The invention relates to a method for preparing alpha-ketopimelic acid (hereinafter also referred to as ΆΚΡ'; AKP is also known as 2-oxo-heptanedioic acid). The invention further relates to a method for preparing 5-formylpentanoic acid (hereinafter also referred to as '5-FVA') and to a method for preparing 6-aminocaproic acid (hereinafter also referred to as '6-ACA'). The invention also relates to a method for preparing diaminohexane (also known as 1 ,6-hexanediamine). The invention further relates to a heterologous cell which may be used in a method according to the invention. The invention further relates to the use of a heterologous cell in the preparation of ε-caprolactam (hereafter referred to as 'caprolactam'), 6-aminocaproic acid, adipate or diaminohexane.

Diaminohexane is inter alia used for the production of polyamides such as nylon 6,6. Other uses include uses as starting material for other building blocks (e.g. hexamethylene diisocyanate) and as crosslinking agent for epoxides. A Known preparation method proceeds from acrylonitrile via adiponitrile.

Adipic acid (hexanedioic acid) is inter alia used for the production of polyamide. Further, esters of adipic acid may be used in plasticisers, lubricants, solvent and in a variety of polyurethane resins. Other uses of adipic acid are as food acidulans, applications in adhesives, insecticides, tanning and dyeing. Known preparation methods include the oxidation of cyclohexanol or cyclohexanone or a mixture thereof (KA oil) with nitric acid.

Caprolactam is a lactam which may be used for the production of polyamide, for instance nylon-6 or nylon-6,12 (a copolymer of caprolactam and laurolactam). Various manners of preparing caprolactam from bulk chemicals are known in the art and include the preparation of caprolactam from cyclohexanone, toluene, phenol, cyclohexanol, benzene or cyclohexane. These intermediate compounds are generally obtained from mineral oil. In view of a growing desire to prepare materials using more sustainable technology it would be desirable to provide a method wherein caprolactam is prepared from an intermediate compound that can be obtained from a biologically renewable source or at least from an intermediate compound that is converted into caprolactam using a biochemical method. Further, it would be desirable to provide a method that requires less energy than conventional chemical processes making use of bulk chemicals from petrochemical origin.

It is known to prepare caprolactam from 6-ACA, e.g. as described in US-A 6, 194,572. As disclosed in WO 2005/068643, 6-ACA may be prepared biochemically by converting 6-aminohex-2-enoic acid (6-AHEA) in the presence of an enzyme having a,b-enoate reductase activity. The 6-AHEA may be prepared from lysine, e.g. biochemically or by pure chemical synthesis. Although the preparation of

6-ACA via the reduction of 6-AHEA is feasible by the methods disclosed in WO 2005/068643, the inventors have found that - under the reduction reaction conditions - 6-AHEA may spontaneously and substantially irreversibly cyclise to form an undesired side-product, notably b-homoproline. This cyclisation may be a bottleneck in the production of 6-ACA, and may lead to a considerable loss in yield.

In WO 2009/113855 a novel method is disclosed wherein 6-ACA is biocatalytically prepared from a different compound, namely AKP. WO 2009/1 13855 refers to a number of ways to obtain AKP: by a chemical process, by extraction from a natural source, or biocatalytically. A biocatylic pathway that is proposed in general in WO 2009/113855 is preparing AKP biocatalytically using an Aks enzyme system, wherein AKP is obtained by C1 -elongation from alpha-ketoglutaric acid (AKG).

However, it would be desirable to provide a method for preparing AKP biocatalytically which has an increased yield of AKP or an increased yield of 6- ACA or another product (e.g. diaminohexane) obtained by further converting the biocatalytically obtained.

It is an object of the invention to provide a novel method for preparing

AKP, which may be used, in particular, for the preparation of 6-ACA, diaminohexane or another compound of interest, in particular such a method with an improved product yield within a relatively reaction time.

It is further an object to provide a novel biocatalyst, suitable for catalysing one or more reaction step in a method for preparing AKP.

One or more further objects which may be solved in accordance with the invention will follow from the description below.

The inventors have realized it is possible to prepare AKP using a specific biocatalyst, comprising a plurality of enzymatic activities, wherein at least two of said enzymatic activities are selected from a specific group of enzymatic activities.

Accordingly, the invention relates to a method for preparing alpha- ketopimelic acid, comprising converting alpha-ketoglutaric acid into alpha-ketoadipic acid and converting alpha-ketoadipic acid into alpha-ketopimelic acid, wherein at least one of these conversions is carried out using a heterologous biocatalyst catalysing at least one of these conversions, wherein the heterologous biocatalyst comprises - an AksD enzyme having homo _n -aconitase activity or a homologue thereof having homo _n - aconitase activity,

- an AksE enzyme having homo _n -aconitase activity or a homologue thereof having homon-aconitase activity,

- an AksF enzyme having homo _n -isocitrate dehydrogenase or a homologue thereof having homo _n -aconitase activity,

wherein at least one enzyme selected from the group of the AksD enzyme, the AksE enzyme and the AksF enzyme and the homologues of any of these, is an Aks enzyme from Methanococcus aeolicus or a functional analogue thereof.

In a preferred method of the invention, the biocatalyst further comprises an NifV enzyme or another Aks enzyme having homo _(n) -Citrate activity or a homologue thereof having homo _(n) Citrate activity.

The AKP may for instance be used as an intermediate in the preparation of 5-formylpentanoic acid (5-FVA).

Accordingly, the invention further relates to a method for preparing 5-

FVA comprising biocatalytically decarboxylating AKP prepared in a method according to the invention, thereby forming 5-FVA.

The 5-FVA is for instance a suitable intermediate compound for preparing 6-ACA, caprolactam, adipic acid or diaminohexane.

The AKP may for instance be used as an intermediate in the preparation of alpha amino-pimelic acid (AAP).

Accordingly, the invention further relates to a method for preparing AAP comprising biocatalytically transaminating AKP prepared in a method according to the invention, thereby forming AAP.

The AAP is for instance a suitable intermediate compound for preparing 6-ACA, or caprolactam.

6-ACA may for instance be converted into caprolactam or into diaminohexane.

The invention further provides a heterologous cell, comprising one or more heterologous nucleic acid sequences encoding one or more heterologous enzymes capable of catalysing at least one reaction step in the preparation of

alpha-ketopimelic acid from alpha-ketoglutaric acid.

Such cell may in particular be used as a biocatalyst in a method for preparing at least one compound selected from the group of AKP, 5-FVA, 6-ACA, diaminohexane and caprolactam. In accordance with the invention, no problems have been noticed with respect to an undesired cyclisation of an intermediate product, when forming 6-ACA and optionally caprolactam, resulting in a loss of yield.

As is illustrated in the examples, an increased yield in AKP or a product obtained by further converting AKP, such as 6-ACA or AAP (alpha- aminopimelic acid) is achieved within a specific reaction time, when one or more Aks enzymes from M. aeolicus is used.

The term "or" as used herein is defined as "and/or" unless specified otherwise.

The term "a" or "an" as used herein is defined as "at least one" unless specified otherwise.

When referring to a noun (e.g. a compound, an additive, etc.) in the singular, the plural is meant to be included.

When referring herein to carboxylic acids or carboxylates, e.g. 6-ACA, AAP, another amino acid, or AKP, these terms are meant to include the protonated carboxylic acid group (i.e. the neutral group), their corresponding carboxylate (their conjugated bases) as well as salts thereof. When referring herein to amino acids, e.g.

6-ACA, this term is meant to include amino acids in their zwitterionic form (in which the amino group is in the protonated and the carboxylate group is in the deprotonated form), the amino acid in which the amino group is protonated and the carboxylic group is in its neutral form, and the amino acid in which the amino group is in its neutral form and the carboxylate group is in the deprotonated form, as well as salts thereof.

When referring to a compound of which stereoisomers exist, the compound may be any of such stereoisomers or a combination thereof. Thus, when referred to, e.g., an amino acid of which enantiomers exist, the amino acid may be the

L-enantiomer, the D-enantiomer or a combination thereof. In case a natural

stereoisomer exists, the compound is preferably a natural stereoisomer.

When an enzyme is mentioned with reference to an enzyme class

(EC) between brackets, the enzyme class is a class wherein the enzyme is classified or may be classified, on the basis of the Enzyme Nomenclature provided by the

Nomenclature Committee of the International Union of Biochemistry and Molecular

Biology (NC-IUBMB), which nomenclature may be found at

http://www.chem.qmul.ac.uk/iubmb/enzyme/. Other suitable enzymes that have not

(yet) been classified in a specified class but may be classified as such, are meant to be included. The term "homologue" is used herein in particular for polynucleotides or polypeptides having a sequence identity of at least 30 %, preferably at least 40 %, more preferably at least 60%, more preferably at least 65%, more preferably at least 70 %, more preferably at least 75%, more preferably at least 80%, in particular at least 85 %, more in particular at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 % or at least 99 %.

