FIELD OF THE INVENTION

The present invention relates to a method for providing a control for use in a screen for a pathogenic virus, uses, nucleotide sequences, vectors, ribonucleic acids, deoxyribonucleic acids, compositions, kits and methods for manufacture and for detecting the presence or absence of a pathogenic virus. BACKGROUND

Biological reference materials or standards of known activity or potency are important calibrators for bioassays to permit results to be compared and harmonised within and between laboratories, no matter when or where the bioassays are performed. In the case of nucleic acid amplification technology (NAT)-based diagnostic tests, the use of control samples of known activity allows the sensitivity and specificity of the test system to be monitored and quality assured. The desired requirements of a NAT reference standard should be that it is safe (non-infectious), represent all the relevant target sequences in equal or known amounts, control for the whole process including nucleic acid extraction and purification and exhibit commutability (behave as close as possible to the clinical sample).

Reference material for NAT assays targeting some blood borne pathogens have been produced and available, such as Human Immunodeficiency virus (HIV)-1 and -2, Parvovirus B19, Hepatitis A, B and C. These are inactivated whole viruses or in some cases infectious material (e.g. HCV). A similar approach cannot be sensibly used for highly pathogenic viruses, which requires a biosafety containment level 4.

Nucleic acid amplification based diagnostic techniques have a crucial role during the ongoing Ebola virus outbreak in West Africa. Reference materials are needed to assess the validity of the assays used, to compare results across assays and to provide guidance to the regulatory agencies in the evaluation of new assays. It is crucially important that Ebola virus NAT reference materials standardise and control the entire process from the extraction to the final amplification and detection reaction. Current in-house and commercial assays utilize plasmids or in vitro RNA transcripts as reference for the assays. Such reference materials do not control for the extraction procedure and may therefore incur false negative results. Wild type virus preparations have been used as controls, but these are limited to those laboratories which have access to bio-containment level 4 facilities. Inactivation of high titre virus stock by a single method does not assure safety and most publish procedures to produce viral antigen through a combination of methods also results in disruption of viral RNA making its suitability as NAT standard uncertain. There is therefore a need for a new technological platform for the production of safe, noninfectious, stable NAT reference material for highly pathogenic RNA viruses.

SUMMARY OF THE INVENTION

According to a first aspect the present invention provides a method for providing a control for use in a screen for a pathogenic virus comprising:

a. performing ribonucleic acid (RNA) extraction on a recombinant RNA virus, wherein:

i. said recombinant RNA virus comprises a control RNA sequence for identification of the presence or absence of a pathogenic virus;

ii. the control RNA sequence comprises at least 3 kb contiguous nucleotide sequence of said pathogenic virus or a complement thereof;

iii. the recombinant RNA virus is a Lentivirus or a Gammaretrovirus; and iv. the pathogenic virus is a pathogenic RNA virus; and

b. providing an isolated recombinant RNA virus sequence.

In a second aspect, the invention provides a use of a recombinant RNA virus wherein:

a. said recombinant RNA virus comprises a control RNA sequence for identification of the presence or absence of a pathogenic virus; and

b. the control RNA sequence comprises at least 3 kb contiguous nucleotide sequence of said pathogenic virus or a complement thereof; and

c. the recombinant RNA virus is a Lentivirus or a Gammaretrovirus ;

in the preparation of a positive control for reducing false negatives associated with a pathogenic viral screen and/or for stabilising a control RNA sequence. In a third aspect there is provided a method for preparing a recombinant RNA virus comprising:

a. providing a Lentiviral vector or Gammaretroviral vector comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus genome sequence or complement thereof; and

b. co-expressing said vector in a host cell with a nucleotide sequence encoding one or more Lentiviral or Gammaretroviral protein(s) to form a recombinant RNA virus. In a fourth aspect there is provided a nucleotide sequence comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus or a complement thereof operably linked to a promoter, wherein said nucleotide sequence is modified such that:

a. it comprises one or more nucleotide modifications, so that the nucleotide sequence is incapable of producing a pathogenic viral protein; and/or b. it lacks one or more regulatory nucleotide sequence essential for translation of the viral genome sequence, so that the nucleotide sequence is incapable of producing a pathogenic viral protein.

In a fifth aspect there is provided a vector comprising a nucleotide sequence of the present invention.

In a sixth aspect there is provided a method for manufacturing a ribonucleic acid (RNA) product comprising:

a. expressing a nucleotide sequence according to the invention, a vector according to the invention in a host cell or in vitro; and

b. isolating a RNA. In a seventh aspect there is provided a RNA obtainable by a method of the invention or a synthesised RNA structurally equivalent thereto.

According to an eighth aspect the invention provides a deoxyribonucleic acid (DNA) obtainable from a RNA of the invention.

In a ninth aspect there is provided a ribonucleoprotein comprising a RNA of the invention and a viral protein.

In a tenth aspect the invention provides a composition comprising a nucleotide sequence according to the invention, a vector according to the invention, a RNA according to the invention, a DNA according to the invention or a ribonucleoprotein according to the invention.

According to an eleventh aspect the present invention provides a kit comprising a nucleotide sequence, a vector, a RNA, a DNA, a ribonucleoprotein or a composition according to the invention and instructions for using same. In a twelfth aspect there is provided a method for detecting the presence or absence of a pathogenic virus comprising:

a. providing an experimental sample and a control sample, wherein the control sample comprises:

i. an isolated recombinant RNA extracted from a recombinant RNA virus, wherein:

A. said recombinant RNA virus comprises a control RNA sequence for identification of the presence or absence of a pathogenic virus;

B. the control RNA sequence comprises at least 3 kb contiguous nucleotide sequence of said pathogenic virus or a complement thereof;

C. the recombinant RNA virus is a Lentivirus or a Gammaretrovirus; and

D. the pathogenic virus is a pathogenic RNA virus;

ii. a nucleotide sequence of the invention;

iii. a vector of the invention;

iv. a RNA of the invention;

v. a DNA of the invention;

vi. a ribonucleoprotein of the invention;

vii. a composition of the invention; or

viii. a kit of the invention;

b. screening the experimental sample and the control sample for the presence or absence of a pathogenic viral nucleotide sequence; and

c. comparing a result obtained in step b. for the experimental sample and the control sample.

In a thirteenth aspect there is provided a data-storage medium comprising data obtained by the method of any preceding claim. BRIEF DESCRIPTION OF THE DRAWINGS

Embodiments of the invention will now be described, by way of example only, with reference to accompanying drawings, in which:

Figure 1 shows generation of lentiviral particles containing Ebola virus RNA. A) Ebola virus genes nucleoprotein (NP), viral protein 35 (VP35), glycoprotein (GP), viral protein 40 (VP40) and the polymerase encoding gene L were sequentially cloned into lentiviral vector pSFJenti between the restriction sites Sail and BstEII. Main elements of the lentiviral vector for the production of the viral RNA and incorporation within HIV-like particle are indicated. B) Particles size distribution of the 1 :100 dilution in PBS of stock preparation of lentiviral particles containing Ebola virus RNA for NP-VP35-GP genes. The graph represents the mean of 5 acquisitions (black line) ± standard deviation (grey shading surrounding black line). C) A representative image of the same preparation at dilution 1 : 10 in PBS analysed by negative staining transmission electron microscopy. The average particle size was 116.02 nm (average of 9 fields).

Figure 2 shows performance of the HIV-EBOV RNA preparations in qRT-PCR. Representative amplification plot of two 10-fold serially diluted high titre LVV_NP-VP35-GP (A) and LW_VP40-L (B) vials. Samples from two reconstituted vials per each sample were run in duplicate and the mean values of the duplicates plot as threshold cycle against fluorescence. The dilutions of the high titre LW_NP-VP35-GP (C) and LW_VP40-L (D) were also plot against the dilution factor. Efficiencies of the reaction were calculated based on the slope of the regression line as 102% for np-target qRT-PCR and 1 10% for l-target qRT-PCR. The same samples, run without the reverse transcriptase reaction (RT negative), were detectable up to 10 ^"2 dilution for LVV_NP-VP35-GP and 10 ^"1 for LW_VP40-L. Three 10-fold dilutions of the plasmids pSF-lenti-NP-VP35-GP and pSF-lenti-VP40-L were run in parallel and the values were the same between RT positive and RT negative qRT-PCR. Figure 3 shows efficiency of the quantitative RT-PCR targeting HIV LTR. Viral RNA extracted from serial dilutions of WHO 3 ^rd HIV-1 International standard (dilution factor 5, diamond), LVV_NP-VP35-GP high (dilution factor 10, square) and LVV-VP40-L (dilution factor 10, triangle) were processed in duplicate in a quantitative RT-PCR using primers and probes annealing within the U5 region of the HIV LTR. The graph shows a representative result of 3 independent experiments; the efficiencies of the reaction between samples were similar as represented by the slope of linear regression: HIV-1 IS= 3.122, LW_NP-VP35- GP=3.142, LW_VP40-L=3.1 10.

Figure 4 shows a sequence of a vector of the invention (pSF-lenti-NP_VP35_Gp) shown as SEQ ID No. 1.

Figure 5 shows a sequence of a vector of the invention (pSF-lenti-VP40-L) shown as SEQ ID No. 2.

Figure 6 shows the nucleotide sequence of Ebola Zaire virus gene NP shown as SEQ ID No. 3.

Figure 7 shows a polypeptide sequence (SEQ ID No. 4) encoded by SEQ ID No. 3.

Figure 8 shows the nucleotide sequence of Ebola Zaire virus gene VP35 shown as SEQ ID No. 5.

Figure 9 shows a polypeptide sequence (SEQ ID No. 6) encoded by SEQ ID No. 5. Figure 10 shows the nucleotide sequence of Ebola Zaire virus gene VP40 shown as SEQ ID No. 7.

Figure 11 shows a polypeptide sequence (SEQ ID No. 8) encoded by SEQ ID No. 7.

Figure 12 shows the nucleotide sequence of Ebola Zaire virus gene GP/sGP shown as SEQ ID No. 9.

Figure 13 shows a polypeptide sequence (SEQ ID No. 10) encoded by SEQ ID No. 9.

Figure 14 shows the nucleotide sequence of Ebola Zaire virus gene VP30 shown as SEQ ID No. 11.

Figure 15 shows a polypeptide sequence (SEQ ID No. 12) encoded by SEQ ID No. 11.

Figure 16 shows the nucleotide sequence of Ebola Zaire virus gene VP24 shown as SEQ ID No. 13.

Figure 17 shows a polypeptide sequence (SEQ ID No. 14) encoded by SEQ ID No. 13.

Figure 18 shows the nucleotide sequence of Ebola Zaire virus gene L shown as SEQ ID No. 15.

Figure 19 shows a polypeptide sequence (SEQ ID No. 16) encoded by SEQ ID No. 15. DETAILED DESCRIPTION

A seminal finding of the present invention is that a RNA extracted from a recombinant RNA virus as disclosed herein is particularly useful for the preparation of a control for use in a screen for a pathogenic virus (e.g. a diagnostic assay).

Thus, in one embodiment there is provided a method for providing a control for use in a screen for a pathogenic virus comprising:

a. performing ribonucleic acid (RNA) extraction on a recombinant RNA virus, wherein:

i. said recombinant RNA virus comprises a control RNA sequence for identification of the presence or absence of a pathogenic virus;

ii. the control RNA sequence comprises at least 3 kb contiguous nucleotide sequence of said pathogenic virus or a complement thereof;

iii. the recombinant RNA virus is a Lentivirus or a Gammaretrovirus; and iv. the pathogenic virus is a pathogenic RNA virus; and

b. providing an isolated recombinant RNA virus sequence.

There is also provided a use of a recombinant RNA virus wherein:

a. said recombinant RNA virus comprises a control RNA sequence for identification of the presence or absence of a pathogenic virus; b. the control RNA sequence comprises at least 3 kb contiguous nucleotide sequence of said pathogenic virus or a complement thereof; and

c. the recombinant RNA virus is a Lentivirus or a Gammaretrovirus;

in the preparation of a positive control for reducing false negatives associated with a pathogenic viral screen and/or for stabilising a control RNA sequence.

In one embodiment the recombinant RNA virus for use in the present invention is a Lentivirus or a Gammaretrovirus (preferably the recombinant RNA virus may be a Lentivirus). The recombinant RNA virus for use in a method and/or use of the present invention comprises a control RNA sequence for identification of the presence or absence of a pathogenic virus and further comprises at least 3 kb contiguous nucleotide sequence of a pathogenic virus or a complement thereof.

The term "control" as used herein is synonymous with "positive control" and takes its normal meaning in the art. Suitably when an extracted (e.g. isolated) RNA is used as a positive control a result which is positive for the presence of a pathogenic viral nucleotide sequence in the control sample is indicative of a functional assay (e.g. in a PCR-based assay a positive result may be the presence of an amplicon). Suitably therefore the use of a positive control as per the present invention may thereby reduce false negatives associated with a viral diagnostic screen when compared to not using a positive control of the invention.

The control RNA sequence allows for the identification of the presence or absence of a pathogenic virus. The presence or absence of a pathogenic virus may be determined using a method for detecting a pathogenic virus herein and include inter alia detection of the presence or absence of a pathogenic viral nucleotide sequence (e.g. using PCR).

The term "stabilising a control RNA sequence" as used herein may mean improving the stability of a control RNA sequence of the invention when compared to an RNA sequence that has not been packaged within a recombinant RNA virus disclosed herein. Stability of a control RNA sequence (e.g. at an ambient temperature) can be determined using any suitable means. For example, RNA stability may be assessed by PCR (e.g. reverse transcriptase-PCR).

Alternatively or additionally, RNA stability may be determined using gel electrophoresis and determining whether truncations of a RNA are present. In one embodiment, a use according to the present invention improves stability of a control RNA of the invention when stored for at least 1 week (preferably for about 2 weeks) at at least 10 °C, 20 °C, or 30 °C when compared to a RNA that is not comprised in a recombinant Lentivirus or Gammaretrovirus.

The term "pathogenic virus" used herein preferably refers to a pathogenic virus requiring containment level BSL-3 or 4.

In one embodiment the pathogenic virus invention may be a pathogenic RNA virus. Suitably, the pathogenic RNA virus from which the control RNA sequence is obtainable (e.g. obtained) may be the same pathogenic RNA virus being screened for.

