METHOD FOR MULTIPLEX DETECTION AND QUANTITATION

OF NUCLEIC ACIDS

Technical Field

[0001] The invention generally relates to methods for quantitative detection of nucleic acid target sequences. More specifically the invention includes methods for quantitative detection of SNPs and monitoring SNP changes over time to guide therapeutic intervention.

Background

[0002] Imatinib mesylate (STI571, Gleevec) is a kinase inhibitor that has been demonstrated to be a highly specific and robust agent for the treatment of cancer. However, as with many chemotherapeutic agents, resistance to the compound has developed. For example, in Philadelphia chromosome-positive (Ph(+)) leukemia, point mutations within the Bcr-Abl kinase domain emerged as a major mechanism of resistance to imatinib. Studies using Bcr-Abl-transformed Ba/F3 cells subjected to selection with imatinib resulted in the development of resistant colonies (i.e., homogeneous cell populations) with mutations within the kinase domain that resembled the pattern and frequency of mutations observed in human chronic myeloid leukemia (CML) imatinib resistant patients (von Bubnoff et al., Blood, 105:1652-1659. 2005).

[0003] Bcr-Abl-transformed Ba/F3 cells were separately treated with an alternative AbI kinase inhibitor, PD 166326, using the same method at concentrations appropriate for the compound. Treatment of the cells with PD 166326 produced a distinct pattern of Bcr-Abl resistance. Overall, 27 mutations were identified at 20 different sites within the gene. The majority of mutations that came up with both imatinib and PD 166326 could effectively be suppressed by increasing the dose of PD166326 to 50 to 500 nM. In contrast, only a few mutations could be suppressed by increasing the imatinib dose to 5 to 10 μM. However, 3 mutations of the kinase displayed complete resistance to PD 166326, but could be effectively inhibited by standard concentrations of imatinib. In all but one clone, resistance was due to a single point mutation. The authors suggested that selection of chemotherapeutic agents could be guided by monitoring mutations and associated resistance patterns, and that such

monitoring methods could be applied to treatment of conditions with specific small molecule protein binding agents, such as kinase inhibitors.

[0004] Characterization of mutations in the mixed cell populations derived from biopsies and tissue samples is not amenable to sequencing methods that can be used to analyze mutations in clonal populations. Most commonly used sequencing methods rely on bulk averaging of the extension products from multiple templates. In order for a mutation to be detected in a mixed population, it must be present in at least about 20% of the population of the templates sequenced. When a mutation can be detected in a mixed population, determination of the amount of the mutation present cannot be determined quantitatively. Moreover, detection of such anomalies in sequencing is not amenable to automation or high throughput screens preferred in clinical laboratory settings. Ideally, monitoring for changes in nucleotide sequence that can result in development of resistance would be most useful if the mutations could be detected prior to clinically significant resistance to the chemotherapeutic agent develops. This would potentailly be prior to a detectable change as determined by sequencing.

[0005] Methods for identification of single nucleotide polymorphisms (SNPs) without sequencing have been developed. However, the methods do not allow for the quantitative detection of SNPs or the determination of their relative proportions in the population. For example, US Patent 4,988,617 (incorporated herein by reference) teaches ligation mediated SNP detection. In the method, two probes are annealed to adjacent segments of a target sequence and treated with ligase. If the juxtaposed ends of the probes are complementary to the adjacent segments of the target sequence, the juxtaposed ends of the probes are a substrate for ligase, and can be joined to generate a product that is indicative of the presence of the sequence complementary to the joined probe sequence. However, if the juxtaposed ends of the probes are not complementary to the target sequence, they are not a substrate for ligase and cannot be joined.

[0006] Ligation mediated SNP detection methods have been modified to include an amplification step to facilitate the detection of the amplification product. JP- A-4262799 and JP-A-4304900 both disclose the use of ligation reactions combined with amplification reactions for detecting a target nucleic acid sequence in a specimen sample. The methodology comprises contacting the sample in the presence of a ligase with a straight chain probe polynucleotide, which has a sequence designed to be

cyclized, or circularized, as the result of the presence of a target nucleic acid sequence. The cyclized polynucleotide is then used as a template in an enzymatic polymerization reaction. By adding a primer which is at least partially complementary to the cyclized probe together with a nucleic acid polymerase and nucleotide triphosphates, a single stranded chain nucleic acid is formed which has a repeated sequence complementary to the probe and at least partially to the template. The amplification product is then detected either via a labelled nucleic acid triphosphate incorporated in the amplification, or by an added labelled nucleic acid probe capable of hybridizing to the amplification product. Two polymerase chain reaction (PCR) primer binding sites can be incorporated into the probe sequences to allow for subsequent amplification of the ligated product (Zhange et al., Gene 211: 277-285, 1998). Circular probes, also known as padlock probes, are also used in SNP detection methods (see, e.g., Thomas et al., Arch. Path. Lab. Mec. 123:1170-1176). Such probes are frequently detected using cascade rolling circle amplification methods which provides higher sensitivity than PCR methods. However, the method does not allow for quantification. US Patent 6,858,412 describes a method for multiplex detection of probes wherein the ends of the probes are annealed to a target sequence, to allow the ends to be joined, cleaved at a different site, and amplified. US Patent Application Publication 2006/0121458 teaches a method using padlock probes and PCR amplification for detection of multiple target sequences. The method requires the use of multiple detectable labels to distinguish various PCR products produced and is used for detection rather than quantification of the target sequences.

Summary

[0007] In one aspect, disclosed herein methods for detection of a target sequence in a sample. The methods include providing a plurality of target sequences, preferably wherein at least one target sequence having a known sequence is present in a known quantity to provide a reference for quantitation of the amount of the unknown target sequence(s) present. The methods include the use of a plurality of circular nucleic acid probes corresponding to each of the plurality of target sequences to be detected, including the known sequence. Each probe includes the following segments in a specific linear fashion from the 5' end of the probe to the 3' end of the probe: a

first segment complementary to a target sequence for probe annealing, a first variable segment, a first PCR primer binding site, a complement to a second PCR primer binding site (sometimes referred to as a PCR primer binding site for simplicity), a second variable segment, and a second segment complementary to the target sequence for probe annealing. In some embodiments of the probe, a linker, optionally including a polymerization terminator, is present between the two PCR primer binding sites. Upon annealing of the probe to the target sequence, the probe is circularized, and the 5' end and the 3' end of the probe are adjacent, but not necessarily contiguous, to each other.

[0008] The methods further include contacting the plurality of probes with the plurality of target sequences under conditions to allow for annealing of the probes to the target sequences. If the annealed segments of the probe are not contiguous by design, the complementary segment of the target sequence between the probes is filled using a polymerase. The annealed complexes are treated with ligase. If the juxtaposed termini of the probe are annealed to the target sequence, a closed circular probe is generated using ligase. The closed circular probe is then used as a template for amplification by PCR. In an embodiment, the first PCR primer binding sites in all of the probes are identical, and the second PCR primer binding sites in all of the probes are identical. The first PCR primer binding site and the complement to a second PCR primer binding site are distinct. At least one time during the amplification process, a sample is dispensed from the PCR amplification reaction to detect the presence of a PCR product wherein, the length of a PCR product is correlated to the presence of a specific target sequence. In an embodiment, the method can further include quantitation of the amount of PCR product from an unknown target sequence detected by comparing the amount of PCR product generated by the known sequence present in a known quantity in the reaction mixture. The PCR product can be detected by inclusion of a detectable label in at least one of each pair of PCR primers used in the methods.

[0009] Also provided herein are methods for detecting the presence of a plurality of target sequences in a nucleic acid sample comprising:

[0010] providing a plurality of target sequences wherein at least one target sequence and at least one reference target sequence has a known sequence and is present in a known quantity;

[0011] providing a plurality of nucleic acid probes corresponding to each of the plurality of target sequences to be detected, wherein each probe comprises:

[0012] a 3' end and a 5' end, wherein a segment at the 3' end is complementary to at least a first segment of a target sequence, and a segment at the 5' end is complementary to at least a second segment of the target sequence, and the first segment of the target sequence and second segment of the target sequence are adjacent to each other on the target sequence; a first variable region adjacent to each complementary segment of the 3' end, and a second variable segment adjacent to each complementary segment of the 5' end; a first primer binding site adjacent to each first variable region, and a second primer binding site adjacent to each second variable region; and optionally a linker that can further include a polymerization terminator between the primer binding sites;

[0013] contacting the probes with the target sequences in a mixture under conditions to permit annealing of the probes to the target sequences;

[0014] contacting the target sequence-probe mixture with a ligase;

[0015] contacting the sequence probe-mixture with a first primer complementary to the first primer binding site, a second primer complementary to the second primer binding site, and a polymerase in an amplification reaction mixture;

[0016] analyzing the amplification reaction mixture to detect an amplification product of a defined size wherein each product of a defined size is indicative of the presence of a specific target sequence; and

[0017] determining the amount of specific target sequence present in the original sample by comparing the amount of the amplification product of a specific target sequence detected to the amount of the amplification product of the known target sequence in the original sample.

[0018] In an embodiment, the method further comprises at least one reference target sequence that is present in a known quantity.

[0019] In an embodiment, the method further comprises dispensing an aliquot of the of the amplification reaction mixture at least once during the amplification reaction.

[0020] In an embodiment, the nucleic acid is DNA. In an embodiment, the

DNA is generated by reverse transcription of an RNA template.

[0021] In an embodiment, the nucleic acid is RNA, wherein the RNA is selected from the group consisting of mRNA, tRNA, rRNA, microRNA, snRNA, and siRNA.

[0022] In an embodiment, the first segment of the target sequence for probe annealing and the second segment of the target sequence for probe annealing are separated by about zero to about 50 nucleotides on the target sequence.

[0023] In an embodiment, at least one PCR primer binding site includes at least one high affinity nucleotide or nucleotide analog.

[0024] In an embodiment, the PCR primer binding site is about 30 or fewer nucleotides in length, about 20 or fewer nucleotides in length, about 15 or fewer nucleotides in length, or about 12 or fewer nucleotides in length.

[0025] In an embodiment all of the first PCR primer binding sites have the same sequence. In an embodiment, all of the second PCR primer binding sites have the same sequence.

[0026] In an embodiment, at least a first PCR primer or a second PCR primer includes a detectable label.

[0027] In an embodiment the linker comprises a nucleotide sequence and/or non-nucleic acid elements (e.g., chemical linkers). The linker need not be a template for primer extension by a polymerase.

[0028] In an embodiment, the polymerization terminator is comprises at least one non-conventional deoxynucleotide site to block polymerization, including, but not limited to abasic site, at least one ribonucleotide, an ethenoadenosine, a 3- methylcytosine, a 5-aminothymidine, or a cleaved restriction endonuclease site. The polymerization terminator can also include a non-nucleic acid element.

[0029] In another aspect, the invention includes kits for practicing the methods described herein.

Brief Description of the Drawings

[0030] Figure 1 is a schematic of an embodiment of an annealed target sequence-primer complex wherein the first target sequence and the second target sequence are contiguous. The top target WT nucleic acid sequence 5'- AAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGG-3' is SEQ ID NO: 1. The top target mutant nucleic acid sequence 5'-

AAGCACAAGCTGGGCGAGGGCCAGTACGGGGAGG-3' is SEQ ID NO: 2. The half-probe sequence 5'-CGCCCAGCTTGTGCT-3' is SEQ ID NO: 3. The half-probe sequence 5'-CTCCCCGTACTGGCCCT-S' is SEQ ID NO: 4. [0031] Figure 2 is a schematic of an embodiment of an annealed target sequence-primer complex wherein the first target sequence and the second target sequence are not contiguous. The top target WT nucleic acid sequence 5'- AAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGG-3' is SEQ ID NO: 1. The top target mutant nucleic acid sequence 5'-

AAGCACAAGCTGGGCGAGGGCCAGTACGGGGAGG-3' is SEQ ID NO: 2. The half-probe sequence 5'-CCAGCTTGTGCT- 3' is SEQ ID NO: 5. The half-probe sequence 5'-CTCCCCGTACTGGCCCT-S' is SEQ ID NO: 4. [0032] Figure 3 is a schematic of an embodiment of the methods described herein.

