This application claims the benefit of European Patent Application EP22382008 filed on January 10 ^th , 2022.

Technical Field

The present invention belongs to the field of biological sample processing, in particular, the processing of samples comprising nucleic acids. The method of the invention is particularly useful for preparing biological samples for diagnosing infectious disease by genetic analysis.

Background Art

The role of molecular diagnostics is critical in today's global health care environment. In the developing world, most deaths are due to a lack of proper diagnostics and the associated follow-on treatment of infectious diseases, such as acute respiratory infections, malaria, HIV, and tuberculosis. Furthermore, the recent pandemic of SARS-CoV-2 has accentuated the need for tools to effectively detect and control infectious diseases anywhere in the world.

Molecular diagnostics procedures often require the detection of specific nucleic acid sequences present in a biological sample. Before a nucleic acid molecule can be detected or quantified, it is necessary to make it available by processing the sample. In fact, sample preparation is a major cost and time component of genetic testing.

Frequently, the target nucleic acid is contained within a viral particle, a bacterial cell, a fungal cell, or the cell of a more complex organism, such as a human white blood cell.

Thus, sample preparation methods for nucleic acid analysis commonly entail a first step of lysis to liberate the nucleic acids into a solution, followed by a step of nucleic acid purification.

Conventional sample preparation methods involve laborious extraction procedures that include several washing and centrifuging steps, making them tedious, labor-intensive, and slow. Moreover, organic extraction methods often involve the use of chaotropic agents, such as guanidinium thiocyanate, and organic solvents to lyse cells and denature proteins, which makes them hazardous and highly contaminant. Also, residual amounts of these substances carried over into the eluted sample can interfere with subsequent enzymatic processing of the isolated nucleic acid, for example in nucleic acid sequencing or amplification. Therefore, these methods have limitations since they produce amplification problems, the cause being the inability to remove inhibitors, undesirable interferences of the reagents, or simply because the method is not sufficiently efficient.

In addition, several inorganic methods have been developed, which include the use of high salt concentrations, glass powders or silica-gel suspensions, however, these are time-consuming, requiring several steps, washing and desalting procedures or multiple transfers of the sample to different containers.

Nucleic acid-extraction kits are relatively expensive and hardly available in low-resource areas. Also, the skyrocketing increment on the clinical use of genetic testing due to the COVID-19 pandemic has led to a worldwide shortage of reagents and kits, generating a major bottleneck for disease diagnosis also in developed countries.

For all these reasons, many research groups around the world have concentrated their efforts on either simplifying or eliminating the nucleic acid extraction step for genetic testing. However, the methods disclosed in the art are either too slow and cumbersome or are not capable of efficiently eliminating enough contaminants from the sample, leading to unreliable results in the subsequent genetic analysis.

Moreover, methods that allow a rapid and very simple extraction of nucleic acids in developing countries, where poverty and poor hygiene conditions contribute to spread certain diseases that can cause a sudden epidemics situation, are still necessary.

Thus, in spite of the progress made so far, there is still a need for fast, efficient, and safe methods for processing samples that allow the direct detection of nucleic acids.

Summary of Invention

The present inventors have developed a method for processing nucleic acid-containing samples that enables the direct detection of DNA or RNA without carrying out cumbersome nucleic acid extraction steps or using hazardous chemicals.

As shown in the examples below, through extensive experimentation the present inventors have surprisingly found that mixing the sample with a ternary combination comprising an ion exchange resin, a protease, and albumin followed by a short heat treatment allows rapidly and safely obtaining a nucleic acid containing supernatant suitable for genetic analysis techniques, such as PCR, without the need of complex purification steps. Therefore, the obtention of nucleic acids from the sample can be performed by any person without exposure to hazardous chemicals.

Advantageously, the inventors have found that the addition of albumin to the mixture synergistically potentiates the removal of inhibitory or degrading enzymes and other contaminants which allows obtaining a sample that can be used directly for detection assays without requiring any further purification steps (see Tables 2 and 5). Notably, this effect was not obtained when other agents were added to the mixture (see Table 3).

The present invention offers an unprecedentedly rapid, simple, and efficient method to provide nucleic acids that can be used immediately as reagents in diagnostic analyses. Compared to conventional extraction methods, the method herein provided offers equivalent genetic results with the advantage of shortening the time of the analysis and reducing its cost. In fact, the method of the invention can be performed in less than 20 min.

The extraction-free method herein provided is very versatile as it can process a wide variate of samples, from tissue swabs to saliva samples, and it can be combined with a variety of nucleic acid amplification and detection kits.

The rapid identification of infected patients enabled by the method of the invention may be of particularly importance during reagent shortage situations, like the shortage caused by the COVID-19 pandemic.

Altogether, the results herein provided show that the invention provides an efficient method that allows bypassing the traditional nucleic acid extraction procedures and that contributes to improve the testing capacity, in particular during health emergency situations or in countries with limited resources.

