity as the unmodified polypeptide. Conservative substitution tables listing functionally similar amino acids are known in the art. See Crighton (1984) Proteins, W.H. Freeman and Company.

In another preferred embodiment, the polypeptide having substantial similarity is an allelic variant of a polypeptide sequence, or a fragment, domain, repeat, feature, or chimeras thereof. In another preferred embodiment, the isolated nucleic acid includes a plurality of regions from the polypeptide sequence encoded by a nucleotide sequence identical to or having substantial similarity to a nucleotide sequence listed in SEQ ID NO:1 , SEQ ID NO:2 or SEQ ID NO:3, or fragment, domain, or feature thereof, or a sequence complementary thereto.

In another preferred embodiment, the polypeptide is a functional fragment or domain. In yet another preferred embodiment, the polypeptide is a chimera, where the chimera may include functional protein domains, including domains, repeats, post-translational modification sites, or other features. In a more preferred embodiment, the polypeptide is a plant polypeptide. In a more preferred embodiment, the plant is a dicot. In a more preferred embodiment, the plant is a gymnosperm. In a more preferred embodiment, the plant is a monocot. In a more preferred embodiment, the monocot is a cereal. In a more preferred embodiment, the cereal may be, for example, maize, wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt, emmer, teff, milo, flax, gramma grass, Tripsacum, and teosinte. In another preferred embodiment, the cereal is rice.

In a preferred embodiment, the polypeptide is expressed in a specific location or tissue of a plant. In a more preferred embodiment, the location or tissue is for example, but not limited to, epidermis, vascular tissue, meristem, cambium, cortex or pith. In a most preferred embodiment, the location or tissue is leaf or sheath, root, flower, and developing ovule or seed. In a more preferred embodiment, the location or tissue may be, for example, epidermis, root, vascular tissue, meristem, cambium, cortex, pith, leaf, and flower. In a more preferred embodiment, the location or tissue is a seed.

In a preferred embodiment, the polypeptide sequence encoded by a nucleotide sequence having substantial similarity to a nucleotide sequence listed in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, or a fragment, domain, or feature thereof or a sequence complementary thereto, includes a deletion or insertion of at least one nucleotide. In a more preferred embodiment, the deletion or insertion is of less than about thirty nucleotides. In a most preferred embodiment, the deletion or insertion is of less than about five nucleotides.

In a preferred embodiment, the polypeptide sequence encoded by a nucleotide sequence having substantial similarity to a nucleotide sequence listed in SEQ ID NO:1 , SEQ ID NO:2 or SEQ ID NO:3, or fragment, domain, or feature thereof or a sequence complementary thereto, includes a

substitution of at least one codon. In a more preferred embodiment, the substitution is conservative.

The polypeptides for use in the invention, fragments thereof or variants thereof can comprise any number of contiguous amino acid residues from a polypeptide of the invention, wherein the number of residues is selected from the group of integers consisting of from 10 to the number of residues in a full- length polypeptide of the invention. Preferably, the portion or fragment of the polypeptide is a functional protein. The present invention includes active polypeptides having specific activity of at least 20%, 30%, or 40%, and preferably at least 505, 60%, or 70%, and most preferably at least 805, 90% or 95% that of the native (non-synthetic) endogenous polypeptide. Further, the substrate specificity (WKm) is optionally substantially similar to the native (non-synthetic), endogenous polypeptide. Typically the K _m will be at least 30%, 40%, or 50% of the native, endogenous polypeptide; and more preferably at least 605, 70%, 80%, or 90%. Methods of assaying and quantifying measures of activity and substrate specificity are well known to those of skill in the art.

In another embodiment, AtMBD-9 polypeptides can be employed as immunogens for constructing antibodies immunoreactive to an AtMBD-9 protein for such purposes, but not limited to, immunoassays or protein purification techniques. Immunoassays for determining binding are well known to those of skill in the art such as, but not limited to, ELISAs or competitive immunoassays.

Embodiments of the present invention also relate to use of chimeric polypeptides for controlling flowering time and/or shoot branching, said chimeric polypeptides encoded by AtMBD-9 isolated nucleic acid molecules including a chimeric polypeptide containing a polypeptide sequence encoded by an isolated nucleic acid containing a nucleotide sequence including:

(a) a nucleotide sequence listed in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, or an exon, domain, or feature thereof;

(b) a nucleotide sequence having substantial similarity to (a);

(c) a nucleotide sequence capable of hybridizing to (a) preferably under stringent hybridization conditions;

(d) a nucleotide sequence complementary to (a), (b) or (c); and

(e) a nucleotide sequence which is the reverse complement of (a), (b) or (c); or

(T) a functional fragment thereof.

The present invention also relates to the use of expression cassettes comprising an AtMBD-9 nucleic acid for controlling flowering time and/or shoot branching. The AtMBD-9 isolated nucleic acid molecules can express an AtMBD-9 polypeptide in a recombinantly engineered cell such as a bacteria, yeast, insect, mammalian or plant cell. The cells produce the polypeptide in a non-natural condition (e.g. in quantity, composition, location and/or time) because they have been genetically altered to do so. Those skilled in the art are knowledgeable in the numerous expression systems available for expression of nucleic acids encoding a AtMBD-9 protein, and will not be described in detail below.

Briefly, the expression of AtMBD-9 isolated nucleic acids encoding a polypeptide will typically be achieved, for example, by operably linking the nucleic acid or cDNA to a promoter (constitutive or regulatable) followed by incorporation into an expression vector. The vectors are suitable for replication and/or integration in either prokaryotes or eukaryotes. Commonly used expression vectors comprise transcription and translation terminators, initiation sequences and promoters for regulation of the expression of the nucleic acid molecule encoding the polypeptide. To obtain high levels of expression of the cloned nucleic acid molecule, it is desirable to use expression vectors comprising a strong promoter to direct transcription, a ribosome binding site for translation initiation, and a transcription/translation terminator. One skilled in the art will recognize that modifications may be made to the AtMBD-9 polypeptide without diminishing its biological activity. Some modifications may be made to facilitate the cloning, expression or incorporation of the polypeptide of the invention into a fusion protein. Such modification are well known in the art and include, but are not limited to, a

methionine added at the amino terminus to provide an initiation site, or additional amino acids (e.g. poly Histidine) placed on either terminus to create conveniently located purification sequences. Restriction sites or termination codons can also be introduced into the vector. In a preferred embodiment, the expression vector includes one or more elements such as, for example, but not limited to, a promoter-enhancer sequence, a selection marker sequence, an origin of replication, an epitope- tag encoding sequence, or an affinity purification-tag encoding sequence. In a more preferred embodiment, the promoter-enhancer sequence may be, for example, the CaMV 35S promoter, the CaMV 19S promoter, the tobacco PR- la promoter, the ubiquitin promoter, and the phaseolin promoter. In another embodiment, the promoter is operable in plants, and more preferably, a constitutive or inducible promoter. In another preferred embodiment, the selection marker sequence encodes an antibiotic resistance gene. In another preferred embodiment, the epitope-tag sequence encodes V5, the peptide Phe-His-His-Thr-Thr, hemagglutinin, or glutathione-S-transferase. In another preferred embodiment the affinity purification-tag sequence encodes a polyamino acid sequence or a polypeptide. In a more preferred embodiment, the polyamino acid sequence is polyhistidine. In a more preferred embodiment, the polypeptide is chitin binding domain or glutathione-S- transferase. In a more preferred embodiment, the affinity purification-tag sequence comprises an intein encoding sequence.

Prokaryotic cells may be used as host cells, for example, but not limited to, Escherichia coli, and other microbial strains known to those in the art. Methods for expressing proteins in prokaryotic cells are well known to those in the art and can be found in many laboratory manuals such as Molecular Cloning: A Laboratory Manual, by J. Sambrook et al. (1989, Cold Spring Harbor Laboratory Press). A variety of promoters, ribosome binding sites, and operators to control expression are available to those skilled in the art, as are selectable markers such as antibiotic resistance genes. The type of vector chosen is to allow for optimal growth and expression in the selected cell type.

A variety of eukaryotic expression systems are available such as, but not limited to, yeast, insect cell lines, plant cells and mammalian cells. Expression and synthesis of heterologous proteins in yeast is well known (see Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, 1982). Commonly used yeast strains widely used for production of eukaryotic proteins are Saccharomyces cerevisiae and Pichia pastoris, and vectors, strains and protocols for expression are available from commercial suppliers (e.g., Invitrogen).

Mammalian cell systems may be transfected with expression vectors for production of proteins. Many suitable host cell lines are available to those in the art, such as, but not limited to the HEK293, BHK21 and CHO cells lines. Expression vectors for these cells can include expression control sequences such as an origin of replication, a promoter, ( e.g., the CMV promoter, a HSV tk promoter or phosphoglycerate kinase (pgk) promoter), an enhancer, and protein processing sites such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcription terminator sequences. Other animal cell lines useful for the production of proteins are available commercially or from depositories such as the American Type Culture Collection.

Expression vectors for expressing proteins in insect cells are usually derived from the SF9 baculovirus or other viruses known in the art. A number of suitable insect cell lines are available including but not limited to, mosquito larvae, silkworm, armyworm, moth and Drosophila cell lines.

Methods of transfecting animal and lower eukaryotic cells are known. Numerous methods are used to make eukaryotic cells competent to introduce DNA such as but not limited to: calcium phosphate precipitation, fusion of the recipient cell with bacterial protoplasts containing the DNA, treatment of the recipient cells with liposomes containing the DNA, DEAE dextrin, electroporation, biolistics, and microinjection of the DNA directly into the cells. Tranfected cells are cultured using means well known in the art (see, Kuchler, R.J., Biochemical Methods in Cell Culture and Virology, Dowden, Hutchinson and Ross, Inc. 1997).

Once an AtMBD-9 polypeptide is expressed it may be isolated and purified from the cells using methods known to those skilled in the art. The purification process may be monitored using Western blot techniques or radioimmunoassay or other standard immunoassay techniques. Protein purification techniques are commonly known and used by those in the art (see R. Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York 1982: Deutscher, Guide to Protein Purification, Academic Press (1990). Embodiments of the present invention provide a method of producing a recombinant protein in which the expression vector includes one or more elements including a promoter-enhancer sequence, a selection marker sequence, an origin of replication, an epitope-tag encoding sequence, and an affinity purification-tag encoding sequence. In one preferred embodiment, the nucleic acid construct includes an epitope-tag encoding sequence and the isolating step includes use of an antibody specific for the epitope-tag. In another preferred embodiment, the nucleic acid construct contains a polyamino acid encoding sequence and the isolating step includes use of a resin comprising a polyamino acid binding substance, preferably where the polyamino acid is polyhistidine and the polyamino binding resin is nickel- charged agarose resin. In yet another preferred embodiment, the nucleic acid construct contains a polypeptide encoding sequence and the isolating step includes the use of a resin containing a polypeptide binding substance, preferably where the polypeptide is a chitin binding domain and the resin contains chitin-sepharose.

The AtMBD-9 polypeptides for use in the present invention can be synthesized using non-cellular synthetic methods known to those in the art. Techniques for solid phase synthesis are described by Barany and Mayfield, Solid-Phase Peptide Synthesis, pp. 3-284 in the Peptides: Analysis, Synthesis, Biology, Vol.2, Special Methods in Peptide Synthesis, Part A; Merrifield, et al., J. Am. Chem. Soc. 85:2149-56 (1963) and Stewart et a/., Solid Phase Peptide Synthesis, 2 ^nd ed. Pierce Chem. Co., Rockford, IL (1984).

