CANCER

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 61/844,534, filed July 10, 2013, which is incorporated by reference.

SEQUENCE LISTING

[0002] Incorporated by reference in its entirety herein is a nucleotide/amino acid sequence listing submitted concurrently herewith.

BACKGROUND OF THE INVENTION

[0003] Renal cell carcinoma (RCC) is the most common kidney cancer and accounts for approximately 4% of all malignant diseases. In the United States, 39,000 new cases and 13,000 deaths occur each year, and there has been an increase in these incidences recently (see Gupta et al., Cancer Treat. Rev., 34: 193-205 (2008); and Cohen et al., N. Engl. J. Med, 353: 2477-2490 (2005)). Several histological variants have been identified (see Linehan et al., Nat. Rev. Urol., 7: 277-285 (2010)); among these, clear cell RCC (ccRCC) represents the most common renal cancer histology, comprising 70-80% of all RCC cases. Evidence of metastasis is present in about 30% of patients with newly diagnosed disease (see Siegel et al., CA Cancer J. Clin., 61: 212-236 (201 1)). Overall median survival depends on the stage of the tumor at the time of treatment, and very few patients with metastasis respond to currently available therapies. To date, available laboratory testing methods for predicting metastasis in ccRCC are not reliable. Complex biological features in individual patients make it impossible for several algorithms to accurately predict clinical outcome for patients with metastatic RCC (mRCC). Recent studies have shown that the metastatic potential of cancer is induced by genetic changes occurring relatively early in tumorigenesis and that metastatic dissemination may occur continually throughout the course of primary tumor development (see Klein, Science, 321: 1785-1787 (2008)). Molecular biomarkers, which could accurately predict metastasis at an early stage of diagnosis of ccRCC, may be beneficial for a more precise prediction of clinical prognosis and may ultimately be used to identify subsets of patients that may benefit from specific targeted therapies (see Thomas et al, J. Urol, 182: 881 -886 (2009)).

[0004] There exists a desire in the art for a biomarker that can be used to better diagnose kidney cancer and determine the prognosis for kidney cancer in subjects.

BRIEF SUMMARY OF THE INVENTION

[0005] The invention provides a method of determining the prognosis of kidney cancer in a subject. The method comprises (a) obtaining a sample from the subject, (b) analyzing the sample for an expression level of a carboxypeptidase E (CPE) splice variant that lacks the N terminus (CPE-ΔΝ), and (c) correlating the expression level of CPE-ΔΝ in the sample with the prognosis of kidney cancer in the subject.

[0006] The invention further provides a method of diagnosing kidney cancer in a subject. The method comprises (a) obtaining a sample from the subject, (b) analyzing the sample for an expression level of a carboxypeptidase E (CPE) splice variant that lacks the N terminus (CPE- ΛΝ), and (c) correlating the expression level of CPE-ΔΝ in the sample to a diagnosis of kidney cancer in the subject.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)

[0007] Figure 1 is a scattered plot showing the distribution of CPE-ΔΝ mRNA copy number in benign and in metastatic patient samples for the training set as described in Example 2.

[0008] Figure 2 is a scattered plot showing the distribution of CPE-ΔΝ mRNA copy number in benign and in metastatic patient samples for the test set as described in Example 3. Dots with "X" indicate patients who were benign at the time of surgery and found to have metastasis during follow-up.

DETAILED DESCRIPTION OF THE INVENTION

[0009] The inventors identified a splice variant isoform of the prohormone processing enzyme, carboxypeptidase E (CPE), which promotes growth and metastasis of several types of human epithelial-derived tumor cells (see WO 2010/009074). The splice variant isoform of CPE (CPE-ΔΝ) lacks the N-terminus. In humans, the CPE-ΔΝ polypeptide comprises the amino acid sequence of SEQ ID NO: 2 and is encoded by the nucleic acid sequence of SEQ ID NO: 1. In mice, the CPE-ΔΝ polypeptide comprises the amino acid sequence of SEQ ID NO: 4 and is encoded by the nucleic acid sequence of SEQ ID NO: 3.

[0010] The invention provides a method of determining the prognosis of kidney cancer in a subject. The method comprises (a) obtaining a sample from the subject, (b) analyzing the sample for an expression level of CPE-ΔΝ, and (c) correlating the expression level of CPE-ΔΝ in the sample with the prognosis of kidney cancer in the subject.

[0011] The invention further provides a method of diagnosing kidney cancer in a subject. The method comprises (a) obtaining a sample from the subject, (b) analyzing the sample for an expression level of CPE-ΔΝ (e.g., RNA or protein), and (c) correlating the expression level of CPE-ΔΝ in the sample with a diagnosis of kidney cancer in the subject.

[0012] The sample to be analyzed can be any suitable tissue or fluid obtained from the subject. For example, the tissue can be tumor tissue, tissue adjacent to and/or surrounding the tumor, tissue from a location that is not adjacent to a primary tumor but that is suspected of harboring metastasized tumor, or blood.

[0013] The sample can be obtained by any suitable method. For example, sample tissue can be obtained via surgery, biopsy, resected tissue specimen, or arterial or venous blood withdrawal.