Detailed Description

Definitions

[0033] As used herein, the term "sample" refers to a biological material which is isolated from its natural environment and containing a polynucleotide. A "sample" according to the methods disclosed herein can contain a purified or isolated polynucleotide, or it can comprise a biological sample such as a tissue sample, a biological fluid sample, or a cell sample comprising a polynucleotide. A biological fluid includes blood, plasma, serum, sputum, urine, cerebrospinal fluid, lavages, and

leukophoresis samples. A sample can comprise any plant, animal, bacterial or viral material containing a polynucleotide.

[0034] As used herein a "reaction mixture" is a combination of reagents, typically including, but not limited to, salt(s), buffer(s), nucleic acid(s), and enzyme(s). A reaction mixture is typically exposed to conditions under which the desired reaction can occur.

[0035] As used herein, "plurality" is understood to mean more than one, typically at least two. A plurality of targets can include one control target present at a known amount and one target present in an unknown amount.

[0036] As used herein, "detecting" a target sequence is understood to mean that an assay was performed for a specific target in a sample. The amount of sample detected can be none or below the level of detection of the assay. [0037] As used herein, "target sequence" is a nucleic acid sequence that is suspected to be present in a sample. The general term "target sequence" is understood to include the subset of reference target sequence. In the methods described herein, the target nucleic acid is of a known sequence and is of sufficient length to permit annealing of the first and second complementary target sequence segments of the probe wherein the first and second segments of the probe anneal to sequences flanking the site of the specific nucleotide to be determined. A "reference target sequence" is a nucleic acid target sequence known to be in a sample at a known concentration. [0038] As used herein, a "circular probe" is substantially a nucleic acid molecule having a sequence such that when the first and second complementary target sequence segments of the probe anneal to adjacent segments of the target sequence, the probe forms a circular shape, for example as shown schematically in the Figures. A circular probe returns to a linear molecule upon melting from the target sequence. A "closed circular probe" is a circular probe that was annealed to a target sequence and the ends were joined by ligase. A "closed circular probe" is not dependent on another molecule for its circular structure.

[0039] As used herein, "complementary" refers to the ability of precise pairing of purine and pyrimidine bases between strands of DNA and sometimes RNA such that the structure of one strand determines the other. A first polynucleotide is said to be "fully complementary" or "completely complementary" to a second polynucleotide strand if each and every nucleotide of the first polynucleotide forms basepairs with nucleotides within the complementary region of the second polynucleotide. A first

polynucleotide is not completely complementary (i.e., it is partially complementary) to the second polynucleotide if one nucleotide in the first polynucleotide does not base pair with the corresponding nucleotide in the second polynucleotide. The degree of complementarity between polynucleotide strands has significant effects on the efficiency and strength of annealing or hybridization between polynucleotide strands. This is of particular importance in amplification reactions, which depend upon binding between polynucleotide strands.

[0040] As used herein, the term "annealing" means permitting oligonucleotide primers to hybridize to template nucleic acid strands. Conditions for primer annealing vary with the length and sequence of the primer and are based upon calculated T _m for the primer. As used herein, "under conditions to permit annealing" is understood to be in a reaction having appropriate conditions including, but not limited to, appropriate salt, cation, buffer, and complementary nucleic acid concentrations; and appropriate temperature such that formation of double stranded nucleic acid molecules is possible. As used herein, the double stranded nucleic acid molecules are preferably formed by two separate nucleic acid molecules. Generally, an annealing step in an amplification regimen involves reducing the temperature following the strand separation step to a temperature based on the calculated T _m for the primer sequence, for a time sufficient to permit such annealing.

[0041] As used herein, "melting temperature" or "T _m " is understood as a temperature value that is related to the affinity of two complementary nucleic acid molecules for each other. A T _m can be readily predicted by one of skill in the art using any of a number of widely available algorithms (e.g., Oligo™, Primer Design and programs available on the internet, including Primer3 and Oligo Calculator). For most amplification regimens the annealing temperature is elected to be about 5°C below the predicted T _m , although temperatures closer to and above the T _m (e.g., between 1°C and 5°C below the predicted T _m or between 1°C and 5°C above the predicted T _m ) can be used, as can temperatures more than 5°C below or above the predicted T _m (e.g., 6°C below, 8°C below, 10 ⁰ C below or lower and 6°C above, 8°C above, or 10 ⁰ C above). Generally, the closer the annealing temperature is to the T _m , the more specific is the annealing. Time of primer annealing depends largely upon the volume of the reaction, with larger volumes requiring longer times, but also depends upon primer and template concentrations, with higher relative concentrations of primer to template requiring less time than lower concentration. Depending upon volume and relative primer/template

concentration, primer annealing steps in an amplification regimen can be on the order of 1 second to 5 minutes, but will generally be between 10 seconds and 2 minutes. [0042] As used herein, the term "capillary electrophoresis" means the electrophoretic separation of nucleic acid molecules in an aliquot from an amplification reaction wherein the separation is performed in a capillary tube. Capillary tubes are available with inner diameters from about 10 to 300 μm and can range from about 0.2 cm to about 3 m in length, but are preferably in the range of 0.5 cm to 20 cm, more preferably in the range of 0.5 cm to 10 cm. In addition, the use of microfluidic microcapillaries (available, e.g., from Caliper or Aligent Technologies) is specifically contemplated within the meaning of "capillary electrophoresis." In one aspect, the capillary electrophoresis is not performed in microfluidic microcapillaries. [0043] As used herein, the term "amplification profile" or the equivalent terms

"amplification curve" and "amplification plot" mean a mathematical curve representing the signal from a detectable label incorporated into a nucleic acid sequence of interest at two or more steps in an amplification regimen, plotted as a function of the cycle number or stage at which the samples were withdrawn or extruded. The amplification profile is preferably generated by plotting the fluorescence of each band detected after capillary electrophoresis separation of nucleic acids in individual reaction samples. Most commercially available fluorescence detectors are interfaced with software permitting the generation of curves based on the signal detected.

[0044] As used herein, the term "aliquot" refers to a sample volume taken from a prepared reaction mixture. The volume of an aliquot can vary, but will generally be constant within a given experimental run. An aliquot will be less than the volume of the entire reaction mixture. Where there are X aliquots to be withdrawn during an amplification regimen, the volume of an aliquot will be less than or equal to 1/X times the reaction volume.

[0045] As used herein, the term "dispense" means dispense, transfer, withdraw, extrude.

[0046] As used herein, the term "reaction chamber" refers to a fluid chamber for locating reactants undergoing or about to undergo a reaction (e.g., an amplification reaction or an extraction process). A "reaction chamber" can be comprised of any suitable material that exhibits minimal non-specific adsorptivity or is treated to exhibit

minimal non-specific adsorptivity, for example, including, but not limited to, glass, plastic, nylon, ceramic, or combinations thereof.

[0047] As used herein, the term "amplified product" refers to polynucleotides which are copies of all or a segment of a particular polynucleotide sequence and/or its complementary sequence, which correspond in nucleotide sequence to a template polynucleotide sequence and its complementary sequence. An "amplified product," according to the methods, can be DNA or RNA, and it can be double- stranded or single-stranded.

[0048] As used herein, the term "distinctly sized amplification product" means an amplification product that is resolvable from amplification products of different sizes. "Different sizes" refers to nucleic acid molecules that differ by at least one nucleotide in length. Generally, distinctly sized amplification products useful according to the methods described herein differ by greater than or equal to more nucleotides than the limit of resolution for the separation process used in a given method. For example, when the limit of resolution of separation is one base, distinctly sized amplification products differ by at least one base in length, but can differ by 2 bases, 5 bases, 10 bases, 20 bases, 50 bases, 100 bases or more. When the limit of resolution is, for example, 10 bases, distinctly sized amplification products will differ by at least 10 bases, but can differ by 11 bases, 15 bases, 20 bases, 30 bases, 50 bases, 100 bases or more.

[0049] The number of genes that could be investigated in a single reaction can be estimated based on the measurable difference of the product size (1-2 bases) and on the separable size of PCR products derived from the probes (up to 300 bases) and can be as high as 300, but is preferably in the range of 10- 30, inclusive.

[0050] As used herein, the terms "synthesis" and "amplification" are used interchangeably to refer to a reaction for generating a copy of a particular polynucleotide sequence or for increasing the copy number or amount of a particular polynucleotide sequence. In the methods herein, amplification by PCR is preferred. For example, polynucleotide amplification can be a process using a polymerase and a pair of oligonucleotide primers for producing any particular polynucleotide sequence, i.e., the target polynucleotide sequence or target polynucleotide, in an amount which is

greater than that initially present. In an alternative embodiment, a single primer can be used. Amplification can be linear or exponential.

[0051] As used herein, a "target polynucleotide" is a polynucleotide sequence whose abundance in a biological sample is to be analyzed. A target polynucleotide can be RNA or DNA, for example, it can be mRNA or cDNA, a coding region of a gene or a portion thereof. A target polynucleotide can be a product of a reverse transcription of any RNA template. A target polynucleotide sequence generally exists as part of a larger "template" sequence; however, in some cases, a target sequence and the template are the same. Although "template sequence" generally refers to the polynucleotide sequence initially present prior to amplification, the products from an amplification reaction can also be used as template sequence in subsequent amplification reactions. A "target polynucleotide" or a "template sequence" can be a normal polynucleotide (e.g., wild type) or a mutant polynucleotide that is or includes a particular sequence.

[0052] As used herein, an "oligonucleotide primer" refers to a polynucleotide molecule (i.e., DNA or RNA) capable of annealing to a polynucleotide template and providing a 3' end to produce an extension product which is complementary to the polynucleotide template. The conditions for initiation and extension usually include the presence of four different deoxyribonucleoside triphosphates and a polymerization- inducing agent such as DNA polymerase or reverse transcriptase, in a suitable buffer ("buffer" includes substituents which are cofactors, or which affect pH, ionic strength, etc.) and at a suitable temperature. The primer can be single- or double- stranded. The primer is single- stranded for maximum efficiency in amplification, and the primer and its complement form a double-stranded polynucleotide. But it can be double- stranded. "Primers" in specific embodiments of the methods described are less than or equal to 100 nucleotides in length, e.g., less than or equal to 90, or 80, or 70, or 60, or 50, or 40, or 30, or 20, or 15, or equal to 10 nucleotides in length.

[0053] As used herein, "detectable label" refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) signal, and which can be operatively linked to a polynucleotide. Labels can provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray detraction or absorption, magnetism, enzymatic activity, mass spectrometry, binding affinity, hybridization, radiofrequency, nanocrystals and the like. A primer can be labeled so that the amplification reaction product can be "detected" by "detecting" the detectable label.

"Qualitative or quantitative" detection refers to visual or automated assessments based upon the magnitude (strength) or number of signals generated by the label. A labeled polynucleotide (e.g., an oligonucleotide primer) according to the methods herein is labeled at the 5' end, the 3' end, or both ends, or internally. The label can be "direct", e.g., a dye, or indirect, e.g., biotin, digoxin, alkaline phosphatase (AP), horse radish peroxidase (HRP). For detection of "indirect labels" it is necessary to add additional components such as labeled antibodies, or enzymes substrates to visualize the, captured, released, labeled polynucleotide fragment. In a preferred embodiment, an oligonucleotide primer is labeled with a fluorescent label. Suitable fluorescent labels include fluorochromes such as rhodamine and derivatives (such as Texas Red), fluorescein and derivatives (such as 5-bromomethyl and fluorescein), Lucifer Yellow, IAEDANS, 7-Me ₂ N-coumarin-4-acetate, 7-OH-4-CH ₃ -coumarin-3-acetate, 7-NH2-4- CH3-3-acetate (AMCA), monobromobimane, pyrene trisulfonates, such as Cascade Blue, and monobromorimethyl-ammoniobimane (see for example, DeLuca, Immunofluorescence Analysis, In Antibody As A Tool, Marchalonis et al., eds., John Wiley & Sons Ltd., (1982) which is incorporated herein by reference).