Thus, in a first aspect, the present invention provides, a method for processing a nucleic acid-containing sample, the method comprising the steps of a) contacting the nucleic acidcontaining sample with an ion exchange resin; a protease; and albumin; b) heating at a temperature from 60 °C to 120 °C; c) allowing the formation of a sediment (i.e. , a precipitate) and a supernatant; d) recovering the supernatant containing the nucleic-acid.

In a second aspect, the invention provides a composition comprising an ion exchange resin, a protease, and albumin; particularly, a composition for processing a nucleic acidcontaining sample comprising an ion exchange resin, a protease, and albumin. In a third aspect, the invention provides a kit of parts comprising an ion exchange resin; a protease; albumin; optionally, instructions for its use; and, optionally, a PCR buffer; particularly wherein the kit is for processing a nucleic acid-containing sample.

In a fourth aspect, the invention provides the use of an ion exchange resin, a protease, and albumin for processing a nucleic acid-containing sample.

In a fifth aspect, the invention provides a method for amplifying a nucleic acid from a nucleic acid-containing sample, the method comprising the steps of a) processing the sample with a method as defined in the first aspect thereby obtaining a supernatant containing the nucleic acid; and b) amplifying the nucleic acid contained in the supernatant.

In a sixth aspect, the invention provides a processed nucleic acid-containing sample obtainable by the method as defined in the first aspect.

Detailed description of the invention

All terms as used herein in this application, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions for certain terms as used in the present application are as set forth below and are intended to apply uniformly through-out the specification and claims unless an otherwise expressly set out definition provides a broader definition.

For purposes of the present invention, any ranges given include both the lower and the upper end-points of the range. Ranges given, such as concentrations and the like, should be considered approximate, unless specifically stated.

As used herein, the indefinite articles “a” and “an” are synonymous with “at least one” or “one or more.” Unless indicated otherwise, definite articles used herein, such as “the” also include the plural of the noun. As used herein, the term "about" refers to a range of values that is 15 % more or less than a fixed value.

As above stated, the invention provides in a first aspect a method for processing a nucleic acid-containing sample based on the synergistic action of an ion exchange resin, a protease, and albumin. The skilled in the art would understand that the method does not exclude additional steps before, after, or intercalated between the indicated steps. Also, the skilled in the art would understand that components of the combination mixed with the sample can be provided together or separately. The expression "processing a nucleic acid-containing sample", as used herein, refers to a process where compounds that hinder the detection of nucleic acids (such as inhibitory or degrading enzymes and other contaminants) are removed or inactivated, thereby generating a processed sample that can be used directly for detection assays without requiring any further purification steps. In particular, it is meant to encompass "extracting a nucleic acid from a sample containing it", but not to encompass subsequent detection steps such as PCR amplification.

In the method of the invention a sample containing a nucleic acid is mixed with the ternary combination, which is then heated for lysing the sample and inactivating the protease. Then, the resin is allowed to sediment and the supernatant containing the nucleic acid, appears now substantially free of contaminants. Therefore, the method of the invention produces an extract containing the nucleic acids.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the method comprises, in the following order, the steps of a) contacting the nucleic acid-containing sample with an ion exchange resin; a protease; and albumin; b) heating at a temperature from 60 °C to 120 °C; c) allowing the formation of a sediment and a supernatant; d) recovering the supernatant.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the method comprises the steps of a) contacting the nucleic acid-containing sample with an ion exchange resin; a protease; and albumin; b) heating the mixture obtained in step (a) at a temperature from 60 °C to 120 °C; c) allowing the formation of a precipitate or a sediment and a supernatant in the heated mixture obtained in step (b); d) recovering the supernatant obtained in step (c).

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the method consists of the steps a) contacting the nucleic acid-containing sample with an ion exchange resin; a protease; and albumin; b) heating at a temperature from 60 °C to 120 °C; c) allowing the formation of a sediment and a supernatant; d) recovering the supernatant.

In a particular embodiment of the method of the first aspect, the method is for extracting a nucleic acid from a nucleic acid-containing sample.

In a particular embodiment of the method of the first aspect, the sample is selected from the group consisting of whole blood, plasma, serum, urine, saliva, sputum, nasal mucous, respiratory lavage, tears, chorionic villi, amniotic fluid, cerebrospinal fluid, spinal fluid, lavage fluid, feces, prostate fluid, semen, lymphatic fluid, bile, sweat, breast milk, breast fluid, non-human embryonic cells, non-human fetal cells, human or non-human stem cells, cultured cells, cultured bacteria, cultured yeast, tissue biopsy (such as colorectal biopsy, epithelia biopsy, dermal biopsy), tissue swabs or smears (such as nasopharyngeal swab, oropharyngeal swab, vaginal swab, urethral or cervical swab), cervical cytology, synovial fluid, food, feed, soil, produce, water (e.g. drinking water, household water systems, water deposits or tanks, food-processing water or water in food production, recreational water, irrigation water, farming water systems or water for agricultural purposes, water distribution systems, water from wells, rivers, lakes, swimming and bathing areas), a surface swab, a surface rinse, and combinations thereof.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the sample is a biological sample. As used herein, "biological sample" refers to any sample comprising biological material in which nucleic acids are present. In a more particular embodiment, the sample is a liquid sample or a solid or a semisolid diluted sample, in particular, a liquid biological sample. In a more particular embodiment, the biological sample comprises a pathogen such as a virus, virioid or virion, a prion, a bacterium, a fungus, a yeast, a protozoan, worms, helminths, pinworms, trematodes, tissue cells, or a combination thereof.