Homologues generally have an intended function in common with the polynucleotide respectively polypeptide of which it is a homologue, such as encoding the same peptide respectively being capable of catalysing the same reaction (typically the conversion of the same substrate into the same compound) or a similar reaction. A 'similar reaction' typically is a reaction of the same type, e.g. a decarboxylation, an aminotransfer, a C1-elongation. Accordingly, as a rule of thumb, homologous enzymes can be classified in an EC class sharing the first three numerals of the EC class (x.y.z), for example EC 4.1.1 for carboxylyases. Typically, in the similar reaction, a substrate of the same class (e.g. an amine, a carboxylic acid, an amino acid) as the substrate for the reaction to which the similar reaction is similar is converted into a product of the same class as the product of the reaction to which the similar reaction is similar. Similar reactions in particular include reactions that are defined by the same chemical conversion as defined by the same KEGG RDM patterns, wherein the R-atoms and D- atoms describe the chemical conversion (KEGG RDM patterns: Oh, M. et al. (2007) Systematic analysis of enzyme-catalyzed reaction patterns and prediction of microbial biodegradation pathways. J. Chem. Inf. Model., 47, 1702-1712).

The term "homologue" is also meant to include nucleic acid sequences (polynucleotide sequences) which differ from another nucleic acid sequence due to the degeneracy or experimental adaptation of the genetic code and encode the same polypeptide sequence.

The term "functional analogue" is used herein in relation to enzymes that are capable of catalysing the same reaction and can replace said enzyme in any of the C1 -elongation reactions from AKG to AKP, without adversely affecting the conversion rate of AKG into AKP. Typically, the functional analogue is a homologue, in particular a homologue having a relatively high sequence identity with the enzyme of which it is a functional analogue, preferably having a sequence identity at least 60%, more preferably at least 65%, more preferably at least 70 %, more preferably at least 75%, more preferably at least 80%, in particular at least 85 %, more in particular at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 % or at least 99 %.

The term "functional analogue" is used herein in relation to nucleic acid sequences, for nucleic acid sequences that differ from a given sequence of which said analogue is an analogue, yet that encode a peptide (protein, enzyme) having the same amino acid sequence or that encode a homologue of such peptide. In particular, preferred functional analogues are nucleotide sequences having a similar, the same or a better level of expression in a host cell of interest as the nucleotide sequence of which it is referred to as being a functional analogue of. In this respect it is observed that, as the skilled person understands, a better level of expression usually is a higher level of expression if the expression of the peptide (protein, enzyme) is desired.

However, in specific embodiment a better level of expression may be a lower expression level since this might be desirable in context of a metabolic pathway in said host cell. The functional analogue can be a naturally occurring sequence, i.e. a wild- type functional analogue, or a genetically modified sequence, i.e. a non-wild type functional analogue. Codon optimised sequences encoding a specific peptide, are generally non-wild type functional analogues of a wild-type sequence, designed to achieve a desired expression level.

In particular, preferred functional analogues are nucleotide sequences having a similar, the same or a better level of expression in a host cell of interest as the nucleotide sequence of which it is referred to as being a functional analogue of.

Sequence identity or similarity is herein defined as a relationship between two or more polypeptide sequences or two or more nucleic acid sequences, as determined by comparing the sequences. Usually, Sequence Identities or similarities are compared over the whole length of the sequences, but may however also be compared only for a part of the sequences aligning with each other. In the art, "identity" or "similarity" also means the degree of sequence relatedness between polypeptide sequences or nucleic acid sequences, as the case may be, as determined by the match between such sequences. Preferred methods to determine identity or similarity are designed to give the largest match between the sequences tested. In context of this invention a preferred computer program method to determine identity and similarity between two sequences includes BLASTP and BLASTN (Altschul, S. F. et al., J. Mol. Biol. 1990, 215, 403-410, publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, MD 20894). Preferred parameters for polypeptide sequence comparison using BLASTP are gap open 10.0, gap extend 0.5, Blosum 62 matrix. Preferred parameters for nucleic acid sequence comparison using BLASTN are gap open 10.0, gap extend 0.5, DNA full matrix (DNA identity matrix).

In accordance with the invention, a biocatalyst is used, i.e. at least one reaction step in the method is catalysed by a biological material or moiety derived from a biological source, for instance an organism or a biomolecule derived there from. The biocatalyst may in particular comprise one or more enzymes. The biocatalyst may be used in any form. In an embodiment, one or more enzymes are used isolated from the natural environment (isolated from the organism it has been produced in), for instance as a solution, an emulsion, a dispersion, (a suspension of) freeze-dried cells, as a lysate, or immobilized on a support. In an embodiment, one or more enzymes form part of a living organism (such as living whole cells).

The enzymes may perform a catalytic function inside the cell. It is also possible that the enzyme may be secreted into a medium, wherein the cells are present.

Living cells may be growing cells, resting or dormant cells (e.g.

spores) or cells in a stationary phase. It is also possible to use an enzyme forming part of a permeabilised cell (i.e. made permeable to a substrate for the enzyme or a precursor for a substrate for the enzyme or enzymes).

A biocatalyst used in a method of the invention may in principle be any organism, or be obtained or derived from any organism. The organism may be eukaryotic or prokaryotic. In particular the organism may be selected from animals (including humans), plants, bacteria, archaea, yeasts and fungi.

In an embodiment a biocatalyst originates from an animal, in particular from a part thereof - e.g. liver, pancreas, brain, kidney, heart or other organ. The animal may in particular be selected from the group of mammals, more in particular selected from the group of Leporidae, Muridae, Suidae and Bovidae.

Suitable plants in particular include plants selected from the group of Asplenium; Cucurbitaceae, in particular Curcurbita, e.g. Curcurbita moschata (squash), or Cucumis; Mercurialis, e.g. Mercurialis perennis; Hydnocarpus; and Ceratonia.

Suitable bacteria may in particular be selected amongst the group of Vibrio, Pseudomonas, Bacillus, Corynebacterium, Brevibacterium, Enterococcus, Streptococcus, Klebsiella, Lactococcus, Lactobacillus, Clostridium, Escherichia, Thermus, Mycobacterium, Zymomonas, Proteus, Agrobacterium, Geobacillus,

Acinetobacter, Ralstonia, Rhodobacter, Paracoccus, Novosphingobium, Nitrosomonas, Legionella, Neisseria, Rhodopseudomonas, Staphylococcus, Thermotoga,

Deinococcus and Salmonella.

Suitable archaea may in particular be selected amongst the group of methanogens.

More specifically, suitable archaea may be selected amongst the group of Archaeoglobus, Aeropyrum, Halobacterium, Methanosarcina, Methanococcus, Thermoplasma, Pyrobaculum, Methanocaldococcus, Methanobacterium,

Methanosphaera, Methanopyrus and Methanobrevibacter.

Suitable fungi may in particular be selected amongst the group of Rhizopus, Neurospora, Penicillium and Aspergillus.

A suitable yeast may in particular be selected amongst the group of Candida, Hansenula, Kluyveromyces and Saccharomyces.

It will be clear to the person skilled in the art that use can be made of a naturally occurring biocatalyst (wild type) or a mutant of a naturally occurring biocatalyst with suitable activity in a method according to the invention. Properties of a naturally occurring biocatalyst may be improved by biological techniques known to the skilled person in the art, such as e.g. molecular evolution or rational design. Mutants of wild-type biocatalysts can for example be made by modifying the encoding DNA of an organism capable of acting as a biocatalyst or capable of producing a biocatalytic moiety (such as an enzyme) using mutagenesis techniques known to the person skilled in the art (random mutagenesis, site-directed mutagenesis, directed evolution, gene recombination, etc.). In particular the DNA may be modified such that it encodes an enzyme that differs by at least one amino acid from the wild-type enzyme, so that it encodes an enzyme that comprises one or more amino acid substitutions, deletions and/or insertions compared to the wild-type, or such that the mutants combine sequences of two or more parent enzymes or by effecting the expression of the thus modified DNA in a suitable (host) cell. The latter may be achieved by methods known to the skilled person in the art such as codon optimization or codon pair optimization, e.g. based on a method as described in WO 2008/000632.

A mutant biocatalyst may have improved properties, for instance with respect to one or more of the following aspects: selectivity towards the substrate, activity, stability, solvent tolerance, pH profile, temperature profile, substrate profile, susceptibility to inhibition, cofactor utilization and substrate-affinity. Also one may screen for mutants having enhanced level of proteins (enzymes) of interest, improved resistance against proteases (which catalyze the degradation of the protein), or any other factor affecting the final protein (enzyme) level, Mutants with improved properties can be identified by applying e.g. suitable high through-put screening or selection methods based on such methods known to the skilled person in the art.