The present invention further provides a method for modifying (i.e. increasing or decreasing) the concentration or composition of the AtMBD-9 polypeptides in a plant or part thereof. Modification can be effected by increasing or decreasing the concentration and/or the composition (i.e. the ratio of the AtMBD-9 polypeptides) in a plant. The method comprises introducing into a plant cell with an expression cassette comprising an AtMBD-9 nucleic acid molecule, or a nucleic acid encoding a RAR 1 sequence as described above to obtain a transformed plant cell or tissue, culturing the transformed plant cell or tissue. The nucleic acid molecule can be under the regulation of a constitutive or inducible promoter. The method can further comprise inducing or repressing expression of a nucleic acid molecule of a sequence in the plant for a time sufficient to modify the concentration and/or composition in the plant or plant part.

A plant or plant part having modified expression of an AtMBD-9 nucleic acid molecule for use in the invention can be analyzed and selected using methods known to those skilled in the art such as, but not limited to, Southern blot, DNA sequencing, or PCR analysis using primers specific to the nucleic acid molecule and detecting amplicons produced therefrom.

In general, concentration or composition is increased or decreased by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% relative to a native control plant, plant part or cell lacking the expression cassette.

The invention will be further described by reference to the following detailed examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. EXAMPLES RESULTS

AtMBD9 Mutants Flowered Earlier and Produced More Shoot Branches than Wild Type Plants

The SALK_054659 line (Alonso et al. 2003) has a T-DNA insertion in the AtMBD9 gene, and plants homozygous for this mutation exhibited a pleiotropic phenotype as compared with wild type plants (Figure 1 and 2). First, the mutant plants showed an early flowering phenotype. They started

flowering with 10.15 ± 0.8 rosette leaves at 22.0 ± 1.0 days after seed sowing, while wild type plants flowered with 13.05 + 1.1 rosette leaves at 28.5 ± 1.5 days after seed sowing (Figure 1A and B). Second, the apical dominance of this mutant line was decreased, and their lateral shoot branching capacity markedly enhanced as compared with wild type plants. The mutant plants produced 5.2 ± 1.1 secondary rosette branches and 16.6 ± 1.6 tertiary rosette branches, while the wild type plants had 3.2 ± 0.9 secondary rosette branches and 13.5 ± 1.5 tertiary lateral branches (Figure 2A and D). The decreased apical dominance of the mutant plants was manifested by flower buds that continuously grew out from rosette leaf axils, while no outgrowth of flower buds were observed at the axils of wild type rosette leaves at a similar time- point (Figure 2B and C). Third, the mutant plants were about 30% shorter than that of wild type in stature, which was indicated by the decreased height of the primary inflorescence (Figure 2E). Last, this mutant line had longer petioles and leaf blades than wild type at the vegetative stage (Figure 1 C).

Detailed genotyping showed that SALK_054659 has a T-DNA insertion in the second exon of the gene At3g01460 (Figure 3A). Because of the presence of a methyl-CpG-binding domain (MBD) in its product, At3g01460 was named AtMBD9 (Berg et al., 2003), and we designated SALK_054659 as atmbd9-1. The homozygous T-DNA insertion in atmbd9-1 completely knocked out the expression of AtMBD9 (Figure 3B). The Fi generation from the backcross between atmbd9-1 and wild type plants had the same phenotype as wild type plants. In the F ₂ generation, wild type and atmbd9-1 phenotypes segregated at a ratio of 3 : 1 , and a T-DNA insertion always co-segregated with the plants showing the atmbd9-1 phenotype (data not shown). All the data indicate that atmbd9-1 phenotype is recessive, and inherited as a single Mendelian trait.

To confirm that the mutant phenotype is indeed due to the T-DNA insertion in AtMBD9 gene, two additional T-DNA insertion alleles, atmbd9-2 and atmbd9-3, were identified from ABRC seed stocks SALK_121881 and SALK_039302, respectively (Figure 3A), and their genotype and phenotype were investigated in detail. Both atmbd9-2 and atmbd9-3 were found to have

a T-DNA insertion in the sixth exon of the AtMBD9 locus, and expressed no AtMBD9 transcript (Figure 3B). Identical to atmbd9-1, atmbd9-2 and atmbdθ- 3 plants had longer petioles and leaf blades than wild type counterparts (data not shown), and flowered around one week earlier with fewer rosette leaves than wild type plants (Figure 1A and B). Both atmbd9 mutants produced a similar number of lateral shoot branches to atmbd9-1, and had shorter stature than wild type plants (Figure 2A, D and E). Backcrossing experiments revealed that both atmbd9-2 and atmbd9-3 had the mutant phenotype inherited as a single recessive Mendelian trait (data not shown). Further, the F1 progenies from the crosses among atmbd9-'\ , atmbd9-2 and atmbd9-3 displayed the same mutant phenotype as their parents (data not shown), confirming the three mutants are indeed allelic to each other. AtMBD9 Encodes a Multiple Chromatin-Associated Domains/Methyl- CpG-Binding Domain Containing Protein The AtMBDθ gene consists of ten exons and nine introns (Figure 3A) and encodes a protein of 2167 amino acids. Comparing the deduced amino acid sequence of AtMBD9 with protein sequences in the database reveals that AtM BD9 protein contains five domains which are potentially involved in modifying chromatin structure to regulate gene expression (Figure 3C). The MBD domain of AtMBD9 is located between amino acids 258 - 324. Studies on mammalian MBD proteins suggest that MBD is able to bind to a single methylated CpG and is involved in histone deacetylase-dependent repression of gene expression (Ballestar and Wolffe, 2001). The second type of domain is a plant homeodomain (PHD, a Cys4-His-Cys3 zinc finger-like motif) that occurs twice in AtMBD9: one resides in the region between amino acids 86- 131 , the other between amino acid 1303-1335. In Drosophila, the PHD finger domain is found in many nuclear proteins and is suggested to be involved in chromatin-mediated transcriptional regulation (Aasland et al., 1995). Recently, Gozani et al. (2003) found that the PHD domain may function as a nuclear phosphoinositide receptor. The third type of domain in AtMBD9 is a putative BROMO domain located between amino acids 1180-1243. The BROMO domain is found in histone acetyltranserases and the ATPase component of

some nucleosome remodelling complexes, and is involved in specific interactions with acetylated lysine residues in histone H4 tails (Owen et al., 2000). The other two domains in AtMBD9 are a phenylalanine and tyrosine rich N-terminus region (FYRN) in amino acids 408 - 455 and a phenylalanine and tyrosine rich C-terminus region (FYRC) in amino acids 639 - 703. Both FYRN and FYRC have been found in chromatin-associated proteins, such as the Drosophila trithorax protein and the mammalian mixed-linkage leukamia protein (MLL), and their interaction is essential for the stability and subnuclear localization of MLL (Hsieh et al., 2003). Taken together, the presence of five sequence motifs that have been found in chromatin-associated proteins implies that AtM BD9 may regulation gene expression via chromatin-mediated processes.

The Expression of FLC is Reduced in atmbdθ Mutants and the Acetyiation Level of FLC Chromatin is Decreased Extensive genetic studies have demonstrated that CONSTANS (CO),

FLOWERING LOCUS C (FLC), LEAFY (LFY) and SUPRESSION OF CONSTANS 1 (SOC1) play important roles in regulating flowering time in Arabidopsis (Simpson and Dean, 2002; Mouradov et al., 2002). The early flowering phenotype of atmbd9 mutants led us to determine whether the expression of CO, FLC, LFY and SOC1 is affected by AtMBD9 mutations. RT- PCR analysis revealed that the expression level of CO, LFY and SOC1 in the three atmbd9 mutants was very similar to that in wild type plants, while FLC transcription was markedly reduced by AtMBD9 mutations (Figure 4A). To confirm this result, we analyzed FLC expression by quantitative RT-PCR ₁ and found that FLC transcription level was decreased by approximately 4-fold in each of the mutant lines when compared to wild type plants (Figure 4B).

The FLC gene encodes a MADS-box transcriptional factor, and its expression level quantitatively correlates with the delay of flowering time in Arabidopsis (Michaels and Amasino, 1999). Epigenetic studies have established that FLC expression is regulated by the modification of FLC chromatin structure, such as the methylation and acetyiation of histone H3 and/or H4 (Bastow et al., 2003; He et al., 2003; He et al., 2004). AtMBD9

contains five chromatin-associated domains, and one of them is a BROMO domain which exists in histone acetyltransferases and has potential interactions with acetylated histone H4 tails (Owen et al., 2000). Thus, AtMBD9 may down-regulate the expression of FLC gene by altering the acetylation state of FLC chromatin. To test this hypothesis, the acetylation level of histone H3 and H4 in FLC chromatin was analyzed by chromatin immunoprecipitation (ChIP) assays. As shown in Figure 5, the acetylation level was significantly reduced in two regions of FLC chromatin in the atmbd9 mutants as compared with that in wild type plants. One region resided between exon 2 and exon 4 of the FLC gene in the histone H3, and the other was located near to the beginning of the FLC intron 1 in the histone H4 (Figure 5B). In other regions of the FLC chromatin, wild type plants and atmbdθ mutants had no detectable differences in histone H3 and H4 acetylation status. Alteration of FLC Expression in atmbd9-2 and Wild Type Plants Affects Flowering Time, but not Shoot Branching Occurrence

Besides the early flowering phenotype, atmbdθ mutants also display reduced apical dominance, and produced substantially more shoot branches than wild type plants (Figure 2). To determine whether AtMBD9 mutation mediated down-regulation of FLC expression causes both the early flowering and enhanced shoot branching phenotype in atmbdθ mutants, FLC expression was augmented in the atmbd9-2 mutant line by transforming it with a 35S::FLC cDNA construct. Two representative transformants, atmbd9-FLC1 and atmbd9-FLC2, had their FLC expression level increased significantly as compared with their parent line atmbd9-2 (Figure 6A). As expected, these lines flowered around 7-8 days later than did atmbd9-2 plants (Figure 6C). However, similar to atmbd9-2, both atmbd9-FLC1 and atmbd9-FLC2 produced more lateral shoot branches and had a shorter stature than wild type plants (Figure 6E), indicating that increasing FLC expression in atmbd9-2 plants can delay their flowering time, but has no effect on their enhanced shoot branching phenotype. To further address this issue, we identified two homozygous FLC T-DNA insertion mutants, flc-1 and flc-2, from the

SALK_041126 and SALK_072590 lines, respectively. Both flc-1 and flc-2 have a T-DNA insertion in FLC intron 1 , which resulted in a low but still detectable level of FLC expression in the two flc mutants. Shown in Figure 6B, the FLC transcription level in flc-1 and flc-2 was very similar to that in atmbd9- 2, but significantly lower than that in wild type plants. Similar to atmbd9-2, both flc-1 and flc-2 mutants flowered about one week earlier than wild type plants (Figure 6D). However, unlike atmbd9-2, flc-1 and flc-2 did not exhibit the enhanced shoot branching phenotype, but resembled wild type plants for this trait (Figure 6F). Therefore, while /\f/WBD9-mediated regulation of FLC expression indeed acts on the control of flowering time, it has no effect on the occurrence of shoot branching in Arabidopsis.