Non-limiting examples of pathogens and/or diseases caused by pathogens encompassed by the method of the invention include Herpes simplex, varicella-zoster virus (VZV), Respiratory syncytial virus (RSV), Epstein-Barr virus, Cytomegalovirus (CMV), Human polyoma virus 8, Human herpesvirus 8, Legionella pneumophila, Pseudomonas aeruginosis, Staphilococcus aureus, Streptococcus pneumoniae, Aspergillus, Coccioides immitis, Microsporidia, Rotavirus, Hepatitis, Genital warts, (human papillomavirus or HPV, Influenza (flu) and BK virus, Cholera (caused by Vibrio cholerae), diarrhea, colitis and serious intestinal conditions (caused by Clostridium difficile), Shigellosis (caused by Shigella), Salmonellosis (caused by Salmonella typhi, Salmonella paratyphi or Salmonella enteritidis), gastrointestinal illness caused by Vibrio parahaemolyticus), gastroenteritis, urinary tract infections, neonatal meningitis, hemorrhagic colitis, Crohn’s disease, gramnegative pneumonia (caused by Escherichia Coli, enterotoxigenic E. Coli), Campylobacter infection (caused by Campylobacter jejuni, C. hyointestinalis, C. lari, C. rectus, C. upsaliensis, or C. coli), Candidiasis (caused by Candida albicans), hepatitis (caused by Hepatovirus A or Hepatovirus E), common cold, hand, foot and mouth disease, acute hemorrhagic conjunctivitis, aseptic meningitis, myocarditis (caused by Enteroviruses A-L; Poliovirus, Coxsackie, Echovirus), Vomiting bug and Norovirus acute gastroenteritis (caused by Norovirus or Norwalk virus), Poliomyelitis (caused by Poliovirus 1, 2, 3), Respiratory diseases, including severe acute respiratory syndrome (caused by Coronaviruses such as 229E, OC43, SARS-CoV, HCoV NL63, HCoV HKU1 , MERS-CoV and SARS-CoV-2), Stomach flu and gastroenteritis (caused by Rotavirus A-J), Mild cold or flu-like illness (caused by Adenoviruses), Amoebiasis (caused by Entameba histolytica), Giardiasis (caused by Giardia), Crytosporidiosis (caused by Cryptosporidium), Toxoplasmosis (caused by Toxoplasma gondii), Tapeworms (caused by Cestoda), helminthiasis, trichuriasis or whipworm and soil-transmitted helminths (caused by Necator americanus, Ancylostoma duodenale and Trichuris trichura), Foodborne trematodiases (caused by several parasites, such as Clonorchis, Fasciola, Opistorchis. Pargonimus), Malaria (caused by Plasmodium), Tuberculosis (caused by Mycobacterium tuberculosis), Chagas disease (caused by Trypanosoma cruzi), Schistosomiasis (caused by flatworms or schistosomas), Zika fever (caused by Zika virus), Dengue fever (caused by Dengue fever virus DENV), Japanese encephalitis (caused by Japanese encephalitis virus), West Nile fever (caused by West Nile virus), Ascariasis (caused by Ascaris lumbricoides), Leshmaniasis (caused by Leishmania), Mycetoma (Actinomycetoma caused by Nocardia brasiliensis, Stroptomyces somaliensis, Actinomadure madura and Actinomadura pelletieri, or Eumycetoma caused by Madurella mycetomatis), Buruli ulcer (caused by Mycobacterium ulcerans), Leprosy or Hansen’s disease (caused by Mycobacterium leprae), Chromoblastomycosis (caused by Fonsecaea Pedroso, Cladophialophora bantiana, Phialophora verrucosa, Cladophialophora carrionii, Fonsecaea compacta, Paracoccidioidomycosis (caused by Paracoccioides), Trachoma (caused by Chlamydia trachomatis), Yaws, syphilis or bejel (caused by Treponema pallidum), Dracunculiasis or Guinea worm disease (caused by Dracunculus medinensis), Echinococcosis (caused by E. granulosus, E. multiocularis, E. oligathrus or E. vogeli), Lymphatic filariasis (caused by Filarial worms such as Wuchereria bancrofti, Brugia malayi and Brugia timori), Onchocerciasis (caused by Onchocerca volvulus), rabies (caused by Lyssaviruses such as Rabies lyssavirus and Australian bat lyssavirus.