When referred to a biocatalyst, in particular an enzyme, from a particular source, recombinant biocatalysts, in particular enzymes, originating from a first organism, but actually produced in a (genetically modified) second organism, are specifically meant to be included as biocatalysts, in particular enzymes, from that first organism.

In particular in an embodiment wherein AKP is to be converted into a further product, for instance 5-FVA, AAP, diaminohexane or 6-ACA, it is considered advantageous that the host cell is an organism naturally capable of converting AKP to such product or at least capable of catalysing at least one of the necessary reactions. For instance, Escherichia coli has aminotransferase activity, whereby E.coli may catalyze the formation of AAP from AKP (see also below) or the conversion of 5-FVA (which may be formed in the cell if the cell also contains a suitable decarboxylase, see also below) to 6-ACA.

In an embodiment, the host cell is an organism comprising a biocatalyst catalysing the amino adipate pathway for lysine biosynthesis (also termed AAA pathway) or a part thereof (such as lower eukaryotes: fungi, yeasts, euglenoids; certain bacteria, e.g. Thermus, Deinococcus; Archaea) or comprising a biocatalyst for nitrogen fixation via a nitrogenase. If such organism comprises contains a gene encoding an enzyme for which AKA or AKP is a substrate, thereby adversely affecting the production of AKP, such gene is preferably knocked out or expression of the gene is preferably suppressed.

In a preferred embodiment, the host cell is an organism with a high flux through the AAA pathway, such as Penicillium chrysogenum, Ustilago maydis or an organism adapted, preferably optimised, for lysine production. A high flux is defined as at least 20%, more preferred at least 50%, even more preferred at least 70%, most preferred at least 100% of the rate required to supply lysine for biosynthesis of cellular protein in the respective organism under the chosen production conditions.

In a preferred embodiment, the host cell is an organism with high levels of homocitrate being produced, which may be a naturally occurring or a heterologous organism. Such an organism may be obtained by expressing a homocitrate synthase required for formation of the essential cofactor found in nitrogenases or a homologue thereof. In an embodiment, the host cell comprises a heterologous nucleic acid sequence originating from an animal, in particular from a part thereof - e.g. liver, pancreas, brain, kidney, heart or other organ. The animal may in particular be selected from the group of mammals, more in particular selected from the group of Leporidae, Muridae, Suidae and Bovidae.

In an embodiment, the host cell comprises a heterologous nucleic acid sequence originating from a plant. Suitable plants in particular include plants selected from the group of Asplenium; Cucurbitaceae, in particular Curcurbita, e.g. Curcurbita moschata (squash), or Cucumis; Brassicaceae, in particular Arabidopsis, e.g. A. thaliana; Mercurialis, e.g. Mercurialis perennis; Hydnocarpus; and Ceratonia.

In an embodiment, the host cell comprises a heterologous nucleic acid sequence originating from a bacterium. Suitable bacteria may in particular be selected amongst the group of Vibrio, Pseudomonas, Bacillus, Corynebacterium, Brevibacterium, Enterococcus, Streptococcus, Actinomycetales, Klebsiella,

Lactococcus, Lactobacillus, Clostridium, Escherichia, Klebsiella, Anabaena,

Microcystis, Synechocystis, Rhizobium, Bradyrhizobium, Thermus, Mycobacterium, Zymomonas, Proteus, Agrobacterium, Geobacillus, Acinetobacter, Azotobacter, Ralstonia, Rhodobacter, Paracoccus, Novosphingobium, Nitrosomonas, Legionella, Neisseria, Rhodopseudomonas, Staphylococcus, Deinococcus and Salmonella.

In an embodiment, the host cell comprises a heterologous nucleic acid sequence originating from an archaea. Suitable archaea may in particular be selected amongst the group of Archaeoglobus, Aeropyrum, Halobacterium,

Methanosarcina, Methanococcus, Thermoplasma, Thermococcus, Pyrobaculum, Methanospirillum, Pyrococcus, Sulfolobus, Methanococcus, Methanosphaera, Methanopyrus, Methanobrevibacter, Methanocaldococcus and Methanobacterium.

In an embodiment, the host cell comprises a heterologous nucleic acid sequence originating from a fungus. Suitable fungi may in particular be selected amongst the group of Rhizopus, Phanerochaete, Emericella, Ustilago, Neurospora, Penicillium, Cephalosporium, Paecilomyces, Trichophytum and Aspergillus.

In an embodiment, the host cell comprises a heterologous nucleic acid sequence originating from yeast. A suitable yeast may in particular be selected amongst the group of Candida, Hansenula, Kluyveromyces, Yarrowia,

Schizosaccharomyces, Pichia, Yarrowia and Saccharomyces.

It will be clear to the person skilled in the art that use can be made of a biocatalyst wherein a naturally occurring biocatalytic moiety (such as an enzyme) is expressed (wild type) or a mutant of a naturally occurring biocatalytic moiety with suitable activity in a method according to the invention. Properties of a naturally occurring biocatalytic moiety may be improved by biological techniques known to the skilled person, e.g. by molecular evolution or rational design. Mutants of wild-type biocatalytic moieties can for example be made by modifying the encoding DNA of an organism capable of producing a biocatalytic moiety (such as an enzyme) using mutagenesis techniques known to the person skilled in the art. These include random mutagenesis, site-directed mutagenesis, directed evolution, and gene recombination. In particular the DNA may be modified such that it encodes an enzyme that differs by at least one amino acid from the wild-type enzyme, so that it encodes an enzyme that comprises one or more amino acid substitutions, deletions and/or insertions compared to the wild-type, or such that the mutants combine sequences of two or more parent enzymes or by effecting the expression of the thus modified DNA in a suitable (host) cell. The latter may be achieved by methods known to the skilled person such as codon optimization or codon pair optimization, e.g. based on a method as described in WO 2008/000632.

In accordance with the invention, AKP is prepared from AKG. The AKG may in principle be obtained in any way. In particular, AKG may be obtained biocatalytically by providing the heterologous biocatalyst with a suitable carbon source that can be converted into AKG, for instance by fermentation of the carbon source. In an advantageous method AKG is prepared making use of a whole cell

biotransformation of the carbon source to form AKG.

The carbon source may in particular contain at least one compound selected from the group of monohydric alcohols, polyhydric alcohols, carboxylic acids, carbon dioxide, fatty acids, glycerides, including mixtures comprising any of said compounds. Suitable monohydric alcohols include methanol and ethanol. Suitable polyols include glycerol and carbohydrates. Suitable fatty acids or glycerides may in particular be provided in the form of an edible oil, preferably of plant origin.

In particular a carbohydrate may be used, because usually carbohydrates can be obtained in large amounts from a biologically renewable source, such as an agricultural product, preferably an agricultural waste-material. Preferably a carbohydrate is used selected from the group of glucose, fructose, sucrose, lactose, saccharose, starch, cellulose and hemi-cellulose. Particularly preferred are glucose, oligosaccharides comprising glucose and polysaccharides comprising glucose.

In an embodiment of the invention AKG is converted into AKA using a biocatalyst for the conversion of AKG into AKA, part of said biocatalyst originating from the AAA pathway for lysine biosynthesis. Such conversion may involve a single or a plurality of reaction steps, which steps may be catalysed by one or more biocatalysts.

The biocatalyst for catalysing the conversion of AKG into AKA or parts thereof may be homologous or heterologous. In particular, the biocatalyst forming part of the AAA pathway for lysine biosynthesis may be found in an organism selected from the group of yeasts, fungi, archaea and bacteria, in particular from the group of Penicillium, Cephalosporium, Paecilomyces, Trichophytum, Aspergillus,

Phanerochaete, Emericella, Ustilago, Schizosaccharomyces, Saccharomyces, Candida, Kluyveromyces, Yarrowia, Pichia, Hansenula, Thermus, Deinococcus, Pyrococcus, Sulfolobus, Thermococcus, Methanococcus, Methanosarcina,

Methanocaldococcus, Methanosphaera, Methanopyrus, Methanobrevibacter,

Methanospirillum and Methanothermobacter. A suitable biocatalyst may be found in an organism able to produce homocitrate ,e.g. a biocatalyst for the nitrogenase complex in nitrogen fixing bacteria such as cyanobacteria (e.g. Anabaena, Microcystis,

Synechocystis) Rhizobiales (e.g. Rhizobium, Bradyrhizobium), g-proteobacteria (e.g. Pseudomonas, Azotobacter, Klebsiella) and actinobacteria (e.g. Frankia).Thus, if a biocatalyst is used based on a host cell naturally comprising the AAA pathway for lysine biosynthesis or parts thereof, this system may be homologous.