The Response of atmbd9 Mutants to Auxin is Similar to That of Wild Type Plants

It has been known for several decades that auxin plays a central role in establishing plant apical dominance, through which the outgrowth of lateral shoot branches is inhibited and plant shoot architecture is determined (Leyser, 2003). Genetic studies of two mutants with altered response to auxin, axr1-12 and axr3-1, has demonstrated the essential role played by auxin on plant shoot branching. axr1-12, an auxin resistant mutant, is defective in perceiving auxin signalling, and thus exhibits impaired apical dominance as well as enhanced lateral shoot branching capacity (Leyser et al., 1993; Stirnberg et al., 1999). In contrast to axr1-12, axr3-1 is hypersensitive to auxin, and has strengthened apical dominance and decreased shoot branching capacity (Leyser et al., 1996). Given that AXR1 and AXR3 play important roles in auxin-dependent shoot branching occurrence and atmbd9 mutants closely resembled axr1-12 in shoot branching occurrence (Figure 2D and E) ₁ the expression of AXRI and AXR3 was examined in the atmbdθ mutant lines. RT- PCR analysis revealed that the expression level of AXR1 and AXR3 in the atmbd9 mutants was not different from that in the wild type plants (Figure 7A), indicating that the auxin functional pathway controlling shoot branching is not affected by AtMBD9 mutations.

The response of atmbd9 mutants to auxin was assayed by studying the auxin inhibitory effect on root elongation and axillary bud outgrowth. To analyze root elongation, five-day-old seedlings of atmbd9 mutants, axr1-12 and wild type were grown on MS media and then transferred to fresh MS media supplemented with 0 - 10 μM IAA. Without IAA, the three seedling types had similar root growth patterns (Figure 7B). With the addition of IAA in the media, the root growth of the atmbd9 mutants and wild type was decreased about 60% by 0.1 μM IAA, and almost completely inhibited by 1 μM IAA (Figure 7B and C). In contrast, the root growth of axri-12 seedlings was inhibited about 20% by 0.1 μM and 60% by 1 μM IAA (Figure 7B and C). The assay for axuin effect on axillary bud outgrowth was carried out using a split plate system (Chatfield et al., 2000). The first cauline nodes with an axillary bud < 1.5 mm in size were excised from sterile primary inflorescences and placed between two separate, vertically-oriented slabs of agar medium in a Petri dish. The outgrowth of the axillary buds of atmbd9-2, axr1-12 and wild type was similar when no NAA was applied to the apical agar slabs, and reached an average length of 30 -32 mm on day 8 after excision (Figure 7D). When 1 μM NAA was loaded in the apical agar slabs, the outgrowth of atmbd9-2 and wild type axillary buds was completely inhibited until 5-6 days after bud excision, and the outgrowth of the axillary buds was about 6-8 mm on day 8 after bud excision. In contrast, the outgrowth of axr1-12 axillary buds was not impeded by the apically applied NAA, which only decreased the elongation speed of axr1-12 axillary buds by 10% as compared to the NAA- free treatment (Figure 7D). These results, together with the fact that the expression of AXR1 and AXR3 was not altered in atmbd9 mutants, demonstrates that the mutations in AtMBD9 gene do not affect the auxin signalling pathway, and thus indicate that the enhanced shoot branching phenotype of the atmbd9 mutants occurs independent of auxin. The Expression of MAX Genes is not Affected by the Mutations in AtMBDθ Locus

Recently, a novel pathway, named MORE AXILLARY GROWTH (MAX), was identified in Arabidopsis that controls the shoot branching trait (McSteen

and Leyser, 2005). Four critical genes, MAX1 , 2, 3 and 4, in the MAX pathway were cloned and functionally characterized. All the mutations in the four MAX loci result in the enhanced shoot branching phenotype (Booker et al., 2005). As shown in Figure 2D and E, atmbdθ mutants closely resembled max1 and max4-1 in shoot branching occurrence and the length of the primary inflorescence. This observation suggests the possibility that AtMBD9 may function to maintain the expression of the MAX genes in Arabidopsis, and mutations in the AtMBD9 locus may result in the reduction of MAX gene expression and consequently the enhanced shoot branching phenotype seen in the atmbd9 mutants. Therefore, the expression level of the four MAX genes was examined in the atmbdθ mutants. The transcription level of MAX1 , 2, 3, and 4 in atmbd9 mutants was similar to that in wild type plants (Figure 8), indicating that the MAX pathway is not regulated by the AtMBD9 gene, and is thus not involved in the production of the enhanced shoot branching phenotype in atmbd9 mutants.

AtMBD9 Expression in the Shoot Apex and Sites of Shoot Branch Occurrence

Using RT-PCR, Berg et al. (2003) demonstrated that AtMBD9 was expressed in rosette leaves, flowers, and stems, while no AtMBD9 transcript was detected in roots, green siliques and seeds. To examine AtMBD9 expression in more detail throughout Arabidopsis development, we fused the AtMBD9 promoter with the reporter gene -glucuronidase (GUS) and transformed this construct into Arabidopsis plants. Subsequently, the expression of the GUS gene under the control of the AtMBD9 promoter was detected at different developmental stages. At seven days after germination, AtMBD9 expression was detected in the vascular system of the cotyledon and hypocotyls, but not in roots. The strongest GUS staining was found in the shoot apex (Figure 9A) where FLC has a high expression level in Arabidopsis (Michaels and Amasion, 2000). As the Arabidopsis plants mature, AtMBD9 was expressed in the vascular tissues of rosette leaves, old inflorescence stems and cauline leaves (Figure 9B, C and D). Markedly high expression of AtMBD9 was always detected in rosette regions where secondary rosette

branches would be produced (Figure 9B), and in inflorescence junctions where the outgrowth of tertiary branches (Figure 9C) occurs. This pattern fits well with the function of AtMBD9 to regulate the Arabidopsis shoot branching trait. Interestingly, fourteen-day-old plants showed strong AtMBD9-GUS activity in root junction parts where lateral roots are formed (Figure 9B). However, no obvious change in root morphology was seen in the mutant lines (data not shown). In flowers, the AtMBD9-GUS staining was visible only in the vascular tissues of sepals, filament and the receptacles (Figure 9E). In green siliques, AtMBD9 is only expressed at junctions between siliques and pedicels (Figure 9F). DISCUSSION

AtMBD9 has a Unique Modular Organization and is Required for Controlling Arabidopsis Flowering Time and Shoot Branching

An extensive bioinformatics analysis of the Arabidopsis genome has identified 13 putative genes encoding MBD-containing proteins, which constitute the Arabidopsis MBD family (Zemach and Grafi et al., 2003; Scebba et al., 2003; lto et al., 2003; Berg et al., 2003; Springer and Kaeppler, 2005). However, except for the MBD motif, the 13 family members do not share any common domains, and vary drastically in their molecular size. The largest family member is AtMBD9, which is 4 - 14 fold larger than the other 12 members and has four additional functional domains (PHD, FYRN, FYRC and BROMO) besides the MBD. All of these domains are found in various chromatin-associated proteins (Figure 3C). This kind of modular organization of AtMBD9 is unique not only in the AtMBD family, but also in the current genome database, since no proteins from other organisms have a domain constitution similar to that found in AtMBD9 (Springer and Kaeppler, 2005).

In order to explore the biological function of AtMBD9 in planta, the present inventors identified three homozygous AtMBD9 T-DNA insertion mutant alleles, atmbd9-1, 2 and 3, which were all deficient in AtMBD9 transcript expression (Figure 3A and B), and displayed the same phenotype. First, atmbd9-1, 2 and 3 flowered approximately one week earlier and had fewer rosette leaves at bolting than wild type plants (Figure 1). The

expression of FLC, a well-defined repressor of Arabidopsis flowering, was markedly reduced by the mutations in AtMBD9. Second, atmbd9-1, 2 and 3 mutants produced more lateral shoot branches, and had shorter statures than wild type plants and consequently had a bushy shoot architecture (Figure 2). The function of AtMBD9 correlated well with the expression pattern of AtMBD9 during Arabidopsis development. AtMBD9 is highly expressed in the shoot apex (Figure 9A), where strong FLC expression is detected and the transition of shoot meristerms to floral meristerms occurs (Michaels and Amasino, 2000). High expression of AtMBD9 was also detected in the regions where lateral shoot branches (inflorescences) are produced (Figure 9B and C). Therefore, the biological role of AtMBD9 is to regulate flowering time and shoot branching occurrence in Arabidopsis.

AtMBD9 Regulates FLC Expression by Modulating the Acetylation Status of FLC Chromatin It has been well established through extensive molecular and genetic studies of Arabidopsis flowering that four major pathways, namely photoperiod, vernalization, the autonomous pathway, and gibberellin, are involved in the control of Arabidopsis flowering time (Simpson and Dean, 2002; Mouradov et al., 2002). Each of the four pathways executes its own specific function to regulate Arabidopsis flowering time according to the internal and external signals the plant receives. In addition, they interact with each other to make up an integrated network to control Arabidopsis flower timing, and some genes, such as FLC, CO, SOC1, and LFY reside at the intersectant positions in this network (He and Amasion, 2005). The vernalization and autonomous pathways are connected by FLC, a repressor of Arabidopsis flowering. SOC1 integrates the four pathways, and its expression reflects the comprehensive signal inputs from the four pathways. CO is the last acting gene in the photoperiod pathway, and links this pathway to SOC1. LFY is located downstream of SOC1 and acts as an important determinant for the initiation of Arabidopsis flowers. To determine which components in the floral pathways are affected by the AtMBD9 mutations, we analyzed the expression of FLC, CO, SOC1, and LFY in atmbd9 mutants and

found that, among the four genes, only FLC transcript was markedly reduced (Figure 4). To confirm that this AtMBD9 mutation mediated down-regulation of FLC expression is responsible for the early flowering phenotype in atmbd9 mutants, FLC expression was increased in atmbd9-2 plants (Figure 6A). These FLC-transformed atmbd9-2 plants did not display the early flowering phenotype, but flowered at almost the same time as wild type plants (Figure 6C). Moreover, two FLC T-DNA insertion mutants with similar FLC expression level to atmbd9-2 displayed a similar early flowering phenotype to that in atmbd9 mutants (Figure 6D). These findings are consistent with the notion that FLC expression quantitatively represses Arabidopsis flowering (Michaels and Amasino, 1999), and indicate that AtMBD9 controls Arabidopsis flowering time through the regulation of FLC expression.

It has been demonstrated that FLC expression is subject to epigenetic regulation through the covalent modification of FLC chromatin (He and Amasino, 2005). After vernalization treatment, Bastow et al. (2004) found that the methylation and acetylation levels in histone H3 of FLC chromatin were modified in the region ranging from the 5' UTR to the middle of the intron 1 of FLC. In the autonomous pathway, mutations in FLOWERING LOCUS D (FLD) resulted in the hyperacetylation of histone H4 in FLC chromatin around the region close to the transcription starting point, in the first intron and in the second intron (He et al., 2003). Recently, He et al. (2004) reported that Arabidopsis PAF1 complex regulated FLC transcription by modulating histone H3 methylation status in FLC chromatin. Since AtMBD9 contains five chromatin-associated domains, the modification in the state of FLC chromatin was studied to determine if this might have led to a reduction in FLC transcription. Indeed, ChIP assays revealed that the reduction of acetylation level occurred in both histone H3 and H4 of FLC chromatin in the atmbd9 mutants (Figure 5). The reduction in acetylation level of FLC chromatin has been determined to be associated with the repression of FLC expression (He and Amasino, 2005). Accordingly, these ChIP assay results suggest that the in planta function of AtMBD9 in wild type Arabidopsis plants is to maintain or activate FLC expression by keeping or increasing the acetylation level in FLC

chromatin. Consequently mutations in AtMBD9 gene would decrease the acetylation level of FLC chromatin, and thus result in a reduction of FLC expression and early flowering phenotype in atmbdθ mutants.