[0014] Preferably, the inventive methods further comprise the step of obtaining a sample from surrounding non-tumor tissue (N) for the purpose of comparison. In particular, the methods comprise (a) obtaining a sample from a tumor (T) and a sample from surrounding non-tumor tissue (N), (b) analyzing the tumor (T) sample for an expression level of CPE-ΔΝ (e.g., RNA or protein) relative to an expression level of CPE-ΔΝ in the surrounding non-tumor tissue sample (N), and (c) correlating the expression level of CPE-ΔΝ in tumor/non-tumor (T/N) with the prognosis of cancer in the subject.

[0015] The subject can be any mammal (e.g., mouse, rat, rabbit, hamster, guinea pig, cat, dog, pig, goat, cow, horse, primate, or human). Preferably, the subject is a human of any age and sex. [0016] Without wishing to be bound by any particular theory, it is believed that CPE-ΔΝ promotes growth and metastasis of human cancer cells by up-regulating the expression of the metastasis gene, NEDD9 (see, e.g., Kim, Cell, 125: 1269-81(2006)). Additionally, it is believed that CPE-ΔΝ activates gene expression by epigenetic mechanisms by interacting with histone deacetylase and transcription factor SATB1. In this regard, CPE-ΔΝ can serve as a biomarker to reliably predict future metastasis of kidney cancer based on the level of CPE-ΔΝ in the resected primary tumor.

[0017] The inventive methods can be used for diagnosis and prognosis of any type of kidney cancer. In a preferred embodiment, the kidney cancer is renal cell carcinoma (RCC), such as clear cell RCC (ccRCC) or papillary RCC (pRCC). In additional to kidney cancer, the inventive methods can be used with cancer of the ureter, lymphomas, sarcomas, cancer of the uterus, bone cancer, uveal melanoma (in eye/retina), bladder cancer, leukemia, and muscle tumors.

[0018] The expression level of CPE-ΔΝ can be determined by detecting and, optionally, quantifying the levels of mRNA and/or protein of CPE-ΔΝ (referred to herein as "biomarker" or "biomarkers") in the sample.

[0019] Methods for detecting and quantifying such biomarkers are well within the art. In particular, suitable techniques for determining the presence and level of expression of the biomarkers in cells are within the skill in the art. According to one such method, total cellular RNA can be purified from cells by homogenization in the presence of nucleic acid extraction buffer, followed by centrifugation. Nucleic acids are precipitated, and DNA is removed by treatment with DNase and precipitation. The RNA molecules are then separated by gel electrophoresis on agarose gels according to standard techniques, and transferred to

nitrocellulose filters by, e.g., the so-called "Northern" blotting technique. The RNA is then immobilized on the filters by heating. Detection and quantification of specific RNA is accomplished using appropriately labeled DNA or RNA probes complementary to the RNA in question. See, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapter 7, the entire disclosure of which is incorporated herein by reference. [0020] Methods for the preparation of labeled DNA and RNA probes, and the conditions for hybridization thereof to target nucleotide sequences, are described in Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapters 10 and 1 1 , the entire disclosures of which are incorporated herein by reference. For example, the nucleic acid probe can be labeled with, e.g., a radionuclide such as ³ H, ³² P, ³³ P, ^I4 C, or ³⁵ S; a heavy metal; or a ligand capable of functioning as a specific binding pair member for a labeled ligand (e.g., biotin, avidin, or an antibody), a fluorescent molecule, a

chemiluminescent molecule, an enzyme, or the like.

[0021] Probes can be labeled to high specific activity by either the nick translation method of Rigby et al., J. Mol. Biol, 1 13: 237-251 (1977), or by the random priming method of Fienberg, Anal. Biochem., 132: 6-13 (1983), the entire disclosures of which are herein incorporated by reference. The latter can be a method for synthesizing P-labeled probes of high specific activity from RNA templates. For example, by replacing preexisting nucleotides with highly

32.

radioactive nucleotides according to the nick translation method, it is possible to prepare P- labeled nucleic acid probes with a specific activity well in excess of 10 ⁸ cpm/microgram.

Autoradiographic detection of hybridization then can be performed by exposing hybridized filters to photographic film. Densitometric scanning of the photographic films exposed by the hybridized filters provides an accurate measurement of biomarker levels. Using another approach, biomarker levels can be quantified by computerized imaging systems, such as the Molecular Dynamics 400-B 2D Phosphorimager (Amersham Biosciences, Piscataway, N.J., USA).

[0022] Where radionuclide labeling of DNA or RNA probes is not practical, the random- primer method can be used to incorporate an analogue, for example, the dTTP analogue 5-(N-(N- biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine triphosphate, into the probe molecule. The biotinylated probe oligonucleotide can be detected by reaction with biotin-binding proteins, such as avidin, streptavidin, and antibodies (e.g., anti-biotin antibodies) coupled to fluorescent dyes or enzymes that produce color reactions.

[0023] In addition to Northern and other RNA blotting hybridization techniques, determining the levels of RNA transcript can be accomplished using the technique of in situ hybridization. This technique requires fewer cells than the Northern blotting technique, and involves depositing whole cells onto a microscope cover slip and probing the nucleic acid content of the cell with a solution containing radioactive or otherwise labeled nucleic acid (e.g., cDNA or RNA) probes. This technique is particularly well-suited for analyzing tissue biopsy samples from subjects. The practice of the in situ hybridization technique is described in more detail in U.S. Patent

5,427,916, the entire disclosure of which is incorporated herein by reference. The inventive method encompasses automated quantification of CPE-ΔΝ (e.g., in formalin-fixed slides).