[0054] As used herein, a "polynucleotide" generally refers to any polyribonucleotide or poly-deoxyribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotides" include, without limitation, single- and double- stranded polynucleotides. As used herein, the term "polynucleotide(s)" also includes DNAs or RNAs as described above, that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides". The term "polynucleotides" as it is used herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including for example, simple and complex cells. A polynucleotide useful for the methods herein can be an isolated or purified polynucleotide or it can be an amplified polynucleotide in an amplification reaction.

[0055] As used herein, "isolated" or "purified" when used in reference to a polynucleotide means that a naturally occurring sequence has been dispensed from its normal cellular (e.g., chromosomal) environment or is synthesized in a non-natural environment (e.g., artificially synthesized). Thus, an "isolated" or "purified" sequence can be in a cell-free solution or placed in a different cellular environment. The term

"purified" does not imply that the sequence is the only nucleotide sequence present, but that it is essentially free (about 90-95%, up to 99-100% pure) of non-nucleotide or polynucleotide material naturally associated with it, and thus is distinguished from isolated chromosomes.

[0056] As used herein, the term "cDNA" refers to complementary or copy polynucleotide produced from an RNA template by the action of RNA-dependent DNA polymerase (e.g., reverse transcriptase). A "cDNA clone" refers to a duplex DNA sequence complementary to an RNA molecule of interest, carried in a cloning vector.

[0057] As used herein, "genomic DNA" refers to chromosomal DNA, as opposed to complementary DNA copied from an RNA transcript. "Genomic DNA", as used herein, can be all of the DNA present in a single cell, or can be a portion of the DNA in a single cell.

[0058] As used herein, the term "expression profile" or "amplification profile" refers to a representation of the quantitative (i.e., abundance) and qualitative expression of one or more genes in a sample. Preferably the amplification profile describes the activity of multiple (i.e., at least 3, preferably at least 5, 10, 15, 20, 30, 50, 100, 200, 500, 1000, 10,000 or more) genes or transcription units in a sample. A amplification profile for a biological sample can be assembled from the nucleic acid amplification profiles from one or more amplification regimens.

[0059] As used herein, the term "comparing the amplification profile" refers to comparing the differential expression of one or more polynucleotides in two or more samples. Comparison can be between the overall pattern of expression, including the presence, absence and/or abundance of individual amplicons or sets of amplicons. Comparison can be manual or automated.

[0060] As used herein, the term "abundance" refers to the amount (e.g., measured in μg, μmol or copy number) of a target polynucleotide in a sample. The "abundance" of a polynucleotide can be measured by methods well known in the art (e.g., by UV absorption, by comparing band intensity on a gel with a reference of known length and amount), for example, as described in Basic Methods in Molecular Biology, (1986, Davis et al., Elsevier, N. Y.); and Current Protocols in Molecular Biology (1997, Ausubel et al., John Wiley & Sons, Inc.). One way of measuring the abundance of a polynucleotide in the methods herein is to measure the fluorescence

intensity emitted by such polynucleotide, and compare it with the fluorescence intensity emitted by a reference polynucleotide, i.e., a polynucleotide with a known amount.

[0061] As used herein, the term "sampling device" refers to a mechanism that withdraws or extrudes an aliquot from an amplification during the amplification regimen. Sampling devices in the embodiments herein are adapted to minimize contamination of the amplification reaction(s), by, for example, using pipeting tips or needles that are either disposed of after a single sample is withdrawn, or by incorporating one or more steps of washing the needle or tip after each sample is withdrawn. Alternatively, the sampling device can contact the capillary to be used for capillary electrophoresis directly with the amplification reaction in order to load an aliquot into the capillary. Alternatively, the sample device can include a fluidic line (e.g. a tube) connected to a controllable valve which will open at a particular cycle or point in the amplification regimen. Sampling devices known in the art include, for example, the multipurpose Robbins Scientific Hydra 96 pipettor, which is adapted to sampling to or from 96 well plates. This and others can be readily adapted for use according to the methods disclosed herein.

[0062] As used herein, the term "amplification regimen" means a process of specifically amplifying the abundance of a nucleic acid sequence of interest. Amplification regimens are most often "cyclic," i.e., they are comprised of repeated steps of primer annealing and polymerization, usually in conjunction with repeated steps of thermal denaturation of template nucleic acids. A cyclic amplification regimen will preferably comprise at least two, and preferably at least 5, 10, 15, 20, 25, 30, 35 or more iterative cycles of thermal denaturation, oligonucleotide primer annealing to template molecules, and nucleic acid polymerase extension of the annealed primers. Conditions and times necessary for each of these steps are well known in the art. Amplification achieved using an amplification regimen is preferably exponential, but can alternatively be linear. Other amplification regimens are non-cyclic, or continuous. Non-cyclic amplifications proceed to completion once initiated, and most often involve templates with RNA polymerase recognition sites and the action of RNA polymerase and reverse transcriptase.

[0063] As used herein, the phrase "dispensing an aliquot from the reaction mixture at plural stages" refers to the withdrawal or extrusion of an aliquot at least twice, and preferably at least 3, 4, 5, 10, 15, 20, 30 or more times during an

amplification regimen. A "stage" will refer to a point after a given number of cycles, or, where the amplification regimen is non-cyclic, will refer to a selected time after the initiation of the regimen.

[0064] As used herein, the term "extrude" means that an aliquot is forced out of one end or orifice of a reaction vessel by pressure, e.g., air pressure, applied on another end or orifice of the vessel.

[0065] As used herein, the term "quantitative information regarding the abundance of a nucleic acid species" refers to information about the amount of a nucleic acid species. The quantitative information can be relative (e.g., fold difference over the amount of that nucleic acid in another sample), or absolute.

[0066] As used herein, the term "thermal cycled amplification regimen" refers to an amplification regimen comprising a plurality of cycles of thermal denaturation, primer annealing and primer extension or polymerization.

[0067] As understood herein, a segment "at the end" or "at an end" of, for example, a circular probe is understood to mean a string of at least two nucleotides that extend to the most 5' nucleotide or the most 3' nucleotide of the probe. As used herein, "at the terminus" or "at a terminus" as in, at the terminus of the probe is understood to refer to the most 5' or the most 3' nucleotide of the probe.

[0068] As used herein, "adjacent" means arranged on the same linear nucleic acid molecule with a separation of no more than about 50 nucleotides, for example the probe anneals to two segments of a single target sequence wherein the two segments are no more than about 50 nucleotides apart on the target sequence. As used herein, adjacent segments can also be "contiguous", which is understood as being in actual contact with each other, or connected through an unbroken sequence. As used herein, "juxtaposed ends" are understood to be at least partially annealed to adjacent segments of the target sequence, and oriented such that the ends, if fully annealed to the target sequence, would be a substrate for ligase. For example, the ends of the probe are juxtaposed in Figure 1.

[0069] As used herein, a "substrate for ligase" is understood herein to be a double stranded nucleic acid wherein both strands are DNA molecules or one of the strands is a DNA molecule and the other strand is an RNA molecule, having a break in the backbone of at least one strand, without missing any nucleotides and being fully hybridized to the complementary strand at the site of the break, wherein the ends of the

strands at the point of the break include a 3' hydroxyl and a 5' phosphate respectively such that a ligase enzyme can catalyze the joining of the strands. Ligases can be thermostable or non-thermostable ligases. Non-thermostable ligases can be inactivated by exposure to elevated temperature, for example, the denaturing step of a polymerase chain reaction.

[0070] As used herein, a "substrate for polymerase" is understood herein to be a single stranded nucleic acid, preferably DNA, with a portion of double stranded sequence wherein the 3' end of the first strand of the double stranded portion is fully complementary to the sequence to which is annealed, and the second strand extends beyond the 3' end of the first strand in the direction in which the 3' end would extend. The 3' end further includes a 3 '-hydroxyl group to allow for extension of the 3' end. [0071] As used herein, a "non-nucleic acid element" is understood to be a chemical entity or component that can be incorporated into a nucleotide chain that is not a nucleotide or nucleotide analog. Such groups include, but are not limited to an aliphatic carbon chain, polyethyleneoxide, peptide, carbohydrate, and amine linker. [0072] As used herein, "nucleotide analog" is understood herein to mean a compound capable of base pairing to a complementary nucleic acid in a specific manner wherein the heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid. A "high affinity nucleotide" or "high affinity nucleotide analog" is a nucleotide analog with a higher T _m than that of the corresponding natural nucleotide (i.e., at least 5% higher). Such nucleotide analogs are well known in the method of nucleic acid therapeutics. Some nucleotide analogs can be incorporated into a nucleic acid using chemical synthesis methods well known to those skilled in the art. For example, in Locked Nucleic Acids (LNAs) the 2'-hydroxyl group is linked to the 4' carbon atom of the sugar ring thereby forming a 2'-C,4'-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. LNA and LNA analogs display very high duplex thermal stabilities with complementary DNA and RNA (T _m =+3 to +10 C), stability towards 3'-exonucleolytic degradation and good solubility properties (see, e.g., US Patent No 7,060,809). Other preferred sugar substituent groups include methoxy, aminopropoxy, allyl, — O-allyl, and fluoro (see, e.g., US Patents 5,519,134; 5,627,053; and 5,670,633. [0073] Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a sequence of 1 to 50 nucleotides in length is understood to include nucleotide sequences of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,

15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,

38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides.

[0074] Unless specifically stated or obvious from context, as used herein, the term "or " is understood to be inclusive.

[0075] Unless specifically stated or obvious from context, as used herein, the terms "a" and "the" are understood to be singular or plural.

Detailed Description

[0076] The methods described herein provide a specific, sensitive, and quantitative method for target sequence detection, including SNP detection, and gene expression analysis by the use of the methods herein for quantitatively monitoring and analyzing the amplification of polynucleotides by PCR. Disclosed herein are methods for the detection and quantification of one or more target sequences in a single amplification reaction mixture. In the methods, the plurality of target sequences, for example, can include a first probe corresponding to a wild-type sequence and a second probe corresponding to a known mutant target sequence that includes a single point mutation or polymorphism. The target sequence can also include multiple mutations. The methods can include the detection and quantitation of at least one unknown target in a single amplification mixture. In addition, the ligation reaction can also include a reference target sequence provided at a known quantity to be used for the quantification of the target sequence(s) present in unknown quantity. [0077] The methods herein rely on the generation of different sized amplification products from closed circular probes that are formed by ligase upon annealing of the terminal nucleotides of the circular probe to the corresponding target sequence, including a SNP sequence. Variable regions are designed such that the total length of the PCR product from amplification of the closed circular probe template (total number of nucleotides of each of the two PCR primers plus the length of the closed circular probe between the two PCR primer binding sites, is distinct for the probes directed to each target sequence to be detected. If a target sequence is present, annealing of the circular probe to the target sequence juxtaposes the two ends of the circular probe, making the ends substrates for ligase. In some embodiments, the 3' and 5' segments of the probe do not anneal to adjacent sites on the target sequence, requiring contacting the annealed circular probe-target sequence complex with a polymerase prior to treatment with ligase. If an extension step is to be used on a

circular probe comprised of unmodified nucleotides, the polymerase does not contain proofreading or strand displacement activity. If an extension step is to be used on a circular probe comprised of modified nucleotides resistant to exonuclease activity (e.g., phosphorothioate nucleotides) at the end of the probe, a polymerase with proofreading activity can be used. Such a probe design can be preferred, for example, for detection of target sequences with repetitive portions. Such a design can provide an additional level of specificity to the methods by use of a polymerase that is more sensitive to mismatches at the termini of the circular probe than a ligase. The closing of the circular probe generates a template for amplification by PCR. By monitoring the amount of amplification product produced, the amount of template present in the original reaction mixture can be determined.

[0078] A basic PCR amplification can be broken down into three phases: (1) exponential phase: exact doubling of product is accumulated at every cycle, assuming 100% reaction efficiency. The reaction is very specific and precise; (2) Linear (high variability) phase: the reaction components are being consumed, the reaction is slowing and the products are starting to degrade; (3) plateau (end-point) phase: the reaction has stopped, no more products are being made and if left long enough, the PCR products will begin to degrade. A problem with detection in the plateau phase of PCR is that the quantitation is affected so as to no longer reflect the amount of the starting nucleic acid template.