In a more particular embodiment, the pathogen causes a disease selected from the group consisting of COVID-19 (caused by Severe Acute Respiratory Syndrome Corona Virus-2, SARS-CoV-2), Aspergillosis (caused by Aspergillus fumigatus), Acquired Immune Deficiency Syndrome (AIDS, caused by Human Immuno-deficiency Virus, HIV), Chlamydia, Gonorrhea, Syphilis, Trichomoniasis, cold sores, chickenpox, measles, influenza, some types of cancer and others.

In an even more particular embodiment, the biological sample is a nasopharyngeal or oropharyngeal swab diluted in Viral Transport Medium (VTM). As used herein, "Viral Transport Medium" or "VTM" is any culture medium suitable for the non-propagating transport of viruses. In another particular embodiment, the sample can be diluted in any transport medium, such as a Universal Transport Medium (UTM). In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the sample comprises polymerase chain reaction inhibitors and the supernatant recovered in step (d) is substantially free of polymerase chain reaction inhibitors, in particular, cations. As used herein, "polymerase chain reaction inhibitors" are agents which prevent the amplification of nucleic acids through the polymerase chain reaction; and a "supernatant substantially free of polymerase chain reaction inhibitors" refers to a supernatant containing polymerase chain reaction inhibitors in a concentration low enough as to not significantly hinder a polymerase chain reaction.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the nucleic acid is selected from the group consisting of DNA, RNA, and a combination thereof. In a more particular embodiment, the nucleic acid is genomic DNA, plasmid DNA, viral DNA, DNA obtained from a DNA amplification reaction, RNA, viral RNA, RNA obtained from an RNA amplification reaction, DNA that has been reverse transcribed from an RNA sample (i.e. , cDNA), and a combination thereof.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the step (a) consists of mixing the nucleic acid-containing sample with an ion exchange resin, a protease, and albumin.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the step (b) is performed directly after step (a) or (a ¹ ); and/or the step (c) is performed directly after step (b) or (b ¹ ).

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the temperature in step (b) is from 70 °C to 110 °C, from 80 °C to 105 °C, from 90 °C to 100 °C, or of about 100 °C

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, step (b) is carried out until the protease is inactivated and/or the sample is lysed. The skilled in the art can perform routinary tests to calculate the appropriate incubation time to inactivate the protease and lyse the sample. The skill in the art can adjust the parameters of the techniques for optimal results. For illustrative purposes, protease inactivation can be measured by incubating the protease with a protein-containing sample under conditions suitable for protease activity and then analyzing the reaction products by Western-Blotting. In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, step (b) is carried out for at least 1 min, at least 3 min, at least 5 min, at least 10 min, at least 15 min, or at least 20 min. In another particular embodiment, step (b) is carried out from 1 min to 30 min, from 5 min to 20 min, from 10 to 15 min, or for about 10 min.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, step (c) is carried out at a temperature from 15 to 25 °C, particularly at about room temperature.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, step (c) comprises allowing the heated mixture to stand until a sediment and a supernatant are formed; or alternatively, centrifuging the heating mixture until a sediment and a supernatant are formed. The higher density of the ion exchange resin will lead to its precipitation or sedimentation, which can be accelerated by centrifuging the mixture. The skilled in the art can know when a sediment and a supernatant are formed by simple visual inspection.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, step (c) comprises allowing the formation of a sediment or a sediment comprising the ion exchange resin and a supernatant comprising the nucleic acid, the albumin, and the inactivated protease. In a more particular embodiment, step (c) comprises allowing the formation of a sediment or a sediment and a supernatant, wherein the supernatant is substantially free of polymerase chain reaction inhibitors.

The step (d), recovering the supernatant, can be performed by any routinary method known in the art, such as decantation, filtration or pipetting. In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, step (d) comprises recovering the supernatant by decanting.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the method further comprises the step (a ¹ ) vortexing the mixture obtained in step (a). In a more particular embodiment, the vortexing of step (a ¹ ) is carried out for at least 1 sec, at least 2 sec, at least 3 sec, at least 4 sec or at least 5 sec. In a more particular embodiment, the vortexing of step (a ¹ ) is carried out from 1 sec to 10 sec, from 2 sec to 8 sec, or for about 5 sec.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the method further comprising the step (b ¹ ) vortexing the mixture obtained in step (b). In a more particular embodiment, the vortexing of step (b ¹ ) is carried out for at least 1 sec, at least 2 sec, at least 3 sec, at least 4 sec or at least 5 sec. In a more particular embodiment, the vortexing of step (b ¹ ) is carried out from 1 sec to 10 sec, from 2 sec to 8 sec, or for about 5 sec.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the method comprises or consists of the steps: a) contacting the nucleic acid-containing sample with an ion exchange resin, a protease, and albumin; a') vortexing the mixture obtained in step (a); b) heating at a temperature from 60 °C to 120 °C; b') vortexing the mixture obtained in step (b); c) allowing the formation of a sediment and a supernatant; and d) recovering the supernatant containing the nucleic acid.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the method further comprises the step (o') purifying or isolating the nucleic acid after step (c). Any nucleic acid purification or isolation method known by the skilled in the art can be applied in step (o').