In one embodiment the pathogenic virus (e.g. pathogenic RNA virus) may be a virus detailed on the ViPR Virus Pathogen Resource (http://www. viprbrc.org/brc/home. spg?decorator=vipr, which is incorporated herein by reference).

In one embodiment the pathogenic virus may be one or more selected from the group consisting of: Calciviridae, Coronaviridae, Flaviviridae, Hepeviridae, Picornaviridae, Togaviridae, Arenaviridae, Bunyaviridae, Filoviridae, Paramyxoviridae and Rhabdoviridae.

An Arenaviridae virus may be one or more genus selected from the group consisting of: Arenavirus, Mammarenavirus, Reptarenavirus, and Unclassified Arenaviridae.

A Bunyaviridae virus may be one or more genus selected from the group consisting of: Hantavirus, Nairovirus, Negevirus, Orthobunyavirus, Phlebovirus and Unclassified Bunyaviridae.

A Caliciviridae virus may be one or more genus selected from the group consisting of: Lagovirus, Nebovirus, Norovirus, Recovirus, Sapovirus, Vesivirus and Unclassified Caliciviridae.

A Coronaviridae virus may be selected from the subfamily Coronavirinae or Torovirinae.

In one embodiment a Coronavirinae virus may be one or more genus selected from the group consisting of: Alphacoronavirus, Betacoronavirus, Deltacoronavirus, Gammacoronavirus and Unclassified Coronaviridae. In another embodiment a Torovirinae virus may be one or more genus selected from the group consisting of: Bafinivirus and Torovirus. A Filoviridae virus may be one or more genus selected from the group consisting of: Cuevavirus, Ebolavirus, Marburgvirus and Unclassified Filoviridae.

A Flaviviridae virus may be one or more genus selected from the group consisting of: Flavivirus, Hepacivirus, Pegivirus, Pestivirus and Unclassified Flaviviridae.

A Hepeviridae virus may be one or more genus selected from the group consisting of: Hepevirus, Piscihepevirus and Unclassified Hepeviridae.

A Paramyxoviridae virus may be one or more subfamily selected from the group consisting of: Paramyxovirinae and Pneumovirinae.

In one embodiment a Paramyxovirinae virus may be one or more genus selected from the group consisting of: Aquaparamyxovirus, Avulavirus, Ferlavirus, Henipavirus, Morbillivirus, Respirovirus, Rubulavirus and Unclassified Paramyxoviridae.

In another embodiment a Pneumovirinae virus may be one or more genus selected from the group consisting of: Metapneumovirus and Pneumovirus.

A Picornaviridae virus may be one or more genus selected from the group consisting of: Aphthovirus, Aquamavirus, Avihepatovirus, Avisivirus, Cardiovirus, Cosavirus, Dicipivirus, Enterovirus, Erbovirus, Gallivirus, Hepatovirus, Hunnivirus, Kobuvirus, Megrivirus, Mischivirus, Mosavirus, Oscivirus, Parechovirus, Pasivirus, Passerivirus, Rosavirus, Sakobuvirus, Salivirus, Sapelovirus, Senecavirus, Teschovirus, Tremovirus and Unclassified Picornaviridae.

A Rhabdoviridae virus may be one or more genus selected from the group consisting of: Bracorhabdovirus, Cytorhabdovirus, Ephemerovirus, Lyssavirus, Novirhabdovirus, Nucleorhabdovirus, Perhabdovirus, Sigmavirus, Sprivivirus, Tibrovirus, Tupavirus, Vesiculovirus and Unclassified Rhabdoviridae. A Togaviridae virus may be one or more genus selected from the group consisting of: Alphavirus, Rubivirus and Unclassified Togaviridae.

In one embodiment the pathogenic RNA virus may be a positive sense pathogenic RNA virus. Suitably a positive sense pathogenic RNA virus may be one or more selected from the group consisting of: a SARS coronavirus, a MERS coronaviruses, a Dengue virus, a Chikungunya virus, a Ross river virus, a Yellow fever virus, a West Nile virus, a Japanese encephalitis virus, a Zika virus, and an ambisense RNA viral sequences (e.g. Lassavirus). In another embodiment the pathogenic RNA virus may be a negative sense pathogenic RNA virus. Suitably a negative sense pathogenic RNA may include viruses causing haemorrhagic fever. Suitably, a negative sense pathogenic RNA virus may be selected from the group consisting of: Ebolavirus spp. Sudan and Bundibugyo, Marburg virus, Hantaviruses, Rift Valley fever virus, Crimean-Congo hemorrhagic fever virus, Nipah virus and Hendra virus.

In one embodiment the negative sense pathogenic RNA virus being screened for in the present invention may be a Marburg virus. Suitably, a Marburg virus for use in the present invention may be a Marburg virus having a genome with GenBank accession number DQ447649.

In embodiments where the RNA pathogenic virus is Ebola, suitably the Ebola virus may be one or more Ebola virus species selected from the group consisting of: Zaire, Bundibugyo, Sudan, Reston and Tai Forest. Suitably, the Ebola virus may be Ebola virus species Zaire. Ebola Zaire is taught in Gire et al, Science, 2014, 345(6202), 1369-1372 the contents of which is incorporated herein by reference.

Preferably the Ebola virus screened for may be an Ebola Zaire Makona 2014 virus (e.g. isolate H.sapiens-wt/GIN/2014/Makona-Kissidougou-C15, GenBank accession number KJ660346.2 (Baize S, Pannetier D, Oestereich L, Rieger T, Koivogui L, Magassouba N, et al. Emergence of Zaire Ebola virus disease in Guinea. N Engl J Med 2014 Oct 9;371 (15): 1418- 25 incorporated herein by reference).

In another embodiment the Ebola virus screened for may be an Ebola Sudan virus, suitably an Ebola Sudan virus having a genome with GenBank accession number AY729654. In one embodiment a method of the present invention comprises performing RNA extraction on a recombinant RNA virus. The term "extracting" is synonymous with "isolating" and as used herein means removing a product of interest from one or more contaminants which might be present in a composition comprising said product of interest, preferably with the aim of obtaining a product of interest that is free from said contaminants. The term "extracting" or "isolating" as used herein may refer to a degree of purification rather than to absolute purification. Therefore the term "extracting" or "isolating" may refer to removing at least 5% (suitably at least 10% or 20%) of contaminants. Suitably "extracting" or "isolating" may refer to removing at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of contaminants.

Suitably the term "extracting" or "isolating" refers to removing a RNA comprising a control RNA sequence for use in the invention from one or more recombinant RNA viral proteins, preferably with the aim of obtaining a RNA that is free from said recombinant RNA viral protein(s) and/or further contaminant(s).

Thus, in one embodiment the term "extracting" or "isolating" as used in this context may mean removing at least 5% (suitably at least 10% or 20%) of viral protein and/or further contaminant(s). Suitably "isolating" may refer to removing at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of viral protein and/or further contaminant(s).

In some embodiments, the term "extracting" or "isolating" may refer to removing an nucleotide, vector, RNA, DNA, ribonucleoprotein and/or composition of the invention from one or more contaminants present in a composition. In some embodiments, one or more contaminants may be one or more alternative nucleotides, vectors, RNAs, DNAs and/or ribonucleotides.

Techniques for the isolation of RNA and/or ribonucleoproteins are commercially available, such as for example the RNeasy kit or the QIAamp ^® Viral RNA Mini Kit (both from Qiagen Ltd., UK). Thus, the present invention provides a RNA obtainable by a method according to the invention or a synthesised RNA structurally equivalent thereto.

The term "structurally equivalent thereto" means that the RNA has an identical structure to a RNA produced by a nucleotide sequence of the invention.

The present invention comprises the use of a control RNA sequence comprising at least 3 kb of contiguous nucleotide sequence of a pathogenic virus or a complement thereof. The term "contiguous nucleotide sequence of a pathogenic virus or a complement thereof" as used herein refers to sequential nucleotides of a reference viral genome sequence. The reference viral genome sequence is preferably identical to the pathogenic virus being detected in a screen for which the control is to be used. For example at least 3 kb contiguous nucleotide sequence of a pathogenic virus genome sequence suitably means 3 kb of nucleotides that are sequential in the reference pathogenic virus genome sequence.

The term "contiguous nucleotide sequence of a pathogenic virus or a complement thereof" as used herein is intended to encompass orthologues and/or variants of at least 80% or 85% sequence identity to the reference viral genome sequence. In one embodiment the term "contiguous nucleotides of a viral genome sequence" may encompass orthologues and/or variants of at least 90% or 95% sequence identity to the reference viral genome sequence. Suitably the term "contiguous nucleotides of a viral genome sequence" may encompass orthologues and/or variants of at least 98% or 99% or 100% sequence identity to the reference viral genome sequence.

The term "contiguous nucleotide sequence of a pathogenic virus or a complement thereof" is also intended to encompass sequences comprising a modification (e.g. one or more nucleotide modifications and/or lacking one or more regulatory elements associated therewith in the viral genome sequence) as well as antisense transcripts of a pathogenic viral genome sequence. In some embodiments a control RNA as disclosed herein may be derived from a viral DNA sequence. In other embodiments the RNA of, or for use in, the present invention may be of an opposite sense to a viral DNA or RNA sequence. For example, if a viral DNA or RNA sequence is in a positive sense, the RNA of the invention may be in the negative sense. For the avoidance of doubt the control RNA sequence of the invention is an RNA sequence exogenous to the recombinant Lentivirus and/or Gammaretrovirus referred to herein. The term "exogenous" preferably means that the RNA sequence of the invention is obtainable from a pathogenic virus that is of a different family, genus, species, strain or isolate (more preferably a different family) from the recombinant Lentivirus and/or Gammaretrovirus used in the method.

In a preferred embodiment the control RNA sequence as referred to herein is contiguous with a Lentiviral or Gammaretroviral sequence.

The at least 3 kb contiguous nucleotide sequence of a pathogenic virus or a complement thereof herein may refer to a nucleotide sequence that has been PCR-derived from genetic material from an RNA virus or may be in vitro synthesised. In some cases restriction sites may be added to the 5' and/or 3' end of said sequences allowing for cloning using basic molecular biological techniques.

In some embodiments the control RNA sequence comprise between about 3 kb to about 9.5 kb contiguous nucleotide sequence of a pathogenic viral genome sequence. Suitably, the control RNA sequence may comprise between about 4 kb to about 9 kb of a pathogenic viral genome sequence or a complement thereof. Suitably, the control RNA sequence may comprise between about 5 kb to about 9 kb of a pathogenic viral genome sequence or a complement thereof.

Preferably, the control RNA sequence may comprise between about 6 kb to about 9 kb of a pathogenic viral genome sequence or a complement thereof.

In some embodiments the control RNA sequence may comprise at least about 4 kb or at least about 5 kb of a pathogenic viral genome sequence or a complement thereof. Suitably, the control RNA sequence may comprise at least about 6 kb or at least about 7 kb of a pathogenic viral genome sequence or a complement thereof.

Preferably the control RNA sequence may comprise or consist of at least 5 kb of a pathogenic viral genome sequence or complement thereof. Preferably, the control RNA sequence may comprise about 6.7 kb or about 8.3 kb or of a pathogenic viral genome sequence or a complement thereof. In one embodiment the control RNA sequence of, or for use in, the present invention may comprise a viral gene or portion thereof. Suitably the control RNA sequence of, or for use in, the present invention may comprise at least 2, 3, 4 or 5 pathogenic viral genes or portions thereof

In one embodiment the pathogenic RNA virus gene or portion thereof may be a positive sense pathogenic RNA virus. Suitably a positive sense pathogenic RNA virus gene or portion thereof may be one or more selected from the group consisting of: a SARS coronavirus, a MERS coronaviruses, a Dengue virus, a Chikungunya virus, a Ross river virus, a Yellow fever virus, a West Nile virus, a Japanese encephalitis virus, a Zika virus, and an ambisense RNA viral sequences (e.g. Lassavirus).

In another embodiment the pathogenic RNA virus gene or portion thereof may be a negative sense pathogenic RNA virus. Suitably the negative sense pathogenic RNA virus gene or portion thereof may be obtainable from a virus causing haemorrhagic fever. Suitably, a negative sense pathogenic RNA virus gene or portion thereof may be selected from the group consisting of: Ebolavirus spp. Sudan and Bundibugyo, Marburg virus, Hantaviruses, Rift Valley fever virus, Crimean-Congo hemorrhagic fever virus, Nipah virus and Hendra virus.

In one embodiment the gene or portion thereof may be obtainable from a Marburg virus gene or portion thereof. Suitably, a Marburg virus gene or portion thereof may be obtainable from Marburg virus having a genome with GenBank accession number DQ447649.

Suitably a Marburg virus gene or portion thereof may be selected form the group consisting of: NP, VP35, VP40 and GP.

In one embodiment the gene or portion thereof may be an Ebola virus gene or portion thereof.

In one embodiment the gene or portion thereof may be obtainable from Ebola Zaire, suitably an Ebola Zaire having a genome with GenBank accession number KJ660346.2. In another embodiment the gene or portion thereof may be obtainable from Ebola Sudan virus, suitably an Ebola Sudan virus having a genome with GenBank accession number AY729654. Suitably an Ebola virus gene or portion thereof may be selected from the group consisting of: NP, VP35, VP40, GP/sGP, VP30, VP24 and L.

In one embodiment the Ebola virus gene may be NP or a portion thereof. The NP gene of Ebola encodes a RNA binding protein believed to be responsible for genomic packaging.

In one embodiment the NP gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 3 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the NP gene may be a nucleotide sequence encoded by SEQ ID No. 3 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the NP gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 4 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the NP gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 4 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the Ebola virus gene may be VP35 or a portion thereof. The VP35 gene of Ebola encodes a polymerase cofactor in the RNA polymerase transcription and replication complex.

In one embodiment the VP35 gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 5 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the VP35 gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 5 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the VP35 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 6 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the VP35 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 6 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the Ebola virus gene may be VP40 or a portion thereof. The VP40 gene of Ebola encodes a virus assembly and budding promotion factor. Without wishing to be bound by theory, it is believed that VP40 interacts with host proteins of the multivesicular body pathway.

In one embodiment the VP40 gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 7 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the VP40 gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 7 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the VP40 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 8 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the VP40 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 8 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof. In another embodiment the Ebola virus gene may be GP/sGP or a portion thereof. The GP/sGP gene of Ebola encodes a glycoprotein responsible for binding to receptors on target cells.