[0079] "Real-time PCR" analysis detects specific nucleic acid amplification products as they accumulate in real-time. Real-time PCR provides advantages over traditional end-point PCR by allowing for the detection of PCR amplification during the early phases of the reaction.

[0080] Quantification according to the current invention can be performed by one of the following methods. Quantification relative to the known amount of the reference sequence can be performed by introducing known amount of reference target sequence (DNA or RNA) in the ligation reaction, providing a corresponding probe for the reference sequence and performing ligation and PCR amplification simultaneously for target sequences and reference target sequences. Preferably, the PCR primers used for amplification of the reference and target probes are the same. In one embodiment nucleotide at the very 3 '-end of the probe is the same for reference and target probes to account for possible different ligation efficiency of the probes terminating with

different nucleotides. At the end of PCR amplification the reaction mixture is analyzed by capillary electrophoresis and the amount of the amplified PCR products are detected. The ratio of the amplified PCR products defined as ratio of corresponding peaks areas or heights is used to calculate the starting amount of the unknown target sequence. This approach is applicable if the amounts of the target and reference nucleic acids differ no more than about 100 fold.

[0081] For some applications it is preferred to use endogenous nucleic acid present in the sample as a reference in quantification instead of exogenously added nucleic acid. For example, the amount of mutant BCR/ AbI can be measured in reference to the amount of unmutated, wild type BCR/ AbI. In this approach, a probe or probes to endogenous nucleic acid/s are included in the ligation reaction. The probe for the reference sequence is selected to hybridize to a different sequence in the same target gene, or to target a different gene in the sample. The probe for reference target sequence preferably contains sequences for PCR primers identical to the PCR primers for amplification of the target sequence. At the end of PCR amplification the reaction mixture is analyzed preferably by capillary electrophoresis and the quantity of the amplified PCR products corresponding to unknown target and reference target sequences are determined. The ratio of the amplified PCR products defined as ratio of corresponding peaks areas or heights are used to calculate the starting amount of the target sequence. This approach is applicable if the relative amounts of the target and reference nucleic acids differ no more than about 100 fold.

[0082] The methods described above can be used for quantitative genotyping as well as for gene expression analysis. The RNA targets can be measured in ligation reactions using DNA ligases including, but not limited to, for example, T4 DNA ligase.

[0083] In the case when this difference in the relative amounts of target sequence and reference target sequence is greater than about 100 fold, the end point quantification accuracy is decreased. In a preferred embodiment, quantification is preferably performed by dispensing aliquots one or more times during the amplification reaction for determination of the threshold cycle (Ct). The method for determination is discussed below.

[0084] Nucleic acid amplification profiling involves the measurement of amplification products present at various stages during an amplification regimen (see

US Patent Application Publication No. 2004/0166513, incorporated herein by reference). Because it can identify the limits of the exponential, linear, and plateau phases of an amplification reaction, knowledge of the abundance of amplification product at various stages of the amplification process permits one to reliably extrapolate the abundance of the original template in a biological sample. While an amplification profile of a single nucleic acid template or a small set of such templates can be generated through use of the TaqMan™ or "molecular beacons "-type real time approaches, these methods are rather limited in the number of targets that can be followed in a single reaction. A major limitation is that each different species must be labeled with a differentially detectable fluorophore.

[0085] U.S. Patent 7,081,339 describes a real-time PCR method using capillary electrophoresis for analysis (the entirety of which is incorporated herein by reference). The Patent provides a method for monitoring the amplification of a nucleic acid sequence of interest using a plurality of linear templates; however, the analysis and detection principle is the same. The method comprises performing at least three cycles of a PCR reaction wherein at least one of the pair of primers for each product to be detected contains a detectable label; removing an aliquot of the amplification mixture; separating nucleic acid molecules in the aliquot; and detecting incorporation of the at least one detectable marker into a product, wherein the removing is performed during the cycling regimen, and wherein the detection permits the monitoring of the amplification (i.e., generation of products) in real time. Data analysis, including standard curve generation and copy number calculation, can be performed automatically.

[0086] The sampling methods used preferably include withdrawal of an aliquot of the amplification mixture multiple times throughout the amplification reaction, preferably at regular intervals, such as after each cycle of amplification (e.g., denaturing, annealing, extension). By withdrawing or extruding samples of the reaction mixture at various cycles of the amplification regimen, and detecting the size and amount of various amplified species present, the amount of numerous amplified products can be monitored at each phase of the amplification, thereby identifying the limits of the exponential, linear, and plateau phases for a target sequence in a reaction mixture.

[0087] The sampling procedures can be optimally applied to amplification methods that permit the multiplex amplification of greater numbers of target sequences in a single reaction vessel. By highlighting the exponential phase for the amplification of each different template species present in a biological sample, this approach permits the accurate extrapolation of the amounts of numerous templates present in a biological sample. Thus, the sampling method alone, or particularly in combination with methods that increase the multiplex ability of amplification reactions, provides a dramatic increase in the amount of quantitative template information one can obtain from a single amplification reaction. Moreover, by detection of product at earlier cycles when less product is present, resolution of the detection method is increased, allowing the method to be performed using a single detectable label rather than requiring multiple detectable labels.

[0088] In the practice of cyclic nucleic acid amplification, the experimentally defined parameter "C " refers to the cycle number at which the signal generated from a quantitative amplification reaction first rises above a "threshold", i.e., where there is the first reliable detection of amplification of a target nucleic acid sequence. "Reliable" means that the signal reflects a detectable level of amplified product during amplification. C _t generally correlates with starting quantity of an unknown amount of a target nucleic acid, i.e., lower amounts of target result in later C _t . C _t is linked to the initial copy number or concentration of starting nucleic acid by a simple mathematical equation:

Log(copy number)= aC _t + b, where a and b are constants.

[0089] Therefore, by measuring Ct for the products amplified from two different closed circular probes, the original relative concentration of this closed circular probes in these samples can be easily evaluated.

Sampling Methods and Devices

[0090] The methods described herein teach the sampling of nucleic acid amplification reaction mixtures for quantitative target sequence detection, preferably multiplex SNP detection, using amplification profiles. Sampling can occur at any time during or after an amplification reaction. In an embodiment, an aliquot of the reaction is

withdrawn or extruded from the tube or reaction vessel at the end of each PCR cycle. In an embodiment, an aliquot of the reaction is withdrawn or extruded from the tube or reaction vessel at the end of every several PCR cycle, e.g., every two cycles, every three cycles, every four cycles. In an embodiment, an aliquot of the reaction is withdrawn or extruded from the tube or reaction vessel at the end of a series of predetermined cycles. While a uniform sample interval will most often be desired, there is no requirement that sampling be performed at uniform intervals. As just one example, the sampling routine can involve sampling after every cycle for the first five cycles, and then sampling after every other cycle.

[0091] Sampling or dispensing of an aliquot from an amplification reaction can be performed in any of several different general formats. The sampling or removal method can depend on any of a number of factors including, but not limited to, the equipment available, the number of samples to be analyzed, and the timing of detection relative to sample collection (e.g., concurrently vs. sequential). The exact method of removal or extrusion of samples is not a limitation of the methods of the invention. Sampling is preferably performed with an automated device, especially for high throughput applications. Sampling can also be performed using direct electrokinetic or hydrodynamic injection from PCR reaction into a capillary electrophoretic device. The method of sampling used in the methods are preferably adapted to minimize contamination of the cycling reaction(s), by, for example, using pipetting tips or needles that are either disposed of after a single aliquot is withdrawn, or by using the same tip or needle for dispensing the sample from the same PCR reaction vessel. Methods for simultaneous sampling and detection are well known to those skilled in the art (see, e.g., US Patent Application Publication 2004/0166513, incorporated herein by reference).

[0092] The volume of an aliquot dispensed at the sampling step can vary, depending, for example, upon the total volume of the amplification reaction, the sensitivity of product detection, and the type of separation used. Amplification volumes can vary from several microliters to several hundred microliters (e.g., 5 μl, 10 μl, 20 μl, 40μl, 60 μl, 80 μl, 100 μl, 120 μl, 150 μl, or 200 μl or more), preferably in the range of 10-150 μl, more preferably in the range of 10-100 μl. The exact volume of the amplification reaction is not a limitation of the invention. Aliquot volumes can vary from 0.01% to 30% of the reaction mixture. The volume of the aliquots dispensed from

the amplification is not a limitation of the invention. The amplification regimen can be performed on plural independent nucleic acid amplification mixtures, optionally in a multiwell container. The container(s) in which the amplification reaction(s) are preformed is not a limitation of the invention.

[0093] The nucleic acids in the aliquots are separated, e.g., by size and/or charge, and the separated species are detected to allow for quantitation, thereby generating an amplification profile. Whereas the non-linearity of amplification at late stages of the amplification process normally precludes the ability to accurately quantitate the amount of a given product in a nucleic acid sample by measuring amplicon abundance after multiple cycles, the amplification profile generated using a sampling method provides quantitative as well as qualitative data that do permit such determination. The detection of target sequence abundance at various cycles during the amplification provides a real time representation of the amplification for each species amplified and detected in a given reaction. Because non-linearity in the amplification process can be accounted for in such a real time profile, the profile permits the efficient quantitative determination of the amount of target sequence in an original sample. This is but one example of the advantages provided by a amplification profile generated by such a method.

[0094] Other advantages provided by the real time profiling performed in such a manner include, for example, the ability to follow the amplification profiles for multiple target sequences in a single sample. Because the size separation by, for example, CE, can resolve species differing by as little as one nucleotide, the sample withdrawn from an amplification reaction can have multiple differently sized amplicons, each representing a different transcript in the original sample. Due to the resolution of the separation and detection methods herein, multiple detectable labels are not required and a single detectable label can be used.

Separation and detection methods

[0095] Any of a number of different nucleic acid separation methods can be used in the methods disclosed herein. For example, various adaptations of electrophoresis and liquid chromatography are well suited for separating nucleic acid species in a sample from an amplification reaction.

[0096] Electrophoretic separation is preferably performed as capillary electrophoresis (CE), due to the small sample sizes necessary and the speed and resolution achievable. Another benefit of CE is that there exist a variety of off-the-shelf CE devices that are interfaced with fluorescence detectors, for example, high throughput CE equipment is available commercially, for example, the Reveal Systems fully automated 24-, 96-, and 192-capillary electrophoresis genetic analysis system from Spectrumedix Corporation (State College, PA). Others include the P/ ACE 5000 series from Beckman Instruments Inc (Fullerton, CA) and the ABI PRISM 3130 and 3730 genetic analyzer (Applied Biosystems, Foster City, CA), LabChip® 90 and 3000 Automated Electrophoresis System (Caliper, Hopkinton, MA) and Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). Each of these devices comprises a fluorescence detector that monitors the emission of light by molecules in the sample near the end of the CE column. The standard fluorescence detectors can distinguish numerous different wavelengths of fluorescence emission, providing the ability to detect multiple fluorescently labeled species in a single CE run from an amplification sample.

[0097] CE devices capable of running 96 samples at a time mesh nicely with, for example, thermal cyclers or other amplification devices that run multiple samples simultaneously. CE devices that provide automated sample loading, electrophoresis and detection for multiple samples in parallel are described in U.S. Pat. Nos. 6,217,731 and 6,001,230. As an alternative to fluorescence detection, a CE device can be interfaced with a mass spectrometry device for detection of the various nucleic acid species in an amplification reaction by molecular mass (CE/MS). Mass spectrometry devices capable of such detection are commercially available.

[0098] Liquid chromatography (LC) is another option for the separation of nucleic acids in samples withdrawn or extruded from an amplification reaction. Commonly, LC is coupled with mass spectrometry (LC/MS), such that the mass of HPLC- separated species is determined by mass spectrometry. LC/MS systems are commercially available, for example, from Agilent Technologies (e.g., the 1100 Series ™ LC/MS) and from Applied Biosystems (e.g., the API 3000™ or API 4000™ LC/MS systems), among others.