The function of AtMBD9 in regulating Arabidopsis flowering time appears to be in contrast to that of the autonomous pathway. This pathway has been defined by a group of mutants exhibiting late flowering phenotype (Mouradov et al., 2002.). All autonomous pathway mutants contain a highly expressed FLC gene, in which the flowering is delayed. Based on this, the function of the autonomous pathway in wild type plants is considered to repress FLC expression and promote early flowering (Michaels and Amasino, 2001). Arabidopsis has two main naturally occurring flowering time variants, namely the winter annuals (late flowering before vernalization) and summer annuals (early flower without vernalization) (He and Amasino, 2005). The winter annuals have dominant alleles of FRIGIDA (FRI) and FLC. FRI overcomes the function of the autonomous pathway, and activates FLC expression as well as inhibits early flowering. The summer annuals, such as Columbia, contain a functional FLC and an active autonomous pathway, but a non-functional FRI allele. This situation raises the question of whether the summer annuals have some genes or pathways to counteract the function of the autonomous pathway in the regulation of FLC expression and flowering time. Without such genes or pathways, we do not know to what extent the autonomous pathway would repress FLC expression and promote early flowering in Arabidopsis. The seeming contrasting role of AtMBD9 and the autonomous pathway in the regulation of FLC expression and flowering time in Arabidopsis suggest AtMBD9 may be one candidate for such a gene. Therefore, it will be very interesting and informative to determine the interaction between AtM BD9 and the autonomous pathway in Arabidopsis. AtMBDθ may Regulate a New Pathway to Control Arabidopsis Shoot Branching Trait The overall shoot architecture is an important feature of plant species, because it produces the species-characterized morphology, and determines the foliage available for photosynthesis and thus for final biomass and seed

yield. One major determinant of a plant's shoot architecture is its capacity for shoot branching (McSteen and Leyser, 2005). Shoot branches are usually formed in two developmental steps: the initiation of axillary shoot meristems and the following outgrowth of axillary buds (Sussex and Kerk, 2001). In Arabidopsis, several genes have been defined to affect the development process of shoot branching. First, the LATERAL SUPPRESSOR gene plays an essential role in the initiation of axillary shoot meristerms (Greb et al., 2001). Second, the AXR1, AXR3 and MAX genes are involved in the outgrowth of axillary buds (McSteen and Leyser, 2005). Last, the SUPERSHOOT gene is required for both steps to produce lateral shoot branches (Tantikanjana et al., 2001). In this study, the loss of function mutation in AtMBD9 gene resulted in a significant increase in the production of lateral shoot branches and the continuous outgrowth of axillary buds from rosette leaves (Figure 2), indicating that AtMBD9 gene negatively regulates the outgrowth of lateral shoot branches while it has no effect on the initiation of anxillary shoot meristems. This notion is further supported by the observation that the enhanced lateral shoot branching phenotype of atmbd9 mutants closely resembled that of axri-12 and max1 - max4 mutants (Figure

2). There is a great deal of evidence that auxin plays a central role in controlling the outgrowth of shoot branches through apical dominance (Leyser, 2003), and molecular genetic analysis of mutations in AXR1 and AXR3 has defined the two genes as important players in this function of auxin. The AXR1 mutant, axr1-12, is resistant to exogenous auxin and exhibits a highly branched shoot phenotype (Stirnberg et al., 1999). The AXR3 mutant, axr3-1, displays hypersensitivity to auxin and its shoot branching capacity is markedly reduced (Leyser et al., 1996). These experimental discoveries present the strongest genetic evidence to demonstrate the function of auxin in the regulation of shoot branching, and also the relationship between a plant's sensitivity to auxin and its shoot branching pattern. To determine whether auxin is involved in the production of the enhanced shooting branching phenotype in atmbdθ mutants, the response of atmbd9 mutants to auxin was

assayed and found that atmbd9 mutants had a similar sensitivity to auxin as did wild type (Figure 7). Further, it was observed that the expression of AXR1 and AXR3 were not affected by the mutations in AtMBD9 gene (Figure 7). These data evidently indicate that AtMBD9 regulates the growth of shoot branches independent of auxin.

Although auxin has been well known to control shoot branching, abundant evidence suggests that auxin acts indirectly on the outgrowth of axillary buds, and thus it is believed that secondary messengers are necessary for the auxin action (McSteen and Leyser, 2005). Since cytokinin can promote the outgrowth of axillary buds directly (Cline, 1991), and auxin suppresses the synthesis and transport of cytokinin in Arabidopsis (Nordstrom et al., 2004), cytokinin is a candidate for the auxin secondary messenger (Leyser, 2003). Therefore, the function of cytokinin and auxin in mediating shoot branching occurrence has usually been studied together. In this study, it was observed that the response of atmbd9 mutants to cytokinin was very similar to that of wild type seedlings, and atmbd9 mutants had a totally different shoot branching phenotype from Arabidopsis mutants with altering cytokinin sensitivity (data not shown). Therefore, it is reasonable to believe that the function of AtMBD9 in shoot branching is not related to cytokinin. Besides auxin and cytokinin, a novel carotenoid-derived hormone with unknown molecular identity has been found to affect lateral shoot branching in Arabidopsis, and MAX genes, MAX1 - MAX4 compose a single pathway to synthesize and perceive this novel hormone (Booker et al., 2005). Mutations in the four MAX genes significantly increase lateral shoot branches, and reduce the stature of the whole plant, which explains why the max mutants have a bushy shoot architecture. The observation that the atmbd9 and max mutants are similar in shoot branching pattern (Figure 2D and E) raises the possibility that AtMBD9 has the potential capacity to regulate the expression of the MAX genes. However, this experimental results showed that the expression level of the MAX genes in the atmbd9 mutants did not differ from that in wild type plants (Figure 8), indicating that the MAX" pathway is not likely involved in AtMBD9's execution of its function in regulating shoot branching.

Given that auxin and the MAX pathway have been defined as the two major contributors in the regulation of shoot branching till now in Arabidopsis, and both are not affected by the AtMBD9 mutations, AtMBD9 may regulate a novel pathway to control Arabidopsis shoot branching trait. Based on the mode with which AtMBD9 regulates FLC expression to control Arabidopsis flowering time, AtMBDθ may affect Arabidopsis shoot branching occurrence by regulating the expression of some potential target gene(s) in a chromatin- dependent manner. Functional Characterization of AWIBD9 Unveils a Striking Functional Difference Between Mammalian and Plant MBD Genes

Recently, Springer and Kaeppler (2005) identified 16 MBD genes each in rice and maize genome, and provided bioinformatics analysis results to suggest that plants and mammals have distinct sets of MBD proteins. First, plant and mammalian MBD proteins share no conserved sequence besides the MBD region. Second, plant MBD proteins do not have some domains frequently occurring in the mammalian counterparts, such as transcription repression domains, CXXC domains, SET domains and DNA glycosylase domains. The functional characterization of AtMBD9 gene in this study presents some biological data that demonstrate the functional difference between plant and mammalian MBD proteins. The mammalian MBD family includes five members: MeCP2, MBD1 - MBD4.. The biological function of all mammalian MBD members except MBD4, which is involved in repairing mistatched DNA (Wu et al., 2003), is to physically recruit histone deacetylases to methyl-CpG-enriched regions in the genome, and consequently execute histone deacetylase-dependent repression of gene expression (Meehan, 2003). In contrast, AtMBD9 functions to maintain or increase, rather than repress, the expression of the FLC gene in Arabidopsis plants because mutations in AtMBD9 markedly repressed FLC expression (Figure 4). However, additional plant MBD proteins have to be functionally characterized before we can make a definitive conclusion on this issue. Further, AtMBD9 affected FLC expression by modifying the acetylation state of histone H3 and H4 in FLC chromatin.

MATERIALS and METHODS

Plant Materials and Growth Conditions

Arabidopsis thaliana plants (ecotype: Columbia) were grown routinely on LA4 soil (SunGro Horticulture Canada Ltd. BC, Canada) under controlled environmental conditions (23 ⁰ C day/18 ⁰ C night, white fluorescent illumination of 150 μmol/m ² s, 16 hr light/8 hr dark, and 65% relative humidity). To isolate T-DNA insertion mutant alleles for AtMBD9 (At3g0160), seeds of SALK_054659, SALKJ 21881 and SALK_039302 obtained from the Arabidopsis Biological Resource Center (ABRC) were grown up, and their genomic DNA was extracted according to Lukowitz et al. (2000). The homozygous AtMBD9 T-DNA insertion mutant lines were identified from the three seed stocks by genotyping PCR with a T-DNA left board primer LBaI (5 ^> -TGGTTCACGTAGTGGGCCATCG-3 ^I (SEQ ID NO:5)) and three pairs of gene specific primers for SALK_054659 (1F: 5' TCCTTGGATCCAAGTGAG- 3' (SEQ ID NO:6) and 1R: 5'-CACTGTTCTGTTCCACCA (SEQ ID NO:7)), SLAK_121881 (2F: 5 ^I -ACACCTTGAGCAGTGTGCCGA-3 ^I (SEQ ID NO:8) and 2R: δ'-CCTTGGTCTCAAGACCCGTAG-S' (SEQ ID NO:9)), and SLAK_039302 (3F: δ'-GCTGGTCCTGAAACCAATGTT-S' (SEQ ID NO: 10) and 3R: S'-GAAGTTTCCGTTCTAACATCAGC-S' (SEQ ID NO:11)). TWO homozygous FLC (At5g10140) T-DNA insertion mutant alleles were isolated from SALK_041126 and SALK_072590. The seeds of axr1-12, max1, and max4-1 mutants were generously provided by Dr. Ottoline Leyser (University of York, UK). Generation of Constructs and Transformation of Arabidospsis Plants The AtMBD9 promoter fragment (1.4 kb) was amplified from the

Arabidopsis genomic DNA by PCR with a pair of primers (F: 5'- ATCTTCTAGAGTCGTCGTAGTCATACT-3' (SEQ ID NO: 12) and R: 5'- ATCTCCATGGAATCGAGCATTGTTTGC-3' (SEQ ID NO: 13)). The PCR product was cloned between the Xbal and Ncol sites of the β-glucuronidase (GUS) reporter gene fusion binary vector pCAMBIA3301 (CAMBIA, Canberra, Australia).

The Arabidopsis FLC cDNA (600 bp) was amplified by RT-PCR with a pair of FLC specific primers (F: TCTAGAGGATCAAATTAGGGCACAA-β ¹ (SEQ ID NO:14) and R: δ'-ACAGAGCTCTAATTAAGTAGTGGGAGAGTC-S' (SEQ ID NO: 15)). The PCR product was then cloned into the binary vector pROK2 between Xba I and Sac I. The expression of FLC cDNA in this construct was driven by the 35S promoter.

The constructs made above were transformed into Agrobacterium tumefaciens strain EHA105. Arabidopsis plants were transformed by using the floral dip method (Clough and Bent, 1998). RT-PCR and Quantitative RT-PCR

Total RNA was extracted from the rosette leaves of three-week-old Arabidopsis plants using TriZol reagent (Invitrogen). The first-strand cDNA was synthesized from the total RNA samples and used for PCR. The expression of FLC, SOC1, CO, LFY, AXR1, AXR3, MAX1, MAX2, MAX3, and MAX4 was detected by the semi-quantitative PT-PCR, and Actin-8 expression was used as the internal control. The specific primers and PCR conditions for these genes are available when required.