In a preferred embodiment of the invention a high productivity of AKA by the biocatalyst is desired. A biocatalyst containing the AAA pathway for lysine biosynthesis or parts thereof may be modified by methods known in the art such as mutation/ screening or metabolic engineering to this effect. A high level of AKA can be generated by increasing the activity of enzymes involved in its formation and/ or decreasing the activity involved in its conversion to e.g. amino adipate.

Enzymes involved in formation of AKA include homocitrate synthase (EC 2.3.3.14), homo aconitase (EC 4.2.1.36), and homoisocitrate dehydrogenase (EC 1.1.1.87). The activity for these enzymes in the host cell can be increased by methods known in the art such as (over-) expression of genes encoding the respective enzyme and/ or functional homologues, alleviating inhibitions by substrates, products or other compounds, or improving catalytic properties of the enzymes by molecular evolution or rational design. A preferred method to perform directed evolution may be based on WO 2003/010183.

As it is undesired that the AKA that is produced is converted to aminoadipate (AAA) - which would be a further step in the pathway for lysine biosynthesis - it is preferred that the heterologous biocatalyst has low or no activity of an enzyme catalysing this conversion, in particular an aminotransferase, such as aminoadipate aminotransferase (EC 2.6.1.39) or amino acid dehydrogenase capable of catalysing this conversion. Thus, in case the host cell providing the biocatalyst comprises a gene encoding such an enzyme, such gene is preferably inactivated, knocked out, or the expression of such gene is reduced. As this step is essential in the AAA pathway for lysine production a host cell which has limited, minimal activity to supply the required amount of lysine for growth and maintenance but is not capable of high level conversions of AKA to AAA is advantageous. In particular in case Penicillium chrysogenum is the host, the aminotransferase may have the sequence of Sequence ID 45, or a homologue thereof.

Inactivation of a gene encoding an undesired activity may be accomplished, by several methods. One approach is a temporary one using an anti- sense molecule or RNAi molecule (e.g. based on Kamath et al. 2003. Nature 421 :231- 237). Another is using a regulatable promoter system, which can be switched off using external triggers like tetracycline (e.g. based on Park and Morschhauser, 2005, Eukaryot. Cell. 4:1328-1342). Yet another one is to apply a chemical inhibitor or a protein inhibitor or a physical inhibitor (e.g. based on Tour et al. 2003. Nat Biotech 21 :1505-1508). A much preferred method is to remove the complete gene(s) or a part thereof, encoding the undesired activity. To obtain such a mutant one can apply state of the art methods like Single Cross-Over Recombination or Double Homologous Recombination. For this, one needs to construct an integrative cloning vector that may integrate at the predetermined target locus in the chromosome of the host cell. In a preferred embodiment of the invention, the integrative cloning vector comprises a DNA fragment, which is homologous to a DNA sequence in a predetermined target locus in the genome of host cell for targeting the integration of the cloning vector to this predetermined locus. In order to promote targeted integration, the cloning vector is preferably linearized prior to transformation of the host cell. Linearization is preferably performed such that at least one but preferably either end of the cloning vector is flanked by sequences homologous to the target locus. The length of the homologous sequences flanking the target locus is preferably at least 0.1 kb, even preferably at least 0.2 kb, more preferably at least 0.5 kb, even more preferably at least 1 kb, most preferably at least 2 kb. The length that finally is best suitable in an experiment depends on the organism, the sequence and length of the target DNA. The efficiency of targeted integration of a nucleic acid construct into the genome of the host cell by homologous recombination, i.e. integration in a predetermined target locus, is preferably increased by augmented homologous recombination abilities of the host cell. Such phenotype of the cell preferably involves a deficient hdfA or hdfB gene as described in WO 05/95624. WO 05/95624 discloses a preferred method to obtain a filamentous fungal cell comprising increased efficiency of targeted integration by preventing non-homologous random integration of DNA fragments into the genome. The vector system may be a single vector or plasmid or two or more vectors or plasmids, which together contain the total DNA to be introduced into the genome of the host cell.

Fungal cells may be transformed by protoplast formation, protoplast transformation, and regeneration of the cell wall. Suitable procedures for transformation of fungal host cells are described in EP 238023 and Yelton et al. (1984. Proc. Nat. Acad. Sci. USA 81 :1470-1474). Suitable procedures for transformation of filamentous fungal host cells using Agrobacterium tumefaciens are described by de Groot M.J. et al. (1998. Nat. Biotechnol. 16:839-842. Erratum in: Nat. Biotechnol. 1998. 16: 1074). Other methods like electroporation, described for Neurospora crassa, may also be applied.

Fungal cells are transfected using co-transformation, i.e. along with gene(s) of interest also a selectable marker gene is transformed. This can be either physically linked to the gene of interest (i.e. on a plasmid) or on a separate fragment. Following transfection transformants are screened for the presence of this selection marker gene and subsequently analyzed for the integration at the preferred

predetermined genomic locus. A selectable marker is a product, which provides resistance against a biocide or virus, resistance to heavy metals, prototrophy to auxotrophs and the like. Useful selectable markers include, but are not limited to, amdS (acetamidase), argB (ornithinecarbamoyltransferase), bar

(phosphinothricinacetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC or sutB (sulfate adenyltransferase), trpC (anthranilate synthase), ble (phleomycin resistance protein), as well as equivalents thereof. The most preferred situation is providing a DNA molecule comprising a first DNA fragment comprising a desired replacement sequence (i.e. the selection marker gene) flanked at its 5' and 3' sides by DNA sequences substantially homologous to sequences of the chromosomal DNA flanking the target sequence. Cells wherein the target sequence in the chromosomal DNA sequence is replaced by the desired replacement sequence can be selected by the presence of the selectable marker of the first DNA fragment. To increase the relative frequency of selecting the correct mutant microbial strain, a second DNA fragment comprising an expression cassette comprising a gene encoding a selection marker and regulatory sequences functional in the eukaryotic cell can be operably linked to the above described fragment (i.e. 5'-flank of target locus + selection marker gene + 3'-flank of target locus) and cells wherein the target sequence in the chromosomal DNA sequence is replaced by the desired replacement sequence can be selected by the presence of the selectable marker of the first DNA fragment and the absence of the second selection marker gene.

In case the enzyme system forming part of the aminoadipate pathway for lysine biosynthesis is heterologous to the host cell, it is preferred that no genes are included into the host cell that encode an enzyme catalysing the conversion of ketoadipate into aminoadipate. The term 'enzyme system' is in particular used herein for a single enzyme or a group of enzymes whereby a specific conversion can be catalysed. Said conversion may comprise one or more chemical reactions with known or unknown intermediates e.g. the conversion of AKG into AKA or the conversion of AKA into AKP. Such system may be present inside a cell or isolated from a cell. It is known that aminotransferases often have a wide substrate range. It may be desired to decrease activity of one or more such enzymes present in a host cell such that activity in the conversion of AKA to AAA is reduced, whilst maintaining relevant catalytic functions for biosynthesis of other amino acids or cellular components. Also a host cell devoid of any other enzymatic activity resulting in the conversion of AKA to an undesired side product is preferred.

The preparation of AKP from AKG is based on a biosynthetic pathway making use of Ci-elongation. The principle of Ci-elongation is known to exist in methanogenic Archaea as part of coenzyme B biosynthesis and part of biotin biosynthesis. Coenzyme B is considered essential for methanogenesis in these organisms and alpha-ketosuberate is an important intermediate in coenzyme B biosynthesis. In such methanogenic Archaea alpha-ketoglutaric acid is converted to alpha-ketoadipic acid, then alpha-ketopimelic acid and finally alpha-ketosuberic acid by successive addition of methylene groups following a plurality of reaction steps (see also Figure 1):

a. alpha-keto-acid of length C _n + acetyl-CoA homo _n citrate + CoA-SH (steps 1 , 5 and 9 in Figure 1) b. homon-citrate > homo _n -aconitate (catalyzed by homo _n -citrate dehydratase (steps 2, 6 and 10 in Figure 1)

c. homo _n aconitate > isohomo _n -citrate (steps 3, 7 and 11) in Figure 1)

d. homon-isocitrate + NADP ⁺ alpha-keto-acid of length C _n+ i + NADPH + H ⁺ + C0 ₂ (steps 4, 8 and 12 in Figure 1)

wherein n is selected from 1-4.