Circular nucleic acid probe design

[0099] The methods described herein include the use of nucleic acid probes such as those depicted in Figures 1 and 2. The nucleic acid probes need not be composed exclusively of nucleotides. The probes can include nucleotide and non- nucleotide analogs, chemical linkages, and other chemical modifications that do not interfere with the function of the probe (e.g., binding to the target sequence, ligase substrate, polymerase template). The probes include two segments, one at each of the 5' end and the 3' end of the probe, which are complementary to adjacent segments of the target sequence. These complementary segments extend to the first and last nucleotides of the probe, respectively. In a preferred embodiment, the melting temperature (T _m ) of each complementary probe segment with its complementary target sequence segment is about the same, varying no more than about 10 ⁰ C, 8°C, 6°C, 4°C, or 2°C. In a preferred embodiment, a thermostable ligase is used. Therefore, the T _m of the complementary probe segments for their target sequences must be sufficiently high to prevent melting of the probe-target sequence complex during the ligation step. As probe targeting is dependent upon the location of SNPs rather than by design, the length of the complementary segments of the probe can vary, within and between the probes.

[00100] In a preferred embodiment, the T _m s of each half -probe (the complementary segment at the 5' end of the probe and the complementary segment at the 3' end of the probe) are similar to the temperature used for annealing and ligation, varying by no more than about 8°C, for example, by no more than 6°C, 4°C or 2°C. Preferably, the T _m s of each half probe could be higher or lower than the temperature of annealing and ligation, within the defined limits (+/- 8°C).

[00101] In a further preferred embodiment, the temperature for annealing and ligation is equal to or greater than 52°C in order to minimize interference with hybridization to targets caused by internal secondary structure in the probe molecule.

[00102] Probes must be a sufficient length such that circularization of the probe is not limited by steric hindrance or structural strain. It is understood that the probes useful in the methods described herein include appropriate groups at the termini (e.g., 5 '-phosphate and 3'-hydroxyl) to allow for the ends to be a substrate for ligase and/or polymerase. Methods for addition of these chemical groups is well known to those skilled in the art. In an embodiment, the probe is at least about 50 nucleotides in length up to about 150 nucleotides in length. This probe length can be synthesized using

standard synthesis methods well known to those skilled in the art or obtained commercially (e.g Integrated DNA Technologies). Longer probes can also be used, up to 300 nucleotides in length. However, probes of such length are typically made in parts and joined afterwards by chemical linkage or ligation. Probes substantially less than 300 nucleotides in length can also be made in this manner. In an embodiment, the parts of the probe can be joined between the two PCR primer binding sites with a polymerization terminator (e.g., non-nucleotide portion).

[00103] Representative examples of circular probes 1 are shown in Figures 1 and

2. The relative lengths of the segments of the probe are not drawn to scale, and can vary relative to each other within the scope of the invention. The probes include a first target binding segment 3 and second target binding segment 5 at the 5' end 7 and 3' end 9 of the probe, respectively, for binding to a first target sequence 11 and a second target sequence 13 of a nucleic acid. In Figure 1, the probe is shown annealed to a target sequence wherein the most terminal 3' nucleotide of the probe 15 is paired with an adenine base (A) 17 in the target sequence, indicated to be a mutant nucleotide in the target sequence. In an embodiment, the site for potential mismatch can be at the first nucleotide at the 5 'end of the circular probe. In Figure 1, there is no gap between the 5' end and 3' end of the circular probe. Therefore, the probe-target sequence complex shown is a substrate for ligase. In Figure 2, a gap 19 of 3 nucleotides is shown between the 3' end 9 and the 5' end 7 of the circular probe. As the 3' end of the circular probe is annealed to the target sequence, the complex is a template for extension by a polymerase. If a polymerase extension step is to be used, it is preferred that the mismatch be at the 3' end of the circular probe. After the gap is filled, the circular probe is closed using ligase. If filling is to be performed using a polymerase and the mismatch is at the 3' end of the probe, the polymerase must lack 3' exonuclease activity to prevent cleavage of a mismatched base. In an embodiment, a polymerase with proofreading activity (e.g., 3' exonuclease activity) is used in combination with a probe containing one or more nuclease resistant (e.g., phosphorothioate) nucleotides at the 3' end. In an embodiment, the polymerase lacks strand displacement activity such that the 5' end of the annealed probe is not displaced during the filling reaction (e.g., Taq polymerase). In an embodiment, the ligase is removed or inactivated prior to the amplification step.

[00104] The circular probe further includes a first variable segment 21 and a second variable segment 23. The sequences of the variable segments are not sufficiently similar to that of the PCR primer binding sites or the target binding segment sequences to interfere with the binding of the PCR primers and target sequences to their specific sites. The variable sequences allow for the generation of amplification products of distinct sizes as exemplified by SNP 1 amplicon 25, SNP 2 amplicon 27, and SNP 3 amplicon 29, shown in each of Figures 1 and 2. Each SNP amplicon is produced from a distinct closed circular probe. In the schematic examples shown, differences in the length of the SNP amplicon are due to differences in length of the variable segments. However, differences in length of amplification products can also be do to differences in length of other segments of the probe and/or amplification primers.

[00105] The circular probe further includes a first PCR primer binding site 31 and complement to a second PCR primer binding site 33, labeled for simplicity as a PCR primer binding site. The length of the PCR primer binding sites and their distance from the target binding segment is a matter of choice. The primer binding sites are oriented such that amplification from the circular probe occurs only if the probe is a closed circle (i.e., towards the original ends of the probe). In an embodiment, the PCR primer binding sites can be joined to each other with no intervening sequence.

[00106] A linker segment 35 is shown between the PCR primer binding sites.

The linker can be comprised of a nucleotide sequence or a non-nucleotide element, such as a chemical linker. In an embodiment, the linker is a spacer region between the two PCR primer binding site so that the circular probe is sufficiently long to be circularized, or to generate probes of similar or identical overall length to compensate for differing lengths of the variable regions. If the linker comprises a nucleotide sequence, the sequence is not sufficiently similar to that of the PCR primer binding sites or the target segment binding sequences to interfere with the binding of the PCR primers and target sequences to their specific sites. The linker segment can alternatively or additionally include a polymerizationterminator to inhibit the generation of concatemers.

[00107] Figure 3 is a schematic of an embodiment of the methods disclosed herein. Figure 3A(I) shows a target sequence-circular probe complex in which the 3' terminal nucleotide of the circular probe is annealed to the target sequence, indicated to

be a mutant sequence. This complex is a substrate for ligase. Figure 3B(I) shows a similar target sequence-circular probe complex in which the 3' terminal nucleotide of the circular probe is not annealed to the target sequence, indicated to be a wild type sequence. This complex is not a substrate for ligase.

[00108] Figure 3A(2) shows a closed circular probe that is a template for amplification by PCR. Primers are shown annealed to the PCR primer binding sites, wherein one of the primers has a detectable label at the 3' end. As shown in Figure 3A(3), the amplification reaction from the closed circular template results in the generation of amplification products having a detectable label.

[00109] Figure 3B(2) shows a circular probe that is not closed. Although the

PCR primers are able to bind, no amplification products of the appropriate size are generated, as shown in Figure 3C(3).

Complementary target binding segments

[00110] The complementary target binding segments of the circular probe are present at each the 5' end and the 3' end of the probe. The complementary sequences extend to the first and last nucleotide of the probe, respectively. The sequence and binding site of the target binding segments is determined by the sequences to be detected; therefore, optimal sequences for probe binding cannot be selected by location. However, the length of the target binding domains can be varied to produce segments with desired T _m s. It is preferred that the T _m s of all target binding segments to be used in a single reaction mixture are about the same, varying no more than about 10 ⁰ C, 8°C, 6°C, 4°C, or 2°C. As the methods disclose herein typically use a thermostable ligase, the T _m of the target binding segment must be sufficiently high to be stable at the ligation temperature. A target binding segment is about 6 to about 30 nucleotides in length, or any length therebetween.

[00111] Complementary target binding segments are typically designed in at least pairs to correspond to the wild-type sequence and the mutated sequence. If multiple mutations are known to be possible at a specific site, more than two target segments are designed to detect potential mutations at a specific site. By detecting both the wild- type sequence and the mutant sequence in the population of target molecules,

the percent of mutant sequences in the pool can be most accurately determined. However, if all of the PCR primer binding sites are identical in all of the circular probes, the number of copies of wild- type and target sequences can be determined by using target probes directed to segments of the target sequence known to not include mutations. Preferably, if such methods are used to determine copy number of the target sequence in the sample, at least two, preferably at least three control probes targeted to sequences not containing mutations are used.

[00112] Depending on the density of the mutations in the target sequence to be analyzed, complementary target segments can be designed to detect multiple mutations near the ends of the probe sequences. Methods for design of such primers is known to those skilled in the art.

[00113] Complementary target segments can be designed to be complementary adjacent, but not necessarily contiguous, segments of the target binding sequence. The complementary target segments can be separated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides or any value therebetween. Complementary target segments can be separated for any of a number of reasons. For example, the segments can be separated to improve specificity of binding of one of the segments in a repeat region. The segments can be separated to identify mutations in target sequences that can include multiple mutations, making the discrimination between mutations difficult by eliminating the need for a sequence that is complementary across the full length of the target. The segments can also be separated to alter the length of the final amplification product generated in the amplification step. The segments can also be separated to increase the stringency of the method for discrimination between annealed and non-annealed nucleotides by selection of a polymerase with high discrimination for non-paired nucleotides. Such considerations are well understood by those skilled in the art.

Variable segments

[00114] The detection methods of provided herein rely on the production of distinctly sized amplification products for each of the target sequences to be detected. This variation in size is controlled predominantly by the length of the variable regions. The variable regions flank the target sequence binding segments and can include

natural or artificial sequences. The sequences of the variable regions are not sufficiently similar to that of the PCR primer binding site sequences or the target binding segment sequences to interfere with the binding of the PCR primers and target binding segments to their specific sites. The amount of similarity required to interfere with binding is dependent upon a number of factors well understood by those skilled in the art including the length of the sequence over which there is complementarity and the temperature at which annealing will be performed, in each of the probe-target sequence annealing step and the PCR primer annealing step.

PCR primer binding sites

[00115] PCR primer binding sites flank some or all of the the variable segments.

The position of the PCR binding sites can be moved relative to the variable segments making the size of the probes the same or approximately the same overall length, but resulting in differentially sized PCR products. In an embodiment, all of the first PCR primer binding sites have a first sequence, and all of the complement sequences of the second PCR primer binding sites have a second and distinct sequence. As used herein, it is understood that the site to which the second PCR primer will bind is the complementary strand of the closed circular probe. For the sake of simplicity, the probe can be referred to as having a first and second PCR primer site. Although shown as a PCR primer site in the Figures, it is understood that amplification by PCR requires two template strands, and the second strand is generated in the first round of amplification from the closed circular template. The use of a single pair of PCR primers for the amplification of all closed circular template target sequences eliminates variability in template primer binding, potentially improving the quantitative aspects of the methods herein. The use of a single primer pair can also reduce the number of control circular probe/ target sequence pairs that need to be analyzed. In such embodiments, all amplification products have a single detectable label; therefore, the products are not distinguished based on the detectable label present.

[00116] In an alternative embodiment, all of the first PCR primer binding sites are not the same and/or all of the second PCR primer binding sites are not the same. Such an embodiment can be preferred when the target sequences to be detected are highly variable making the design of a single pair of PCR primer binding sites less

optimal. Such an embodiment can also be preferred when the use of multiple detectable labels is desired. However, the use of multiple first and/or second PCR primer binding sequences does not require the use of multiple detectable labels.

[00117] Considerations regarding the design of PCR primer binding sites and

PCR primers are well known to those skilled in the art. In a preferred embodiment, the PCR primers for use in a single reaction in the methods herein, all have about the same T _m . In a preferred embodiment, the T _m of the primers differs no more than about 10 ⁰ C, 8 ⁰ C, 6 ⁰ C, 4°C, or 2°C. Methods for determining the T _m for a specific primer-primer binding site pair is well known to those skilled in the art (see, e.g., PCR Protocols, edited by Bartlett and Stirling, Humana Press, 2003).