To analyze FLC transcription with quantitative RT-PCR, a pair of primers (F: 5 ^> -GCCAAGAAGACCGAACTCATG-3 ^I (SEQ ID NO:16) and R: 5'- GGAGATTTGTCCAGCAGGTGA-S' (SEQ ID NO: 17)) was designed using the Applied Biosystems (CA ₁ USA) software Primer Express 2.0. The quantitative RT-PCR for FLC gene was performed and analyzed with a 7300 real time PCR system according to the manufacturer's instruction. The expression of the GAPDH gene was used as an internal control and analyzed with its specific primers (F: δ'-CTTGGAAGGAGCTAGGAATTGACA-S' (SEQ ID NO: 18) and R: δ'-ATGTGTTTCCCTGCACCTTCTC-S' (SEQ ID NO: 19)). ChIP Assays

The FLC chromatin immunoprecipitation assays were performed according to Johnson et al. (2002) with some modification. After growth on MS medium for 10-12 days, seedlings of CoI and atmbd9 mutants were harvested, and 300 mg leaves were used for one immunoprecipitation. Chromatin samples were immunoprecipitated with antibodies against acetyl-

histone H3 (catalogue no: 06-599) and acetyl-histone H4 (catalogue no: 06- 866, Upstate Biotechnology), respectively. Each of the immunoprecipitations was replicated three times. To determine the amounts of immunoprecipitated genomic DNA, quantitative PCR was carried out with nine primer pairs ranging from the 5' UTR to the seventh exon of genomic FLC DNA sequence (Figure 5A). Seven primers were described by Bastow et al. (2004), and the other two pairs of primers were H (F: δ'-ATAAGCACTGCGTGTTGTGTG-S' (SEQ ID NO:20) and R: δ'-CCCTTAACTCTAACCAGCCGT-S' (SEQ ID NO:21)) and I (F: 5'-TCAGTTCCAACTCCAAGTGTC-3 ^I (SEQ ID NO:22) and R: 5'-ACATCTCCATCTCAGCTTCTG-3' (SEQ ID NO:23)). ACTIN 2/7 was used as the PCR internal control and its primers were designed by Johnson et al. (2002). Auxin Response of AtMBD9 Mutants

The response of the atmbdθ mutant root growth to auxin was determined according to Timpte, et al. (1995). Surface sterilized seeds of wild type, atmbd9 mutants and axr1-12 were germinated and grown vertically on MS medium (Murashige and Skoog, 1962). Five days later, seedlings were transferred to fresh MS medium supplemented with 0 to 10 μM IAA. The seedlings were positioned horizontally so that root tips grew perpendicularly to the original roots. Three days after the seedling transfer, the new root growth was measured. The percentage of root growth inhibition by auxin was calculated relative to the root growth on MS medium without IAA.

The auxin response of atmbdθ mutant axillary bud growth was assayed as described by Chatfield et al. (2000). Seedlings of wild type, atmbd9-2 and axr1-12 were grown in Magenta boxes containing 50 ml Arabidopsis thaliana salt medium (ATS) with 01% sucrose and 0.8% agar (Wilson et al., 1990), and primary inflorescences appeared after 22-27 days growth. Split plates with two separate ATS medium blocks were prepared, and 1 μM 1 -naphthalene acetic acid (NAA) was added to one medium block. Inflorescence sections with the first cauline node and an axillary bud < 1.5 mm were excised, and placed over the gap between the two medium blocks in a split plate. The apical ends of the sections were inserted into the medium blocks with 1 μM

NAA. The split plates were positioned vertically with the NAA blocks on the top.

Histochemical GUS Staining

Histochemical detection of GUS activity was performed as described by Jefferson (1987). The transgenic plant tissues or whole seedlings harbouring AtMBDQ promoter-GUS construct were vacuum filtrated for 1 min in staining solution (100 mM sodium phosphate buffer, pH 7.0, EDTA 1 mM, potassium cyanoid, 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-Gluc), and incubated at 37 ⁰ C overnight. Chlorophyll was then washed away with 70% ethanol.

Having now described particular embodiments of the invention by way of the foregoing examples, which are not intended to be limiting, the invention will now be further set forth in the following claims. Those skilled in the art will recognize that the claims also permit for the inclusion of equivalents beyond the claims' literal scope.

REFERENCES

Aasland, R., Gibson, T.J., and Stewart, A.F. (1995). The PHD finger: implications for chromatin-mediated transcriptional regulation. Trends

Biochem. Sci. 20, 56-59. Alonso, J.M., Stepanova, A.N., Leisse, T.J., Kim, C.J., Chen, H., Shinn, P.,

Stevenson, D.K., Zimmerman, J., Barajas, P., Cheuk, R., Gadrinab, C,

Heller, C, Jeske, A., Koesema, E., Meyers, CC, Parker, H., Prednis, L.,

Ansari, Y., Choy, N., Deen, H., Geralt, M., Hazari, N., Horn, E., Karnes, M.,

Mulholland, C, Ndubaku, R., Schmidt, I., Guzman, P., Aguilar-Henonin, L., Schmid, M., Weigel, D., Carter, D.E., Marchand, T., Risseeuw, E.,

Brogden, D., Zeko, A., Crosby, W.L., Berry, CC, and Ecker, J.R. (2003).

Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301 ,

653-657.

Amir R.E., and Zoghbi, H.Y. (2000) Rett syndrome: methyl-CpG-binding protein 2 mutations and phenotype-genotype correlations. Am. J. Med. Genet.

97, 147-152.

Ballestar, E., and Wolffe, A.P. (2001). Methyl-CpG-binding proteins: targeting specific gene repression. Eur. J. Biochem. 268, 1-6.

Bastow, R., Mylne, J.S., Lister, C, Lippman, Z., Martienssen, R.A., and Dean, C (2004). Vernalization requires epigenetic silencing of FLC by histone methylation. Nature 427, 164-167.

Berg, A., Meza, T.J., Manic, M., Thorstensen, T., Kristiansen, K., and

Aalen, R.B. (2003). Ten members of the Arabidopsis gene family encoding methyl-CpG-binding domain proteins are transcriptionally active and at least one, AtMBDH, is crucial for normal development. Nucleic Acid Res. 31,

5291-5304.

Bird, A.P., and Wolffe, A.P. (1999). Methylation-induced repression-belts, braces, and chromatin. Cell 99, 451-454.

Bird, A. (2002). DNA methylation patterns and epigenetic memory. Genes & Dev. 16, 6-21.

Booker, J., Sieberer, T., Wright, W., Williamson, L., Willett, B., Stimberg,

P., Turnbull, C, Srinivasan, M., Goddard, P., and Leyser, H.M.O. (2005).

MAX1 encodes a cytochrome P450 family member that acts downstream of

MAX3/4 to produce a carotenoid-derived branch-inhibiting hormone. Dev. Cell

8, 443-449.

Burn, J.E., Bagnall, D.J., Metzger, J.D., Dennis, E.S., and Peacock, WJ. (1993). DNA methylation, vernalization, and the initiation of flowering. Proc.

Natl. Acad. Sci. USA. 90, 287-291.

Chatfield, S.P., Stirnberg, P., Forde, B.G., and Leyser, O. (2000). The hormonal regulation of axillary bud growth in Arabidopsis. Plant J. 24,159-

169. Cline, M.G. (1991). Apical dominance. Bot. Rev. 57, 318-358.

Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,

735-743.

Ehrlich.K.C. (1993). Characterization of DBPm, a plant protein that binds to DNA containing 5-methylcytosine. Biochim. Biophys. Acta, 1172, 108-116.

Finnegan,E.J., Peacock,W.J., and Dennis, E.S. (1996). Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development.

Proc. Natl Acad. Sci. USA 93, 8449-8454.

Fuks, F., Hurd, P.J., Wolf, D., Nan, X., Bird, A.P., and Kouzarides, T. (2003). The methyl-CpG-binding protein MeCP2 links DNA methylation to histone methylation. J Biol Chem. 278, 4035-4040.

Gozani, O., Karuman, P., Jones, D.R., Ivanov, D., Cha, J., Lugovskoy,

A.A., Baird, C.L., Zhu, H., Field, S.J., Lessnick, S.L., Villasenor, J.,

Mehrotra, B., Chen, J., Rao, V.R., Brugge, J.S., Ferguson, C.G., Payrastre, B., Myszka, D.G., Cantley, L.C., Wagner, G., Divecha, N.,

Prestwich, G.D., and Yuan, J. (2003). The PHD finger of the chromatin- associated protein ING2 functions as a nuclear phosphoinositide receptor.

Cell 114, 99-111.

Greb, T, Clarenz, O., Schafer, E., Muller, D., Herrero R., Schmitz, G., and Theres, K. (2003). Molecular analysis of the lateral suppressor gene in

Arabidopsis reveals a conserved control mechanism for axillary meristem formation. Genes & Dev. 17, 1175-1187.

Gruenbaum, Y., Naveh-Many, T., Cedar, H., and Razin, I. (1981). Sequence specificity of methylation in higher plant DNA. Nature 292, 860-862. Guy, J., Hendrich, B., Holmes, M., Martin J.E., and Bird, A. (2001). A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. Nat. Genet. 27, 322-326.

He, Y., Michaels, S.D., and Amasino, R.M. (2003). Regulation of flowering time by histone acetylation in Arabidopsis. Science 302, 1751-1754. He, Y., and Amasino, R.M. (2005). Role of chromatin modification in flowering-time control. Trends Plant Sci. 10, 30-35. He, Y., Doyle, M.R., and Amasino, R.M. (2004). PAF 1 -complex-mediated histone methylation of FLOWERING LOCUS C chromatin is required for the vernalization-responsive, winter-annual habit in Arabidopsis. Genes & Dev. 18, 2774-2784. Hendrich, B., Guy, J., Ramsahoye, B., Wilson, V.A., and Bird, A.P. (2001). Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development. Genes & Dev. 15, 710-723.

Hsieh, J.J., Ernst, P., Erdjument-Bromage, H., Tempst, P., and Korsmeyer, S.J. (2003). Proteolytic cleavage of MLL generates a complex of N- and C-terminal fragments that confers protein stability and subnuclear localization. MoI. Cell. Biol. 23, 186-194.

Ito, M., Koike, A., Koizumi, N., and Sano, H. (2003). Methylated DNA- binding proteins from Arabidopsis. Plant Physiol. 133, 1747-1754. Jeddeloh, J.A., Stokes, T.L., and Richards, E.J. (1999). Maintenance of genomic methylation requires a SW12/SNF2-like protein. Nat. Genet. 22, 94- 97.

Jefferson, R.A. (1987). Assaying chimeric genes in plants. The GUS fusions: β- Glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901-3907. Johnson, L., Cao, X., and Jacobsen, S. (2002). Interplay between two epigenetic marks. DNA methylation and histone H3 lysine 9 methylation. Curr. Biol. 12, 1360-1367.

Leyser, H.M.O. (2003). Regulation of shoot branching by auxin. Trends Plant

Sci. 8, 541-545.

Leyser, H.M.O., Lincoln, C.A., Timpte, T., Lammer, D., Turner, J., and

Estelle, M. (1993). Arabidopsis auxin-resistance gene-AXR1 encodes a protein related to ubiquitin-activating enzyme E1. Nature 364, 161-164.

Leyser, H.M.O., Pickett, F.B., Dharmasiri, S., and Estelle, M. (1996).

Mutations in the AXR3 gene of Arabidopsis result in altered auxin response including ectopic expression from the SAUR-AC1 promoter. Plant J. 10, 403-

413. Lukowitz, W., Gillmor, C.S., and Scheible, W. (2000). Positional cloning in arabidopsis. Why it feels good to have a genome initiative working for you.

Plant Physiol. 123, 795-805.

Matzke, M.A., Primig, M., Trnovsky, J., and Matzke, A.J.M. (1989).

Reversible methylation and inactivation of marker genes in sequentially transformed tobacco plants. EMBO J. 8, 643-649.

McSteen, P., and Leyser, H.M.O. (2005). Shoot branching. Annu Rev Plant

Biol. 56, 353-374.

Meehan, R.R. (2003). DNA methylation in animal development. Semin. Cell

Dev. Biol. 14, 53-65. Michaels, S. and Amasino, R.M. (1999). FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell

11, 949-956.