In one embodiment the GP/sGP gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 9 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the GP/sGP gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 9 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the GP/sGP gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 10 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the GP/sGP gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 10 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the Ebola virus gene may be VP30 or a portion thereof. The VP30 gene of Ebola encodes a transcription anti-termination factor. In one embodiment the VP30 gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 1 1 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the VP30 gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 1 1 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the VP30 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 12 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the VP30 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 12 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the Ebola virus gene may be VP24 or a portion thereof. Without wishing to be bound by theory it is believed that the VP24 gene of Ebola encodes a membrane-associated protein believed to prevent the establishment of cellular antiviral state by blocking the interferon-alpha/beta and IFN-gamma signalling pathways.

In one embodiment the VP24 gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 13 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the VP24 gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 13 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the VP24 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 14 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the VP24 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 14 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the Ebola virus gene may be L or a portion thereof. The L gene of Ebola encodes an polypeptide believed to have RNA-directed RNA polymerase, mRNA guanylyl transferase, mRNA (guanine-N(7)-)-methyltransferase and/or poly(A) synthetase activities.

In one embodiment the L gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 15 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the L gene or portion thereof may be a nucleotide sequence encoded by SEQ ID No. 15 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the L gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 16 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the L gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 16 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In one embodiment the Ebola virus sequence may be an Ebola virus non-coding sequence or portion thereof. Suitably, an Ebola virus non-coding sequence or portion thereof may be selected from the group consisting of: an intergenic region, a 5' UTR, and a 3UTR. The term "portion thereof" as used in this context means at least about 200, 400, 600, 700, 800, 1000, 1200 or 1400 bp. Suitably the term "portion thereof" means at least about 1000 bp.

In one embodiment the recombinant RNA virus for use in a method of the invention may be a Lentivirus and/or a Gammaretrovirus. Preferably the recombinant RNA virus for use in a method of the invention may be a Lentivirus.

Thus, the control and/or recombinant RNA virus may be prepared by a Lentiviral or Gammoretroviral (suitably a Lentiviral system).

A Lentiviral system as used herein may refer to a system whereby at least 3 kb contiguous nucleotide sequence of a pathogenic virus genome sequence or complement thereof is cloned into a Lentiviral vector (e.g. pSF-lenti, commercially available from Oxford Genetics). Such vectors suitably comprise one or more genetic elements for packaging a RNA expressed from said vector into a Lentiviral particle.

In one embodiment a recombinant RNA virus may be prepared by:

a. expressing a nucleic acid comprising at least 3 kb contiguous nucleotide sequence of said pathogenic virus or a complement thereof; and

b. associating the expressed nucleic acid with a viral protein.

Suitably a recombinant RNA virus prepared by such a method may then be isolated as per step b. of the method of the invention.

Suitably, preparation of a ribonucleoprotein may be carried out in a host cell.

Suitably, a viral protein may be co-expressed with the nucleic acid comprising at least 3 kb contiguous nucleotide sequence of said pathogenic virus or a complement thereof.

The recombinant RNA virus may be prepared by a method comprising:

a. providing a Lentiviral vector or Gammaretroviral vector (preferably a Lentiviral vector) comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus genome sequence or complement thereof; and

b. co-expressing said vector in a host cell with a nucleotide sequence encoding one or more Lentiviral or Gammaretroviral protein(s) to form a recombinant RNA virus.

Suitably the method further comprises isolating the recombinant RNA virus. In a particularly preferred embodiment there is provided a method for providing a control for use in a screen for a pathogenic virus comprising: providing a Lentiviral vector or Gammaretroviral vector (preferably a Lentiviral system) comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus genome sequence or complement thereof;

co-expressing said vector in a host cell with a nucleotide sequence encoding one or more Lentiviral or Gammaretroviral protein(s) to form a recombinant RNA virus (and optionally isolating said recombinant RNA virus);

isolating the recombinant RNA virus; and

performing ribonucleic acid (RNA) extraction on a recombinant RNA virus, wherein:

i. said recombinant RNA virus comprises a control RNA sequence for identification of the presence or absence of a pathogenic virus;

ii. the control RNA sequence comprises at least 3 kb contiguous nucleotide sequence of said pathogenic virus or a complement thereof; iii. the recombinant RNA virus is a Lentivirus or a Gammaretrovirus; and iv. the pathogenic virus is a pathogenic RNA virus; and providing an isolated recombinant RNA virus sequence.

In one embodiment the one or more Lentiviral or Gammaretroviral proteins may be selected from the group consisting of a gag protein, pol protein and a rev protein (suitably a Lentiviral gag protein, pol protein and rev protein).

Suitably a gag protein, pol protein, rev protein or combinations thereof may be encoded for by a Lentiviral and/or Gammaretroviral (suitably a Lentiviral) packaging vector. The term "packaging vector" as used herein is intended to refer to a vector that is different (e.g. a different entity) to a Lentiviral or Gammaretroviral vector as used herein.

The term "Lentiviral vector" as used herein refers to a vector comprising one or more genetic sequence elements derived from a Lentivirus suitable for packaging an RNA of the invention into a ribonucleoprotein (e.g. a recombinant RNA virus) comprising one or more Lentiviral protein(s).

The term "Gammaretroviral vector" as used herein refers to a vector comprising one or more genetic sequence elements derived from a Gammaretrovirus suitable for packaging an RNA of the invention into a ribonucleoprotein (e.g. a recombinant RNA virus) comprising one or more Gammaretroviral protein(s). Typically a Lentiviral or Gammaretroviral vector for use in the present invention comprises one or more selected from the group consisting of: retroviral long terminal repeats (LTR) either wild type or missing the U3 region, packaging signal, Rev responsive element (REV)- required for lentiviral vector, poly purine tract, unique restriction sites for the cloning of the heterologous genes, retroviral long terminal repeats (LTR) either wild type or missing the U5 region and a polyadenylation site.

Suitably a lentiviral vector may be a pSF-lenti vector ((OG269) commercially available from Oxford Genetics Ltd, UK). Other Lentiviral vectors include OG593 and OG637 also commercially available from Oxford Genetics Ltd, UK as well as those disclosed in GB9517263.1 (which is incorporated herein by reference in its entirety).

Vectors may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.

Gammaretroviral vectors are known in the art and suitable examples include those from Takara Clontech (e.g. Cat. no. 631503-631501-631509) or as described in Soneoka et al Nucleic Acids Res. 1995 Feb 25; 23(4): 628-633 (incorporated herein by reference). In embodiments where the pathogenic virus to be detected is a positive strand pathogenic RNA virus a control RNA sequence comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus may be inserted into a Lentiviral or Gammaretroviral vector in the same orientation as other Lentiviral or Gammaretroviral features (e.g. the promoter and/or LTR). In embodiments where the pathogenic virus to be detected is a negative strand pathogenic RNA virus a control RNA sequence comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus may be inserted into a Lentiviral or Gammaretroviral vector in the opposite orientation with respect to other Lentiviral or Gammaretroviral features (e.g. the promoter and/or LTR).

Cloning in the orientations indicated above, suitably mimics the presentation of the viral RNA in the wild-type virus.

The term "host cell" as used herein includes any cell that comprises a nucleotide as defined herein or an expression vector as described above and which is used in the production of a RNA or recombinant RNA virus of the invention. A host cell for use in a method of the invention may be a mammalian host cell. Suitably, a human host cell, for example a human cell line. In a preferred embodiment the host cell may be a HEK cell, such as a HEK 293 cell. In a particularly preferred embodiment the host cell may be a HEK 293T-17 cell such as ATCC CRL-1 1268 (commercially available from American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 201 10 USA).

Any means for transfecting a host cell with a nucleotide sequence, DNA or RNA of the invention may be employed, for example by polyethylenimine (PEI), calcium phosphate, Llpofectamine (Life Technologies), Xtreme Transfection reagent (Roche), FuGene (Promega) techniques.

The association of said RNA with a viral protein may be achieved by admixing one or more viral proteins with a RNA of the invention. Suitably, the association may occur in vivo (e.g. in a host cell).

Alternatively or additionally, a method for manufacturing a recombinant RNA virus for use in the present invention may comprise expressing one or more RNA viral protein(s), suitably co- expressing one or more viral protein(s) in a host cell or in vitro (preferably in a host cell) to produce a recombinant RNA virus comprising a RNA of the invention and one or more viral protein(s). Suitably, said method may further comprise isolating said recombinant RNA virus (e.g. using a sucrose gradient). The viral protein may be a Lentiviral protein (e.g. an HIV viral protein) and/or a Gammaretroviral protein.

Suitably, the viral protein may be a structural viral protein (e.g. a nucleoprotein). In one embodiment the viral protein may be a gag protein, pol protein, rev protein or combinations thereof (suitably a Lentiviral gag protein, pol protein, rev protein or combinations thereof). Suitably a gag protein, pol protein, rev protein or combinations thereof may be encoded for by a Lentiviral and/or Gammaretroviral (suitably a Lentiviral) packaging vector. In some embodiments the ribonucleoprotein of the invention may be a virus comprising a nucleotide sequence, vector and/or RNA of the invention (suitably Lentivirus or a Gammaretro virus) . In a particularly preferred embodiment the ribonucleoprotein of, or for use in, the present invention may be prepared using a Lentiviral system or a Gammaretroviral system (more preferably a Lentiviral system).

In a particularly preferred embodiment, a RNA, recombinant RNA virus, nucleotide sequence, DNA, ribonucleoprotein, kit or composition of the invention may be incapable of producing a pathogenic viral protein.

In one embodiment the invention provides for a nucleotide sequence comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus or a complement thereof operably linked to a promoter, wherein said nucleotide sequence is modified such that:

a. it comprises one or more nucleotide modifications, so that the nucleotide sequence is incapable of producing a pathogenic viral protein; and/or

b. it lacks one or more regulatory nucleotide sequence essential for translation of the viral genome sequence, so that the nucleotide sequence is incapable of producing a pathogenic viral protein.

The term "nucleotide sequence" as used herein may refer to an oligonucleotide sequence or polynucleotide sequence. The nucleotide sequence may be of genomic or synthetic or recombinant origin, which may be double-stranded or single-stranded whether representing the sense or anti-sense strand. Preferably the nucleotide sequence may be double- stranded.

The term "nucleotide sequence" as used herein in reference to the present invention may include genomic DNA, cDNA, synthetic DNA, and/or RNA. Suitably, the term "nucleotide sequence" as used herein refers to DNA.

A nucleotide sequence encompassed by the scope of the present invention may be prepared using recombinant DNA techniques (i.e. recombinant DNA). However, in one embodiment of the invention, the nucleotide sequence may be synthesised, in whole or in part, using chemical methods well known in the art (see Caruthers MH et al., (1980) Nuc Acids Res Symp Ser 215-23 and Horn T et al., (1980) Nuc Acids Res Symp Ser 225-232 which is incorporated herein by reference).

The term "incapable of producing a pathogenic viral protein" means that even if a nucleotide sequence or vector of the invention is transcribed to RNA (e.g. a RNA of the invention) and subsequently translated that a pathogenic viral protein is not produced. The term "incapable of producing a pathogenic viral protein" in not intended to exclude the translation of RNA (e.g. a RNA of the invention) transcribed from the nucleotide sequence or vector of the invention into a protein if such a protein has less than 50% sequence identity to a pathogenic viral protein. Suitably a protein translated from a RNA (e.g. a RNA of the invention) may have less than 25%, 10% or 5% sequence identity to a pathogenic viral protein. Preferably a protein translated from a RNA (e.g. a RNA of the invention) may have less than 1 % sequence identity to a pathogenic viral protein. In one embodiment the nucleotide sequence (suitably at least 3 kb contiguous nucleotide sequence of a pathogenic viral genome sequence or complement thereof) may be modified such that it comprises one or more nucleotide modifications, so that the nucleotide sequence (preferably the pathogenic viral genome sequence comprised therein) is incapable of producing a pathogenic viral protein.

The term "one or more nucleotide modifications" embraces one or more nucleotide modifications when compared to an unmodified nucleotide sequence (preferably an unmodified pathogenic viral genome sequence (e.g. a pathogenic viral reference sequence)). In some embodiments the one or more nucleotide modification(s) may result in the preparation of a nucleotide sequence that is no longer capable of producing a pathogenic viral protein. For example, the one or more nucleotide modification may result in a frame- shift of the pathogenic viral genome sequence with respect to a start codon. Such nucleotide modifications can be modifications of the pathogenic viral genome sequence or modification outside of the pathogenic viral genome sequence (e.g. a modification between the pathogenic viral genome sequence and the operably linked promoter).

The term "unmodified nucleotide sequence" as used herein refers to a reference nucleotide sequence from which a nucleotide sequence of the genome is derivable (e.g. derived). Preferably the unmodified nucleotide sequence may be an unmodified pathogenic viral genome sequence. The terms "unmodified pathogenic viral genome sequence" and " pathogenic viral genome sequence capable of producing an viral protein" as used herein refer to an pathogenic viral genome sequence prior to modification. For example if the (e.g. at least 3 kb contiguous nucleotide sequence of a pathogenic viral genome sequence or complement thereof) pathogenic viral genome sequence is derived from Ebola (e.g. Ebola Zaire), then the unmodified pathogenic viral genome sequence is the wild-type Ebola (e.g. Ebola Zaire) viral genome sequence prior to modification.

In one embodiment the terms "unmodified pathogenic viral genome sequence" and "pathogenic viral genome sequence capable of producing a pathogenic viral protein" as used herein refer to a genome sequence obtainable from Ebola. Suitably obtainable from one or more Ebola virus species selected from the group consisting of: Zaire, Bundibugyo, Sudan, Reston and Tai Forest (preferably an Ebola Zaire virus species). In a particularly preferred embodiment the terms "unmodified pathogenic viral genome sequence" and " pathogenic viral genome sequence capable of producing a pathogenic viral protein" as used herein may mean an Ebola Zaire Makona 2014 virus (e.g. isolate H.sapiens- wt/GIN/2014/Makona-Kissidougou-C15, GenBank accession number KJ660346.2 (Baize S, Pannetier D, Oestereich L, Rieger T, Koivogui L, Magassouba N, et al. Emergence of Zaire Ebola virus disease in Guinea. N Engl J Med 2014 Oct 9;371 (15):1418-25 incorporated herein by reference).