[00118] In some embodiments, the PCR primer binding sites of the probe can be modified to include high affinity nucleotides or nucleotide analogs. This is most easily accomplished when the circular probes are made by chemical synthesis. However, the methods disclosed herein are not limited by the method of synthesis of the probes or other reagents used in the method. As the methods disclosed herein are typically performed on a complex mixture of nucleic acids, such as total genomic DNA obtained from a biopsy or other biological sample, inclusion of high affinity nucleotides in the probe increases the specificity of primer binding to the probe, possibly increasing the specificity and the quantitative aspects of the methods herein. The use of high affinity nucleotides in the primer binding sites can also allow for the use of shorter PCR primers, less than 20 nucleotides in length, such as 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides in length, depending on the number of high affinity nucleotides in the PCR primer binding site. The use of shorter primers can decrease the generation of non-specific products from non-closed circular probe templates, potentially decreasing background. The use of shorter primers can also allow for the generation of shorter PCR products from the closed circular template by shortening the variable segments and moving the PCR primer sites closer to the segments complementary to the target sequence. Such a combination of probe and primer design can potentially increase the resolution of the methods herein by producing shorter amplification products.

[00119] In one embodiment PCR primers sequences can also include nucleotides from the expanded genetic alphabet, such as isoC and isoG nucleotides, which are not present in natural DNA or RNA. The synthesis and properties of such bases are described in US patents 5,432,272 and 6,001,983, 6,037,120, and 6,140,496.

Incorporation of such non-standard nucleotides in the probe sequence and providing corresponding complementary nucleotidetriphosphates will ensure specific amplification of probe-derived amplicons limiting non-specific PCR amplification even in the very complex background of genomic DNA.

Limiting concatemer generation during amplification

[00120] The use of high affinity nucleotides in the PCR primer sites in conjunction with a low displacement polymerase (e.g., Phusion™ DNA polymerase, DyNAzyme™ EXT DNA polymerase, each available from New England Biolabs, and Taq polymerase) can also abrogate the need for inclusion of a polymerization terminator in the probe. Binding of the PCR primer to a high affinity binding site can further decrease strand displacement by the polymerase, preventing the generation of concatamers from multiple rounds of polymerization around the closed circlar probes.

[00121] The generation of concatamers can also be limited in the absence of a polymerization terminator by the use of PCR primers that include a 5 'non-annealing sequence, about 5 to 10 nucleotides in length, and a polymerase with a 5 'nuclease activity (e.g., Taq) that promotes cleavage of the growing strand by the polymerase upon encountering the 5' non-annealing sequence. The method preferably includes a ligase removal or inactivation step prior to the amplification step.

[00122] The generation of concatamers can also be limited by the use of short extension times, especially during the first few cycles of extension, preferably in conjunction with polymerases having relatively low polymerization rates (e.g., Vent® and Deep Vent® DNA polymerase (New England Biolabs), or P. furiosus DNA polymerase (Stratagene)).

[00123] Concatemer generation can also be limited by inclusion of a polymerization terminator in the probe. A polymerization terminator is a sequence or chemical entity that the polymerase used in the amplification step cannot traverse. For example, a polymerization terminator can include at least one, preferably more than one, nucleotide or nucleotide analogs that cannot be used as a template for polymerization by the polymerase, such as at least one abasic sites, or at least one ribonucleotide, or at least one modified base blocking polymerization, such as

ethenoadenosine, 3-methyl cytosine, 5 -amino-thymidine. The polymerization terminator can include a restriction enzyme cleavage site that is cleaved after the ligation step and removal of the ligase, but prior to the amplification step of the methods herein. In an embodiment, a polymerization terminator is a non-nucleotide element of the probe. Such a component can be incorporated into the probe by a chemical linkage of each of two halves of the circular probe to the non-nucleotide element. Such non-nucleotide elements can include aliphatic carbon chain, polyethyleneoxide, peptides, carbohydrates. A convenient method for synthesis of such probes includes synthesis of separate oligonucleotides encoding two halfs of probe, such oligonucleotides incorporating a linkable group at the 3'- and 5'- end . For example, one oligonucleotide incorporates 5'-aminogroup and another oligonucleotide incorporates thiol group at the 3 '-end (the same nucleotide can carry a phosphate at the 5'-end). Two half of the probes can be joined together by reaction with heterobifunctional crosslinkers such as MBS (m-Maleimidobenzoyl-N- hydroxysuccinimide ester), Sulfo-SMCC (Sulfosuccinimidyl 4-[N- maleimidomethyl] cyclohexane- 1 -carboxylate) , LC-SMCC (Succinimidyl-4- [N- Maleimidomethyl] cyclohexane- 1 -carboxy- [6-amidocaproate] ), Sulfo-KMUS (N- [k- Maleimidoundecanoyloxy]sulfosuccinimide ester), Sulfo-SIAB (N- Sulfosuccinimidyl[4-iodoacetyl]aminobenzoate), NHS-PE08-Maleimide (all reagents from Pierce Biotechnology (Rockford, IL)) or similar molecular structures. In another embodiment, amino-group is incorporated into the 3 '-end and thiol group incorporated at the 5 '-end of corresponding oligonucleotide. Such or similar approach can be used to join two oligonucleotides each upto 150 bases to generate ligatable probes with a length up to 300 bases.

[00124] The methods to limit concatemer generation can be used alone or in conjunction with each other within the methods of the invention.

Permitting concatemer generation during amplification

In one embodiment concatemer generation can be used to increase sensitivity of the assay, since multiple copies of the PCR amplicon will be created in one PCR cycle. Preferably, the condition of PCR amplification in the presence of thermostable strand- displacing DNA polymerase can be adjusted in a way to generate concatemers during

early PCR cycles, therefore creating more than 2 copies of PCR amplicon per cycle. At the later cycles, concatemer formation can be limited by shortening of the extension step of PCR reaction resulting in preferential amplification of short amplicons, preferably momomeric amplicons which can be accurately separated and quantified during the capillary electrophoresis separation step. This approach can result in significant increase in the of amplified products for a given PCR cycle, as well as potential decrease in the number of PCR cycles required for generation of the detectable product. For example, if during the extention step of PCR reaction polymerase creates a PCR product containing 6 PCR amplicons, by the cycles 6 there will be more than 1100 PCR amplicons (monomeric amplicons in both monomer and concatemer form) comparing with 32 amplicons in conventional PCR reaction, which corresponds in potential shortening of PCR amplification by 5 cycles.

Use of ligation-dependent amplification for quantification of RNAs and mixtures of DNAs and RNAs.

[00123] The probe design for quantification of RNAs and mixtures of DNAs and

RNAs follows the same rules as outlined above. To normalize for efficiency of ligation and PCR amplification, additional control RNAs are included in the reaction mixture at known concentration and are subjected to the same procedures as target RNAs. The probes for control RNAs preferably include the same sequences for PCR amplification as probes designed for the target RNAs, but also could comprise different sequences which amplified with the same amplification efficiency (+/- 0.1) and have the same melting temperatures (e.g., +/- 0.5 degree) as primers for amplification of the target probes. It is also preferred that probes designed for target and control sequences have the same nucleotide at the ligation site to minimize variation of the ligation efficiency. DNA ligases, such as T4 DNA ligase, known to conduct ligation of DNA probe on an RNA template, can be used for target- specific probe ligation.

[00124] RNA and DNA targets can also be quantified simultaneously in the same reaction using ligation-dependent amplification. In one embodiment the ligation is performed using a mixture of ATP-dependent ligase (for example T4 DNA ligase) for probes directed to RNA targets and NAD-dependent thermostable ligase for probes directed to DNA targets (such as Taq, Tth or similar- ligase). First, the nucleic acid

sample is hybridized to the probes without heat denaturation of the sample (under temperature conditions when DNA remains in double- stranded form and thus inactive for probe binding), therefore favoring ligation of the RNA-directed targets. Then the sample is subjected to heat denaturation at 80-100 C which will inactivate ATP- dependent ligase and also will allow probes to hybridize to single stranded DNA. This will result in the ligation of DNA-directed probes with NAD-dependent ligase which are known to prohibit ligation of DNA probe on RNA template. Appropriate quantification (normalization) controls can be provided in the reaction in RNA or DNA form corresponding to selected targets.

Example 1 : Monitoring of SNP variation over time in a subject undergoing treatment with a kinase inhibitor

[00125] A subject is diagnosed with CML due to a translocation of the

Philadelphia chromosome resulting in the generation of Bcr-Abl. White blood cells are collected and total RNA is prepared from the cells using routine methods, e.g., using Quagene RNAEasy RNA extraction kit according to the manufacturer's instructions. BCR/ AbI fusion transcript is amplified in the RT-PCR reaction. Reverse transcription is performed using random hexamer primers in a reaction mixture containing final concentrations: 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl ₂ , 0.01M DTT, 0.8 mM dNTP, 0.2 mg/ml BSA, 20% trehalose. 3 U/μl of Superscript II RNase H-Reverse Transcriptase (SSRTII; Invitrogen) and 1 U/μl of RNAsin (Ambion) are added and reverse transcribed at 37 degree C for 30 min. PCR amplification is performed using primers: 5'- CCACAGCATTCCGCTGACCATCAA (forward primer for BCR sequence) and 5'- CTACCTTC ACCAAGTGGTTCTCC (reverse primer for AbI sequence) in the presence of 0.5 μM primers and in 10 mM KCl, 10 mM (NtIO ₂ SO ₄ , 20 mM Tris-HCl (pH 8.8), 2 mM MgSO ₄ , 0.1% Triton X-100, 0.2 mM dNTPs, 2 U Vent™ DNA polymerase. PCR amplification is conducted for 15-30 cycles of 15 s at 95°C, 30 s at 57°C and 1.5 min at 70 ⁰ C. Amplified DNA is diluted and interrogated with probes prepared to detect the following mutations in the nucleic acid sequence of Bcr-Abl:G250E 5'- CGCCCAGCTTGTGCTTTGACATTACCGACTATCGGTCAACGATAXXTTCCGC

GTAAACAACCGTAATTAGGTCCCCGTACTGGCCCT-S' (SEQ ID NO: 7); E255K

5' -

CCCCGTACTGGCCCATATGACATTACCGACTATCGGTCAACGAATXXTTCC

GCGTAAACAACCGTAATTAGGAATACGCCCTCGTACACCT-S '(SEQ ID NO:

8); T315I 5'-

TGAGTTCATGACCTACATCAATGACATTACCGACTATCGGTCAACGAATAA

XXTTTCCGCGTAAACAACCGTAATTAGGAATCACGTTCTATATCATCAT-

3'(SEQ ID NO: 9); F317L 5'-

ATGACCTACGGGAACCATCATTCATGACATTACCGACTATCGGTCAACGAA

TAAXXTTTCCGCGTAAACAACCGTAATTAGGTCAATCAATATCATCACTGA

GTTG-3'(SEQ ID NO: 10); M351T 5'-

GGAGTACCTGGAGAAGATCATATGCATGACATTACCGACTATCGG

TCAACGAATAAXXTTTCCGCGTAAACAACCGTAATTAGGTCATTCGATCAA

GATCTCGTCAGCCAC-3'(SEQ ID NO: 11); and wild type (WT BCR/ABL) 5'-

CCCAACTACGACAA

GTGATCATGATGTTCCTGACATTACCGACTATCGGTCAACGAATAAXXTTTC

CGCGTAAACAACCGTAATTAGGTCATCTAACGATCACTGTCTATGGTGTGTC

C-3'(SEQ ID NO: 12); where X= abasic nucleotide.