[0024] The relative number of RNA transcripts in cells also can be determined by reverse transcription of RNA transcripts, followed by amplification of the reverse-transcribed transcripts by polymerase chain reaction (RT-PCR). The levels of RNA transcripts can be quantified in comparison with an internal standard, for example, the level of mRNA from a standard gene present in the same sample. Suitable genes for use as an internal standard include, for example, myosin or glyceraldehyde-3 -phosphate dehydrogenase (G3PDH). The methods for quantitative RT-PCR and variations thereof are within the skill in the art.

[0025] Any suitable primers can be used for the quantitative RT-PCR. Preferably, the primers are specific to CPE-ΔΝ and do not amplify wild-type CPE. It is within the skill in the art to generate primers specific to CPE-ΔΝ (see Figs. 5B and 6 for a comparison of wild-type CPE and CPE-ΔΝ). Primers can be of any suitable length, but preferably are between 9 and 70 (e.g., 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, as well as ranges of the values described herein) nucleotides.

[0026] In one embodiment, the pair of primers specific to human CPE-ΔΝ include fwd: 5'- ATGGCCGGGCATGAGGCGGC-3 ' (SEQ ID NO: 5) and rev: 5'-

GCTGCGCCCCACCGTGTAAA-3 ' (SEQ ID NO: 6). The primers also can have greater or fewer nucleotides. In particular, a maximum length primer pair specific to human CPE-ΔΝ is fwd: 5'-GAGCGCAGCGATGGCCGGGCATGAGGCGGCGCCGGCGGC-3' (SEQ ID NO: 7) and rev: 5 ' -GGCCCTCGAAGCTGCGCCCC ACCGTGTAAATCCTGCTGAT-3 ' (SEQ ID NO: 8), and a minimal length primer pair specific to human CPE-ΔΝ is fwd: 5'-CGGGCATGA-3' (SEQ ID NO: 9) and rev: 5'-CCCCACCGT-3' (SEQ ID NO: 10). Primer pairs of intermediate lengths (e.g., between the minimal and maximum length primer pairs) also are encompassed by the invention.

[0027] The invention also provides a pair of primers specific to mouse CPE-ΔΝ, such as fwd: 5'- GACAAAAGAGGCCAGCAAGA-3 ' (SEQ ID NO: 1 1) and rev: 5'- CAGGTTCACCCGGCTCAT-3 ' (SEQ ID NO: 12). The primers also can have greater or fewer nucleotides. In particular, a maximum length primer pair specific to mouse CPE-ΔΝ is fwd: 5'- CAGACAAAAGAGGCCAGCAAGAGGACGGCA-3 ' (SEQ ID NO: 13) and rev: 5'- ATTCAGGTTCACCCGGCTCATGGACCCCG-3' (SEQ ID NO: 14), and a minimal length primer pair specific to mouse CPE-ΔΝ is fwd: 5'-AGGCCAGCAA-3 ' (SEQ ID NO: 15) and rev: 5'-GTTCACCCGG-3' (SEQ ID NO: 16). However, primer pairs of intermediate lengths (e.g., between the minimal and maximum length primer pairs) also are encompassed by the invention.

[0028] A tissue microarray can be utilized to detect biomarker expression. In the tissue microarray technique, a hollow needle is used to remove tissue cores as small as 0.6 mm in diameter from regions of interest in paraffin-embedded tissues such as clinical biopsies or tumor samples. These tissue cores are then inserted in a recipient paraffin block in a precisely spaced, array pattern. Sections from this block are cut using a microtome, mounted on a microscope slide and then analyzed by any method of standard histological analysis. Each microarray block can be cut into 100 - 500 sections, which can be subjected to independent tests. Tests commonly employed in tissue microarray include immunohistochemistry and fluorescent in situ

hybridization.

[0029] In some instances, it may be desirable to use microchip technology to detect biomarker expression. The microchip can be fabricated by techniques known in the art. For example, probe oligonucleotides of an appropriate length, e.g., 40 nucleotides, are 5 '-amine modified at position C6 and printed using commercially available microarray systems, e.g., the GENEMACHINE™ OmniGrid 100 Microarrayer and Amersham CODELINK™ activated slides. Labeled cDNA oligomer corresponding to the target RNAs is prepared by reverse transcribing the target RNA with labeled primer. Following first strand synthesis, the

RNA/DNA hybrids are denatured to degrade the RNA templates. The labeled target cDNAs thus prepared are then hybridized to the microarray chip under hybridizing conditions, e.g., 6 times SSPE/30% formamide at 25 °C for 18 hours, followed by washing in 0.75 times TNT at 37 °C for 40 minutes. At positions on the array, where the immobilized probe DNA recognizes a complementary target cDNA in the sample, hybridization occurs. The labeled target cDNA marks the exact position on the array where binding occurs, thereby allowing automatic detection and quantification. The output consists of a list of hybridization events, which indicate the relative abundance of specific cDNA sequences, and therefore the relative abundance of the corresponding complementary biomarker, in the subject sample. According to one embodiment, the labeled cDNA oligomer is a biotin-labeled cDNA prepared from a biotin-labeled primer. The microarray is then processed by direct detection of the biotin-containing transcripts using, e.g., Streptavidin-Alexa647 conjugate, and scanned utilizing conventional scanning methods. Image intensities of each spot on the array are proportional to the abundance of the

corresponding biomarker in the subject sample.