The one or more nucleotide modifications may be selected from the group consisting of substitutions, deletions, inversions and insertions.

In one embodiment the nucleotide modification may be a substitution.

In another embodiment the nucleotide modification may be a deletion. In a further embodiment the nucleotide modification may be an inversion.

In a yet further embodiment the nucleotide modification may be an insertion.

Such modifications can be carried out using standard techniques known to one skilled in the art, for example using standard techniques in molecular biology. For example, such techniques include those taught in J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1 -3, Cold Spring Harbor Laboratory Press which is incorporated herein by reference.

In one embodiment the one or more modification may introduce one or more stop codon(s) in the nucleotide sequence. Suitably two or more stop codons may be introduced in the nucleotide sequence. Preferably three or more (more preferably three) stop codons may be introduced in the nucleotide sequence.

In another embodiment the one or more modification may introduce one or more stop codon(s) in the pathogenic viral genome sequence comprised in the nucleotide sequence of the invention. Suitably two or more stop codons may be introduced in the pathogenic viral genome sequence comprised in the nucleotide sequence of the invention. Preferably three or more (more preferably three) stop codons may be introduced in the pathogenic viral genome sequence comprised in the nucleotide sequence of the invention.

In some embodiments, a plurality of stop codons (e.g. two or more, three or more, and/or four or more stop codons) may be inserted sequentially.

The term "stop codon" has its normal meaning in the art and refers to a three nucleotide sequence that results in translation termination of a RNA comprising said sequence. Suitably the stop codon (when present in a RNA sequence) may be one or more selected from the group consisting of: UAG, UAA and UGA.

In some embodiments a nucleotide sequence of the present invention may be modified to render one or more start codon(s) non-functional. Suitably a viral genome sequence comprised in the nucleotide sequence of the invention may be modified to render one or more start codon(s) non-functional.

Rendering one or more start codon(s) non-functional may comprise substituting one or more start codon nucleotides with an alternative nucleotide, deleting the start codon or a portion thereof, inverting the start codon, or inserting one or more nucleotide(s).

In another embodiment the nucleotide sequence (suitably the at least 3 kb contiguous nucleotide sequence of a pathogenic viral genome sequence or complement thereof) may be modified such that it lacks one or more regulatory nucleotide sequences essential for translation of the pathogenic viral genome sequence, so that the nucleotide sequence is incapable of producing a pathogenic viral protein.

The term "one or more regulatory nucleotide sequences essential for translation" as used in this context may refer to a start codon and/or a promoter. Preferably the term "one or more regulatory nucleotide sequences essential for translation" refers to a start codon.

The term "start codon" as used herein refers to a first codon of a RNA translated by a ribosome. Suitably, the "start codon" may be AUG (when comprised in a RNA sequence).

In some embodiments, alternatively or additionally the nucleotide sequence (suitably the at least 3 kb contiguous nucleotide sequence of a pathogenic viral genome sequence or complement thereof) may be modified such that the pathogenic viral genome sequence is in an antisense orientation with respect to the promoter when compared to a pathogenic viral genome sequence capable of producing a pathogenic viral protein, so that the nucleotide sequence is incapable of producing a pathogenic viral protein.

The term "antisense orientation with respect to the promoter" means that the pathogenic viral genome sequence when transcribed produces an RNA that is a reverse complement of an pathogenic viral genome sequence capable of being translated to produce a pathogenic viral protein. For example, if a sequence capable of being translated to produce a pathogenic viral protein comprises the nucleotides:

...ATCGATCG...

Then a sequence in an "antisense orientation with respect to the promoter" will be transcribed to produce the following sequence:

... CGAUCGAU...

Thus, it can be seen that a sequence in an "antisense orientation with respect to the promoter" will not encode an RNA transcript (and ultimately a protein) that is structurally and/or functionally equivalent to that of a pathogenic viral genome sequence capable of being translated to produce a pathogenic viral protein. Preferably any protein that may be produced may have less than 50% sequence identity to a pathogenic viral protein (preferably less than 25%, 10% or 5% sequence identity to a pathogenic viral protein, more preferably less than 1 % sequence identity to a pathogenic viral protein).

Suitably, a nucleotide sequence that is in an "antisense orientation with respect to the promoter" may be prepared by inverting the orientation of a pathogenic viral genome sequence. In one embodiment, the nucleotide sequence (suitably the at least 3 kb contiguous nucleotide sequence of a pathogenic viral genome sequence or complement thereof) may be modified such that it comprises one or more nucleotide modifications and modified such that it lacks one or more regulatory nucleotide sequences essential for translation of the pathogenic viral genome sequence, so that the nucleotide sequence is incapable of producing a pathogenic viral protein.

Suitably, the nucleotide sequence (suitably the at least 3 kb contiguous nucleotide sequence of a pathogenic viral genome sequence or complement thereof) may be modified such that: a. the pathogenic viral genome sequence is in an antisense orientation with respect to the promoter when compared to a pathogenic viral genome sequence capable of producing a pathogenic viral protein; and

b. the nucleotide sequence (suitably the at least 3 kb contiguous nucleotide sequence of a pathogenic viral genome sequence or complement thereof) modified such that it comprises one or more nucleotide modifications; and

c. further modified such that it lacks one or more regulatory nucleotide sequences essential for translation of the pathogenic viral genome sequence;

so that the nucleotide sequence is incapable of producing a pathogenic viral protein.

In some embodiments the nucleotide sequence may comprise between about 3 kb to about 9.5 kb contiguous nucleotide sequence of a pathogenic viral genome sequence. Suitably, the nucleotide sequence may comprise between about 4 kb to about 9 kb of a pathogenic viral genome sequence or a complement thereof. Suitably, the nucleotide sequence may comprise between about 5 kb to about 9 kb of a pathogenic viral genome sequence or a complement thereof. Preferably, the nucleotide sequence may comprise between about 6 kb to about 9 kb of a pathogenic viral genome sequence or a complement thereof.

In some embodiments the nucleotide sequence may comprise at least about 4 kb or at least about 5 kb of a pathogenic viral genome sequence or a complement thereof. Suitably, the nucleotide sequence may comprise at least about 6 kb or at least about 7 kb of a pathogenic viral genome sequence or a complement thereof.

Preferably the nucleotide sequence may comprise or consist of at least 5 kb of a pathogenic viral genome sequence or complement thereof.

Preferably, the nucleotide sequence may comprise about 6.7 kb or about 8.3 kb or of a pathogenic viral genome sequence or a complement thereof. The pathogenic viral genome sequence of the present invention may be obtainable (e.g. obtained) from a pathogenic RNA virus.

In one embodiment the pathogenic RNA virus may be a positive sense pathogenic RNA virus. Suitably a positive sense pathogenic RNA virus may be one or more selected from the group consisting of: a SARS coronavirus, a MERS coronaviruses, a Dengue virus, a Chikungunya virus, a Ross river virus, a Yellow fever virus, a West Nile virus, a Japanese encephalitis virus, a Zika virus, and an ambisense RNA viral sequences (e.g. Lassavirus).

In another embodiment the pathogenic RNA virus may be a negative sense pathogenic RNA virus. Suitably a negative sense pathogenic RNA may include viruses causing haemorrhagic fever. Suitably, a negative sense pathogenic RNA virus may be selected from the group consisting of: Ebolavirus spp. Sudan and Bundibugyo, Marburg virus, Hantaviruses, Rift Valley fever virus, Crimean-Congo hemorrhagic fever virus, Nipah virus and Hendra virus. In embodiments where the pathogenic RNA virus is a negative sense pathogenic virus, suitably the RNA virus may be a Marburg virus. Suitably a Marburg virus may be one having a genome with GenBank accession number DQ447649.

In embodiments where the RNA pathogenic virus is Ebola, suitably the Ebola virus may be one or more Ebola virus species selected from the group consisting of: Zaire, Bundibugyo, Sudan, Reston and Tai Forest. Suitably, the Ebola virus genome sequence of the present invention may be obtainable (e.g. obtained) from the Ebola virus species Zaire. Ebola Zaire is taught in Gire et al, Science, 2014, 345(6202), 1369-1372 the contents of which is incorporated herein by reference.

Preferably the Ebola virus genome sequence of, or for use in, the present invention may be obtainable (e.g. obtained) from an Ebola Zaire Makona 2014 virus (e.g. isolate H.sapiens- wt/GIN/2014/Makona-Kissidougou-C15, GenBank accession number KJ660346.2 (Baize S, Pannetier D, Oestereich L, Rieger T, Koivogui L, Magassouba N, et al. Emergence of Zaire Ebola virus disease in Guinea. N Engl J Med 2014 Oct 9;371 (15):1418-25 incorporated herein by reference).

In another embodiment the Ebola virus genome sequence of the present invention may be obtainable (e.g. obtained) from the Ebola virus species Sudan, suitably Ebola Sudan having a genome with GenBank accession number AY729654.

In one embodiment the nucleotide sequence of the present invention may comprise a pathogenic viral gene or portion thereof. Suitably the nucleotide sequence of the present invention may comprise at least 2, 3, 4 or 5 pathogenic viral genes or portions thereof

In one embodiment the nucleotide sequence of the invention may comprise a pathogenic RNA virus gene or portion thereof of a positive sense pathogenic RNA virus. Suitably a positive sense pathogenic RNA virus gene or portion thereof may be one or more selected from the group consisting of: a SARS coronavirus, a MERS coronaviruses, a Dengue virus, a Chikungunya virus, a Ross river virus, a Yellow fever virus, a West Nile virus, a Japanese encephalitis virus, a Zika virus, and an ambisense RNA viral sequences (e.g. Lassavirus).

In another embodiment the nucleotide sequence of the invention may comprise a pathogenic RNA virus gene or portion thereof of a negative sense pathogenic RNA virus. Suitably a negative sense pathogenic RNA virus gene or portion thereof of a virus causing haemorrhagic fever. Suitably, a negative sense pathogenic RNA virus gene or portion thereof may be selected from the group consisting of: Ebolavirus spp. Sudan and Bundibugyo, Marburg virus, Hantaviruses, Rift Valley fever virus, Crimean-Congo hemorrhagic fever virus, Nipah virus and Hendra virus. In one embodiment the gene or portion thereof may be obtainable from a Marburg virus gene or portion thereof. Suitably, a Marburg virus gene or portion thereof may be obtainable from Marburg virus having a genome with GenBank accession number DQ447649. Suitably a Marburg virus gene or portion thereof may be selected form the group consisting of: NP, VP35, VP40 and GP.

In one embodiment the gene or portion thereof may be an Ebola virus gene or portion thereof.

In one embodiment the gene or portion thereof may be obtainable from Ebola Zaire, suitably an Ebola Zaire having a genome with GenBank accession number KJ660346.2.

In another embodiment the gene or portion thereof may be obtainable from Ebola Sudan virus, suitably an Ebola Sudan virus having a genome with GenBank accession number AY729654.

Suitably an Ebola virus gene or portion thereof may be selected form the group consisting of: NP, VP35, VP40, GP/sGP, VP30, VP24 and L.

In one embodiment the Ebola virus gene may be NP or a portion thereof. The NP gene of Ebola encodes a RNA binding protein believed to be responsible for genomic packaging.

In one embodiment the NP gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 3 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the NP gene may be a nucleotide sequence shown as or encoded by SEQ ID No. 3 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the NP gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 4 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the NP gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 4 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof. In another embodiment the Ebola virus gene may be VP35 or a portion thereof. The VP35 gene of Ebola encodes a polymerase cofactor in the RNA polymerase transcription and replication complex.

In one embodiment the VP35 gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 5 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the VP35 gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 5 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the VP35 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 6 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the VP35 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 6 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof. In another embodiment the Ebola virus gene may be VP40 or a portion thereof. The VP40 gene of Ebola encodes a virus assembly and budding promotion factor. Without wishing to be bound by theory, it is believed that VP40 interacts with host proteins of the multivesicular body pathway. In one embodiment the VP40 gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 7 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the VP40 gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 7 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the VP40 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 8 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the VP40 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 8 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the Ebola virus gene may be GP/sGP or a portion thereof. The GP/sGP gene of Ebola encodes a glycoprotein responsible for binding to receptors on target cells.

In one embodiment the GP/sGP gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 9 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the GP/sGP gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 9 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof. In another embodiment the GP/sGP gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 10 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the GP/sGP gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 10 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the Ebola virus gene may be VP30 or a portion thereof. The VP30 gene of Ebola encodes a transcription anti-termination factor. In one embodiment the VP30 gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 11 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the VP30 gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 1 1 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the VP30 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 12 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the VP30 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 12 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the Ebola virus gene may be VP24 or a portion thereof. Without wishing to be bound by theory it is believed that the VP24 gene of Ebola encodes a membrane-associated protein believed to prevent the establishment of cellular antiviral state by blocking the interferon-alpha/beta and IFN-gamma signalling pathways.

In one embodiment the VP24 gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 13 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the VP24 gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 13 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the VP24 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 14 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the VP24 gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 14 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In another embodiment the Ebola virus gene may be L or a portion thereof. The L gene of Ebola encodes an polypeptide believed to have RNA-directed RNA polymerase, mRNA guanylyl transferase, mRNA (guanine-N(7)-)-methyltransferase and/or poly(A) synthetase activities.

In one embodiment the L gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 15 or a nucleotide sequence having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably the L gene or portion thereof may be a nucleotide sequence shown as or encoded by SEQ ID No. 15 or a nucleotide sequence having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof. In another embodiment the L gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 16 or a polypeptide having at least 75% identity thereto (suitably at least 80% or 85% identity thereto) or a portion thereof. Suitably, the L gene or portion thereof may be a nucleotide sequence encoding a polypeptide shown as SEQ ID No. 16 or a polypeptide having at least 90% identity thereto (suitably at least 95% or 99% identity thereto) or a portion thereof.

In one embodiment the Ebola virus sequence may be an Ebola virus non-coding sequence or portion thereof. Suitably, an Ebola virus non-coding sequence or portion thereof may be selected from the group consisting of: an intergenic region, a 5' UTR, and a 3UTR. The term "portion thereof" as used in this context means at least about 200, 400, 600, 700, 800, 1000, 1200 or 1400 bp. Suitably the term "portion thereof" means at least about 1000 bp.