Michaels, S. and Amasino, R.M. (2000). Memories of winter: Vernalization and the competence to flower. Plant Cell Environ. 23, 1145-1154. Michaels, S. D., and Amasino, R. M. (2001). Loss of FLOWERING LOCUS

C activity eliminates the late-flowering phenotype of FRIGIDA and autonomous pathway mutations but not responsiveness to vernalization, Plant

Cell 13, 935-941.

Mouradov, A., Cremer, F., and Coupland, G. (2002). Control of flowering time: interacting pathways as a basis for diversity. Plant Cell S111-130.

Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497

Owen, D.J., Ornaghi, P., Yang, J. C, Lowe, N., Evans, P.R., Ballario, P.,

Neuhaus, D., Filetici, P., and Travers, A.A. (2000). The structural basis for the recognition of acetylated histone H4 by the bromodomain of histone acetyltransferase Gcnδp. EMBO J. 19, 6141-6149. Nordstrom, A., Tarkowski, P., Tarkowska, D., Norbaek, R., Astot, C,

Dolezal, K., and Sandberg, G. (2004). Auxin regulation of cytokinin biosynthesis in Arabidopsis thaliana: a factor of potential importance for auxin- cytokinin-regulated development. Proc. Natl. Acad. Sci. USA 101, 8039-8044.

Pitto, L., Cemilogar, F., Evangelista, M., Lombardi, L., Miarelli, C, and Rocchi, P. (2000). Characterization of carrot nuclear proteins that exhibit specific binding affinity towards conventional and non-conventional DNA methylation. Plant MoI. Biol. 44, 659-673.

Ronemus, M.J., Galbiati, M., Ticknor, C, Chen, J., and Dellaporta, S.L.

(1996) Demethylation-induced developmental pleiotropy in Arabidopsis. Science 273, 654-657.

Scebba, F., Bernacchia, G., De Bastiani, M., Evangelista, M., Cantoni,

R.M., CeIIa, R., Locci, M.T., and Pitto, L. (2003). Arabidopsis MBD proteins show different binding specificities and nuclear localization. Plant MoI. Biol.

53, 715-731. Simpson, G.G., and Dean, C. (2002). Arabidopsis, the Rosetta stone of flowering time? Science 296, 285-289.

Springer, N.M., and Kaeppler, S.M. (2005). Evolutionary divergence of monocot and dicot methyl-CpG-binding domain proteins. Plant Physiol. 138,

92 - 104. Stirnberg, P., Chatfield, S.P., and Leyser, H.M.O. (1999). AXRf acts after lateral bud formation to inhibit lateral bud growth in Arabidopsis. Plant Physiol.

121, 839-847.

Sussex, I.M., and Kerk, N,M. (2001). The evolution of plant architecture.

Curr. Opin. Plant Biol. 4, 33-37. Tantikanjana, T., Yong, J.W., Letham, D.S., Griffith, M., Hussain, M.,

Ljung, K., Sandberg, G., and Sundaresan, V. (2001). Control of axillary bud

initiation and shoot architecture in Arabidopsis through the SUPERSHOOT gene. Genes & Dev. 15, 1577-1588.

Timpte, C, Lincoln, C, Pickett, F.B., Turner, J., and Estelle, M. (1995).

The AXR1 and AUX1 genes of Arabidopsis function in separate auxin- response pathways. Plant J. 8, 561-569.

Wilson, A. K., Pickett, F. B., Turner, J. C, and Estelle, M. (1990). A dominant mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic acid. MoI. Gen. Genet. 222, 377-383.

Wu, P., Qiu, C, Sohail, A., Zhang, X., Bhagwat, A.S., and Cheng.X., (2003). Mismatch repair in methylated DNA. Structure and activity of the mismatch-specific thymine glycosylase domain of methyl-CpG-binding protein

MBD4. J. Biol. Chem. 278, 5285-5291.

Zemach, A., and Grafi, G. (2003) Characterization of Arabidopsis thaliana methyl-CpG-binding domain (MBD) proteins. Plant J. 34, 565-572. Zhang, D., Ehrlich, K.C., Supakar, P.C. and Ehrlich, M. (1989). A plant

DNA-binding protein that recognizes 5-methylcytosine residues. MoI. Cell Biol.

9, 1351-1356.

TABLE 1: Arabidopsis AtMBDθ (At3g01460) cDNA full sequence (6531 bp) (SEQ ID NO:1)

ATGGAACCCACTGATTCTACTAACGAGCAACTCGGAGACACTAAGACCGCCGCTGTC AAGGAAGAGAGT CGCTCCTTTCTCGGCATCGATCTCAACGAAATCCCTACCGGCGCTACTCTCGGCGGTGGT TGCACCGCT GGTCAGGATGACGACGGCGAATATGAACCTGTTGAAGTTGTTAGGTCAATTCACGATAAC CCGGACCCA GCCCCTGGAGCCCCTGCCGAGGTTCCTGAACCGGATCGGGATGCTTCGTGCGGCGCGTGT GGAAGACCT GAGTCTATAGAGCTCGTTGTAGTCTGCGATGCCTGTGAGCGAGGCTTTCATATGTCTTGT GTCAACGAT GGAGTTGAGGCGGCTCCTTCCGCCGATTGGATGTGCAGCGACTGTCGTACTGGCGGCGAG AGGAGCAAA CTGTGGCCGTTGGGGGTTAAGTCCAAGCTCATTCTGGACATGAACGCCTCGCCGCCCAGT GATGCTGAG GGATACGGAGCTGAGGAGACGTCTGATTCGAGAAAGCATATGCTCGCCAGCAGCTCTTGC ATTGGAAAC TCTTTTGATTATGCAATGATGCATTCAAGCTTCTCAAGTCTCGGTAGAGGACATGCTAGT CTCGAAGCT TCAGGGTTAATGTCTCGTAATACTAAAATGAGTATGGATGCATTGGGTTCACATAATCTA GGTTTTGGA TTCCCATTAAACTTGAACAATAGTAGTTTGCCCATGAGATTTCCATCCTTGGATCCAAGT GAGTTGTTT CTGCAAAATCTCAGGCATTTCATATCTGAAAGGCATGGAGTATTGGAAGATGGCTGGCGT GTCGAATTC AGACAACCTTTAAATGGTTATCAGTTATGTGCAGTGTATTGTGCTCCGAATGGAAAAACA TTTAGTTCA ATACAAGAAGTTGCTTGTTATCTGGGCTTGGCAATTAATGGTAACTACAGCTGTATGGAT GCTGAAATC AGGAATGAGAATTCTCTTCTTCAAGAAAGATTGCATACGCCCAAGAGAAGAAAGACATCA AGATGGCCA AACAATGGTTTCCCTGAGCAAAAGGGTAGTTCAGTGAGTGCTCAACTCAGGCGTTTTCCA TTCAATGGT CAGACCATGTCTCCTTTCGCCGTTAAATCTGGTACTCATTTTCAGGCTGGTGGTTCTCTT AGCTCTGGA AATAATGGATGCGGTTGTGAGGAAGCTAAGAATGGATGTCCGATGCAGTTTGAAGATTTC TTTGTTCTG TCGCTTGGACGAATTGACATAAGACAGTCTTACCATAATGTCAACGTGATTTATCCAATA GGATATAAG TCCTGCTGGCATGACAAGATCACGGGGTCACTATTTACATGTGAAGTATCTGATGGCAAT TCTGGTCCC ATTTTCAAGGTTACACGGTCACCATGCTCGAAATCATTTATTCCAGCTGGATCAACTGTC TTCTCCTGC CCAAAGATTGATGAAATGGTGGAACAGAACAGTGACAAACTTAGTAATCGTAGAGATAGT ACTCAAGAG CGTGATGATGACGCTAGTGTTGAGATCCTTCTTTCGGAACACTGCCCACCTCTTGGAGAT GATATATTG TCTTGTTTACGTGAGAAGAGTTTCTCCAAGACAGTCAATTCCCTGCGCTCAGAGGTTGAT TCTTCTCGA GTAGATTTTGATAAAAATTTATCCTATGATCAGGACCATGGGGTTGAAATTGGTGACATT GTTGTGGAA GAAGATTCATTGTCTGATGCATGGAAAAAAGTGTCTCAAAAACTTGTTGATGCATGTTCA ATTGTACTG AAGCAGAAGGGTACCCTGAATTTCCTATGTAAGCATGTTGACAGAGAAACAAGTGAAATC AACTGGGAT ACCATGAATGAGAAAGACAATGTAATTTTATCGTTGTCAAAATTTTGCTGTTCGTTGGCT CCTTGCAGT GTCACGTGTGGTGAAAAGGATAAAAGCGAATTTGCAGCAGTAGTTGATGCTTTGTCAAGG TGGCTCGAT CAAAACAGATTTGGACTTGATGCAGATTTTGTACAGGAAATGATTGAACATATGCCTGGT GCCGAATCA TGTACGAATTATAGGACTCTGAAGAGTAGAAGTTCTTCTTCTGTTCCTATAACTGTAGCG GAAGGAGCG CTAGTGGTCAAACCAAAAGGTGGGGAAAATGTCAAGGACGAAGTTTTCGGTGAGATTTCT CGGAAAGCC AAGAAGCCTAAACTAAATGGTGGTCATGGTGTCAGAAATCTACACCCTCCTCCTGGGAGG CCAATGTGT TTGAGGCTCCCTCCTGGGCTTGTTGGTGACTTCCTTCAGGTATCTGAAGTGTTCTGGCGT TTCCATGAA ATTTTGGGTTTTGAAGAGGCTTTCTCACCTGAAAACCTTGAACAGGAGCTTATCAATCCA GTGTTTGAT GGTTTGTTTCTTGATAAACCTGGGAAAGATGATAAGAGAAGTGAGATTAACTTTACTGAT AAGGATTCT ACAGCTACTAAACTTTTTTCTTTGTTCGATGAATCTCGCCAACCTTTTCCTGCAAAAAAT ACCTCTGCT TCTGAACTAAAGGAGAAAAAGGCAGGGGATTCTTCTGATTTTAAGATTTCAGATTCCTCT CGTGGGTCG TGTGTGGGTGCACTTCTAACAAGGGCTCACATTTCGCTTCTGCAAGTGCTAATATGTGAG CTGCAATCC AAGGTAGCTGCATTTGTTGATCCAAACTTTGATTCTGGCGAATCGAGATCCAGACGAGGA CGAAAAAAG GATGACAGTACACTTTCTGCTAAAAGAAATAAGCTGCATATGCTTCCTGTTAATGAGTTC ACTTGGCCT GAATTGGCCCGTAGGTACATCTTGTCTCTTTTATCCATGGATGGGAACCTCGAATCAGCA GAGATTGCT GCACGTGAAAGTGGTAAGGTATTCCGTTGCTTACAAGGGGATGGTGGTTTGCTTTGCGGC TCGCTTACA GGAGTGGCTGGGATGGAAGCAGATTCAATGTTACTTGCAGAGGCTATTAAGAAAATATCT GGTTCGTTG ACAAGCGAAAATGATGTTCTTTCTGTGGAAGATGATGATTCCGATGGCCTTGATGCTACT GAGACAAAC ACTTGCAGTGGTGATATTCCAGAGTGGGCTCAGGTTTTGGAACCTGTGAAAAAGCTTCCA ACAAATGTT GGGACTAGAATCAGAAAGTGTGTCTATGAAGCTTTAGAGAGAAATCCACCAGAGTGGGCA AAGAAGATA TTGGAGCATTCTATCAGTAAAGAAATATATAAAGGCAATGCATCAGGACCAACAAAGAAA GCTGTCCTC TCATTGCTAGCGGATATTCGAGGTGGAGACTTGGTGCAGAGGTCTATTAAAGGAACCAAA AAGCGGACA TATATAAGTGTATCTGATGTCATTATGAAGAAATGCCGTGCTGTATTGCGTGGTGTTGCA GCTGCAGAC GAGGATAAAGTCCTTTGCACTTTACTGGGAAGAAAGTTACTGAATTCCAGTGATAATGAT GATGACGGG CTCCTGGGATCACCTGCAATGGTTTCGCGTCCCTTAGACTTCAGAACTATTGATTTGAGG TTGGCTGCT GGTGCGTATGACGGATCAACTGAAGCTTTTCTTGAAGATGTTCTTGAGCTGTGGAGTAGT ATACGTGTT ATGTATGCAGATCAGCCCGATTGTGTGGACCTGGTTGCAACATTGTCTGAAAAATTCAAG TCGTTATAC GAGGCTGAGGTTGTACCACTTGTTCAGAAACTTAAGGACTACAGGAAATTGGAATGCCTA AGTGCAGAG