[0030] The use of the array has one or more advantages for mRNA expression detection. First, the global expression of several hundred genes can be identified in a single sample at one time. Second, through careful design of the oligonucleotide probes, the expression of both mature and precursor molecules can be identified. Third, in comparison with Northern blot analysis, the chip requires a small amount of RNA and provides reproducible results using 2.5 μg of total RN A.

[0031] Protein in a sample can be detected using a variety of methods, such as protein immunostaining, immunoprecipitation, protein microarray, radio-immunoassay, and Western blot, all of which are well known in the art. Immunostaining is a general term in biochemistry that applies to any use of an antibody-based method to detect a specific protein in a sample. Similarly, immunoprecipitation is the technique of precipitating an antigen out of solution using an antibody specific to that antigen. This process can be used to enrich a given protein to some degree of purity. A Western blot is a method by which protein may be detected in a given sample of tissue homogenate or extract. It uses gel electrophoresis to separate denatured proteins by mass. The proteins are then transferred out of the gel and onto a membrane (typically nitrocellulose), where they are "probed" using antibodies specific to the protein. As a result, researchers can examine the amount of protein in a given sample and compare levels between several groups. [0032] The expression level of CPE-ΔΝ can be correlated to a prognosis by comparing the biomarker expression level in the sample to biomarker expression in surrounding non-tumor tissue or to a standard. The standard with which the sample is compared can be a normalized standard and/or can be a sample taken at an earlier time from the same subject. That is, the sample can be compared to a sample taken from the same subject prior to treatment or the subject after treatment has commenced (i.e., the subject at an earlier time). In this way, the efficacy of treatment also can be determined.

[0033] The prognosis of the cancer in a subject can be determined in the inventive method. The cancer can be from a primary tumor and/or a metastatic lesion. In this regard, the prognosis can be that the cancer in the subject is or is not likely to metastasize or already has metastasized. The prognosis can be that the cancer in the subject is or is not a metastatic lesion. The prognosis also can include combinations of the above.

[0034] The diagnosis of cancer in a subject can be determined in the inventive method.

Cancer cells are circulating in the blood even before a tumor is formed. After the tumor is formed, the tumor continually sheds cancer cells, which circulate in the blood. The expression level of CPE-ΔΝ in the sample can be used to determine whether a subject has cancer. For example, if the expression level of CPE-ΔΝ in a sample is >2 (e.g., 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, or greater) times than that of a control sample (e.g., a sample from a subject without cancer), the diagnosis is that the subject has cancer.

[0035] Additionally, the expression level of CPE-ΔΝ in a sample (e.g., blood sample) can be used to diagnose a suspected cancer as metastatic or having an increased risk of recurrence and future metastases. Even if a clinician diagnoses a cancer as benign based on the pathology of the primary tumor and the absence of visible metastases, a patient with increased expression of CPE- ΔΝ mRNA in the tumor has an increased risk of recurrence and future metastases (e.g., within 2, 3, 4, 5, 6, 7, 8, 9, or 10 years from resection of the primary tumor) based on the expression level of CPE-ΔΝ mRNA in the tumor. A patient with an increased expression of CPE-ΔΝ mRNA should be closely monitored for recurrence and metastases.

[0036] In one embodiment, the prognosis of cancer is based on the ratio of CPE-ΔΝ mRNA in tumor (T) versus non-tumor (NT) tissue. In particular, subjects with CPE-ΔΝ (e.g., mRNA or protein) T/NT ratios of <2 are much less likely than subjects with CPE-ΔΝ T/NT ratios of >2 (e.g., 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, or greater) to have metastatic cancer or a recurrence of cancer (e.g., metastatic cancer).

[0037] In another embodiment, the prognosis and/or diagnosis of cancer is based on the copy number of CPE-ΔΝ mRNA in tumor tissue. The copy number can be determined by any suitable method (e.g., quantitative RT-PCR).

[0038] When the cancer is kidney cancer, CPE-ΔΝ mRNA copy numbers in tumor tissue of less than 6,000 (e.g., 5,000 or less, 4,000 or less, 3,000 or less, 2,000 or less, or 1 ,000 or less) correlate to a prognosis that the tumor is benign. Patients in this group have a low risk of recurrence or metastasis (e.g., within 2, 3, 4, 5, 6, 7, 8, 9, or 10 years from resection of the primary tumor). In contrast, CPE-ΔΝ mRNA copy numbers in tumor tissue of 6,000 or greater (e.g., 7,000 or greater, 8,000 or greater, 9,000 or greater, 10,000 or greater, 1 1 ,000 or greater, 12,000 or greater, 13,000 or greater, 14,000 or greater, 15,000 or greater, 20,000 or greater, or 25,000 or greater) correlate with a prognosis that the tumor is metastatic.

[0039] The invention also provides a kit to measure CPE-ΔΝ mRNA and protein (e.g., from tissue biopsies and resected primary tumor tissues) for diagnostic or assay purposes. For example, the kit can comprise one or more primer pairs that detect CPE-ΔΝ mRNA levels and/or one or more probes that detect CPE-ΔΝ protein levels. Preferably, the primers and probes can differentiate between CPE-ΔΝ and wild-type CPE. The kits can be used to determine metastasis in a subject, to predict future recurrence/metastasis, and/or to monitor tumor progression in a subject (e.g., to determine efficacy of a cancer treatment). In a particular embodiment, the one or more primer pairs include SEQ ID NO: 5 and SEQ ID NO: 6.

[0040] The invention further provides a method of treatment for the subject that is accordance with the determined prognosis. The treatment can be any suitable treatment.