[00126] Briefly, the probes at 20 pM final concentration are combined with amplified BCR/Abl DNA in a Buffer containing 20 mM Tris-HCl, pH 8.0 at room temperature, 2 mM MgCl ₂ , 100 mM KCl, 10 mM dithiothreitol, 1 mM NAD+ and 20 μg/ml BSA, 2 U of DNA Ligase (Taq or Tth DNa ligase) and incubated for 15 min at 60 C. The reaction mixture is supplemented with PCR primers ULP 28 (5'- CGTTGACCGATAGTCGG TAATGTCA-3'(SEQ ID NO: 13)) and ULP 48 (5'-FAM labeled TTCCGCGTAAACAACCGTAATTAGG-3'(SEQ ID NO: 14)) at lμM concentration final and 2 U of Taq DNA polymerase. 20-30 PCR amplification cycles (30s at 94°C, 30 s at 58°C, 60 s at 72°C) are performed with samples being withdrawn after every other cycle. The amplified PCR products are separated by capillary electrophoresis on an ABI 3730x1 Genetic analyzer (using collected aliquots mixed with formamide in 1:5 ratio) or an ICE capillary electrophoresis system (using direct electrokinetic injection from the PCR reaction). The amounts of fluorescent PCR products are measured from peak height or peak area and threshold cycles (Ct) are determined. The amount of wt and mutant DNA is calculated from calibration plots of

Ct versus initial copy number and amount of mutant is reported as a percentage relative to the wt BCR/ AbI. If no mutations are found at sites corresponding to mutations that result in the resistance to imatinib, the subject is treated with a single round of chemotherapy at a dose level and on a schedule determined by the physician. A reduction in signs and symptoms of CML is observed in response to treatment. After an interval determined by the treating physician, white blood cells are collected from the subject and total RNA is isolated by routine methods. The total RNA is screened with the same series of probes used prior to chemotherapeutic intervention. As a control, a portion of the RNA isolated prior to initiation of chemotherapy is tested as a control. A new mutation is thereby identified in a small portion of the DNA from the white blood cells isolated after initiation of chemotherapy. The mutation is known to result in resistance to imatinib. In this instance, an alternate treatment is selected by the physician for the next round of therapy.

Example 2 : Monitoring of SNP variation over time in a subject undergoing treatment with a kinase inhibitor using total genomic DNA.

[00127] A procedure similar to that described in Example 1 is performed to assess the mutations of BCR/ AbI using total genomic DNA. In this example DNA is isolated from blood using PAXgene Blood DNA System for DNA purification from clinical samples. Extracted DNA (0.2-1 ug) is subjected to ligation with the probes and PCR amplification as described above

Example 3 : Monitoring of BCRJAbI copy number and SNP variation over time in a subject undergoing treatment with a kinase inhibitor.

[00128] In this example in addition to the procedures of Example 1, copy number of BCR/ AbI kinase domain is measured during amplification. To facilitate measurement of the copy number, the PCR reaction is sampled during amplification and PCR product is quantified as outlined above. For improved accuracy a copy of a reference gene (such as beta-2-microglobulin or beta-glucuronidase) is measured (e.g., using primers described in Gabert et al, Leukemia (2003) 17, 2318-2357). Detection

of steady or rising copy number of BCR/ AbI is indicative of emergence of resistant mutants and advises further detection and quantification of resistant SNPs.

Example 4: Detection and quantification ofBcr-Abl mutants

[00125] In this example, multiple ligation probes (multiplexing) were combined to detect and quantify the presence of mutant single nucleotide polymorphisms (SNPs) in a sample. Model targets for wildtype and mutant Bcr-Abl cDNAs were cloned, linearized and gel purified as 1.6 Kb, double- stranded DNA fragments. Each target contained internal reference sequence and a sequence comprising single mutant SNP or wild type sequence corresponding to the target SNP. These molecules were used as model targets at 50OfM during the ligation phase of the assay. Ligation probe characteristics are shown in Table 1, and ligation probe sequences are shown in Table 2.

Table 1 : Ligation Probe Characteristics

SNP Tarαet Lenαth (bo) Im. (°C) ¹ Stuffer

Probes

Oligo# Probe Phenotype Genotype Overall Amplicon (573') 5' 3' M13-[5']:[3']

BS0748 LP-ref wildtype C 1032 124 122 1 1/13 57.6 54.6 [1 -28] [101 -125+η

BS0749 LP3 T315I C1308T 136 134 16/13 56.5 51 .3 [201 -225] [301 -336]

BS0750 LP4R E255K G1 127A 130 128 12/1 1 55.6 54.1 [401 -427] [501 -534]

BS0752 LP7 E255V A1 128T 152 150 1 1/1 1 56 50.6 1001 -1042 1101 -1142

Algorithm of Wetmur (1991, Critical Rev. Biochem. Molec. Biol. 26:227-259), updated with the thermodynamic parameters of Allawi & SantaLucia (1997, Biochemistry 36:10581-10594).

[00126] Briefly, a lOμl premix of 2X components (1OU 9°N™ ligase (New

England BioLabs), 2OmM Tris-HCl (pH 7.5), 600 μM ATP, 5mM DTT, 0.1% Triton X-100, 2OmM MgCl ₂ , 1OnM each of LPref, LP3, LP4R and LP7) was added to lOμl of different types of targets while at > 6O ⁰ C. Reactions were denatured at 94 ⁰ C for 2

minutes, annealed and ligated at 58 ⁰ C for 20 minutes, and the reaction stopped by denaturing at 94 ⁰ C and adding 20μl of 1OmM EDTA/Tris-HCl (pH 8.3). lOμl of stopped ligation reactions were added into 40μl of PCR mastermix yielding 25OnM primers Rub_FA (5'-CTTTGTCGGGTTTTCTCCGTATCC-S '(SEQ ID NO: 19)) and FAM-ST3_RA

(5 '-TTCGCTCGTAGTCGAACGCC-S' (SEQ ID NO:20)) in IX Multiplex MasterMix with HotStarTaq DNA polymerase (Qiagen). Thermal cycling was performed for 16- 38 cycles (20s at 95 ⁰ C, 20s at 58 ⁰ C, 20s at 72 ⁰ C), with samples collected every other cycle. Samples were analyzed by capillary electrophoresis as described in Example 1.

[00127] Data analysis measured the signal from the various SNP ligation probes

(LPsnp) and compared them as a ratio of copy numbers to the signal from the internal reference ligation probe (LPref) within each reaction. This was calculated by subtracting C _t s values (which represent base-2 logarithmic transformations of copy numbers) for each LPsnp from the C _t s from LPref (LPref - LPsnp). These differences, raised to the power of 2, yielded the fractional copy number for LPsnp compared to LPref.

Ratio of (Copy# LPsnp) : (Copy# LPref) = 2 ^(Ct(LPref) - ^Q(LPsnP » Absolute target calibration numbers were not available, nor needed, because the reference site was present in every target. This was true whether the wildtype sequence or the mutant sequence was present at the SNP site. Table 3 shows a summary of the results of these ratios for the different SNP sites when containing wildtype sequences (background signals), along with calculations for limits of detection set at signal-to- noise ratios of > 2. Table 4 shows summary results of these ratios for the different SNP sites when containing mutant sequences. In a given example all mutant sequences were spiked at the molar ratio of 1 : 1 : 1.

Table 3: Ratio of Mutant :Reference Sequence on Wildtype (Mismatched SNP)Targets in

Multiplex Assay

LPref LP3 LP4R LP7

Target (SNP) (Wt) (T315I) (E255K) (E255V) mean ± s.d.(n) 1 +/- 0 (1 12) 0.03 +/- 0.02 (104) 0.07 +/- 0.05 (56) 0.01 +/- 0 (104)

LOD (B + 2xs.d.,B>) 0.07 0.17 0.02

Table 4: Measured Molar Ratio of Mutant:Reference on Cognate ( Matched Mutant SNP)

Targets in Multiplex Assay

Ratio to Reference

Mutation mean ± s.d.(n)

Reference 1 +/- 0 (1 12)

SNP T315I 1 .34 +/- 0.1 (8)

SNP E255K 0.81 +/- 0.2 (8)

SNP E255V 0.6 +/- 0.19 (8) n=number of replicate measurements

Thus the mutations are detectable in multiplex formats when present in as few as 2% to 17% of the Bcr-Abl molecules, depending upon the specific mutation.

[00129]

Example 5: PCR Primers

[00130] PCR primers suitable for use in the methods described herein were selected with the following characteristics: Max delta G of hybridizing to human RNAs (delta G's calculated using Primer 3 software): -17 kc/m; Max delta G of hybridizing of human RNAs to the 3'-prime end of the primer: -15.5 kc/m; Max delta G of hybridizing to human genomic DNA: -24 kc/m; Max delta G of hybridizing to human genomic DNA to the 3'-prime end of the primer: -22 kc/m; no significant (delta G is more than -10 kc/m) hybridization to human ribosomal RNA (18S and 23S), absence of stable hairpins (delta G is more than -2 kc/m) and self-primer dimers (delta G is more than -8 kc/m; preferably more than -4 kc/m); Tm (melting temperature) is between 58.5 and 60.5 ⁰ C. Other primers meeting these characteristics are also suitable for use in the methods described herein. Each probe should comprise one such primer sequence and the complement of another such primer sequence.

Sequence of the selected primers: 5'- to 3'- CTCAATTCGTTAGTACGCGCATCAC (SEQ ID NO: 21)

CGGATCATTACGCGACGATAGTTTT (SEQ ID NO: 22)

TCGCGCATTACGACTCGATAAGTTA (SEQ ID NO: 23)

CGGTTAGTATCATGCGACGTACCAG (SEQ ID NO: 24)

ATAGCGCACCGAATCTATTAACGGA (SEQ ID NO: 25)