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, step (a) comprises contacting the nucleic acid-containing sample and a composition comprising an ion exchange resin, a protease, and albumin, at a volume ratio (nucleic acid-containing sample : composition) from 1 :0.1 to 1:10, from 1 :0.2 to 1 :8, from 1:0.3 to 1 :7, from 1:0.4 to 1:6, from 1 :0.5 to 1 :5, from 1 :0.6 to 1 :4, from 1 :0.7 to 1 :3, from 1 :0.8 to 1 :2, or at a volume ratio of about 1:1.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the method is with the proviso that a nucleic-acid isolation or purification step is not performed. In a more particular embodiment, the method is with the proviso that the method does not comprise an organic solvent extraction step, particularly a phenol-chloroform extraction step or phenol- chloroform-isoamyl alcohol extraction step.

In a particular embodiment of the method of the first aspect, optionally in combination with any of the embodiments provided above or below, the method comprises the steps of a) contacting the nucleic acid-containing sample with a chelating resin, particularly Chelex- 100; a proteinase, particularly proteinase K; and albumin, particularly BSA; b) heating at a temperature from 60 °C to 120 °C; c) allowing the formation of a sediment and a supernatant; and d) recovering the supernatant containing the nucleic acid. As above indicated, in a second aspect the invention provides a composition for processing a nucleic acid-containing sample comprising an ion exchange resin, a protease, and albumin.

In a particular embodiment of the composition of the second aspect, optionally in combination with any of the embodiments provided above or below, the composition is lyophilized.

In a particular embodiment of the composition of the second aspect, optionally in combination with any of the embodiments provided above or below, the composition further comprises a polar solvent. As used herein, “polar solvent” refers to a solvent that is readily miscible with water and other polar solvents. Polar solvents are well-known and can be assessed by measuring any parameter known to those of skill in the art, including dielectric constant, polarity index and dipole moment. The skilled in the art would know which polar solvents to choose for the composition of the invention considering that they have to be suitable for carrying the ion exchange resin, protease, albumin and the nucleic acids.

In a particular embodiment of the composition of the second aspect, optionally in combination with any of the embodiments provided above or below, the polar solvent is water or tampon buffer. In a more particular embodiment, the polar solvent is milli-Q water, and the tampon buffer is TE buffer or CAPS. As used herein, "TE buffer" is a commonly used buffer solution in molecular biology especially in procedures involving DNA, cDNA or RNA, that comprises Tris and EDTA.

In a particular embodiment of the composition of the second aspect, optionally in combination with any of the embodiments provided above or below, the composition comprises at least one of the following:

- the ion exchange resin at a concentration from 4 % wt to 99 % wt, from 10 % wt to 80 % wt, from 20 % wt to 60 % wt, from 30 % wt to 50 % wt, or of about 40 %.

- the protease at a concentration from 0.05 % wt to 5 %; from 0.1 % wt to 1 % wt; from 0.2 % wt to 0.8 % wt, from 0.3 % wt to 0.7 % wt; or of about 0.5 % wt.

- the albumin is at a concentration from 0.2 % wt to 20 % wt, from 0.5 % wt to 10 % wt; from 1 % wt to 4 % wt, from 1.5 % wt to 3 % wt, or of about 2 % wt, being the sum of the ingredients up to 100 %.

In a particular embodiment of the composition of the second aspect, optionally in combination with any of the embodiments provided above or below, the ion exchange resin is at a concentration from 10 % wt to 80 % wt, particularly about 40 % wt; the protease is at a concentration from 0.1 % wt to 1 %, particularly about 0.5 % wt; and/or the albumin is at a concentration from 0.5 % wt to 4 % wt, particularly about 2 % wt; being the sum of the ingredients up to 100 %.

As used herein, the term "% wt" or "percentage by weight" of a component refers to the amount of the single component relative to the total weight of the composition or, if specifically mentioned, of another component.

As above discussed, in a third aspect the invention provides a kit of parts comprising an ion exchange resin; a protease; albumin, optionally, instructions for its use; and optionally, a PCR buffer. As used herein, a “PCR buffer” refers to any buffer solution that allows the activity of a DNA polymerase, and thus, the generation of the DNA amplicons. In a more particular embodiment, the PCR buffer comprises ammonium sulfate, Tris/HCI, MgCh, Tween 20, and, optionally, PEG-200; particularly, 26.67 mM ammonium sulfate, 111.6 mM Tris/HCI pH 8.8, 5 mM MgCh, and 0.33% Tween 20.

As above indicated, in a fourth aspect the invention provides the use of an ion exchange resin, a protease, and albumin for processing a nucleic acid-containing sample. The above aspect can be also formulated as the use of an ion exchange resin, a protease, and albumin for extracting a nucleic acid from a nucleic acid-containing sample. The invention also provides the use of a composition as defined in the second aspect or the kit as defined in the third aspect for processing a nucleic acid-containing sample, particularly, in a method as defined in claim 1.