This repetitive reaction sequence has been described for the methanogens Methanosarcina thermophila and Methanocaldococcus jannashii. Similar non-iterative reactions are involved in Ci-extension of other alpha-etocarboxylic acids in other metabolic pathways such as the conversion of oxaloacetate to alpha- ketoglutarate in the oxidative citrate cycle, conversion of alpha-isovalerate to isocaproate as part in the isopropylmalate pathway to leucine, conversion of alpha- ketoglutarate to alpha-ketoadipate in the AAA pathway to lysine, conversion of pyruvate to alpha-ketobutyrate in the pyruvate pathway to isoleucine, and in the conversion of maleate to pyruvate. Collectively these reactions are defined as "C elongation".

Several genes and enzymes involved in Ci-elongations have been described and characterized from M. jannashii. It was shown that these enzymes and the encoding genes are similar to each other and to other enzymes and their encoding genes involved in Ci-elongations in other organisms. A subset of enzymes for the iterative elongation of alpha-ketoglutarate to alpha-ketosuberate via alpha -ketoadipate and alpha -ketopimelate has been characterized biochemically and was called "Aks". Some of the genes encoding these enzymes have been identified in the genome sequence of M. jannashii and others have been proposed.

The inventors have realized that Ci -elongation can be used to prepare AKA or AKP on an industrial scale, such that AKA or AKP can be made available as an intermediate for the preparation of special compounds or commodity products, such as diaminohexane, adipic acid or caprolactam, by incorporating one or more nucleic acid sequences encoding an enzyme system involved in Ci elongation into a suitable host cell.

As indicated above, at least one of the Aks enzymes AksD, AksE, and AksF is from Methanococcus aeolicus or a functiononal analogue thereof. In particular, one or more further enzymes for catalysing Ci elongation for use in accordance with the invention (AksD, AksE, AksF, Nifv or other AksA ) may be used from a methanogen selected from the group of Methanococcus, Methanospirillum, Methanocaldococcus, Methanosarcina, Methanothermobacter, Methanosphaera, Methanopyrus and Methanobrevibacter. More specifically one or more enzymes may be used from a methanogen selected from the group of Methanothermobacter thermoautotropicum, Methanococcus maripaludis, Methanosphaera stadtmanae, Methanopyrus kandleri, Methanosarcina thermophila, Methanococcus vannielii, Methanospirillum hungatei, Methanosaeta thermophila Methanosarcina acetivorans and Methanococcus aeolicus.

Further, suitable enzymes for catalysing Ci elongation of AKG and/or AKA may e.g. be found in organisms comprising an enzyme system for catalysing lysine biosynthesis via the aminoadipate pathway or parts thereof or contain homologues thereof as part of other metabolism such as e.g. homocitrate synthase involved in nitrogen fixation. In particular organisms selected from the group of yeasts and fungi, such as Penicillium, Cephalosporium, Aspergillus, Phanerochaete,

Emericella, Ustilago, Paecilomyces, Trichophytum, Yarrowia, Hansenula,

Schizosaccharomyces, Saccharomyces, Candida, Kluyveromyces, in particular

Penicillium chrysogenum, Penicillium notatum, Paecilomyces carneus, Paecilomyces persinicus, Cephalosporium acremonium, Aspergillus niger, Emericella nidulans, Aspergillus oryzae, Ustilago maydis, Schizosaccharomyces pombe, Saccharomyces cerevisiae, Yarrowia lipolytica, Hansenula polymorpha, Candida albicans, Candida maltosa, and Kluyveromyces lactis; bacteria, such as Azotobacter, Pseudomonas,

Klebsiella, Deinococcus, Thermus, in particular Azotobacter vinelandii, Pseudomonas stutzerii, Klebsiella pneumoniae, Deinococcus radiourans, Deinococcus geothermalis, Thermus thermophilus; and archae, such as Pyrococcus, Sulfolobus, Thermococcus, Methanococcus, Methanocaldococcus, Methanosphaera, Methanopyrus,

Methanospirillum, Methanobrevibacter, Methanosarcina and Methanothermobacter, in particular Pyrococcus horikoshii, Sulfolobus solfataricus, Thermococcus kodakarensis, Methanococcus maripaludis, Methanococcus aeolicus, Methanococcus vannielii, Methanocaldococcus jannashii, Methanosphaera stadtmanae, Methanopyrus kandleri, Methanosarcina thermophilus, Methanospirillum hungatei, Methanosaeta thermophila, Methanosarcina acetivorans and Methanothermobacter thermoautotrophicum. Such yeast, fungus, bacterium, archaeon or other organism may in particular provide a homocitrate synthase capable of catalysing "reaction a" in the elongation of AKG to AKA and optionally the elongation of AKA to APK.

Further, suitable biocatalysts for catalysing a reaction step in the preparation of AKP may be found in Asplenium or Hydnocarpus, in particular Asplenium septentrionale or Hydnocarpus anthelminthica, which naturally are capable of producing AKP.

Further, specific examples of AksA, AksD, AksE and AksF enzymes that may be used are listed in the following tables, homologues thereof may also be used:

Step Enzyme Organism gene Protein name

1 AksA Methanocaldococcus jannashii MJ0503 NP_247

479

Methanothermobacter MTH1630 NP_276 thermoautotropicum ΔΗ 742

Methanococcus maripaludis S2 MMP0153 NP_987

273

Methanococcus maripaludis C5 MmarC5_1522 YP_001

098033

Methanococcus maripaludis 07 MmarC7_1 153

YP_001 330370

Methanospaera stadtmanae DSM Msp_0199 YP_447 3091 259

Methanopyrus kandleri AV19 MK1209 NP_614

492

Methanococcus vannielii SB Mevan 1158 YP_001

323668

Klebsiella pneumoniae nifV P05345

Step Enzyme Organism gene Protein name

Azotobacter vinelandii nifV P05342 Pseudomonas stutzerii nifV ABP790

47

Methanococcus aeolicus Nankai 3 Maeo 0994 YP_001

325184

2, 3 AksD Methanocaldococcus jannashii MJ1003 NP_247

997

Methanothermobacter MTH1386 NP_276 thermoautotropicum ΔΗ 502

Methanococcus maripaludis S2 Mmp1480 NP_988

600

Methanococcus maripaludis C5 MmarC5_0098 YP_001

096630

Methanococcus maripaludis 07 MmarC7_0724 YP_001

329942

Methanospaera stadtmanae DSM Msp_1486 YP_448 3091 499

Methanopyrus kandleri AV19 MK1440 NP_614

723

Step Enzyme Organism gene Protein

name

Methanococcus vannielii SB Mevan 0789 YP_001

323307

Methanococcus aeolicus Nankai 3 Maeo 0311 YP_001

32451 1

Methanosarcina acetivorans MA3085* NP_617

978*

Methanospirillum hungatei JF-1 Mhun_1800* YP_503

240*

Methanosaeta thermophila PT Mthe_0788* YP_843

217*

Methanosphaera stadtmanae DSM Msp_1 100* YP_448

3091 126*

References to gene and protein can be found via www.ncbi.nlm.nih.gov/ (for listed gene/protein marked with an *: as available on 2 March 2010, for the others: as available on 15 April 2008).

Step Enzyme Organism gene Protein name

2, 3 AksE Methanocaldococcus jannashii MJ1271 NP_248267

Methanothermobacter MTH1387 NP_276503 thermoautotropicum ΔΗ

Methanococcus maripaludis S2 MMP0381 NP_987501 Methanococcus maripaludis C5 MmarC5_1257 YP_001097769 Methanococcus maripaludis 07 MmarC7_1379 YP_001330593 Methanospaera stadtmanae DSM Msp_1485 YP_448498 3091

Methanopyrus kandleri AV19 MK0781 NP_614065 Methanococcus vannielii SB Mevan_1368 YP_001323877 Methanococcus aeolicus Nankai Maeo_0652 YP_001324848 3

Methanosarcina acetivorans MA3751* NP_618624* Methanospirillum hungatei JF-1 Mhun_1799* YP_503239* Methanosphaera stadtmanae Msp_0374* YP_447420* DSM 3091

Methanosaeta thermophila PT Mthe 0853* YP 843282*

Step Enzyme Organism gene Protein name

4 AksF Methanocaldococcus jannashii MJ1596 NP_248605

Methanothermobacter MTH184 NP_275327 thermoautotropicum ΔΗ

Methanococcus maripaludis S2 MMP0880 NP988000 Methanococcus maripaludis C5 MmarC5_0688 YP001097214 Methanococcus maripaludis 07 MmarC7_0128 YP_001329349 Methanospaera stadtmanae DSM Msp_0674 YP_447715 3091

Methanopyrus kandleri AV19 MK0782 NP_614066 Methanococcus vannielii SB Mevan_0040 YP_001322567 Methanococcus aeolicus Nankai

3 Maeo_1484 YP_001325672

Methanosarcina acetivorans MA3748* NP_618621* Methanospirillum hungatei JF-1 Mhun_1797* YP_503237* Methanosphaera stadtmanae YP_447715* DSM 3091 Msp_0674*

Methanosaeta thermophila PT Mthe 0855* YP 843284*

References to gene and protein can be found via www.ncbi.nlm.nih.gov/ ((for listed gene/protein marked with an *: as available on 2 March 2010, for the others: as available on 15 April 2008).