The pathogenic viral genome sequence of the invention is operably linked to a promoter.

The term "operably linked to a promoter" as used herein means that the pathogenic viral genome sequence as described herein is situated such that when the promoter is activated the pathogenic viral genome sequence is transcribed. Therefore, the term "operably linked" is intended to exclude scenarios where the pathogenic viral genome sequence described herein is unable to be transcribed upon promoter activation.

The term "promoter" takes its normal meaning in the art, i.e. a RNA polymerase binding site.

The promoter may be any promoter capable of directing expression of a nucleotide sequence or vector of the invention (e.g. in a host cell). In some embodiments the promoter may be any promoter (e.g. an eukaryotic promoter) capable of directing expression of a nucleotide sequence or vector of the invention in a mammalian cell, suitably in a human cell.

A promoter of the present invention may be a cytomegalovirus promoter (CMV), an SV40 promoter, an EF1a promoter, a PGK1 promoter, a Ubc promoter, a CAG promoter, a TRE promoter, a UAS promoter, an Ac5 promoter, a Polyhedrin promoter, a CaMKIIa promoter, a GAL1 promoter, a GAL10 promoter, a TEF1 promoter, a GDS promoter, an ADH1 promoter, a CaMV35S promoter, a Ubi promoter, an H1 promoter, a U6 promoter or combinations thereof. Suitably the promoter of the present invention may be a CMV promoter, preferably a CMV major immediate early promoter.

In some embodiments, the pathogenic viral genome sequence may be operably linked to a promoter and one or more additional gene regulatory elements. In one embodiment a nucleotide sequence and/or vector of the present invention may comprise one or more additional gene regulatory elements of viral origin.

In one embodiment the one or more additional gene regulatory elements are Lentiviral or Gammaretroviral regulatory elements.

Typically a Lentiviral or Gammaretroviral vector for use in the present invention comprises one or more selected from the group consisting of: retroviral long terminal repeats (LTR) either wild type or missing the U3 region, packaging signal, Rev responsive element (REV)- required for lentiviral vector, poly purine tract, unique restriction sites for the cloning of the heterologous genes, retroviral long terminal repeats (LTR) either wild type or missing the U5 region and a polyadenylation site.

In one embodiment a nucleotide sequence of the invention may comprise (or consist of): a. SEQ ID No. 1 or a nucleotide sequence having at least 75% sequence identity to thereto;

b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 75% sequence identity to thereto;

c. SEQ ID No. 2 or a nucleotide sequence having at least 75% sequence identity to thereto; and/or

d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least 75% sequence identity to thereto.

In another embodiment a nucleotide sequence of the invention may comprise (or consist of): a. SEQ ID No. 1 or a nucleotide sequence having at least 80% sequence identity to thereto;

b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 80% sequence identity to thereto;

c. SEQ ID No. 2 or a nucleotide sequence having at least 80% sequence identity to thereto; and/or d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least 80% sequence identity to thereto.

Suitably a nucleotide sequence of the invention may comprise (or consist of):

a. SEQ ID No. 1 or a nucleotide sequence having at least 85% sequence identity to thereto;

b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 85% sequence identity to thereto;

c. SEQ ID No. 2 or a nucleotide sequence having at least 85% sequence identity to thereto; and/or

d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least 85% sequence identity to thereto.

Suitably, a nucleotide sequence of the invention may comprise (or consist of):

a. SEQ ID No. 1 or a nucleotide sequence having at least 90% sequence identity to thereto;

b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 90% sequence identity to thereto;

c. SEQ ID No. 2 or a nucleotide sequence having at least 90% sequence identity to thereto; and/or

d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least 90% sequence identity to thereto.

Suitably, a nucleotide sequence of the invention may comprise (or consist of):

a. SEQ ID No. 1 or a nucleotide sequence having at least 95% sequence identity to thereto;

b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 95% sequence identity to thereto;

c. SEQ ID No. 2 or a nucleotide sequence having at least 95% sequence identity to thereto; and/or

d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least 95% sequence identity to thereto.

The present invention also provides a vector comprising a nucleotide sequence of the invention. The term "vector" as used herein means a construct capable of being transcribed in vivo and/or in vitro.

The choice of vector, e.g. plasmid, cosmid, virus or phage vector, genomic insert, (preferably a plasmid) will often depend on the host cell into which it is to be introduced. The present invention may cover other forms of expression vectors which serve equivalent functions and which are, or become, known in the art. Once transformed into the host cell of choice, the vector may replicate and function independently of the host cell's genome, or may integrate into the genome itself. The vectors may contain one or more selectable marker genes - such as a gene which confers antibiotic resistance e.g. ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Alternatively, the selection may be accomplished by co- transformation (as described in W091/17243 which is incorporated herein by reference).

In one embodiment a vector of the present invention may be a lentiviral vector.

Thus, in a further embodiment, the invention provides a method of making nucleotide sequences of the present invention for use in any one of the vectors, host cells, other methods and/or uses of the present invention, by introducing a nucleotide sequence into a replicable vector. Suitably such methods may further comprise introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector.

In one embodiment a vector of the invention may comprise (or consist of):

a. SEQ ID No. 1 or a nucleotide sequence having at least 75% sequence identity to thereto;

b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 75% sequence identity to thereto;

c. SEQ I D No. 2 or a nucleotide sequence having at least 75% sequence identity to thereto; and/or

d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least

75% sequence identity to thereto.

In another embodiment a vector of the invention may comprise (or consist of):

a. SEQ ID No. 1 or a nucleotide sequence having at least 80% sequence identity to thereto; b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 80% sequence identity to thereto;

c. SEQ ID No. 2 or a nucleotide sequence having at least 80% sequence identity to thereto; and/or

d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least

80% sequence identity to thereto.

Suitably a vector of the invention may comprise (or consist of):

a. SEQ I D No. 1 or a nucleotide sequence having at least 85% sequence identity to thereto;

b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 85% sequence identity to thereto;

c. SEQ ID No. 2 or a nucleotide sequence having at least 85% sequence identity to thereto; and/or

d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least

85% sequence identity to thereto.

Suitably, a vector of the invention may comprise (or consist of):

a. SEQ ID No. 1 or a nucleotide sequence having at least 90% sequence identity to thereto;

b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 90% sequence identity to thereto;

c. SEQ ID No. 2 or a nucleotide sequence having at least 90% sequence identity to thereto; and/or

d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least

90% sequence identity to thereto.

Suitably, a vector of the invention may comprise (or consist of):

a. SEQ ID No. 1 or a nucleotide sequence having at least 95% sequence identity to thereto;

b. a portion of SEQ ID No. 1 or a portion of a nucleotide sequence having at least 95% sequence identity to thereto;

c. SEQ ID No. 2 or a nucleotide sequence having at least 95% sequence identity to thereto; and/or

d. a portion of SEQ ID No. 2 or a portion of a nucleotide sequence having at least

95% sequence identity to thereto. The nucleotide sequence and/or vector of the invention may be prepared synthetically by established standard methods, e.g. the phosphoroamidite method described by Beucage S.L. et al., (1981 ) Tetrahedron Letters 22, p 1859-1869, or the method described by Matthes et al., (1984) EMBO J. 3, p 801 -805. In the phosphoroamidite method, oligonucleotides are synthesised, e.g. in an automatic DNA synthesiser, purified, annealed, ligated and cloned in appropriate vectors. The nucleotide sequence and/or vector of the invention may be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin, or mixed genomic and cDNA origin, prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate) in accordance with standard techniques. Each ligated fragment corresponds to various parts of the entire nucleotide sequence. The DNA sequence may also be prepared by polymerase chain reaction (PCR) using specific primers, for instance as described in US 4,683,202 or in Saiki R K et al., (Science (1988) 239, pp 487-491). The present invention also encompasses sequences that are complementary to the nucleic acid sequences and/or vector of the invention or sequences that are capable of hybridising either to the sequences of the present invention or to sequences that are complementary thereto. The term "hybridisation" as used herein shall include "the process by which a strand of nucleic acid joins with a complementary strand through base pairing" as well as the process of amplification as carried out in polymerase chain reaction (PCR) technologies.

The present invention also encompasses the use of nucleotide sequences that are capable of hybridising to the sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof.

The term "variant" also encompasses sequences that are complementary to sequences that are capable of hybridising to the nucleotide sequences presented herein.

Preferably, the term "variant" encompasses sequences that are complementary to sequences that are capable of hybridising under stringent conditions (e.g. 50°C and 0.2xSSC {1 xSSC = 0.15 M NaCI, 0.015 M Na ₃ citrate pH 7.0}) to the nucleotide sequences presented herein.

More preferably, the term "variant" encompasses sequences that are complementary to sequences that are capable of hybridising under high stringent conditions (e.g. 65°C and O.I xSSC {1xSSC = 0.15 M NaCI, 0.015 M Na ₃ citrate pH 7.0}) to the nucleotide sequences presented herein.

The present invention also relates to nucleotide sequences that can hybridise to the nucleotide sequences of the present invention (including complementary sequences of those presented herein).

The present invention also relates to nucleotide sequences that are complementary to sequences that can hybridise to the nucleotide sequences of the present invention (including complementary sequences of those presented herein).

Also included within the scope of the present invention are polynucleotide sequences that are capable of hybridising to the nucleotide sequences presented herein under conditions of intermediate to maximal stringency.

In a preferred aspect, the present invention covers nucleotide sequences that can hybridise to the nucleotide sequence of the present invention, or the complement thereof, under stringent conditions (e.g. 50°C and 0.2 x SSC). In a more preferred aspect, the present invention covers nucleotide sequences that can hybridise to the nucleotide sequence of the present invention, or the complement thereof, under high stringent conditions (e.g. 65°C and 0.1 x SSC).

In one embodiment a nucleotide sequence and/or vector of the invention may be a recombinant sequence - i.e. a sequence that has been prepared using recombinant DNA techniques.

These recombinant DNA techniques are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1 -3, Cold Spring Harbor Laboratory Press.

In one embodiment the present invention provides a method for manufacturing a nucleotide sequence and/or vector of the invention comprising: a. providing a nucleotide sequence comprising at least 3 kb contiguous nucleotide sequence of a pathogenic viral genome sequence or complement thereofoperably linked to a promoter;

b. modifying the nucleotide sequence such that:

i. it comprises one or more nucleotide modifications, so that the nucleotide sequence is incapable of producing a pathogenic viral protein; and/or ii. it lacks one or more regulatory nucleotide sequences essential for translation of the pathogenic viral genome sequence, so that the nucleotide sequence is incapable of producing a pathogenic viral protein.

The present invention also provides methods for manufacturing a RNA of the invention.

In one embodiment a method for manufacture a RNA comprises synthesising a RNA the equivalent to that encoded by a nucleotide sequence of the invention.

In one embodiment a method for manufacturing a RNA comprises expressing a nucleotide sequence or vector according to the invention.

Expression of the nucleotide sequence or vector can be achieved using any technique known by the person skilled in the art. For example, in one embodiment expression may be carried out in a host cell. Suitably, such methods may comprise transforming a suitable host cell with a nucleotide sequence or vector according to the invention.

A host cell for use in a method of the invention may be a mammalian host cell. Suitably, a human host cell, for example a human cell line. In a preferred embodiment the host cell may be a HEK cell, such as a HEK 293 cell. In a particularly preferred embodiment the host cell may be a HEK 293T-17 cell such as ATCC CRL-1 1268 (commercially available from American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 201 10 USA).

Suitably, the method further comprises isolating said expressed RNA.

Thus, the present invention provides a RNA (preferably a control RNA) obtainable by a method according to the invention or a synthesised RNA structurally equivalent thereto. The present invention also provides a DNA obtainable from the RNA of the present invention. The DNA may be obtained by standard techniques, such as reverse transcriptase PCR (e.g. as available commercially from ThermoFisher Scientific, USA). In one embodiment a RNA of the invention may be associated with a viral protein to form a ribonucleoprotein.

The term "ribonucleoprotein" as used herein refers to a RNA sequence associated with a protein. The association of RNA and protein may be effected by any suitable means, including, for example, protein-nucleic acid interactions. In other words the term "ribonucleoprotein" as used herein may refer to a RNA-protein complex.

In one embodiment a ribonucleoprotein may be prepared by:

a. expressing a nucleic acid of, or for use in, the present invention (e.g. comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus or a complement thereof); and

b. associating the expressed nucleic acid with a viral protein.

Suitably, preparation of a ribonucleoprotein may be carried out in a host cell. Suitably, a human host cell, for example a human cell line. In a preferred embodiment the host cell may be a HEK cell, such as a HEK 293 cell. In a particularly preferred embodiment the host cell may be a HEK 293T-17 cell such as ATCC CRL-1 1268 (commercially available from American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 201 10 USA).

The association of said RNA with a viral protein may be achieved by admixing one or more viral proteins with a RNA of the invention. Suitably, the association may occur in vivo (e.g. in a host cell). In one embodiment, preparation of a ribonucleoprotein may comprise co-expressing a viral protein (e.g. a viral protein encoded by one or more plasmid(s)) with a nucleic acid of, or for use in, the present invention (e.g. comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus or a complement thereof). Alternatively or additionally, a method for manufacturing a ribonucleoprotein of the invention may comprise expressing one or more viral protein(s), suitably co-expressing one or more viral protein(s) in a host cell or in vitro (preferably in a host cell) to produce a ribonucleoprotein comprising a RNA of the invention and one or more viral protein(s). Suitably, said method may further comprise isolating said ribonucleoprotein comprising a RNA of the invention and one or more viral protein(s) (e.g. using a sucrose gradient).

The present invention relates to a ribonucleoprotein comprising a RNA of the invention and one or more viral protein(s) as well as its uses.

In one embodiment a viral protein may be a Lentiviral protein (e.g. an HIV viral protein) and/or a Gammaretroviral protein.

Suitably, the viral protein may be a structural viral protein (e.g. a nucleoprotein).

In one embodiment the viral protein may be a gag protein (preferably a Lentiviral gag protein) or a pol protein (preferably a Lentiviral pol protein).

In some embodiments the ribonucleoprotein of the invention may be a virus comprising a nucleotide sequence, vector and/or RNA of the invention (suitably Lentivirus or a Gammaretro virus) .