Suitable treatments include chemotherapy, radiation, surgery, suppression of CPE-ΔΝ, NEDD9 inhibition, and combinations thereof. Methods of chemotherapy, radiation, and surgical intervention are well within the art and can be determined on a case-by-case basis depending on the location, type, and stage of the cancer.

[0041] In one embodiment, the treatment includes suppression of CPE-ΔΝ. In this regard, an effective amount of an inhibitor of CPE-ΔΝ is administered to the subject. Desirably, the inhibitor prevents metastasis or slows the progression of metastasis (e.g., by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%).

[0042] The inhibitor can be administered at any time following a prognosis determination. The inhibitor can be administered alone or in combination with other treatments. For instance, the inhibitor can be administered prior to surgical resection of a tumor. The inhibitor also can be administered following surgical resection of a tumor. One skilled in the art can readily determine an effective amount of the inhibitor composition to be administered to a given subject, by taking into account factors such as the size and weight of the subject, the extent of disease penetration, the age, health, and sex of the subject, the route of administration, and whether the administration is regional or systemic.

[0043] One skilled in the art also can readily determine an appropriate dosage regimen for administering a composition that alters biomarker levels or gene expression to a given subject. For example, the composition can be administered to the subject once (e.g. as a single injection or deposition). Alternatively, the composition can be administered multiple times on any suitable schedule, e.g., once or twice daily, monthly, bimonthly, or biannually. The

administration of the treatment to a subject can be for a period ranging from days, weeks, months, or years. In certain embodiments, the treatment continues throughout the life of the subject. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of the composition administered to the subject can comprise the total amount of composition administered over the entire dosage regimen.

[0044] The inhibitor can be any suitable entity that suppresses/inhibits expression or transcriptional activity of CPE-ΔΝ. For example, the inhibitor can comprise a nucleic acid that is complementary to DNA or RNA (i.e., mRNA or tRNA) of CPE-ΔΝ that binds to and inhibits expression of CPE-ΔΝ. Alternatively, the treatment can include the administration of a NEDD9 inhibitor comprising a nucleic acid that is complementary to the NEDD9 DNA or RNA (i.e., mRNA or tRNA).

[0045] In this regard, the invention further provides a composition comprising an inhibitor of CPE-ΔΝ and/or a NEDD9 inhibitor and a pharmaceutically acceptable carrier.

[0046] Suitable compositions for inhibiting the expression of genes, such as the gene encoding CPE-ΔΝ and/or NEDD9, include double-stranded RNA (such as short- or small- interfering RNA or "siRNA"), antisense nucleic acids, and enzymatic RNA molecules such as ribozymes. These components can be targeted to a given biomarker gene product and can destroy or induce the destruction of the target biomarker gene product.

[0047] For example, expression of a given gene can be inhibited by inducing RNA interference of the gene with an isolated double-stranded RNA ("dsRNA") molecule which has at least 90%, for example, at least 95%, at least 98%, at least 99%, or 100%, sequence identity/homology with at least a portion of the gene product. In a preferred embodiment, the dsRNA molecule is a "short or small interfering RNA" or "siRNA" (e.g., shRNA).

[0048] siRNA useful in the inventive methods comprise short double-stranded RNA from about 17 nucleotides to about 29 nucleotides in length, and preferably from about 19 to about 25 nucleotides in length. The siRNA comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (hereinafter "base-paired"). The sense strand comprises a nucleic acid sequence which is substantially identical to a nucleic acid sequence contained within the target gene product.

[0049] As used herein, an siRNA "substantially identical" to a target sequence contained within the target nucleic sequence is a nucleic acid sequence that is identical to the target sequence or differs from the target sequence by at most one or two nucleotides. The sense and antisense strands of the siRNA can comprise two complementary, single-stranded RNA molecules, or can comprise a single molecule in which two complementary portions are base- paired and are covalently linked by a single-stranded "hairpin" area (shRNA).

[0050] The siRNA also can be altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides. Such alterations can include the addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, or modifications that make the siRNA resistant to nuclease digestion, or the substitution of one or more nucleotides in the siRNA with

deoxyribonucleotides.

[0051] One or both strands of the siRNA also can comprise a 3' overhang. As used herein, a "3' overhang" refers to at least one unpaired nucleotide extending from the 3 '-end of a duplexed RNA strand. Thus, in one embodiment, the siRNA comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxyribonucleotides) in length, preferably from 1 to about 5 nucleotides in length, more preferably from 1 to about 4 nucleotides in length, and most preferably from about 2 to about 4 nucleotides in length. In a preferred embodiment, the 3 ' overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA can comprise 3 ' overhangs of dithymidylic acid ("TT") or diuridylic acid ("uu").

[0052] The siRNA can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector (e.g., lentiviral, adenoviral, or retroviral vector), as described above for the isolated gene product. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in U.S. Patent Application Publication No. 2002/0173478 and U.S. Patent 7,148,342, the entire disclosures of which are incorporated herein by reference. Examples of shRNA include SEQ ID NOs: 17-19.