The NifV enzyme or functional analogues thereof may in particular be a NifV enzyme from Azotobacter, more in particular Azotobacter vinelandii, or a functional analogue thereof. Alternatives include Nifv enzymes from Klebsiella, in particular Klebsiella pneumoniae, and Pseudomonas, in particular Pseudomonas stutzerii, and functional analogues thereof. In a specifically preferred embodiment, the Nifv enzyme or functional analogue is an enzyme comprising a sequence according to Sequence ID NO: 2, or a functional analogue thereof.

The AksD enzyme or homologue thereof, the AksE enzyme or homologue thereof or the AksF enzyme or homologue thereof may in particular originate from an organism selected from the group of Methanocaldococcus,

Methanothermobacter, Methanococcus, Methanospaera, Methanopyrus,

Methanobrevibacter, Methanosarcina, Methanospirillum, Methanosaeta and

Methanosphaera or homologues thereof, with the proviso that at least one is from Methanococcus aeolicus.

The AksD and the AksE preferably are used as a heterodimer.

In particular good results have been achieved in an embodiment wherein AksD and AksE originate from the same organism or are functional analogues of an AksD and an AksE from the same organism, in particular both from the same Methanococcus species.

In a specific embodiment, the AksD enzyme or homologue thereof or the AksE or homologue thereof originate from an organism selected from the group of Methanococcus aeolicus, in particular M. aeolicus Nankai, more in particular M.

aeolicus Nankai 3, Methanococcus vannielii or is a homologue of an AksD respectively AksE of any of these organisms.

Preferably, AksD and the AksE are used in about equimolar levels, in particular in a molar ratio of 0.8: 1 to 1.2:1 , more in particular of 0.9: 1 to 1.1 :1.

In a preferred embodiment, the AksD enzyme or homologue thereof or the AksE or homologue thereof originate from an organism selected from the group of Methanococcus aeolicus, in particular M. aeolicus Nankai, more in particular M. aeolicus Nankai 3\ or is a homologue thereof.

In a specifically preferred embodiment, the AksD enzyme or homologue thereof is an enzyme comprising a sequence according to Sequence ID NO: 34, or a functional analogue thereof.

In a specifically preferred embodiment, the AksE enzyme or homologue thereof is an enzyme comprising a sequence according to Sequence ID NO: 31 , or a functional analogue thereof.

If an AksF enzyme from Methanococcus aeolicus or functional analogues thereof is used, it preferably is an aksF enzyme from Methanococcus aeolicus Nankai, more in particular from Methanococcus aeolicus Nankai 3, or a functional analogue thereof. In a specifically preferred embodiment, the AksF enzyme or functional analogue is an enzyme comprising a sequence according to Sequence ID NO: 43, or a functional analogue thereof.

Good results have been achieved in a method wherein the AksD, the AksD and the AksF each independently are from the group of Aks enzymes from Methanococcus and functional analogues of Aks enzymes of Methanococcus. In particular, a high yield (of AKP, or product obtained by converting the AKP) has been obtained in a method wherein Aks D, AksE and AksF are selected from the group of Aks enzymes from M. aeolicus and functional analogues of Aks enzymes of M.

aeolicus. Another AksF from Methanococcus, with which particularly good results have been achieved, is AksF from M. maripaludis.

The AKP obtained in accordance with the invention may be used as an intermediate compound for preparing a further compound, such as 6-ACA or another compound mentioned above. The conversion may in principle be carried out in a manner known per se, for instance from the above cited prior art.

In particular, the invention further relates to a method for preparing 5- FVA, AAP or 6-ACA from the AKP obtained in accordance with the invention.

In an embodiment, the AKP is decarboxylated thereby forming 5-FVA and - if desired - the 5-FVA is converted into 6-ACA.

In a further embodiment, the AKP is converted into AAP and - if desired - into 6-ACA.

Such preparation of 5-FVA, AAP or 6-ACA from the AKP may in particular be accomplished in a manner as described in WO 2009/113855, of which the contents with respect to the preparation of 5-FVA, AAP or 6-ACA are incorporated by reference, in particular the examples, the claims directed to the preparation of any of these compounds, and the decarboxylases and the aminotransferases identified in the sequence listing, including homologues thereof.

If desired, 6-ACA obtained in accordance with the invention can be cyclised to form caprolactam, e.g. as described in US-A 6, 194,572.

In a further embodiment, the AKP is used for preparing alpha- ketosuberic acid (AKS), in a method comprising subjecting the AKP to Ci-elongation, using a biocatalyst having catalytic activity with respect to said Ci-elongation. In particular, the enzymes having catalytic activity with respect to the Ci-elongation of AKP may each independently originate from an organism selected from the group of methanogenic archae. Preferably, one or more of said enzymes are selected from the group of Methanococcus, Methanocaldococcus, Methanosarcina,

Methanothermobacter, Methanosphaera, Methanopyrus and Methanobrevibacter.

In a preferred embodiment, the AKS is biocatalytically prepared using a biocatalyst comprising

- an AksA enzyme having homo(n)citrate activity or an homologue thereof (e.g. a Nifv);

- at least one enzyme selected from the group of AksD enzymes having homon- aconitase activity, AksE enzymes having homo _n -aconitase activity, homologues of said AksD enzymes and homologues of said AksE enzymes, preferably both an AksD enzyme or homologue and an AksE enzyme or homologue; and

- an AksF enzyme having homo _n - isocitrate dehydrogenase or a homologue thereof.

These enzymes may in particular be selected from the respective enzymes listed in WO 2009/113855, of which the contents with respect to these enzymes are incorporated by reference, in particular the Tables 1A and 1 B.

The formed alpha-ketosuberic acid can further be converted into 7-aminoheptanoic acid using the same concept as described herein for the conversion of AKP to 6-ACA, namely by using one or more biocatalysts selected from the group of decarboxylases, aminotransferases and amino acid dehydrogenases capable of catalysing a reaction step in a method of the invention. Alternatively, one or more of such subsequent reaction steps can be performed chemically. 7-Aminoheptanoic acid prepared in such way can then be cyclised to form the corresponding C ₇ -lactam (also referred to as azocan-2-one or zeta-aminoenantholactam) and/or polymerized directly or via the said C ₇ -lactam for the production of nylon-7 or copolymers thereof.

The product obtained in a method according to the invention can be isolated from the biocatalyst, as desired. A suitable isolation method can be based on methodology commonly known in the art.

Reaction conditions for any biocatalytic step in the context of the present invention may be chosen depending upon known conditions for the biocatalyst, in particular the enzyme, the information disclosed herein and optionally some routine experimentation.

In principle, the pH of the reaction medium used may be chosen within wide limits, as long as the biocatalyst is active under the pH conditions. Alkaline, neutral or acidic conditions may be used, depending on the biocatalyst and other factors. In case the method includes the use of a micro-organism, e.g. for expressing an enzyme catalysing a method of the invention, the pH is selected such that the micro-organism is capable of performing its intended function or functions. The pH may in particular be chosen within the range of four pH units below neutral pH and two pH units above neutral pH, i.e. between pH 3 and pH 9 in case of an essentially aqueous system at 25 °C. A system is considered aqueous if water is the only solvent or the predominant solvent (> 50 wt. %, in particular > 90 wt. %, based on total liquids), wherein e.g. a minor amount of alcohol or another solvent (< 50 wt. %, in particular < 10 wt. %, based on total liquids) may be dissolved (e.g. as a carbon source) in such a concentration that micro-organisms which may be present remain active. In particular in case a yeast and/or a fungus is used, acidic conditions may be preferred, in particular the pH may be in the range of pH 3 to pH 8, based on an essentially aqueous system at 25 °C. If desired, the pH may be adjusted using an acid and/or a base or buffered with a suitable combination of an acid and a base.

In an advantageous embodiment, the method of the invention comprises a fermentative process. The term fermentative is used herein in a broad sense, as is common in the art, and thus refers to the use of microorganisms or a cell culture of cells of a larger organism to convert or modify a substance into a product useful to humans. Herein the conditions need not be anaerobic.

In principle, the incubation conditions can be chosen within wide limits as long as the biocatalyst shows sufficient activity and/ or growth. This includes aerobic, micro-aerobic, oxygen-limited and anaerobic conditions.