In a particularly preferred embodiment the ribonucleoprotein of, or for use in, the present invention may be prepared using a Lentiviral system or a Gammaretroviral system (more preferably a Lentiviral system). In some embodiments the ribonucleoprotein may be a virus, suitably an RNA virus (preferably a recombinant Lentivirus or Gammaretrovirus).

The invention also relates to compositions comprising a nucleotide sequence, vector, RNA, DNA and/or ribonucleoprotein of the present invention. In one embodiment a composition of the invention may comprise a buffer, suitably a buffer that stabilises a nucleotide sequence, vector, RNA, DNA and/or ribonucleoprotein of the present invention and/or that is compatible with performing a PCR reaction.

A composition according to the present invention may be formulated into a high or low titre composition. A high titre composition may comprise a high concentration of a nucleotide sequence, vector, RNA, DNA and/or ribonucleoprotein of the present invention (preferably a high concentration of a ribonucleoprotein of the present invention). A low titre composition may comprise a low concentration of a nucleotide sequence, vector, RNA, DNA and/or ribonucleoprotein of the present invention (preferably a high concentration of a ribonucleoprotein of the present invention).

In one embodiment a high titre composition as used herein may refer to a composition comprising a nucleotide sequence, vector, RNA, DNA and/or ribonucleoprotein of the present invention in a concentration that can be titrated in a qPCR reaction using a standard curve. In contrast, a low titre composition as used herein may refer to a composition comprising a nucleotide sequence, vector, RNA, DNA and/or ribonucleoprotein of the present invention in a concentration that cannot be titrated in a qPCR reaction using a standard curve e.g. which is at or below the limit of detection sensitivity of qPCR.

In one embodiment a composition of the invention may comprise universal buffer (e.g. 10mM Tris-HCI pH 7.4, 0.5% Serum Albumin (e.g. human serum albumin - Bio Produces Laboratory Limited), 0.1 % D-(+)-trehalose dehydrate (Sigma)), preferably an isovolume thereof (e.g. an equal volume of universal buffer).

In one embodiment the composition may be freeze-dried and/or desiccated.

The present invention also provides a kit comprising a nucleotide sequence, a vector, a RNA, a DNA, a ribonucleoprotein or a composition according to the invention and instructions for using same. In some embodiments the kit may comprise one or more further reagents. For example, the kit may comprise one or more nucleic acid detection reagents.

In one embodiment the kit may comprise one or more nucleic acid detection reagent selected from the group consisting of: a primer, a probe, a polymerase and a buffer (e.g. a reaction buffer for a polymerase).

In one embodiment the invention provides a method for screening for a virus comprising: a. providing a nucleotide sequence, a RNA, a DNA, a ribonucleoprotein, a composition or a kit according to the invention; and

b. using the nucleotide sequence, RNA, DNA, ribonucleoprotein, composition or kit according to the invention as a positive control in a screen for a virus. The present invention also relates to a method for detecting the presence or absence of a pathogenic virus comprising:

a. providing an experimental sample and a control sample, wherein the control sample comprises:

i. an isolated recombinant RNA extracted from a recombinant RNA virus, wherein:

A. said recombinant RNA virus comprises a control RNA sequence for identification of the presence or absence of a pathogenic virus;

B. the control RNA sequence comprises at least 3 kb contiguous nucleotide sequence of said pathogenic virus or a complement thereof;

C. the recombinant RNA virus is a Lentivirus or a Gammaretrovirus; and

D. the pathogenic virus is a pathogenic RNA virus;

ii. a nucleotide sequence of the invention;

iii. a vector of the invention;

iv. a RNA of the invention;

v. a DNA of the invention;

vi. a ribonucleoprotein of the invention;

vii. a composition of the invention; or

viii. a kit of the invention;

b. screening the experimental sample and the control sample for the presence or absence of a pathogenic viral nucleotide sequence; and

c. comparing a result obtained in step b. for the experimental sample and the control sample.

In one embodiment the method for detecting the presence or absence of a pathogenic virus may refer to detecting the presence or absence of an RNA virus.

In one embodiment the pathogenic RNA virus may be a positive sense pathogenic RNA virus. Suitably a positive sense pathogenic RNA virus may be one or more selected from the group consisting of: a SARS coronavirus, a MERS coronaviruses, a Dengue virus, a Chikungunya virus, a Ross river virus, a Yellow fever virus, a West Nile virus, a Japanese encephalitis virus, a Zika virus, and an ambisense RNA viral sequences (e.g. Lassavirus). In another embodiment the pathogenic RNA virus may be a negative sense pathogenic RNA virus. Suitably a negative sense pathogenic RNA may include viruses causing haemorrhagic fever. Suitably, a negative sense pathogenic RNA virus may be selected from the group consisting of: Ebolavirus spp. Sudan and Bundibugyo, Marburg virus, Hantaviruses, Rift Valley fever virus, Crimean-Congo hemorrhagic fever virus, Nipah virus and Hendra virus.

Preferably the negative sense pathogenic RNA virus may be a Marburg virus.

In embodiments where the RNA pathogenic virus is Ebola, suitably the Ebola virus may be one or more Ebola virus species selected from the group consisting of: Zaire, Bundibugyo, Sudan, Reston and Tai Forest.

Suitably, the Ebola virus may be obtainable (e.g. obtained) from the Ebola virus species Zaire. Ebola Zaire is taught in Gire et al, Science, 2014, 345(6202), 1369-1372 the contents of which is incorporated herein by reference.

Preferably the Ebola virus may be obtainable (e.g. obtained) from an Ebola Zaire Makona 2014 virus (e.g. isolate H.sapiens-wt/GIN/2014/Makona-Kissidougou-C15, GenBank accession number KJ660346.2 (Baize S, Pannetier D, Oestereich L, Rieger T, Koivogui L, Magassouba N, et al. Emergence of Zaire Ebola virus disease in Guinea. N Engl J Med 2014 Oct 9;371 (15):1418-25 incorporated herein by reference).

The term "experimental sample" refers to a sample to be tested. In one embodiment the experimental sample may be obtained from a test subject (preferably a human test subject).

In one embodiment the experimental sample may be obtained from a biological fluid (biofluid) sample or a fraction thereof.

The biofluid sample may be a urine sample, a blood sample, a cerebrospinal fluid sample, a lymph sample, combinations thereof or a fraction thereof.

Suitably, the biofluid sample may be a urine sample or a fraction thereof.

Suitably, the biofluid sample may be a saliva sample or a fraction thereof.

Suitably the biofluid sample may be a blood sample or a fraction thereof. The term "blood" as used herein comprises whole blood, blood serum (henceforth "serum") and blood plasma (henceforth "plasma"). Serum and plasma are derived from blood and thus may be considered as specific subtypes within the broader genus "blood". Processes for obtaining serum or plasma from blood are known in the art. For example, it is known in the art that blood can be subjected to centrifugation in order to separate red blood cells, white blood cells, and plasma. Serum is defined as plasma that lacks clotting factors. Serum can be obtained by centrifugation of blood in which the clotting process has been triggered. Optionally, this can be carried out using specialised centrifuge tubes designed for this purpose.

The biofluid sample for use in the present invention may not have undergone any processing or may have only undergone minimal processing after being obtained from a test subject. The term "fraction thereof" when used herein in the context of biofluid fractions refers to a portion of a biofluid fraction obtainable or obtained following processing of a biofluid. Suitably a biofluid fraction refers to one or more constituent(s) of a biofluid that has been separated from one or more further biofluid constituent(s). For example, a fraction of a blood sample may be a blood plasma fraction.

The control sample for use in the present invention may comprise (or consist of) an isolated recombinant RNA extracted from a recombinant RNA virus of the invention, a nucleotide sequence, vector, RNA, DNA, ribonucleoprotein, composition or kit according to the present invention.

Suitably the control sample comprises (or consists of) an isolated recombinant RNA extracted from a recombinant RNA virus of the invention

In some embodiments the control sample may comprise (or consist of) a DNA obtainable from an RNA of the invention.

Suitably, the control sample may comprise (or consist of) an DNA of the present invention. Preferably, an isolated DNA of the present invention. Suitably, the control sample may comprise (or consist of) a RNA of the present invention. Preferably, an isolated RNA of the present invention (e.g. isolated using a total nucleic acid extraction kit (Roche Diagnostics) in a COBAS® Ampliprep Instrument (Roche Diagnostics)). The methods for screening may therefore comprise a sample processing step, wherein the experimental sample and/or control sample are processed to isolate a DNA and/or RNA.

In some embodiments the method for detecting the presence or absence of a pathogenic virus may additionally or alternatively comprise a step whereby DNA is obtained from RNA. Suitably, DNA may be obtained from RNA by a reverse transcriptase PCR step. Preferably said DNA may be subsequently isolated.

The method may further comprise screening the experimental sample and the control sample for the presence or absence of a pathogenic viral nucleotide sequence. The screening may be carried out using any method in the art suitable for detecting the presence or absence (preferably presence) of a DNA and/or RNA molecule.

In one embodiment the screening may be carried out using PCR, suitably quantitative PCR, preferably quantitative reverse-transcriptase PCR (qRT-PCR). Commercial kits are available to assist the skilled person to perform qRT-PCR, for example the RNA UltraSense One-Step Quantitative RT-PCR system (available from Life Technologies) and/or Realstar Filovirus Screen RT-PCR Kit 1.0 (Altona Diagnostics). Where qRT-PCR is used, the skilled person will typically use a specially-designed instrument for quantification of results. Suitable instruments include the Mx3005p instrument (Stratagene) and analysis software such as MxPro v.4.1 (Stratagene) or the LightCycler 480 II (Roche Diagnostics) and LightCycler 480 v.1.5.62 software (Roche).

The methods of screening may further comprise a step of comparing a result obtained in the screening step for the experimental sample and the control sample. In some embodiments the comparison may be effected using suitable quantification software (e.g. as described above).

Suitably, a result which is positive for the presence of a pathogenic viral nucleotide sequence in the control sample is indicative of a functional assay. In other words, a positive result in the control sample and a negative result in an experimental sample provides a user with an indication that a pathogenic viral diagnostic is functional and that the experimental sample does not contain a pathogenic viral nucleotide. Advantageously the method of the invention reduces the incidence of false negatives.

The method for detecting the presence or absence of a pathogenic virus may further comprise recording the output of at least one step on a data-storage medium. By way of example, the method of the present invention can generate data relating to the experimental sample and/or control sample, such data being recordable on a data-storage medium (for example, a form of computer memory such as a hard disk, compact disc, floppy disk, or solid state drive). Such data may comprise (or consist of) data relating to detection of the absence or presence of a pathogenic virus nucleotide and/or the absence or presence of a pathogenic virus and/or quantification data related to the absence or presence of a pathogenic virus nucleotide sequence.

The invention therefore also provides a data-storage medium comprising data obtained by a method of the present invention.

ALIGNMENT SCORES FOR DETERMINING SEQUENCE IDENTITY

A R N D C Q E G H I L K M F P S T W Y V

A 4

R-1 5

N -2 0 6

D-2-2 1 6

C 0-3-3-3 9

Q-1 1 0 0-3 5

E -1 0 0 2 -4 2 5

G 0-2 0-1 -3 -2 -2 6

H -2 0 1 -1 -3 0 0 -2 8

I -1 -3 -3 -3 -1 -3 -3 -4 -3 4

L -1 -2 -3 -4 -1 -2 -3 -4-3 2 4

K-1 2 0-1 -3 1 1 -2-1 -3-2 5

M -1 -1 -2 -3 -1 0-2-3-2 1 2-1 5

F -2 -3 -3 -3 -2 -3 -3-3-1 0 0-3 0 6

P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 7

S 1 -1 1 0-1 0 0 0-1 -2-2 0-1 -2-1 4

T 0 -1 0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2-1 1 5

W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 1 -4-3-211 Y -2 -2 -2 -3 -2 -1 -2 -3 2 -1 -1 -2 -1 3 -3 -2 -2 2

V 0 -3 -3 -3 -1 -2 -2 -3 -3 3 1 -2 1 -1 -2 -2 0 -3

The percent identity is then calculated as: Total number of identical matches

[length of the longer sequence plus the

number of gaps introduced into the longer

sequence in order to align the two sequences]

Substantially homologous polypeptides are characterized as having one or more amino acid substitutions, deletions or additions. These changes are preferably of a minor nature, that is conservative amino acid substitutions (see below) and other substitutions that do not significantly affect the folding or activity of the polypeptide; small deletions, typically of one to about 30 amino acids; and small amino- or carboxyl-terminal extensions, such as an amino- terminal methionine residue, a small linker peptide of up to about 20-25 residues, or an affinity tag. CONSERVATIVE AMINO ACID SUBSTITUTIONS

Basic: arginine

lysine

histidine

Acidic: glutamic acid

aspartic acid

Polar: glutamine

asparagine

Hydrophobic: leucine

isoleucine

valine

Aromatic: phenylalanine

tryptophan

tyrosine

Small: glycine

alanine

serine threonine

methionine

In addition to the 20 standard amino acids, non-standard amino acids (such as 4- hydroxyproline, 6-/V-methyl lysine, 2-aminoisobutyric acid, isovaline and a -methyl serine) may be substituted for amino acid residues of the polypeptides of the present invention. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids may be substituted for amino acid residues. The polypeptides of the present invention can also comprise non-naturally occurring amino acid residues.

Non-naturally occurring amino acids include, without limitation, trans-3-methylproline, 2,4- methano-proline, cis-4-hydroxyproline, trans-4-hydroxy-proline, N-methylglycine, allo- threonine, methyl-threonine, hydroxy-ethylcysteine, hydroxyethylhomo-cysteine, nitro- glutamine, homoglutamine, pipecolic acid, tert-leucine, norvaline, 2-azaphenylalanine, 3- azaphenyl-alanine, 4-azaphenyl-alanine, and 4-fluorophenylalanine. Several methods are known in the art for incorporating non-naturally occurring amino acid residues into proteins. For example, an in vitro system can be employed wherein nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylating tRNA are known in the art. Transcription and translation of plasmids containing nonsense mutations is carried out in a cell free system comprising an E. coli S30 extract and commercially available enzymes and other reagents. Proteins are purified by chromatography. See, for example, Robertson et al., J. Am. Chem. Soc. 1 13:2722, 1991 ; Ellman et al., Methods Enzymol. 202:301 , 1991 ; Chung et al., Science 259:806-9, 1993; and Chung et al., Proc. Natl. Acad. Sci. USA 90: 10145-9, 1993). In a second method, translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs (Turcatti et al., J. Biol. Chem. 271 : 19991-8, 1996). Within a third method, E. coli cells are cultured in the absence of a natural amino acid that is to be replaced (e.g., phenylalanine) and in the presence of the desired non-naturally occurring amino acid(s) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine). The non-naturally occurring amino acid is incorporated into the polypeptide in place of its natural counterpart. See, Koide et al., Biochem. 33:7470-6, 1994. Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification. Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395-403, 1993). A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids may be substituted for amino acid residues of polypeptides of the present invention.