In a particular embodiment of the use provided in the fourth aspect, the sample is contacted simultaneously with the ion exchange resin, the protease, and the albumin.

In a particular embodiment of any of the previous aspects, optionally in combination with any of the embodiments above or below, the ion exchange resin, the protease, and the albumin are at a weight ratio (weight/weight/weight) (cation exchange resin/protease/albumin) from 1 :0.25:2 to 1 :25:200; from 1:1 :5 to 1 :10:80; from 1 :2:10 to 1 :5:40, or of about 1 :2.5:20.

In a particular embodiment of any of the previous aspects, optionally in combination with any of the embodiments above or below, the ion exchange resin is a chelating resin. In an even more particular embodiment, the chelating resin is selected from the group consisting of Chelex-100, Sepharose 2B, SP Sepharose Fast Flow, Ni Sepharose 6FF, DEAE Sepharose Fast Flow, AG 50W, AG MP-50, Bio-Rex 70, Lewatit TP 260, Diaion CR11 , Ambersep M4195, and combinations thereof. In a more particular embodiment, the ion exchange resin is a cation exchange resin. In a more particular embodiment, the cation exchange resin is a styrene-divinylbenzene co-polymer containing iminodiacetic acid groups. In an even more particular embodiment, the cation exchange resin is Chelex- 100, particularly, Chelex-100 50-100 mesh or Chelex-100200-400 mesh. As used herein, "ion exchange resin" is a resin capable of exchanging ions, and a "cation exchange resin" is a resin capable of exchanging cations. "Chelating resin", as used herein, is an ion exchange resin that comprises chelating agents covalently attached to the polymer matrix. These resins can be obtained from commercial sources (for example, Chelex-100 can be obtained from BioRad or Merk, CAS 11139-85-8).

In a particular embodiment of any of the previous aspects, optionally in combination with any of the embodiments above or below, the protease is a proteinase. In a more particular embodiment, the protease is selected form the group consisting of lysozyme, proteinase K, trypsin, and pepsin. As used herein, "protease" refers to enzymes that degrade proteins by hydrolysis of peptide bonds. The term "proteinase" or " endopeptidase" refers to a specific type of protease that hydrolyzes internal peptide bonds. Proteases, in particular proteinase K, can be obtained from commercial sources (for example, Proteinase K from Merk #70663) or produced following standard methods in molecular biology.

In a particular embodiment of any of the previous aspects, optionally in combination with any of the embodiments above or below, the albumin is serum albumin, particularly serum albumin selected from the group consisting of bovine serum albumin (BSA), human serum albumin (HSA), and mouse serum albumin (MSA). In another particular embodiment, albumin is in the form of powdered non-fat dry milk. Albumin, in particular BSA, HSA, and MSA can be obtained from commercial sources or produced following standard methods in molecular biology.

In a particular embodiment of any of the previous aspects, optionally in combination with any of the embodiments above or below, the ion exchange resin is a chelating resin, particularly Chelex-100; the protease is a proteinase, particularly proteinase K; and the albumin is a serum albumin, particularly BSA.

In a particular embodiment of any of the previous aspects, optionally in combination with any of the embodiments above or below, the kit further comprises polyethylene glycol (PEG), N-acetylcysteine and/or ammonium sulfate. In another particular embodiment of any of the previous aspects, optionally in combination with any of the embodiments above or below, the step (a) of the method comprises contacting the nucleic acid-containing sample with a cation exchange resin, a protease, albumin, and polyethylene glycol (PEG); or alternatively, the nucleic acid-containing sample with a cation exchange resin, a protease, albumin and ammonium sulfate; or alternatively, the nucleic acid-containing sample with a cation exchange resin, a protease, albumin and N-acetylcysteine

As above disclosed, in a fifth aspect, the invention provides a method for amplifying a nucleic acid contained in a sample that comprises processing the sample with a method as defined in the first aspect.

In a particular embodiment of the fifth aspect, optionally in combination with any of the embodiments above or below, the nucleic acid-amplification is RT-PCR, PCR, qPCR, RT- qPCR, SDA, iSDA, HDA, RPA, NASBA, LAMP or EXPAR..

In a particular embodiment of the fifth aspect, optionally in combination with any of the embodiments above or below, the nucleic acid is RNA and the amplification reaction comprises the steps of (i) reverse transcribing RNA into cDNA with reverse transcriptase, and (ii) amplifying the cDNA by PCR, qPCR, LAMP or EXPAR.

In a particular embodiment of the fifth aspect, optionally in combination with any of the embodiments above or below, the method further comprises the step (c) of detecting or quantifying the amplified nucleic acid.