Anaerobic conditions are herein defined as conditions without any oxygen or in which substantially no oxygen is consumed by the biocatalyst, in particular a micro-organism, and usually corresponds to an oxygen consumption of less than 5 mmol/l.h, in particular to an oxygen consumption of less than 2.5 mmol/l.h, or less than 1 mmol/l.h.

Aerobic conditions are conditions in which a sufficient level of oxygen for unrestricted growth is dissolved in the medium, able to support a rate of oxygen consumption of at least 10 mmol/l.h, more preferably more than 20 mmol/l.h, even more preferably more than 50 mmol/l.h, and most preferably more than 100 mmol/l.h.

Oxygen-limited conditions are defined as conditions in which the oxygen consumption is limited by the oxygen transfer from the gas to the liquid. The lower limit for oxygen-limited conditions is determined by the upper limit for anaerobic conditions, i.e. usually at least 1 mmol/l.h, and in particular at least 2.5 mmol/l.h, or at least 5 mmol/l.h. The upper limit for oxygen-limited conditions is determined by the lower limit for aerobic conditions, i.e. less than 100 mmol/l.h, less than 50 mmol/l.h, less than 20 mmol/l.h, or less than to 10 mmol/l.h.

Whether conditions are aerobic, anaerobic or oxygen limited is dependent on the conditions under which the method is carried out, in particular by the amount and composition of ingoing gas flow, the actual mixing/mass transfer properties of the equipment used, the type of micro-organism used and the micro-organism density.

In principle, the temperature used is not critical, as long as the biocatalyst, in particular the enzyme, shows substantial activity. Generally, the temperature may be at least 0 °C, in particular at least 15 °C, more in particular at least 20 °C. A desired maximum temperature depends upon the biocatalyst. In general such maximum temperature is known in the art, e.g. indicated in a product data sheet in case of a commercially available biocatalyst, or can be determined routinely based on common general knowledge and the information disclosed herein. The temperature is usually 90 °C or less, preferably 70 °C or less, in particular 50 °C or less, more in particular or 40 °C or less.

In particular if a biocatalytic reaction is performed outside a host organism, a reaction medium comprising an organic solvent may be used in a high concentration (e.g. more than 50 %, or more than 90 wt. %), in case an enzyme is used that retains sufficient activity in such a medium.

In an advantageous method 6-ACA is prepared making use of a whole cell biotransformation of the substrate for 6-ACA or an intermediate for forming 6-ACA (such as AKP or AAP), said method comprising the use of a micro-organism in which one or more biocatalysts (usually one or more enzymes) catalysing the biotransformation are produced, such as one or more biocatalysts selected from the group of biocatalysts capable of catalysing the conversion of AKP to AAP and biocatalysts capable of catalysing the conversion of AAP to 6-ACA. In a preferred embodiment the micro-organism is capable of producing a decarboxylase and/or at least one enzyme selected from amino acid dehydrogenases and aminotransferases capable of catalysing a reaction step as described above.

The carbon source, which may be used as a substrate for a microorganism used in accordance with the invention, may in particular contain at least one compound selected from the group of monohydric alcohols, polyhydric alcohols, carboxylic acids, carbon dioxide, fatty acids, glycerides, including mixtures comprising any of said compounds. Suitable monohydric alcohols include methanol and ethanol. Suitable polyols include glycerol and carbohydrates. Suitable fatty acids or glycerides may in particular be provided in the form of an edible oil, preferably of plant origin.

In particular a carbohydrate may be used, because usually

carbohydrates can be obtained in large amounts from a biologically renewable source, such as an agricultural product, preferably an agricultural waste-material. Preferably a carbohydrate is used selected from the group of glucose, fructose, sucrose, lactose, saccharose, starch, cellulose and hemi-cellulose. Particularly preferred are glucose, oligosaccharides comprising glucose and polysaccharides comprising glucose.

A cell, in particular a recombinant cell, comprising one or more biocatalysts (usually one or more enzymes) for catalysing a reaction step in a method of the invention can be constructed using molecular biological techniques, which are known in the art per se. For instance, if one or more biocatalysts are to be produced in a recombinant cell (which may be a heterologous system), such techniques can be used to provide a vector (such as a recombinant vector) which comprises one or more genes encoding one or more of said biocatalysts. One or more vectors may be used, each comprising one or more of such genes. Such vector can comprise one or more regulatory elements, e.g. one or more promoters, which may be operably linked to a gene encoding a biocatalyst.

As used herein, the term "operably linked" refers to a linkage of polynucleotide elements (or coding sequences or nucleic acid sequence) in a functional relationship. A nucleic acid sequence is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence.

As used herein, the term "promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skilled in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a promoter that is active under environmental or developmental regulation. The term "homologous" when used to indicate the relation between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, is understood to mean that in nature the nucleic acid or polypeptide molecule is produced by a host cell or organisms of the same species, preferably of the same variety or strain.

The promoter that could be used to achieve the expression of the nucleic acid sequences coding for an enzyme for use in a method of the invention, in particular an aminotransferase, an amino acid dehydrogenase, a decarboxylase, in Aks enzyme or another enzyme such as described herein above may be native to the nucleic acid sequence coding for the enzyme to be expressed, or may be heterologous to the nucleic acid sequence (coding sequence) to which it is operably linked.

Preferably, the promoter is homologous, i.e. endogenous to the host cell.

If a heterologous promoter (to the nucleic acid sequence encoding for the enzyme of interest) is used, the heterologous promoter is preferably capable of producing a higher steady state level of the transcript comprising the coding sequence (or is capable of producing more transcript molecules, i.e. mRNA molecules, per unit of time) than is the promoter that is native to the coding sequence. Suitable promoters in this context include both constitutive and inducible natural promoters as well as engineered promoters, which are well known to the person skilled in the art.

A "strong constitutive promoter" is one which causes mRNAs to be initiated at high frequency compared to a native host cell. Examples of such strong constitutive promoters in Gram-positive micro-organisms include SP01 -26, SP01 -15, veg, pyc (pyruvate carboxylase promoter), and amyE.

Examples of inducible promoters in Gram-positive micro-organisms include, the IPTG inducible Pspac promoter, the xylose inducible PxylA promoter.

Examples of constitutive and inducible promoters in Gram-negative microorganisms include, but are not limited to, tac, tet, trp-tet, Ipp, lac, Ipp-lac, laclq, T7, T5, T3, gal, trc, ara (P _BA D), SP6, A-P _R , and A-P _L .

Promoters for (filamentous) fungal cells are known in the art and can be, for example, the glucose-6-phosphate dehydrogenase gpdA promoters, protease promoters such as pepA, pepB, pepC, the glucoamylase glaA promoters, amylase amyA, amyB promoters, the catalase catR or catA promoters, glucose oxidase goxC promoter, beta-galactosidase lacA promoter, alpha-glucosidase agIA promoter, translation elongation factor tefA promoter, xylanase promoters such as xlnA, xlnB, xlnC, xlnD, cellulase promoters such as eglA, eglB, cbhA, promoters of transcriptional regulators such as areA, creA, xlnR, pacC, prtT, or another promotor, and can be found among others at the NCBI website (http://www.ncbi.nlm.nih.gov/entrez/).

The term "heterologous" when used with respect to a nucleic acid (DNA or RNA) or protein refers to a nucleic acid or protein that does not occur naturally as part of the organism, cell, genome or DNA or RNA sequence in which it is present, or that is found in a cell or location or locations in the genome or DNA or RNA sequence that differ from that in which it is found in nature. Heterologous nucleic acids or proteins are not endogenous to the cell into which it is introduced, but has been obtained from another cell or synthetically or recombinantly produced. Generally, though not necessarily, such nucleic acids encode proteins that are not normally produced by the cell in which the DNA is transcribed or expressed. Similarly exogenous RNA encodes for proteins not normally expressed in the cell in which the exogenous RNA is present. Heterologous nucleic acids and proteins may also be referred to as foreign nucleic acids or proteins. Any nucleic acid or protein that one of skill in the art would recognize as heterologous or foreign to the cell in which it is expressed is herein encompassed by the term heterologous nucleic acid or protein.

A method according to the invention may be carried out in a host organism, which may be novel. The host organism may in particular be a recombinant or heterologous cell.

Accordingly, the invention further relates to a heterologous cell, comprising one or more heterologous nucleic acid sequences encoding one or more heterologous enzymes having catalytic activity in at least one reaction step in the preparation of alpha ketopimelic acid from alpha-ketoglutaric acid, wherein said one or more heterologous enzymes are as defined in any of the claims 1-8, and optionally one or more enzymes having catalytic activity with respect to a reaction step specified in any of the claims 9, 10, 1 1 , 13.