Essential amino acids in the polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-5, 1989). Sites of biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., Science 255:306-12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992; Wlodaver et al., FEBS Lett. 309:59-64, 1992. The identities of essential amino acids can also be inferred from analysis of homologies with related components (e.g. the translocation or protease components) of the polypeptides of the present invention.

Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241 :53-7, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these authors disclose methods for simultaneously randomizing two or more positions in a polypeptide, selecting for functional polypeptide, and then sequencing the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30: 10832-7, 1991 ; Ladner et al., U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and region-directed mutagenesis (Derbyshire et al., Gene 46: 145, 1986; Ner et al., DNA 7: 127, 1988).

Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241 :53-7, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these authors disclose methods for simultaneously randomizing two or more positions in a polypeptide, selecting for functional polypeptide, and then sequencing the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30: 10832-7, 1991 ; Ladner et al., U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and region-directed mutagenesis (Derbyshire et al., Gene 46: 145, 1986; Ner et al., DNA 7: 127, 1988).

ADVANTAGES

In accordance with the foregoing embodiments, it is a seminal finding by the present inventors that a RNA comprising a control RNA sequence extracted from a recombinant RNA virus of the invention is particularly useful as a control (e.g. positive control) in a screen for identification of the presence or absence of a pathogenic virus. In particular, the isolated RNA reduces the incidence of false negatives when compared to use of diagnostic screens not incorporating the use of an isolated RNA of the invention.

Moreover, the methods (and/or products of the invention) provide a generic standard to be used for viral diagnostics. Advantageously, this is achieved via the use of a RNA comprising at least 3 kb contiguous nucleotide sequence of a pathogenic virus or a complement thereof. The standard is generic (e.g. for a particular viral species/isolate) since, due to the coverage of the genome, it is not necessary to know with which primers/probes a user will choose to perform a diagnostic assay for the virus.

Use of a recombinant Lentiviral and/or Gammaretroviral for housing a RNA of the invention have advantageously been shown to be stable at ambient temperatures (or higher) (especially when compared to a naked e.g. unpackaged RNA), thus, allowing for ease of handling and/or reduced transmission and/or shipping costs. Similar advantages are associated with the ribonucleoprotein of the invention. Therefore the invention provides for a more accurate and/or reliable control when compared to less stable compositions.

Additionally use of a recombinant Lentiviral and/or Gammaretroviral for housing a RNA of the invention allows for the easy establishment of the relative potency of each viral product (e.g. by using Lentiviral and/or Gammaretroviral sequences comprised on the RNA housed therein). Alternatively or additionally this ensures that reference materials are produced in equimolar ratios. Advantageously this enables the relative sensitivity of viral diagnostic assays targeting any region of the viral genome to be established.

Additionally, a method, nucleotide, vector, RNA, DNA or ribonucleoprotein according to the present invention can be used reliably and accurately as a control for pathogenic viral screening. For example, the nucleotide sequence (including the vector, RNA, DNA, ribonucleoprotein, composition or kit derived or obtainable therefrom) of the invention allows for a positive control to determine if a pathogenic viral diagnostic assay is functioning and thus reduces the incidence of false negatives.

Advantageously, the methods (e.g. using a recombinant RNA virus of the invention), nucleotide sequence (including the vector, RNA, DNA, nbonucleoprotein, composition or kit derived or obtainable therefrom - preferably the nbonucleoprotein and/or RNA and/or DNA) of the invention allows a user to control for an extraction step (preferably the nbonucleoprotein and/or RNA and/or DNA extraction step). The method and/or nucleotide sequence (including the vector, RNA, DNA, nbonucleoprotein, composition or kit derived or obtainable therefrom) of the invention suitably allows for the provision of materials for calibrating secondary standards and/or materials for use as in-run controls. The nucleotide sequence (including the vector, RNA, DNA, nbonucleoprotein, composition or kit derived or obtainable therefrom) is safe since the nucleotide sequence (including the vector, RNA, DNA or nbonucleoprotein derived or obtainable therefrom) is incapable of producing a pathogenic viral protein as a result of the modification(s) disclosed herein and is therefore safe and/or non-infectious and/or non-replicative.

Advantageously, the products of the invention can be handled (or the methods of the invention carried out) with minimal health risk to a user (e.g. by infection with a pathogenic virus). Moreover the present invention advantageously allows for the production of a control for use in diagnostic assays for newly-emerging pathogenic viral strains/isolates. As soon as a new target sequence is available, the reference material can be produced using the approach described herein in a relatively short amount of time, advantageously allowing the medical community to react quickly to new pathogenic viral strains/isolates.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994), and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide one of skill with a general dictionary of many of the terms used in this disclosure. This disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this disclosure. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, any nucleic acid sequences are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.

The headings provided herein are not limitations of the various aspects or embodiments of this disclosure which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

Amino acids are referred to herein using the name of the amino acid, the three letter abbreviation or the single letter abbreviation.

The term "protein", as used herein, includes proteins, polypeptides, and peptides.

As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and/or the term "protein". In some instances, the term "amino acid sequence" is synonymous with the term "peptide". In some instances, the term "amino acid sequence" is synonymous with the term "enzyme".

The terms "protein" and "polypeptide" are used interchangeably herein. In the present disclosure and claims, the conventional one-letter and three-letter codes for amino acid residues may be used. The 3-letter code for amino acids as defined in conformity with the lUPACIUB Joint Commission on Biochemical Nomenclature (JCBN). It is also understood that a polypeptide may be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code.

Other definitions of terms may appear throughout the specification. Before the exemplary embodiments are described in more detail, it is to understand that this disclosure is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within this disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within this disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in this disclosure.

It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a nucleotide sequence" includes a plurality of such candidate agents and reference to "the RNA" includes reference to one or more RNAs and equivalents thereof known to those skilled in the art, and so forth.

The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that such publications constitute prior art to the claims appended hereto.

The invention will now be described, by way of example only, with reference to the following Figures and Examples.

EXAMPLES

MATERIALS & METHODS

Construction of the lentiviral vectors containing Ebola virus genes

Ebola virus gene nucleotide sequences were derived from Zaire ebolavirus isolate H.sapiens-wt/GIN/2014/Makona-Kissidougou-C15, GenBank accession number KJ660346.2 (Baize S, Pannetier D, Oestereich L, Rieger T, Koivogui L, Magassouba N, et al. Emergence of Zaire Ebola virus disease in Guinea. N Engl J Med 2014 Oct 9;371 (15): 1418-25 incorporated herein by reference). Sequences were modified to contain random stop codons and enzymatic restriction sites at 5' end and 3' end as illustrated in Fig 1A. Each gene was synthesised by GeneWiz Inc. and cloned into pUC57-Kan plasmid. Lentiviral vector pSF- lenti-PGK-FLuc, is a customised version of the pSF-lenti (OG269, Oxford Genetics) in which the Cytomegalovirus (CMV) major immediate early promoter (MIEP) in front of the multi cloning site has been removed and the Puromycin resistance gene has been substituted with the reporter gene Firefly luciferase. Each Ebola virus gene was sequentially subcloned from pUC57-Kan plasmid into the pSF-lenti-PGK-Fluc using standard molecular techniques. Final plasmid sequences pSF-lenti-NP-VP35-GP and pSF-lenti-VP40-L were confirmed by sequencing using Nextera XT kit (lllumina) following manufacturer's instructions, and run on an MiSeq 2 ^χ 251 paired-end v2 Flow Cell (lllumina). Results were analysed using Genious R7 version 7.1.7(Biomatters) and deposited in GenBank (accession number KT186367 and KT186368, respectively).

Generation of the HIV-EBOV RNA preparations

Lentiviral particles were generated by transfection of 5x10 ⁶ HEK 293T-17 (ATCC CRL- 1 1268) cells in a 10cm dish with a mixture of 18 of FuGene-6 transfection reagent (Promega) and 1.5 μg of p8.9 (Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 1997 Sep;15(9):871-5 - incorporated herein by reference) and 2 μg of pSF-lenti-NP-VP35-GP or pSF-lenti-VP40-L in 200 uL of Optimem (Gibco). After 20 minutes at room temperature, the mixture was added drop-wise to the cells in 8 mL of Dulbecco modified essential media (DM EM, Gibco) supplemented with 10% foetal calf serum (PAA) and the cells were cultivated at 37°C with 5% C0 ₂ . Supernatant was harvested at 48 and 72 hours post transfection and filtered using a 0.45 μηι filter (Millipore). Supernatant at the different time points were pooled together and treated for 1 hour at 37°C with 500 U/mL of DNase I (Life Technologies). Particles were purified by ultracentrifugation on a 20% sucrose cushion in 50mM sodium phosphate buffer using a SW28 rotor in a Beckman Optima LE-80K Ultracentrifuge for 2 hours at 23,000rpm at 4°C. Pellets were resuspended in an isovolume of universal buffer, composed of 10mM Tris-HCI pH 7.4, 0.5% Human Serum Albumin (Bio Products Laboratory Limited), 0.1 % D-(+)-trehalose dehydrate (Sigma). High titre preparations were obtained by dilution 1 : 10 of the purified particles in universal buffer; low titre preparations were produced by further 1 : 10,000 dilution of the high titre material in universal buffer. All preparations were kept refrigerated overnight and were freeze/dried within 24 hours. Freeze-drying procedure

In separate procedures, the final preparations were aseptically dispensed in 1 ml_ aliquots into 5 ml_ Schott vials (high titre) or 5 ml_ DIN ampoules (low titre). Stoppers were partially inserted into the containers and the trays of containers loaded onto precooled (-50°C) shelves in a Virtis Advantage Plus freeze dryer (Biopharma Process Systems) for the high titre preparations or in a CS-100 freeze dryer (Serail) for the low titre ones. The same freeze- drying schedule was used for both freeze-driers. For initial freezing, the products were held at -50°C for 5 h, followed by a further 1 h at -50°C at 0.1 mbar to begin primary drying. The temperature was then ramped up to -20°C over 1 hour and held at -20°C for a further 30 h. Secondary drying proceeded by ramping the temperature up to 25°C over 10 h followed by holding at 25°C for a further 15 h at 0.03 mbar. At the end of freeze drying the containers were backfilled with dry nitrogen gas and the stoppers fully inserted into the containers. For the high titre preparations, vials were removed from the freeze dryer and polypropylene screw caps secured. For the low titre preparations, the ampoules were flame-sealed.

Nanoparticle tracking system

The sucrose-purified supernatant preparation of the LVV_NP-VP35-GP particles was 10-fold serially diluted in PBS to achieve a particle concentration of approximately 10 ⁸ particles/mL. Reconstituted vials of the freeze/dried preparations LVV_NP-VP35-GP high and LW_VP40- L high were 10-fold diluted in universal buffer. Samples were analysed using a NanoSight LM10 instrument (Malvern). Samples were injected using a 1 ml_ syringe loaded in the NanoSight syringe pump. Each sample dilution was acquired 5 times per 90-second/time and analysed using Nanoparticle Tracking Analysis 2.3 Analytical software. Before each acquisition 100nm polystyrene latex microspheres, diluted in the same buffer of the samples, were used to calibrate the machine.

Transmission electron microscopy

55μΙ of the 1 : 10 dilution in PBS of the sucrose-purified supernatant containing LW_NP- VP35-GP particles were loaded into an EM90 rotor (Beckman-Coulter) pre-loaded with freshly plasma cleaned carbon coated TEM grids (Agar scientific). The sample was spun at 30 psi (90,000 rpm or 1 18,000xG _r max) for 30 minutes on an airfuge (Beckman-Coulter). Grids were removed and were washed 3 times for 1 minute/time in molecular grade water and were stained in 2% aqueous ammonium molybdate for 1 minute. Excess stain was removed and grids were air dried. Images were acquired on a JEM2100 (JEOL Ltd) using a US4000 camera running digital micrograph software (Gatan inc). Quantitative reverse-transcriptase polymerase chain reaction

The four freeze-dried HIV-EBOV RNA preparations were reconstituted by adding 1 mL of molecular-grade water. For the in-house assays, high titre preparations were 10-fold serially diluted in universal buffer. The 3 ^rd HIV-1 international standard (NIBSC code 10/152) was reconstituted in 1 mL of molecular water as per Instruction for use, and 5-fold serially diluted in universal buffer prior to extraction. 140 of each sample were extracted using QIAamp viral RNA mini kit (Qiagen) following manufacturer's instructions, and eluted in 60 AE buffer. All the reactions were performed using RNA UltraSense One-Step Quantitative RT- PCR system (Life Technologies), following manufacturer's instructions and adding 10 uL of the extracted viral RNA, 0.2 μΜ of each primer and 0.1 μΜ of probe (Table 1). Reactions were run on a Mx3005p instrument (Stratagene) for 30 minutes at 50°C, 10 minutes at 95°C, followed by 35 cycles of 30 seconds at 95°C and 90 seconds at 60°C, and analysed using MxPro v.4.1 software. For the commercial assays, 0.85 mL of each sample was extracted using total nucleic acid extraction kit (Roche Diagnostics) in a COBAS® Ampliprep Instrument (Roche Diagnostics), with an elution volume of 75μί. For the Ebola virus np target gene, 10μί of each extract was added to ^* \ μ\- of LIPSGENE ZEBOV kit oligonucleotides (Bioactiva Diagnostica GmbH), 5μί AB TaqMan polymerase (Applied Biosciences) and 4μί molecular grade water in a 96-well micro-titre plate (Roche Diagnostics) and run on a LightCycler 480 II (Roche Diagnostics) for 5 minutes at 50°C, 20 seconds at 95°C, followed by 45 cycles of 95°C for 15 seconds and 60°C for 1 minute. For the Ebola virus / gene, 10 μΙ_ of the nucleic acid extract was added to 20 μΙ_ of the Realstar Filovirus Screen RT-PCR Kit 1.0 (Altona Diagnostics) and run on a Roche LightCycler 480 II for 20 minutes at 50°C, 2 minutes at 95°C, followed by 45 cycles of 95°C for 15 seconds and 60°C for 1 minute. All results were generated on the LightCycler 480 v.1.5.62 software.