(9t ON αi OHS) OXVODDVXODXVVXODDXODDVXXV

(St ON αi OHS) XODDXVVVVODDVXDVXDVOODXOX

(tt ON αi OHS) DXXDOXVOXDXVXXDVVODVDODXX

(εt ON αi OHS) XOOVODVXVXVVODVXVVDOXDODO

(ZV ON αi OHS) XXDODODVXDVVVXDODVVVDXXXD

(It ON αi OHS) XXOODVVOVOVVVVVXVODXODDOV

(Ot ON αi OHS) VXODDOVVXDODXXOOXVXXXODXO

(6ε ON αi OHS) DDXVDDVVXVXDDXVVODVVODOXO

(8ε ON αi OHS) VODOODVXVVVXDOVXVXVODXDOD

(LZ ON αi OHS) DODXVXVOVXVVVXOVVODDODXOD

(9£ ON αi OHS) XXOOXVVXXDDVXVOODDVODXVOO

(Sε ON αi OHS) ODDOXVOVXXXVXXODDVXDVDODV

(t£ ON αi OHS) XXOVVDODXOXVXDVVXVVODODDV

(££ ON αi OHS) VOVXDDXVODXXODXXVXVODODVV

(Zi ON αi OHS) XVXODVDXOODXXODXXVVDVVOOV

(!£ ON αi OHS) VXODDODXXVVXVXVVXDODDXOOX

(Oε ON αi OHS) DOVOXVXXODVOODXVXVXDDODVO

(6Z ON αi OHS) ODVXDDODXXVODVVXVODVXDXOO

(SZ ON αi OHS) ODDXDVODVXDVVXDVVODXVVDOO

(LZ ON αi OHS) OXOXXXVDXODVXXODODDVXVDVV

(9Z ON αi OHS) DVXDXOXVXVODOVXODODOXXVVD

εεε8£0/800ZSfl/13d 86681 ϊ/800Z: OλV

(L9 ON αi OHS) XOVODOXODXVOVXVOOVXXXXODO

(99 ON αi OHS) DXXVDOVXVVXODOOXXVODDVOXV

(£9 ON αi OHS) XODVDXDXODVVXVVODXODXVOXX

09 ON αi OHS) VOVDODVODXDXODXXVXXVVDDVX

(£9 ON αi OHS) DDOODXXXVXXVVXOODXOVXODOV

(Z9 ON αi OHS) VDVXOVXXVVDVODOVDVXVODODO

(19 ON αi OHS) XODVVDXXVXDODVOOVXDXVOODX

(09 ON αi OHS) VXOODXVDDVDVXVXVVODVODOXX

(65 ON αi OHS) DDODVVOVDXXVXDVVXODVODDVO

(85 ON αi OHS) DXODOXXVODVOODVVXVVVOXXOV

(LS ON αi OHS) XVXOXODVXXXOODVVXVVVDDODD

(95 ON αi OHS) 00DXVX00D0XXVX0VX00DDXVXX

(ςς ON αi OHS) OODVOXODXVVXVVODODVVXDXXV

(fr£ ON αi OHS) DOODDVOXOVXVXVVVXXVOODOOV

(εS ON αi OHS) ODOVDXOODVOVVXVVXODXXXXOO

(Zi ON αi OHS) ODXOODVVVXDVODDVVXXVDOXOV

(iς ON αi OHS) DXVDVVDVVODODVXXDVVXVODOX

(OS ON αi OHS) DDOVDXXODVXVVXDDXVXODODXD

(6t ON αi OHS) XOODDXXVVODVVODVVXOVOVVDX

(8t ON αi OHS) VDXOXVVXOODXOVXVODDVOXXOD

(LP ON αi OHS) DVDVXODVODOXVVXVXVDDXVDOD

εεε8£0/800ZSfl/13d 86681 ϊ/800Z: OλV

(88 ON αi OHS) VODODDVVODXOVXVOVXXVOXOOV

(LS ON αi OHS) OVODVXVDXVXDVXODVVOOXODOD

(98 ON αi OHS) XVODODVXVVDODXXDVXVOVDDVV

(58 ON αi OHS) VOODOVOXVVXVXVVVXXOVODODO

(PS ON αi OHS) DXDOVXXVODVVODVVXOOVDXDOD

(£8 ON αi OHS) XXVODVVDXDXVVXDVXVODDODDX

(ZS ON αi OHS) DVODDXXVODXOOVODVXVOXOVOV

(18 ON αi OHS) XODVODDXVDVVVXXVXODXODOVV

(08 ON αi OHS) DDVDOVXVODODVVODVDVXVVXOX

(6L ON αi OHS) 00D0DXVXDVDVVVXX0DXVVVD0V

(SL ON αi OHS) XVDVDXDVXODOXXVOXVXOOVDOD

(LL ON αi OHS) VXXVDVXVVXODOODXOODXOXVDX

(9L ON αi OHS) VDODVOXVVVXDVXDXVXVDODODV

(ζL ON αi OHS) ODDVODXXOOVXXODOOVXVXVDXO

(VL ON αi OHS) DOOXODXVVXDOVXVVXXDODVOOX

(ZL ON αi OHS) VODDODXXDVXVDVXXVODOXXOVX

(ZL ON αi OHS) DDOODVVXVDXXVXDDVVVOODXOV

(U ON αi OHS) OODDVOVXVDVXXDVVODVVOODXD

(OL ON αi OHS) DXODXOVDDVXODVXXVDODXDXVD

(69 ON αi OHS) DDOVODDVVXVXDVDVDXVVXDODD

(89 ON αi OHS) OOVXXVVXODDVVDVVVXODODDXX

εεε8£0/800ZSfl/13d 86681 ϊ/800Z: OλV

(601 ON αi OHS) ODVDDODVXVXDVODDXVVOOVVVX

(801 ON αi OHS) XOVDODXVXODDXVXXVVODVODVV

(LOl ON αi OHS) XVVXOXODXVXDDODVVDODXXVVO

(901 ON αi OHS) 00VVVD0VDDX0VXVVXVVXD0D0D

(SOl ON αi OHS) XOODDOXODVXXVXXXDXXODOVXX

(W)I ON αi OHS) XDODODXXXVXVXODOXVDVXDOVV

(£01 ON αi OHS) XVOXOVXVXODXVVODDOXVVVODO

(ZOI ON αi OHS) VVXDVVDXOODOODVXVOVXXVOOD

(101 ON αi OHS) ODXVDVVVOVXODDVVOXODVXXOD

(001 ON αi OHS) OXOVDOVVVVODXDXVVXDVVOODO

(66 ON αi OHS) ODVVDODVDXVVXXDODXXOVDVVX

(86 ON αi OHS) XVOXOXXXVXODDVODVODOOVXXO

(Lβ ON αi OHS) ODVODVXXXXDDODVXVDVODXVVV

(96 ON αi OHS) OODDVXXDDVXODXVXVXODXDOOX

(56 ON αi OHS) XXOODVXOXVXXOODVOODOXVXXX

(W5 ON αi OHS) VDXDXVXDXVVXDODVXDXODODOX

(£6 ON αi OHS) DOODVODXVVVOVXXVXOVODOXXO

(Z6 ON αi OHS) OXXXXVODVXVXXVOXDDODDOXOV

(16 ON αi OHS) VODOXVXXODDVVXDXXDVXVODOX

(06 ON αi OHS) VVDVOODODXVVVXVDVXDVXDODX

(68 ON αi OHS) ODVDXXODXVVVVVXXDXOODXODV

εεε8£0/800ZSfl/13d 86681 ϊ/800Z: OλV

(0£l ON αi OHS) XXDDVOXVDODXOVXXVVXOODVDD

(6Zl ON αi OHS) XOODVVXXVVVXXDXODOVODDVOO

(8Zl ON αi OHS) DDODVXXVVOVODXOVDXOXVDXDX

(LZl ON αi OHS) ODXDXODXXODVOVXVODVXOOXVD

(9Zl ON αi OHS) VOOXDXODXXOXVXVXXODVDODVV

(SZl ON αi OHS) XVDDODDVVODDVOVXXVXXXDVOO

(tZI ON αi OHS) VXXOODXXOVXXVODOVXODDVVDD

(£Z1 ON αi OHS) DOVODVXVVXXVOVDVVXODOODDX

(ZZl ON αi OHS) DDXODVXXXOODXODXXXDXVDXVO

(IZl ON αi OHS) VDVODODOXDVXXDDVOXXVVXXDX

(OZl ON αi OHS) DDXXVVDVXODVVODODDVVXVVDV

(611 ON αi OHS) ODOVVODXVVXXVVDXDDVXDVOOD

(811 ON αi OHS) XOODOXXVXOVVDXODXXXVXXODD

(LU ON αi OHS) ODDOOXVXOVVXVODXDVXVODDXD

(911 ON αi OHS) OVODVXVVXXXOVOXXODOVVDDOO

(SIl ON αi OHS) XXVODXDVDVXVDVXXXVVOODODO

(til ON αi OHS) DOXOXVVOXXVXXODOVODOVXVDX

(Ell ON αi OHS) DOVODOVVXXODDVVDXVXODVVVO

(ZII ON αi OHS) DOODVXXVXXODXVXXDVODOOXDX

(III ON αi OHS) VODODOVXDXVVVOXXOODXVVXDV

(OH ON αi OHS) DXXDVODOXXXXODDVVXXDVVVOD

εεε8£0/800ZSfl/13d 86681 ϊ/800Z: OλV

(ISl ON αi OHS) DOXVXVXVVODVXOODVVDOODXVV

(OSl ON αi OHS) 00XVDXVXXVXX0D0DDXXDVX0DD

(6tl ON αi OHS) OXVODOODVXVOXDXOOVXDXOVOX

(8tl ON αi OHS) DDODXVXOVVXDXODXVXXODDOXD

(δtl ON αi OHS) VVVODOXXXVXDVXXOOVXXODODD

(9tl ON αi OHS) OVVXVOODVOODXVDVXOVXXDODO

(StI ON αi OHS) XODDOXVODVVODVXDXVVVXXVDO

(ttl ON αi OHS) DOVXDVODDODXVXXDODXXOVVXX

(εtl ON αi OHS) XDVDVVXXXVODVVODXOVDODVDX

(in ON αi OHS) XVODDVXDXXODXVXVOXDDODXXX

(ItI ON αi OHS) ODDVODODDVVODVXXVDVVXVXXV

(OtI ON αi OHS) OXDXOVXDODXVXVDDVODDXXOOV

(6£I ON αi OHS) DVODXXVODVVXXDXDVODDVVVOD

(8£I ON αi OHS) XOXVXODOXVVDVOXVXODDXDOXO

(L£l ON αi OHS) VDODVVXDVVXOXXODXDOODXVXX

(9£I ON αi OHS) ODXXODXDOXVXODXDOVXXXOVDX

(SEX ON αi OHS) VXVDOVXODXVOXXVDVODDVXODD

(t£I ON αi OHS) XODODXDVVXVDXVVDODVXXOOVV

(εεi ON αi OHS) VXOOXXVDDXDVXDDXVVXXODODD

(Z£l ON αi OHS) VDVOXVXVODVVXDVXVDODOVOOD

dεi ON αi OHS) XXODVXXOXVVOOVXXVVODVDDOD

εεε8£0/800ZSfl/13d 86681 ϊ/800Z: OλV

(ZLl ON αi OHS) DVVDODOVXXDDXVVXDVVXVDDOD

(UI ON αi OHS) DODDVVODVVVXXVXODVDOOXVXO

(OLl ON Ql OHS) XXXVXX00DV00DV0XXXVVXDD00

(691 ON ai OHS) DOXDVXODDVVDXXVOXVODDVDVX

(891 ON ai OHS) OODOOVOVXXDVDVVXXDVOODVVD

(L91 ON Ql OHS) OOVVVODVXVXVVVODVDOVODVOO

(991 ON Ql OHS) DVDOODXXVDXVVXODXXDDXDDVX

(£91 ON Ql OHS) VVDDODVXOOVVXDXVODXXOOXVO

(WI ON αi OHS) VVDDODVDOXVXXVODXDVXXOXOV

(£91 ON Ql OHS) DDOVXDVXODXVXXOVVDXXODOOD

(391 ON αi OHS) DXOVVDOXODOVXVXXDODXXXXOO

(191 ON αi OHS) XOOXVDXXXVDVVVODDVXODDXXO

(091 ON Ql OHS) VOXXVDOXXODXVVXDVODDVVDVO

(6SI ON αi OHS) XVOVXXXODODDOVVXVDVODVDVV

(8SI ON αi OHS) DVVVDVVXDODDVODVXVDDOXXXV

(δSI ON αi OHS) XDVVXXVXXVODOVXXODDODDVOO

(9SI ON αi OHS) ODVODXXOVDXVVVXDVXDODXDOO

(SSI ON Ql OHS) XVODVVXOVXVVODVOODXVDOXDD

(fr£I ON Ql OHS) OVOXXODXVVVXXDOODXOOVXXOD

(£SI ON Ql OHS) OOXODXODVXOODVVVXDVDDXVVV

(ZSI ON αi OHS) VXOXXOVODVOVXDODXVVODVDDX

εεε8£0/800ZSfl/13d 86681 ϊ/800Z: OλV

TCCGAAACGTACCTAAACGAATTGC (SEQ ID NO: 173)

TCGGTTGTTGAACTATTTAACGGCC (SEQ ID NO: 174)

TCAGCCGTGTATATAAAACGCTCGA (SEQ ID NO: 175)

TGTCGAGACGAAAATTGTTGAACGT (SEQ ID NO: 176)

GCGTATGCTTAACGATCCTCTTCGT (SEQ ID NO: 177)

CGCCTCGGTCGTAAGTAAATCTCAG (SEQ ID NO: 178)

CCTCAATCGAGCGGATATGTTAGCT (SEQ ID NO: 179)

ACTGACGGCGAAGTATCGAAATTGT (SEQ ID NO: 180)

TTCCTATCGACACGTTACAACGTCG (SEQ ID NO: 181)

GGTCGTTCCGATAAGTTCGTTTGTC (SEQ ID NO: 182)

ACCGACGAACGAATCTCTCTATTCG (SEQ ID NO: 183)

CGTTCGTCAATTTTTAGGTGACCGT (SEQ ID NO: 184)

TACGTTCGCGTGTATTGTTCGACTT (SEQ ID NO: 185)

GCAGTATCGCGTCAAAGTTCGTAGA (SEQ ID NO: 186)

TCCATAGCCTACGTCGTTACATCGA (SEQ ID NO: 187)

CGGTGTTCCGATTAATACCTCGTGT (SEQ ID NO: 188)

CTGCGACAATATGACGGTATGCCTA (SEQ ID NO: 189)

CCGGATGCTAACGTCATATGTACGA (SEQ ID NO: 190)

[00127] The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than

limiting on the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.

[00128] All references, patents and patent applications cited are incorporated herein by reference in their entirety. The amino acid and nucleotide sequences corresponding to GenBank Accession numbers cited are also incorporated herein by reference in their entirety.