[0053] Expression of a given gene also can be inhibited by an antisense nucleic acid. As used herein, an "antisense nucleic acid" refers to a nucleic acid molecule that binds to target RNA by means of RNA-RNA or RNA-DNA or RNA-peptide nucleic acid interactions, which alter the activity of the target RNA. Antisense nucleic acids suitable for use in the inventive methods are single-stranded nucleic acids (e.g., RNA, DNA, RNA-DNA chimeras, and peptide- nucleic acids (PNA)) that generally comprise a nucleic acid sequence complementary to a contiguous nucleic acid sequence in a gene product. Preferably, the antisense nucleic acid comprises a nucleic acid sequence that is 50-100% complementary, more preferably 75-100% complementary, and most preferably 95-100% complementary, to a contiguous nucleic acid sequence in a gene product.

[0054] Antisense nucleic acids can also contain modifications to the nucleic acid backbone or to the sugar and base moieties (or their equivalent) to enhance target specificity, nuclease resistance, delivery, or other properties related to efficacy of the molecule. Such modifications include cholesterol moieties, duplex intercalators such as acridine, or the inclusion of one or more nuclease-resistant groups.

[0055] Antisense nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated gene products. Exemplary methods for producing and testing are within the skill in the art, as disclosed in, for example, Stein, Science, 261 : 1004 (1993), and U.S. Patent 5,849,902, the entire disclosures of which are incorporated herein by reference.

[0056] Expression of a given gene also can be inhibited by an enzymatic nucleic acid. As used herein, an "enzymatic nucleic acid" refers to a nucleic acid comprising a substrate binding region that has complementarity to a contiguous nucleic acid sequence of a gene product, and which is able to specifically cleave the gene product. Preferably, the enzymatic nucleic acid substrate binding region is 50-100% complementary, more preferably 75-100% complementary, and most preferably 95-100% complementary, to a contiguous nucleic acid sequence in a biomarker gene product. The enzymatic nucleic acids also can comprise modifications at the base, sugar, and/or phosphate groups. An exemplary enzymatic nucleic acid for use in the inventive methods is a ribozyme.

[0057] The enzymatic nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated gene products. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in Werner, Nucl. Acids Res., 23 : 2092-96 (1995); Hammann, Antisense and Nucleic Acid Drug Dev., 9: 25-31 (1999); and U.S. Patent 4,987,071 , the entire disclosures of which are incorporated herein by reference.

[0058] The inventive composition can be administered to a subject by any means suitable for directly or indirectly delivering these compositions to the subject (e.g., the lungs, stomach, and/or blood vessels of the subject). For example, the compositions can be administered by methods suitable to transfect cells of the subject with these compositions. Preferably, the cells are transfected with a plasmid or viral vector comprising sequences encoding at least one biomarker gene product or biomarker gene expression inhibiting product.

[0059] Transfection methods for eukaryotic cells are well known in the art, and include, e.g., direct injection of the nucleic acid into the nucleus or pronucleus of a cell, electroporation, liposome transfer or transfer mediated by lipophilic materials, receptor-mediated nucleic acid delivery, bioballistic or particle acceleration, calcium phosphate precipitation, and transfection mediated by viral vectors.

[0060] For example, cells can be transfected with a liposomal transfer composition, e.g., DOTAP (N-[l-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate, Boehringer-Mannheim) or an equivalent, such as LIPOFECTIN™ reagent (Invitrogen

Corporation). The amount of nucleic acid used is not critical to the practice of the invention; acceptable results may be achieved with 0.1-100 micrograms of nucleic acid/10 ⁵ cells. For example, a ratio of about 0.5 micrograms of plasmid vector in 3 micrograms of DOTAP per 10 ⁵ cells can be used.

[0061] The composition also can be administered to a subject by any suitable enteral or parenteral administration route. Suitable enteral administration routes include, e.g., oral or intranasal delivery. Suitable parenteral administration routes include, e.g., intravascular administration (e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion, and catheter instillation into the vasculature); subcutaneous injection or deposition, including subcutaneous infusion (such as by osmotic pumps); direct application to the tissue of interest (i.e., lung, liver tissue, etc.), for example by a catheter or other placement device (e.g., an implant comprising a porous, non-porous, or gelatinous material); intramuscular injection; and inhalation.

[0062] The composition can be administered to the subject either as naked RNA, in combination with a delivery reagent, or as a nucleic acid (e.g., a recombinant plasmid or viral vector) comprising sequences that express the biomarker gene product or expression inhibiting composition. Suitable delivery reagents include, e.g., the Mirus Transit TKO lipophilic reagent, LIPOFECTIN™ reagent (Invitrogen Corporation), LIPOFECT AMINE™ reagent (Invitrogen Corporation), CELLFECTIN™ reagent (Invitrogen Corporation), polycations (e.g., polylysine), and liposomes.

[0063] Recombinant plasmids and viral vectors comprising sequences that express the biomarker or biomarker gene expression inhibiting compositions, and techniques for delivering such plasmids and vectors to a tissue, are discussed above.

[0064] In a preferred embodiment, liposomes are used to deliver a gene expression-inhibiting composition (or nucleic acids comprising sequences encoding them) to a subject. Liposomes can also increase the blood half-life of the gene products or nucleic acids.

[0065] Liposomes suitable for use in the invention can be formed from standard vesicle- forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example, as described in Szoka, Ann. Rev. Biophys. Bioeng., 9: 467 (1980); and U.S. Patents 4,235,871 , 4,501 ,728, 4,837,028, and

5,019,369, the entire disclosures of which are incorporated herein by reference.

[0066] The liposomes can comprise a ligand molecule that targets the liposome to lungs (i.e., small airways and/or large airways). Ligands which bind to receptors prevalent in the lungs, such as monoclonal antibodies that bind small airway epithelial cells, are preferred.