CONTINUATION OF TABLE 1

ATGAAGAAGGAAATTAAGGACATAGTTGTTTCAGTAAATAAGCTTCCCAAGGCCCCG TGGGATGAGGGG GTATGTAAAGTATGTGGCGTTGACAAAGATGATGACAGTGTTCTCTTGTGTGATACATGC GATGCTGAG TATCACACATATTGTTTAAATCCACCTCTTATTAGAATTCCTGATGGAAATTGGTATTGT CCATCTTGT GTCATTGCCAAGCGCATGGCTCAAGAGGCTTTGGAATCTTACAAACTAGTTAGGCGGCGG AAAGGTAGA AAGTATCAGGGGGAACTCACCCGAGCTTCTATGGAACTGACTGCTCACCTGGCAGATGTG ATGGAAGAA AAGGACTACTGGGAGTTTAGTGCTGAGGAGAGAATCTTGCTGCTTAAGCTTCTATGCGAT GAACTGCTT AGTTCATCTCTTGTCCATCAACACCTTGAGCAGTGTGCCGAAGCAATAATTGAAATGCAG CAGAAGTTA CGCTCTCTTTCCTCAGAATGGAAAAACGCAAAAATGCGGCAAGAATTCCTGACGGCTAAA CTGGCAAAG GTTGAACCGAGTATTCTGAAGGAAGTGGGCGAACCACATAATTCAAGCTACTTTGCAGAC CAAATGGGA TGTGATCCACAACCACAGGAGGGCGTTGGAGACGGAGTTACTCGTGATGATGAGACTTCC TCTACTGCA TATCTTAACAAGAATCAAGGTAAATCTCCACTTGAAACCGATACTCAACCCGGAGAGTCG CATGTTAAT TTCGGTGAGAGCAAAATTTCCTCCCCGGAAACAATATCATCCCCTGGGAGGCATGAGCTA CCTATAGCA GATACCTCTCCTCTTGTAACAGATAATCTGCCTGAAAAAGATACCTCGGAGACCTTGCTT AAGTCAGTT GGAAGGAATCATGAAACACATTCACCAAATTCCAATGCAGTAGAATTGCCGACAGCTCAT GATGCATCT TCTCAGGCTTCCCAAGAGTTGCAGGCTTGTCAGCAGGATTTGAGTGCCACTAGTAATGAA ATTCAGAAT CTTCAGCAATCAATTAGAAGCATAGAATCACAGCTTCTAAAGCAATCTATACGGAGAGAT TTTCTGGGA ACCGATGCTAGTGGTCGGTTATATTGGGGTTGCTGCTTCCCAGATGAAAATCCTCGTATA TTGGTTGAT GGAAGCATATCTTTGCAGAAACCTGTTCAAGCCGATTTGATAGGTTCAAAAGTCCCCTCT CCGTTTCTC CATACCGTTGACCATGGAAGACTAAGGCTTTCACCCTGGACGTATTATGAAACTGAAACC GAGATCAGT GAGCTTGTCCAATGGCTTCATGATGATGATCTGAAAGAAAGAGACCTGAGAGAGTCTATT TTGTGGTGG AAAAGGTTACGATATGGAGACGTTCAAAAGGAAAAGAAACAAGCTCAGAATTTATCTGCT CCGGTATTT GCTACGGGTCTTGAGACCAAGGCTGCCATGTCAATGGAGAAGAGATATGGTCCATGCATC AAACTGGAG ATGGAAACCTTAAAAAAACGGGGGAAGAAGACAAAGGTTGCAGAGCGAGAGAAATTGTGT AGATGCGAA TGCTTGGAATCCATTTTGCCATCTATGATTCACTGCCTCATATGCCATAAAACATTCGCA AGTGATGAT GAGTTTGAGGATCACACTGAGAGTAAGTGTATTCCTTATTCATTAGCAACTGAAGAAGGC AAGGACATC TCTGATTCTTCAAAAGCCAAAGAAAGTCTGAAATCCGATTATCTTAATGTAAAGTCTAGT GCCGGCAAA GATGTAGCTGAAATATCCAATGTTTCTGAACTTGATTCTGGGTTGATAAGATATCAAGAA GAAGAATCT ATTTCCCCATACCATTTTGAGGAGATCTGTTCCAAGTTTGTGACAAAGGATTGCAACAGA GATTTGGTT AAAGAGATCGGTCTGATCAGTTCAAATGGCATTCCAACATTTCTTCCATCGTCATCTACT CATCTTAAC GACTCCGTGCTCATCTCTGCCAAATCCAATAAGCCAGATGGTGGTGATTCAGGGGATCAG GTCATTTTT GCTGGTCCTGAAACCAATGTTGAAGGCTTAAATTCTGAATCTAACATGTCATTCGATAGA TCTGTCACA GACAGTCACGGGGGTCCACTGGATAAACCAAGTGGACTGGGTTTTGGCTTCTCAGAGCAA AAGAATAAG AAATCTTCAGGTAGTGGGTTGAAAAGCTGCTGTGTGGTTCCACAGGCTGCTTTGAAACGA GTAACTGGC AAAGCTTTGCCGGGTTTCAGGTTCCTGAAAACCAACTTGCTTGATATGGATGTAGCACTG CCTGAAGAA GCTTTAAGACCATCGAAATCACATCCAAACCGTAGAAGAGCTTGGCGTGTATTTGTTAAA TCGTCGCAA AGTATATACGAGTTGGTTCAGGCAACAATTGTGGTAGAAGATATGATTAAGACAGAGTAC TTGAAAAAT GAATGGTGGTACTGGTCTTCTCTTTCAGCGGCTGCTAAAATCTCGACTCTCTCAGCGTTA TCCGTCCGT ATCTTCTCCCTCGACGCTGCTATCATTTATGATAAACCCATAACTCCATCAAATCCTATC GATGAAACA AAGCCGATCATCAGCTTACCGGACCAAAAGTCACAGCCGGTTTCGGATTCTCAAGAAAGA AGCAGCAGA GTTAGAAGATCTGGCAAGAAAAGGAAAGAACCCGAGGGATCCTAG

TABLE 2: Rice MBD9-like gene full length genomic sequence (4970 bp) (SEQ ID N0:2)

AGGTAATACGCAACCTGCACACTGCATTTGGTGATCGCCCTGATGTGCTTGAAATGG TTGTTGCATTGT CTCAGAGTTTTGAGTCATTGTACAAGACAGAGGTTGGTTAATCCTATTTTTCTGTTGCAT CTTTGCTTT TCTGTTCAGCTTTATTGTTCCTCCAAATGCCATCACAATAACTAGATATTGTACAAAATA CCAATAGCC ATTACATTTTCCATTCATGGGTTTTGTCACCATTCATTGCACCCTTGAGCTACATTGGTC AGACCATTG TTGTAAACGATTATCAGTTTAGTTTACCTATCCAATTTAGTTTCATAATCTAATGATGGA AACAATGTT ATTGTTACTTGAAAAAAAAAACCACCTCTTTGTGTGTTATCTCATGTGATTGCTAATGCT GATTCGAAT ATATAGATCCTTTTTATAGTTTCATATTTTAAAACATTATAGTCAGGGTTATGTAGAAGT CTTTTATCT TCTCATTTCCCTTCTACTTGGCTGGTGCAGGTGCTTGACCTTGTTGAGAAATTTGACAAA TACCTCTCG GACAAGAATGCTGGTTCAGAAATGCACGAGGAGCTACATGATATTCTAACTGCAGCGAAC AGCTTACCT AAAGCTCCATGGGAAGATGGCGTTTGCAAAGTATGTGGTATTGATAGGGACGATGATAGT GTTCTGCTA TGTGACAAATGTGACTCAGAATACCACACTTACTGCTTGAATCCCCCACTAGCCCGTATA CCAGAAGGG AACTGGTACTGTCCATCATGTATGTTAGGTCAAACGAAAGCACATCATGATCAGGGTGTT CAAGATGTG AAACGGCAGCAAAAGAAATTTGTTGGGGAGGAAGCCCATGCCTTTCAAGAGGAACTTAAT AAATTAGCT ACAGCAATGGAAGAGAAGGAATATTGGGACCTTAACATGCAAGAGGTTTGTTTTTCTTTT TTCCTTTGT ATTTGAAGTAAGCTTCTCTGTTGTTAATGTGTGGTATAAACCAAGAGGCTCCTCAATCCC AAAATAATG ACTCAAAATAAGCTTCTTAGAGTTTTGAGTGATACAAGACAAAGTTGGACCTGCTATAGG CCCCTAAAC CTATAAGGACTTAAGGTCAGGTCAATAATTTGGAGCTTGAAGTTAATTTTGTCATCCATG GAATAGTAT AGTAGCTACAATGTTTTGTTGCTTTGGACATCCAAGTTAAGCAACACGTAAGGAATTGAT GTGTTTTTC TTATTTCTCAGTGGTAAATATATACTGCTGGATACAGTTCTTGTTACCATTTCAAATATA CCTTGTTAT AAGTATGTCTATTTCATGGACATTGCATACAATTTTAGTCTGGTTTGATTTTTTACTTAA GAGTCCTGC CCTCTATTATTGTACTGTACAATACTATGATTGCCTAAGCATTTGCTGGTATGCTGATTT CCATAGTTG ACAAAGTGACCTACATATTTGTTTTAATATTTTATTGTGATCTTTGAAATGCAGAGGATA TATTTACTG AAATTTCTATGCGACGAAATGCTCAACACTGCTCTAATTAGAGAACATCTAGATCAATGT TCAGATAAG TTAGGCGATCTTCAGCAGAAGTTCCGTGCTTCAAATTTTGAATTGAAAGATTTGAAATAT AAGGAGGAG ATGAGGACTTCATATGCTAGACAAAGTAGATCTAGTAAAACTGAACAGCATTTTAACAAC AGTTCTGGA CCCGTGGAAAATCAACAGCAGTGCACGCCCACAGCATTGGACCATCTGGAAGAGGCTGAA CAGGGTAAT GTTGGAGTTAACCTAAACAACCCAGCTGATGGGGTTCCTGATGGGCAATTGAATGTAGGC AAGCCTTAC AAAAGTGACAAAGACATATCCAGTGCATCTATGGTTGAAGAACGCAAATCTTCAGGACTT TCTGAACAA CCATCAGGAATGGCTATTGACCAGATTGATGGGGATGCTATTGATGAAGGGTCCCAGAGT TGTGAGAAG AGGTCATTAGGTGCCAAGAGCAGTACATGTGATAACTTGAACTTGAAAGACACTGAATTT AGCACACCT GGAAGAGAGTTGCCTGATGAAAGAGCCAGCACATCATTCCAAGATAATCTTGAAGCATCA TCAACTAAA TCAATTGAGCTTGATGCTGATAATAATGAAATGGATACTTTATCGGATGACATTTCAAAA TTGCAGGAT TCAATTAGCTTACTAGAGTCACAGATTAATATGGCATCATCGAGAAGAGAGTGTCTGGGT AAGGATTCC ATTGGTCGATTATACTGGGTTATAGGAAGACCGGGTAAACGTCCTTGGTTGGTGGCTGAT GGAAGCATG CTGAAACCCAAGGAGAGAGATATCAGTATGGTTAACAGTTATCCCCCATCTGCTTTTGAT TGCAAAGGT TGGAATTCAGCATCTATTTTCATTTATGAATCTGATGAGGAAATCCAGTGCCTTCTTGAC TGGTTAAGA GACTATGACCCAAGGGAGAAGGAACTGAAAGACTCTATCTTGCAGTGGCAAAGACATTTC TGTCATCAA AGCAGTTCTCCTCTCGTTGATCCTCCAATTTCTGGTCCAAAGGGTGAACAGCTTATGGAG CTTCCAAAT ACCAAGGCTGCAGTAATTTTGGAACAAAAGTATGGTCTGCAATTGGACCAGGACACAAGT GATCTACCG AAAAAGCGAGGAAAGAAGATAAAGTTAAGTTCTGAAGATAGAACATATCGCTGCGACTGT TTGGAACCT GTATGGCCTTCTCGATACCATTGTTTAACATGTCATGAGACTTATCTCATATCTACAGAG TTTGAGGGG CATAATGATGGAAAATGCAGTAAAATCCACCAGTCTCCTGATGAAAGCAGAGAAAATGAT GAGCCAAAA GTGAAGGTTACCAAATCTGATACGAAGGAAAAAGATTCCCTTGAATGTAGCTCTGTCATT GAACCGTCC AGTGACAGAAAATTGATGCAATGCCCATATGACTTTGAAGAAATTTGCAGAAAGTTCGTC ACAAATGAT TCGAACAAGGAGACAGTAAAGCAGATTGGACTTAATGGGTCCAATGGAGTTCCATCATTT GTGCCTTCA CCTGCATTTTTTCTTGAACCTGCAATTGTACAAAGTCAAAACAGAAAAGATGATGAACTC AAGGATTGG ACCTCCTCTTTAGAGGAATGCAATGCAATGTCTGCTCAAAAGCTAGTTCAAGAGGTTTCC AAATCTGGT CAAAGTTGTCCTGGCAATGTGGGTGATGAGAAGGTGCAAAAATCTAAAAAGCCCACCCCT GATAATACT TCTGGTGAGGAAGCACATTCTACAACAGGCAAGCCAACACGATTGCTAGCTGTTAATGGG GGGTTGGTT CCAGAGTCATCCTTGAGGCCTCTTATAGGACGAAACTCTCACATACTTAAGCAGCAAAAG ATAAACTTG CTTGACATCGAAGCAGCCTTGCCTGAGGAGGCACTGAGAGCCTCAAAGTGTCAGCAAATA AGAAGGCGT TCATGGCGTGCATTTGTCAAAGATGCAGAATCAATATCCCAGGTACCTTAATCTATCTAT TCACTGTTT GTTACAGAAATATATCTATGTAGCTTAATGTGTAATCTTGGCATACTGCATTTGGCTTAC GTTCATCAA ATTGATAGTGTTCCGAAATTCTAAGATATACTCTCAAGCATGCAGCGTTAATTTACCATG TCTTTGTTT GTGTCTGCAACAGTTCAATTTAACTGTAAAATTACTTATACAGGATCCATTTATTTAAAA TTTTTAGCA