The heterologous cell may in particular comprise one or more nucleic acid sequences presented in Table 1 of the Examples or one or more functional analogues thereof, provided that at least one of said sequences encodes an enzyme selected from the group of AksD enzymes, AksE enzymes AksF enzymes from Methanococcus aeolicus and functional analogues thereof. The heterologous cell preferably comprises at least one nucleic acid sequence selected from the group of sequences represented by any of the sequence ID No's 1 , 5, 8, 15, 20, 23, 32, 35, 36, and functional analogues thereof.

In an embodiment wherein the AKP is to be converted into a further product, the cell advantageously comprises one or more enzymatic activities having catalytic activity with respect to the conversion of AKP into said further product (directly or into an intermediate). In particular, the host cell may further comprise an amino transferase or an amino acid dehydrogenase and a decarboxylase, which together have catalytic activity with respect to the formation of 6-ACA. Suitable enzymes, and encoding genes, are amongst others described in the present Examples and in WO 2009/113855.

The invention will now be illustrated by the following examples.

EXAMPLES

Cloning of the genes

Protein sequences for the Methanococcus aeolicus Nankai 3 homoaconitase small subunit (AksE, Maeo_0652 [SEQ ID No 31]), homoaconitase large subunit (AksD, Maeo_0311 , [SEQ ID No 34] and homoisocitrate dehydrogenase (AksF, Maeo_1484, [SEQ ID No 43]), homologues thereof from Methanococcus vannielii SB homoaconitase small subunit (AksE, Mevan_1368 [SEQ ID No 40]), homoaconitase large subunit (AksD, Mevan_0789, [SEQ ID No 37] homoisocitrate dehydrogenase (AksF, Mevan_0040, [SEQ ID No 19), homologues thereof from

Methanococcus maripaludis S2 homoaconitase small subunit (AksE, MMP0381 , [SEQ ID No 25]), homoaconitase large subunit (AksD, MMP1480, [SEQ ID No 28]), homoisocitrate dehydrogenase (AksF, MMP0880 [SEQ ID No 22), ]) homologues thereof from Methanospirillum hungatei JF-1 homoaconitase small subunit (AksE, Mhun_1800, [SEQ ID No 13]), homoaconitase large subunit (AksD, Mhun_1799, [SEQ ID No 10]), homoisocitrate dehydrogenase (AksF, Mhun_1797 [SEQ ID No 16), ]) the A. vinelandii homocitrate synthase NifV, [SEQ ID 2 ]), the aminotransferase protein from Vibrio fluvialis JS17 [SEQ ID No. 7] and the Lactococcus lactis branched chain alpha-keto acid decarboxylase KdcA [SEQ ID No. 4] were retrieved from databases. All genes, except for the A. vinelandii homocitrate synthase nifV (Sequence ID No 1), were codon pair optimized for E. coli using methodology described in WO 2008/000632. (Table 13) and the constructs were made synthetically (Geneart, Regensburg, Germany). In the optimization procedure internal restriction sites were avoided and common restriction sites were introduced at the start and stop to allow subcloning in expression vectors. The codon optimised aminotransferase gene from Vibrio fluvialis JS17 (Seq ID NO: 8) was PCR amplified using Phusion DNA polymerase according to the manufacturers specifications using primer pairs AT- Vfl_for_Ec (AAATTT GGTACC GCTAGGAGGAATTAACCATG) + AT-Vfl_rev_Ec (AAATTT ACTAGT AAGCTGGGTTTACGCGACTTC). The codon optimised

decarboxylase gene from Lactococcus lactis coding for Lactococcus lactis branched chain alpha-keto acid decarboxylase KdcA (Seq ID NO: 5) was amplified using Phusion DNA polymerase according to the manufacturers specifications and using primers Kdc_for_Ec (AAATTT ACTAGT GGCTAGGAGGAATTACATATG) and Kdc_rev_Ec (AAATTT AAGCTT ATTACTTGTTCTGCTCCGCAAAC). The aminotransferase fragments were digested with Kpnl/Spel and the decarboxylase fragment was digested with Spel/Hindlll. Both fragments were ligated to Kpnl/Hindlll digested pBBR-lac to obtain pAKP-96.

Genes encoding the homoaconitase small subunit (AksE),, homoaconitase large subunit (AksD) and homoisocitrate dehydrogenase (AksF) from either M. aeolicus, M. vannielii, M. hungatei or M. maripaludis were codon pair optimized for E. coli (using methodology described in WO08000632; Table 13).

Sequences of codon pair optimized genes are shown in Seq ID Nos: 5, 8, 9, 12, 15, 20, 23, 26, 29, 32, 35, 36, 39, and 42. Constructs were made synthetically (Geneart, Regensburg, Germany) containing the optimized genes together with the wild-type nifV gene (SEQ ID No 1), see alsoTable 1 for the genes in each of the constructs . In the optimization procedure internal restriction sites were avoided and common restriction sites were introduced at the start and stop to allow subcloning in expression vectors. Also, upstream of AksD the sequence of the tac promoter from pMS470 was added. Each ORF was preceded by a consensus ribosomal binding site and leader sequence to drive transcription and translation in E.coli. A synthetic AksA /AksF cassette was cut with Ndel/Xbal and a synthetic AksD/AksE cassette was cut with Xbal/Hindlll.

Fragments containing Aks genes were inserted in the Ndel/Hindlll sites of pMS470 to obtain the various vectors. These plasmids were co-transformed with plasmid pAKP96, a vector containing the aminotransferase gene (AT) from V. fluvialis and the decarboxylase gene (DC) from Lactococcus lactis to BL21 to obtain the strains listed in Table 1.

(AT= aminotransferase, DC=decarboxylase)

Protein expression and metabolite production in E. coli

Cultures eAKP429, eAKP489, eAKP491 , eAKP470, eAKP471 eAKP472, eAKP473 and eAKP474 (shown in Table 1 ) were grown overnight in tubes with 10 ml 2*TY medium. 200 μΙ culture was transferred to shake flasks with 20 ml magic medium (Invitrogen). Flasks were incubated in an orbital shaker for 16h at 30°C and 120 rpm. Cells from 20 ml culture were collected by centrifugation and

resuspended in 4 ml Magic medium in 24 well plates and incubated in an orbital shaker at 30°C and 200 rpm. After 24 and 120 hours samples were taken and cells and supernatant were separated by centrifugation. Samples were stored at -20C for analysis

Analysis method for the determination of AKP, 6-ACA and AAP A Waters HSS T3 column 1.8 μηι, 100 mm*2.1 mm was used for the separation of AKP, 6-ACA and AAP with gradient elution as depicted in Table 2. Eluens A consists of LC/MS grade water, containing 0.1 % formic acid, and eluens B consists of acetonitrile, containing 0.1 % formic acid. The flow-rate was 0.25 ml/min and the column temperature was kept constant at 40 °C.

Table 2: gradient elution program used for the separation of AKP, 6-ACA

A Waters micromass Quattro micro API was used in electrospray either positive or negative ionization mode, depending on the compounds to be analyzed, using multiple reaction monitoring (MRM). The ion source temperature was kept at 130 °C, whereas the desolvation temperature is 350 °C, at a flow-rate of 500 L/hr.

For AKP the deprotonated molecule was fragmented with 10-14 eV, resulting in specific fragments from losses of e.g. H ₂ 0, CO and C0 ₂ .

For 6-ACA and AAP the protonated molecule was fragmented with 13 eV, resulting in specific fragments from losses of H ₂ 0, NH ₃ and CO.

To determine concentrations, a calibration curve of external standards of synthetically prepared compounds was run to calculate a response factor for the respective ions. This was used to calculate the concentrations in samples. Samples were diluted appropriately (25 fold) to overcome ion suppression and matrix effects.

Analysis of supernatant and cell extract

Supernatant was diluted 25 times with water prior to U PLC- MS/MS analysis. Results, shown in Table 3, clearly show that the levels of 6-ACA and AAP in strains eAKP671 and eAKP673 are significantly higher as compared to the strains eAKP670 and eAKP674 respectively showing the superior performance of the

M.aeolicus aksF over the homologues from M.vanielii and M.maripaludis. From this table it is also clear that the levels of 6-ACA, AAP and AKP are significantly higher in strain eAKP491 as compared to eAKP674 showing the superior performance of the M.aeolicus aksD/aksE over the homologues from M.maripaludis. It is contemplated that the conversion of AKP to AAP is catalyzed by a natural aminotransferase present in E. coli.

Table 3: 6-ACA, AAP and AKP production in Magic medium

^* AKP was not detectible in the medium. It should be noted that intracellular levels were not taken into account. It is shown though AAP and 6-ACA levels in the medium are higher than in the eAKP674 example. This supports that the AKP production is improved in the eAKP673 example compared to the eAKP674 reference example.