In a sixth aspect, the invention provides a processed nucleic acid-containing sample obtainable by the method as defined in the first aspect. The nucleic acid-containing sample processed according to the method of the invention are particularly suitable for direct nucleic acid amplification, as evidenced by the lower Cq values shown in the examples below. The processed samples prepared according to the present invention are substantially free of nuclease activity and polymerase chain reaction inhibitors, thus, they are superior substrates for polymerase enzymes.

The processed nucleic acid-containing sample "obtainable by" the method as defined above is used herein to define the sample by its preparation method and relates to the sample obtainable by the method which comprises the steps a), b), and c) described above. For the purposes of the invention, the expressions "obtainable”, "obtained" and equivalent expressions are interchangeably used, and in any case the expression "obtainable" includes the expression "obtained".

In a particular embodiment of the sixth aspect, optionally in combination with any of the embodiments above or below, the processed nucleic acid-containing sample further comprises a PCR buffer. In a more particular embodiment, the PCR buffer comprises ammonium sulfate, PEG-200, Tris/HCI, MgCI2, and Tween 20, particularly, 26.67 mM ammonium sulfate, 111.6 mM Tris/HCI pH8.8, 5 mM MgCI2, and 0.33% Tween 20.

All the embodiments disclosed above regarding the method of the first aspect of the invention are also meant to apply to the processed nucleic acid-containing sample of the sixth aspect of the invention.

Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word “comprise” encompasses the case of “consisting of”. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples are provided by way of illustration, and they are not intended to be limiting of the present invention. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.

Examples

Example 1

200 pl of a saliva sample or a VTM sample (TM011 , Vircell) spiked with heat inactivated SARS-CoV-2 (ATCC, VR-1986HK) was added to a vial with 200 pl of processing mixture containing 40 % wt Chelex 200-400 mesh (95621 -100G-F Merck) and Proteinase K, 5 mg/ml (A3830.0500 Panreac Applichem) in milli-Q water, with or without 2% BSA (1010- 30-1 OOM L Seqens).

The vial was vortexed for 5 seconds, then heated at 100 °C for 10 minutes, and vortexed again for 5 seconds. The vial was then allowed to stand until the contents were separated by gravity (i.e. , the resin was allowed to sediment). The supernatant containing the processed sample (i.e., the nucleic acids) was recovered by decantation. The supernatant was directly used in a kit suitable for detection of infections by PCR without further purification.

As control, equivalent nucleic acid-containing samples were extracted with an automated extraction platform (MagLEAD® 12gC instrument using the MagDEA® Dx SV Kit, referred as MagLEAD onwards) following the manufacturer’s instructions.

RT-qPCR was performed with VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Certest Biotec) following manufacturer's instructions. Particularly, the lyophilized qPCR vial of the kit was rehydrated with 12 l of a rehydration buffer comprising 26.67 mM ammonium sulfate, 111.6 mM Tris/HCI pH8.8, 5 mM MgCI2, and 0.33% Tween 20. Then, 8 pl of the processed sample were added to the qPCR vial. The thermocycles used were CFX96™ Real-Time PCR Detection System (Bio-Rad) and AriaMx Real-Time PCR System (Agilent Technologies).

For the detection of Sars-CoV-2, the genes ORFIab and N were targeted. The primers and probes used were the following (China CDC Primers and probes for detection 2019- nCoV, Target 1 and 2, posted on 24 January 2020):

- ORFIab gene: Fw CCCTGTGGGTTTTACACTTAA (SEQ ID NO: 1); Rv ACGATTGTGCATCAGCTGA (SEQ ID NO: 2), Pr CCGTCTGCGGTATGTGGAAAGGTTATGG (SEQ ID NO: 3).

- N gene: Fw GGGGAACTTCTCCTGCTAGAAT (SEQ ID NO: 4); Rv CAGACATTTTGCTCTCAAGCTG (SEQ ID NO: 5); Pr TTGCTGCTGCTTGACAGATT (SEQ ID NO: 6)

The qPCR thermal protocol used is shown in Table 1:

Table 1

FAM™, ROX, and Hex were used as dyes for the qPCR. The target gene ORFIab was detected in the FAM channel, the N gene was detected in the ROX channel, and an internal control was detected in the Hex channel. The qPCR results were analyzed with the software of the thermocycler using standard procedure. In particular, the threshold was adjusted manually. The threshold was calculated as 10 times the standard deviation of the mean baseline fluorescence signal between 3 and 15 cycles. The fluorescence signal that was detected above the threshold was considered a true signal that could be used to define the quantification cycle (Cq) value of the sample. The threshold was changed manually in each experiment in order to find the exponential amplification region of all curves present.

The Cq value was the most important parameter used in the experiments to evaluate the best reagent combination for sample processing. Lower Cq values were indicative of better sample processing (i.e. , lower concentration of contaminants or inhibitory enzymes for the qPCR). The end point fluoresce was used in the experiments as a measure of the qPCR inhibition problems. A significant drop in fluorescence can cause problems in the detection of the samples that are in the Limit of Detection (LOD). ACq value was calculated by subtracting the Cq values obtained in samples processed by the method of the invention to the Cq values obtained in the reference (ACq= method of the invention - reference control).