CONTINUATION OF TABLE 2

GTAAGTCTAGATTCAAGTGGTTAGTTCCTAAGTTGTAAGTCTAGATACACAAGTAAA CAGGATACAGGA ATTATGGGCCACCAAGACCTGAGCTATAATTTAGCCCTTTCTTTTTTTAACTTCATTATG TGAAGATGC AGTATAAATTATTACTTGAGAGCTCTTTTGCATTATCCAATTTCCTGATTAATGACATCC ATCCTCTTT TAGATGGTTTTGGCGGCTAACTTGTTGGAGGGCATGATAAAAGCTGAGTTCTTGAAGAAC GATTGGTGG TACTGGTCTTCCTTCACAGCAGCTATGAAGACATCAACTGTATCCTCACTCGCGCTCAGG GTCTACACT

GGAAACAGAGGTGGGAGGAGGAGGAGAGAGCTTGAATCCTTAGCATCATAATGTAGG ACTCTCCGTTGT AGACTCCAAAGTTAGAAGCCTCTCGGGCAGCAAAAGAATATTATCCTGCTGTCAAGTAGA TCGATGATA

GATGATACAAAGTCTTCTGTTATGTCGTCGCTTAAGGAGGGTAGCGTGGTAGACATC GTTCCGGTACCC

CTGCAAGAGTTCAACCCTGACTGTGTTTTCTTTTACCTCGTATCTACCAGCCTACCG TTTTTCGACTTC

TGTTGTGGTTTTAGGTTCCAGAAGGAAGAATTGGTACTCCATGTGCGAGCATTCGAT CTTGATGCCACC

ATGTAAATTGTTTGAGGCACCTGCAAGTGCTGGCATTTTGATCTGATCCGCCAGGAG TACCCGGTGCAA TTTTCTCTGTTGGACTAACCCTATTCATTGTAGAGGTTATTCCATAGGAGATAGAGGAGA CATGTCAGG

TAGGGAGGATATGTCTCATTTTCTACCCACTTTCACTCTATTAGCCGCAGTGGGTAG TGTAGCGGGTGT

TAGTTTCTCATTCTCATGGTCTGTACTTATGTCGTGTTTAGGGGGGGCGCTCTGGGG CGTTGTATTGAT

AATTTTGATTGTAACTAAACTGAACTGAAACCAATAATGATTAGTCAACAATGATTC GGCTGCCTGAGC GA

TABLE 3: Maize MBD9-like gene partial genomic sequence (2508 bp) (SEQ ID NO:3)

GCACGAGGGGCTAAGGGACATTGATCCAAGGGAGAAGGATCTGAAAGACTCTATCTT GCACTGGCAAAA GTCTATTTATCGCCAGGCTAGTTTCCCCATCACCGATCCTCCAGTGTCCAAGTTTTCAAA GAGTGAGCC ACTTATGGAGCTTCCAAACACCAATGCTTTTATAGGTTTGGAGCAAAAGTATGGTCTGCA AACGGATCA GGACACTAGTGAGCTATCCAAAAGGAGAGGAACGAAGTCAAGGTCGGGTTCTGAAGAAAG AGTATATCG CTGCGACTGTTTAGAGCCTATATGGCCTTCTCGACACCATTGCTTAAATTGTCATGAAAC TTATCTCAC ATTGATGGAATATGAAGGGCATAATGGTGGAAAATGCACCAGCAGTAACGACTGTCCTAA TGAAAGTAA AGAAATTGACGAGCCGAAACTGAAGGGCAGCAAGTCTGATATAAAGGAAAAAGATCCTGT AGTTCATAA TTGTTCCGTTGAACCATCTAACAGTGGAAAATTGGAGTCATGCCCTTATGACTTTGAAGA AATTTGTAG AAAATTTACCACAAATGATTCAATCAAGGAGACGGTGAAGGAGATTGGGCTGCTTGGCTC AAATGGAAT TCCATCTTGTGTACCTTCACCTGCATATTTCCTTGACCCGCCAGTTCTGCTAAATGAAAG TAAAAGAAA TGACGATAAACCAAATGATTGGACTTCCTCATTGCAGGAATGCCAAGCTGTGTCTGCCAA AATGTCAGG GCAAGAGGGATCTCAAGTTGGCCAAGATTTTTCTGGCAATGCAGGTGATGAGGAGTTGCC AAAATCTAA GAAGCCTGTCAGGGATAGTACTTCAGCCAAGGAAGCACCTTCAACAGACATATCCACAAG ATTGCTAAC TGTTAATGGGGGATTGGTTCCAGAGTCATCACTGATGCCTGTAATAGGCAGGAATTTTCA TATCCTGAA GCAGCTAAAGATTAACTTGCTTGACATAGAAGCAGCTTTGCCTGAGGAAGCATTCAGAGC CTCAAAGTC TCAGCAAATAAGAAGACGTTCATGGCGTGCTTTTGTAAAGGATGCAGAATTAATATCATA TGTATGTCA CCCTATTTGTGTATTTTCAATTTACTGTTTTTTTCTTTAAAAAGTAACATTTTCTTTTTC AGTGAGTTT CCAGGAACCATTTTTAGTTCCTAAGAAACTAATCTCTACTGGTACTGAAACCAACTTGAT CTATACCTC TAATTTCCTAAGAAATCTCACTACTTCCCTAAGCAGATAATNNNNNNNNNNGCAGATAAT CTTCTTCAT ATTTTCTTGTTCCTAATTTATGACTTATTGCTCCTTCTAAACTCATACCCTACCGTGCAT TTGAAAATT TTAATTTCACGTTAGCTGCCTCTATGTTTGATTAAAAATGACTAGTGCATGATCTAGTCT CCAAACTGA GATATAGGCCAGAATCCTAAAATTAAGGATGTAATTAGCAAATTGACAGTGCGATGGATC CGAGTGTGG TTGTGGGACCTAATCTGTAATCCTCCCTGTCCCTTCTAACTCAAGTCTGTGAAATTGCAG TTTTAGTTA TGCTAGAAACCTAGAGATAATTGTAGTATGATTCAGTTACTGATTAATCATGTCTTCGCC TCTTTTAGG TGGTATTGGCAATCAATTTCTTGCAGAGCATGATAAAAGCCGAGTTTCTGAAGAAAGATT GGTGGTACT GGTCCTCCTTCACTGCAGCTATCAAGACAACAACTGTATCATCGCTTGCGCTCAGGATTT ACACCCTCG ACGACTGCATCATGTACACAAAGGATCCAGCTCCAAACCTGCAGCCAGCTGACAATGCAA GGTCTGGAA ACAAGGGGAAGAGGAAGAAAGACATAGATTCATGAGCATCGTAACCACAATGCTCCTGGC TTCCCCTGT AGATTCTATCTATCTGCATTTAGAGGCTTCTCAGTTCTCTGGCAGCATAACAACGCGGTC AGGTAGATT GGAGATATAGATGGTAGTGGTCAGGTAGATTGGAGATATAGATGGTAGTGATACAGGTCG CAACCTATG TGTGACCTCTTTCTTACTGTACATTCCAGTGTCACAGCAAGGGTGCAGCCATGATTTGCC CGTTTCAGT CTTGTCCTACTTACTGGCCTGCCATTGCGCGATATCTGCTGTTGCTAAGGCTCAATCTCT GTAAATTCT ACTCGAGGGATGGCACCGGGCAAGTGCTGGTGTTTAATCTGTTGCCCGATGTGTTGATCT GTTCTAGGG GATTAGAGGAGGAATGCTAGGTCGGTAGGATTTACCCCATTTCTACCCTGCTTCATTTTA TTTTAGTGG TGGCAGTGGGTAGTCGTAGTTTTTTCTTTTCTTTTCTTTTCAGAGCTGGGATTGTTTGAT GGATGTCCC CTGCGGCATCTGACTGCTTTAGGGAATTTGATACATGACGAGTGTAATATTTTTTTTGAC ATAGAAGTT GTAACTAAACCGAAACTAATAATG