[0067] The composition of the invention typically includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier can be any suitable pharmaceutically acceptable carrier, such as one or more compatible solid or liquid fillers, diluents, other excipients, or encapsulating substances which are suitable for administration into a human or veterinary patient. The pharmaceutically acceptable carrier can be an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application of the active ingredient. The pharmaceutically acceptable carrier desirably is co-mingled with one or more of the active components, and with each other, in a manner so as not to substantially impair the desired pharmaceutical efficacy of the active components. Pharmaceutically acceptable carriers desirably are capable of administration to a patient without the production of undesirable physiological effects such as nausea, dizziness, rash, or gastric upset. It is, for example, desirable for the pharmaceutically acceptable carrier not to be immunogenic when administered to a human patient for therapeutic purposes.

[0068] The pharmaceutical composition optionally can contain suitable buffering agents, including, for example, acetic acid in a salt, citric acid in a salt, boric acid in a salt, and phosphoric acid in a salt. The pharmaceutical composition also optionally can contain suitable preservatives, such as benzalkonium chloride, chlorobutanol, parabens, and thimerosal.

[0069] The pharmaceutical composition conveniently can be presented in unit dosage form and can be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing the active agent into association with a carrier that constitutes one or more accessory ingredients. In general, the composition is prepared by uniformly and intimately bringing the active component(s) into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. [0070] A composition suitable for parenteral administration conveniently comprises a sterile aqueous preparation of the inventive composition, which is preferably isotonic with the blood of the recipient. This aqueous preparation can be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also can be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1 ,3-butane diol. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed, including synthetic mono-or di- glycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables. Carrier formulations suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, which is incorporated herein by reference thereto.

[0071] The composition of the invention can be in the form of a time-released, delayed release, or sustained release delivery system. The inventive composition can be used in conjunction with other therapeutic agents or therapies. Such an approach can avoid repeated administrations of the inventive composition, thereby increasing convenience to the subject and the physician, and may be particularly suitable for certain compositions of the invention.

[0072] Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide),

copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent 5,075,109. Delivery systems also include non-polymer systems that are lipids including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which the active component is contained in a form within a matrix such as those described in U.S. Patents 4,452,775, 4,667,014, 4,748,034, and 5,239,660 and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patents 3,832,253 and 3,854,480. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.

[0073] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.

EXAMPLE 1

[0074] This example provides the materials and methods for Examples 2-4.

[0075] Patients and tissue sample preparation

[0076] A total of 16 frozen clear cell renal cell carcinoma (ccRCC) specimens and 6 papillary renal cell carcinoma (pRCC) were used for the study. All the samples were collected at the Department of Urology, Comenius University School of Medicine, Bratislava, Slovakia, between 2009 and 2010 from RCC patients. Tissue was collected or surgical waste harvested under a clinical protocol, which was approved by the Institutional Review Board, and informed consent was obtained from each patient before surgery. Renal tumors were classified for their histological type at the Cytopathos, spol. s r.o., Bratislava, Slovakia. All patients with benign tumors did not receive treatment post surgery.

[0077] Total RNA Extraction and Determination of CPE ΔΝ mRNA copy numbers

[0078] Total RNA was extracted from frozen tumor tissues after homogenization in

TRIZOL™ reagent (Invitrogen) followed by RNEASY™ Mini kit (Qiagen) according to the manufacturer's recommendations. Total RNA (0.2 μg) was then converted to cDNA using the Roche first strand synthesis kit (Roche, Indianapolis, IN).

[0079] CPE-ΔΝ mRNA copy numbers were determined by setting up a standard curve using known concentrations of hCPE-ΔΝ cDNA. A complete clone of hCPE-ΔΝ cDNA was excised from its plasmid and purified, and its concentration determined spectrophotometrically. The conversion of microgram value to picomoles was performed using the formula: pmol of dsDNA = μg (of dsDNA) x 106 pg/1 μg x 1 pmol/660 pg x 1/Nbp (Nbp = length of the amplicon in bp, dsDNA = double standard DNA). Serial dilutions of the cDNA were made and used as templates for qRT-PCR to generate a standard curve. The qRT-PCR was carried out in triplicate for eight different concentrations using primers specific for hCPE-ΔΝ (fwd: 5'

ATGGCCGGGCATGAGGCGGC 3' (SEQ ID NO: 5) and rev: 5' GCTGCGCCCCACCGTGTAAA 3' (SEQ ID NO: 6)). The crossing point was determined from the qRT-PCR program and averaged for each point and plotted as a function of the starting template concentration expressed as template copy number.

[0080] For the RCC samples, conditions in the qRT-PCR using CPE-ΔΝ specific primers were as follows: initial denaturation for 5 min at 95 °C, followed by 45 cycles of 15 s at 95 °C, 15 s at 62 °C and 5 s at 72 °C. The PCR reaction was followed by a melting curve program (65- 95 °C) with a heating rate of 0.1 °C per second and a continuous fluorescence measurement and a cooling program at 40 °C. Crossing point values were converted to copy numbers using the standard curve as described above. Negative controls consisting of no-template (water) reaction mixtures were run with all reactions. PCR products also were run on agarose gels to confirm the formation of a single product of the predicted size.