As shown in Table 2 below, the addition of BSA to the processing buffer significantly improved the qPCR results, lowering the Cq value up to 1 whole cycle (Cq = 29 vs. Cq = 30 with FAM) and providing even better results than samples extracted with MagLEAD (Cq = 29 vs. Cq = 29.5 with FAM).

Table 2

Concentration values given are after the addition of the sample to the processing buffer in a 1:1 volume ratio; * ACq (Condition - MagLEAD); RFU refers to relative fluorescence units.

These results clearly show that BSA synergistically potentiates the action of the resin and the protease to remove inhibitory or degrading enzymes and other contaminants, thereby obtaining a sample that is even better suited for nucleic acid detection assays than those obtained with laborious purification steps in expensive equipment (MagLEAD).

Example 2

Samples were processed and analyzed as described in Example 1 varying the components of the processing buffer. In particular, BSA was substituted by Spermidine (S0266-1G), Sarcosyl (L7414-50ML) or PEG (BioUltra, 200, 88440-250ML-F). As shown in Table 3, only BSA potentiated the action of the resin and the protease. The addition of the other agents failed to improve the action of the resin and the protease, as shown by the reduced RFU and increased Cq values:

Table 3

Concentration values given are after the addition of the sample to the processing buffer in a 1:1 volume ratio; * ACq (Condition - MagLEAD).

Example 3

To discard that the improved qPCR results obtained with the addition of the BSA were a result of the action of the BSA during the qPCR reaction and not during the processing of the sample, samples were processed and analyzed as described in Example 1 adding the BSA either in the processing buffer or in the qPCR buffer (i.e. , after the processing).

As shown in Table 4 below, only the addition of BSA in the processing buffer (6th row) significantly improved the qPCR results (i.e., Cq = 29 vs. Cq = 30,56). This effect was not observed when the BSA was added to the qPCR buffer. Table 4

Concentration values given are after the addition of the sample to the processing buffer in a 1 :1 volume ratio; * ACq (Condition - Control (rehydration buffer)). DILBM refers to 16.16 mM ammonium sulfate, 67.63 mM Tris/HCI pH8.8, 3 mM MgCI2, and 0.2% Tween 20

These results clearly show that the BSA synergistically acts during the processing of the sample to produce nucleic-acid containing supernatants highly suitable for further nucleic acid detection.

Example 4

The same procedure described in Example 1 was repeated with real SARS-CoV-2 nasopharyngeal swab in VTM. The primers and probes used for the amplification are the same as in Example 1. The qPCR results obtained with samples processed according to the method of the invention and control samples extracted with MagLEAD are shown in Table 5:

Table 5

Concentration values given are after the addition of the sample to the processing buffer in a 1 :1 volume ratio; * ACq (Condition - MagLEAD).

These results show that real clinical samples contaminated with SARS-CoV-2 and processed by the method of the invention provided significantly better virus detection results than those processed with a buffer not containing albumin, and notably, better detection results than samples processed by MagLEAD.

Example 5

The method of the invention was used for processing various types of samples contaminated by different microorganisms, including virus and bacteria, which provided qPCR results equivalent or even better than MagLEAD.

Example 6

The method of the invention was further used to process biological samples contained in different buffers, including several commercial buffers commonly used in the clinic. Table 6 below shows the successful nucleic acid detection in samples processed by the method of the invention independently on the buffer used for the sample collection, following the method described above in Example 1.

Table 6

ACq (Condition - MagLEAD).

Example 7

The method of the invention was carried out as described in Example 1 with different proteases, ion exchange resins and albumins.

As shown in Table 7 below, equivalent results were obtained when BSA was substituted by mouse albumin or nonfat powdered milk. Analogously, the proteases lysozyme and trypsin provided also good results, as well as the chelating resin Ni Sepharose 6FF.

Table 7

Concentration values given are after the addition of the sample to the processing buffer in a 1:1 volume ratio.

In conclusion, these results show that the method of the invention can be carried out successfully with different ion exchange resins, proteases, and albumins. Example 8

The method of the invention was further used to process different food samples spiked with Listeria monocytogenes or Salmonella, following the protocol described above in Example 1. Table 8 below shows that the method of the invention was also useful for processing food samples, and that BSA potentiated the action of the resin and the protease in food samples independently on the type of food sample and pathogen detected.

Table 8

Example 9

The method of the invention was also used for processing various types of clinical samples as described in Example 1. Table 9 below shows the successful detection of all the samples processed by the method of the invention.

Table 9

Example 10

Samples (saliva samples spiked with heat inactivated SARS-CoV-2) were processed and analyzed as described in Example 1 but varying the composition of the processing buffer. The results of Table 10 below clearly show that the BSA and the proteinase K synergistically enhance the action of the exchange resin (column 1 vs columns 2-4) which allows for an unexpected improvement in the subsequent nucleic acid detection. Table 10