[0081] Statistical procedures

[0082] GraphPad Prism version 5.01 (GraphPad Software, Inc, La Jolla, CA) was used for the statistical analyses. The primary aim of this analysis was to determine whether baseline CPE-ΔΝ mRNA copy number was a diagnostic biomarker for metastasis in ccRCC specimens. The analysis for patient samples was performed with the nonparametric χ2 test and the Fisher's exact test when it was appropriate.

[0083] The confidence intervals (CIs) around sensitivity and specificity were calculated using a web calculator (VassarStats; Vassar College, Poughkeepsie, NY;

vassarstats.net/clinl .html, last accessed November 1 , 201 1).

EXAMPLE 2

[0084] This example provides the cut-off threshold level of CPE-ΔΝ mRNA copy number for metastasis in RCC.

[0085] A set of kidney tumor specimens from patients without metastasis (n = 6) and with metastasis (n = 4) were used as a training set for determination of threshold CPE-ΔΝ mRNA copy numbers to develop a signature associated with metastasis in RCC. Using qPCR, the CPE- ΔΝ mRNA copy number expression in the training set of kidney tumor samples was analyzed. A cut-off of 6000 CPE-ΔΝ mRNA copies per 200 η μΐ, total RNA was established as a threshold value for metastasis. The clinical characteristics and CPE-ΔΝ mRNA copies in the specimens from the training set are summarized in Table 1 and Figure 1.

Table 1. Clinical characteristics and CPE-ΔΝ mRNA copies in the training

EXAMPLE 3

[0086] This example provides CPE-ΔΝ mRNA copy numbers in renal cell carcinomas.

[0087] CPE-ΔΝ mRNA copies per 200 ng/μΕ total RNA were assayed by qRT-PCR in tumor specimens from a cohort of patients with ccRCC or pRCC. The specimens were assayed in a blinded manner. Their clinical profiles and CPE-ΔΝ mRNA copy numbers are summarized in Table 2 and Figure 2.

Table 2. Clinical characteristics and CPE-ΔΝ mRNA copies in RCCs.

[0088] Five samples were found to have values above the cut-off threshold level, and these patients had metastatic ccRCCs at time of surgery. Six ccRCC and 5 pRCC samples had CPE- ΔΝ mRNA copies that were below the cut-off threshold levels, and these patients did not show metastasis at time of surgery. However, there were 5 ccRCC samples and 1 pRCC sample that showed CPE-ΔΝ copy numbers above the cut-off level, and these patients did not have metastasis at time of surgery.

[0089] Based on their CPE-ΔΝ mRNA copy number (>6000) in the resected tumor specimen, these patients were predicted to be at high risk of developing metastatic disease in the future. Follow-up of this group of patients 3 years post-surgery showed that 2 patients had developed metastatic disease (see Table 2 and Figure 2). Two of these patients were still disease-free, and 2 of these patients were not available (see Table 2). Other parameters, such as a patient's sex, age, tumor grade and stage, did not reliably predict future metastasis. It is also evident that where follow-up data were available, 7 out of 9 patients with benign tumors that had a CPE-ΔΝ mRNA copy number less than the cut-off were disease-free 3 years post-surgery (see Table 2).

EXAMPLE 4

[0090] This example demonstrates CPE-ΔΝ as a diagnostic and prognostic biomarker for RCC.

[0091] By using a cut-off equal to 6,000 mRNA copies relative quantification units, and using the status of all 22 patients at time of surgery in the analysis, the diagnostic accuracy of the biomarker for metastasis was found to have a specificity of 65% (95% CI, 41 % to 87%) and a sensitivity of 100% (95% CI, 56% to 100%).

[0092] By using a cut-off value of 6,000 mRNA copies for the calculations, a positive likelihood ratio of 2.8 (95% CI, 1.48 to 5.39) was obtained (see Table 3).

[0093] Specificity for CPE-ΔΝ was maintained even with a cut-off value of 15,000 mRNA copies. There was a statistically significant increase in expression of CPE-ΔΝ in metastatic samples compared with benign (p<0.01) using Fisher Exact Probability Test. No significant difference in CPE-ΔΝ expression levels was found between males and females.

[0094] There was a statistically significant positive correlation between CPE-ΔΝ expression and tumor size (p = 0.215) (data not shown). This correlation, however, may be clinically insignificant.

[0095] Prognostic accuracy of CPE-ΔΝ for metastasis was found to have a specificity and sensitivity of 77.7% (95% CI, 45% to 94%) with a positive predictive (PPR) value of 77.7%, a positive likelihood ratio of 3.5 (95% CI, 0.98 to 12.47) and a diagnostic odds ratio (DOR) of 12.25 (95% CI, 1.32 to 1 13.06) (see Table 4). Table 3. Diagnostic values of sensitivity and specificity of CPE-ΔΝ as a biomarker with different cut-off values.

CI = confidence interval

NA = not available

Table 4. Prognostic values of sensitivity and specificity of CPE-ΔΝ as a biomarker with different cut-off values.

CI = confidence interval

NA = not available

[0096] These results demonstrate that the inventive methods are suitable for diagnosis and prognosis of cancers, such as kidney cancer, in subjects. In particular, these findings show that CPE-ΔΝ is a biomarker that diagnoses metastasis with high accuracy in renal cell carcinoma patients. The biomarker could also identify patients with aggressive tumors that have been diagnosed as benign from histopathology but have a high probability of future metastasis, thereby placing those patients into a high risk category.

[0097] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0098] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non- claimed element as essential to the practice of the invention.

[0099] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.