Table 1. Primers and probes sequences

Name Target Sequence (5'-»3') Ref.

F565 Zaire EBOV NP TCT GAC ATG GAT TAC CAC AAG ATC (1)

P567S Zaire EBOV NP AGG TCT GTC CGT TCA A (1)

R640 Zaire EBOV NP GGA TGA CTC TTT GCC GAA CAA TC (1)

EBOV_L_F Zaire EBOV L AACTGATTTAGAGAAATACAATCTTGC (2)

EBOV_L_p Zaire EBOV L ATTGCAACCGTTGCTATGGT (2)

EBOV_L_R Zaire EBOV L AATGCATCCAATTAAAAACATTC (2)

HIV-LTR_F HIV-1 U5 GCTCTCTGGCTARCTAGGG

HIV-LTR_p HIV-1 U5 GCTTCAAGTAGTGTGTGCCC

HIV-LTR_R HIV-1 U5 GTTACCAGAGTCACACAACAGA Primers and probes used in both quantitative RT-PCR and droplet digital RT-PCR. All probes were Iabelled5'-FAM AND 3'-BHQ1.

(1) Trombley AR, Wachter L, Garrison J, Buckley-Beason VA, Jahrling J, Hensley LE, et al. Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses. Am J Trop Med Hyg 2010 May;82(5):954-60.

(2) Jaaskelainen AJ, Moilanen K, Aaltonen K, Putkuri N, Sironen T, Kallio-Kokko H, et al. Development and evaluation of a real-time EBOV-L-RT-qPCR for detection of Zaire ebolavirus. J Clin Virol 2015 Jun;67:56-8 (which is incorporated herein by reference).

Droplets digital reverse transcriptase polymerase chain reaction

Viral RNA extracted for the in-house assays was also analysed by droplets digital reverse transcriptase polymerase chain reaction (ddRT-PCR). 2 μΙ_ of each sample were added to 12.5 μΙ_ of One-Step RT-ddPCR kit for probes (Bio-Rad) with 0.9 μΜ of each primer and 0.125μΜ of probe (Table 1), 1 μΙ_ of 25mM manganese acetate and molecular-grade water to a final volume of 25 μΙ_. To generate the droplets, 20 μΙ_ of these solutions were pipetted in Droplet Generator DG8 Cartridge (Bio-Rad) together with 70 μΙ_ of droplet generator oil for probes and loaded in the QX100 Droplet Generator (Bio-Rad). The entire droplet emulsion volume was then loaded in a twin. tec semi-skirted 96-well PCR plate (Eppendorf) and heat sealed with pierceable foil in the PX1™ PCR Plate Sealer and placed in a C1000 Touch™ Thermo Cycler (both from Bio-Rad). Thermal cycling conditions were: 30 minutes at 60°C, 5 minutes at 95°C, followed by 45 cycles of 30 seconds at 94°C and 1 minute at 60°C, and a final step of 10 minutes at 98°C.The droplets were read in a QX100™ droplet reader (Bio- Rad), and analysed using QuantaSoft™ software version 1.7.4.

EXAMPLE 1

Generation of lentiviral-particles containing Ebola virus RNA

Zaire Makona 2014 Ebola virus sequences encoding nucleoprotein (np), viral protein 35 (vp35), glycoprotein (gp), viral protein 40 (vp40) and / genes (GenBank KJ660346.2) were in vitro synthesised and sub-cloned into a lentiviral vector derived from pSF-lenti (Oxford Genetics) using the restriction enzymes as indicated in Figure 1A. Due to the size limitation of the insert that can be cloned into a lentiviral vector (about 9 kilo bases), two vectors were produced containing either np-vp35-gp genes or vp40-l gene sequences. To prevent expression of Ebola virus proteins, each Ebola virus gene lacks its start codon, and contains 3 nucleotide changes which introduce stop codons. Furthermore, the Ebola virus genes have been sub-cloned in reverse orientation in relation to the CMV promoter, driving the expression of the lentiviral genomic RNA. The two lentiviral vectors carrying Ebola virus genes were sequenced using lllumina sequencing technology (GenBank KT186367 for pSF- lenti-NP-VP35-GP and KT186368 for pSF-lenti-VP40-L). Lentiviral particles containing Ebola virus RNA were produced by transfection of 293T cells with pSF_NP-VP35-GP or pSF_VP40-L together with a packaging plasmid expressing HIV-1 gag and pol genes. Antisense Ebola virus RNA was packaged within the HIV-like particles. To increase biosafety of the system, the long terminal repeats in the lentiviral vectors are defective (ΔΙΙ3), an internal promoter is missing and no envelope protein is expressed in the transfected cells, rendering HIV-like particles non-infectious.

To confirm that correctly shaped particles were produced with this system, the supernatant containing the HIV-Ebola NP-VP35-GP RNA particles was analysed using nanoparticle tracking analysis (NTA) (Fig 1 B) which determined the average particle size to be 101 nm, similar to previous reports (Papanikolaou E, Kontostathi G, Drakopoulou E, Georgomanoli M, Stamateris E, Vougas K, et al. Characterization and comparative performance of lentiviral vector preparations concentrated by either one-step ultrafiltration or ultracentrifugation. Virus Res 2013 Jul; 175(1): 1-11 - incorporated herein by reference) with an estimate concentration of 3.33 x10 ¹⁰ particles per millilitre. The same preparation was also visualised by electron microscopy (EM) (Fig 1 C) showing spherical particles with evidence of internal core structure of an average diameter of 116 nm consistent with wild type HIV (Gelderblom H.R. Fine Structure of HIV and SIV - www.hiv.lanl.gov/content/sequence/HIV/REVIEWS/Gelderblom.htm l 2010 - incorporated herein by reference).

EXAMPLE 2

Evaluation of the HIV-Ebola virus reference materials in NAT assays

Possible plasmid DNA carryover from the transfection was removed from the supernatant by incubation with DNAse I. Particles were then purified by ultracentrifugation on a sucrose cushion and resuspended in the same volume of universal buffer. Universal buffer is a TRIS- HCI solution containing trehalose and human serum albumin; this has been previously used for lyophilised viral NAT reference materials that may be diluted in a number of different clinical matrices (Fryer JF, Heath AB, Anderson R, Minor PD, World Health Organization. Biologicals Unit, Collaborative Study Group. Collaborative study to evaluate the proposed 1 st [first] WHO international standard for human cytomegalovirus (HCMV) for nucleic acid amplification (NAT)-based assays. Geneva : World Health Organization; 2010; Fryer J. F., Heath B.A., Wilkinson D.E., Minor P.D., Collaborative Study Group. Collaborative study to evaluate the proposed 1st WHO international standards for Epstein-Barr Virus (EBV) for Nucleic Acid Amplification Technology (NAT)-Based Assays. Geneva : World Health Organization; 201 1 - both incorporated herein by reference). Two types of reference materials were produced for each HIV-EBOV RNA preparation: a "high" titre standard, obtained by diluting the viral particle stock 1 : 10 in Universal buffer and a "low" titre control obtained by diluting the "high" titre preparations 1 :10,000 in the same buffer. The four preparations were filled in 1 mL aliquots and freeze-dried following validated standard operating procedures. The appearance of the final products is a white compact cake.

The final freeze-dried preparations were evaluated by quantitative RT-PCR (qRT-PCR) using in-house and commercially available assays. In all the assays, two vials for each standard were reconstituted using 1 mL of molecular grade water, and viral RNA extracted using commercially available kits. In-house assays were developed using published primers and probe sequences for the Ebola virus np gene (Trombley AR, Wachter L, Garrison J, Buckley- Beason VA, Jahrling J, Hensley LE, et al. Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses. Am J Trop Med Hyg 2010 May;82(5):954-60 - incorporated herein by reference) and / gene (Jaaskelainen AJ, Moilanen K, Aaltonen K, Putkuri N, Sironen T, Kallio-Kokko H, et al. Development and evaluation of a real-time EBOV-L-RT-qPCR for detection of Zaire ebolavirus. J Clin Virol 2015 Jun;67:56-8 - incorporated herein by reference). Ten-fold serial dilutions of the high concentration standards showed good efficiencies and linearity of the qRT-PCR for both targets (Fig 2A and B). In parallel, the same preparations were evaluated using commercial assays: RealStar® Ebolavirus RT-PCR kit (Altona Diagnostics)-authorised by the Food and Drug administration for emergency use (Hamburg MA, commissioner of Food and Drugs. FDA letter authorising the emergency use of RealStar Ebolavirus RT-PCR kit 1.0, Altona Diagnostic GmBH. 2014 Nov 16 - incorporated herein by reference), and targeting Ebolavirus / gene, and LIPSGENE ZEBOV kit (Bioactiva Diagnostica GmbH) targeting the np gene. Each preparation produced the expected results using both in-house and commercial assay (Table 2): the difference in the threshold cycle (Ct) between the high titre and the low titre was 13.2 cycles for the lentiviral particles carrying Ebola virus np-vp35-gp (LVV_NP-VP35-GP) and 13.0 cycles for vp40-l genes (LW_VP40-L), using the assays described in the Materials and Methods section "Quantitative reverse-transcriptase polymerase chain reaction" herein. Assuming an efficiency of reaction of 100%, this corresponds to 10,000-fold difference in the target concentration between the high and low titre preparations. Furthermore, no cross contamination (Ct >35) was observed when the LW_NP-VP35-GP materials were assessed in the /-based assays. Conversely, no / sequences were detected in the np-based assays for the LW_VP40-L materials (Table 2). Table 2. Evaluation of the HIV-Ebola virus RNA standard by quantitative RT-PCR.

Reconstituted freeze-dried preparations were evaluated after three independent extractions using either in-house or commercially available quantitative RT-PCR probe based kits targeting the Ebola virus np or / gene. Samples were run in duplicate and the results expressed as average of the threshold cycle (Ct) ± standard deviation.

In order to assess any plasmid DNA carryover contaminations, reactions were performed without the reverse transcriptase step (RT negative). A DNA signal was detected in the high titre preparations, and was about 10,000 times lower than the corresponding RNA signal (Figure 2C and D). The presence of DNA in the high titre reference material despite DNase I treatment may be attribute to the small amount of viral DNA contained within a lentiviral particle (Arts EJ, Mak J, Kleiman L, Wainberg MA. Mature reverse transcriptase (p66/p51) is responsible for low levels of viral DNA found in human immunodeficiency virus type 1 (HIV- 1). Leukemia 1994 Apr;8 Suppl 1 :S175-S178; Lori F, di M, V, de Vico AL, Lusso P, Reitz MS, Jr., Gallo RC. Viral DNA carried by human immunodeficiency virus type 1 virions. J Virol 1992 Aug;66(8):5067-74; Trono D. Partial reverse transcripts in virions from human immunodeficiency and murine leukemia viruses. J Virol 1992 Aug;66(8):4893-900 - all incorporated herein by reference). EXAMPLE 3

Relative quantification of the HIV-EBOV RNA reference materials

The subcloning of the Ebola virus target genes across two separate reference preparations could lead to incongruence in the interpretation of the results, due to difference in Ebola virus gene-specific PCR efficiencies. To estimate the equivalency of Ebola sequences across the reference preparations, we took advantage of the WHO 3 ^rd HIV-1 International Standard (NIBSC 10/152) which shares HIV-1 long terminal repeat (LTR) sequences present within the HIV-Ebola virus RNA reference materials. Using HIV-LTR specific primers and probe targeting the common sequences, the 3 ^rd HIV-1 International Standard was used as a reference for estimating the equivalency of sequences across the HIV-EBOV RNA reference preparations.

Prior to viral RNA extraction, freshly reconstituted vials of the HIV-EBOV RNA reference materials and the 3 ^rd HIV-1 International Standard were serially diluted in universal buffer. The viral RNA was processed in a qRT-PCR, and the efficiencies of the reactions were found to be similar (Figure 3). When expressed relative to the 3 ^rd HIV-1 International Standard (Table 3), the ratio between HIV-EBOV RNA high titre preparations VP40-L and LVV_NP- VP35-GP is 2.3, while for the low titre preparations the ratio is 2.94. Similar to the results obtained using the Ebola virus specific qRT-PCR (Table 3), the high titre and the low titre reference materials differ of about 10,000 times.

HIV-EBOV RNA preparations were also analysed using another NAT-based assay, droplet digital RT-PCR (ddRT-PCR) using the same sets of primers and probe employed for the qRT-PCR; this method is based on Poisson distribution and can provide an absolute copy number in absence of a calibrator. Each sample was analysed using two sets of primers and probe, one targeting the HIV LTR and one for the Ebola virus gene np. Serial dilutions of the high titre HIV-EBOV RNA standard confirmed the linearity of the assay for both set of primers and probe.

In Table 3 are summarised the values obtained for the HIV-EBOV RNA preparations in the different assays, expressed in the readout units of each assay. Where results are reported as 'copies/ml_', the relationship to genuine genome equivalence numbers is unknown. Copies reported in one assay are not necessarily equivalent to copies reported in another. Furthermore, there is no conversion factor between International Units/mL or copies/mL. In all cases the ratio between the high titre and the low titre for each preparation is about 10,000-fold, as expected. All the samples are detectable using both qRT-PCR and ddRT- PCR technologies using different set of primers and probe with results in the same order of magnitude. The high concentration preparations were also analysed by NTA in universal buffer. The particle concentrations were about 10 times higher than values estimated with molecular methods (Table 3) suggesting that about 10% of the particles incorporate HIV- EBOV viral genome. Table 3. Examples of the HIV-Ebola virus RNA standard values using different technologi

Quantitative RT-PCR (qRT-PCR) was performed in duplicate in three independent experiments using HIV-LTR specific primers and probe; samples were quantified against the 3 ^rd HIV-1 International standard (assigned value 185 000 lU/mL) run in parallel. The same samples and set of primers and probe were used in a droplet digital RT-PCR (ddRT-PCR) and results expressed as average of two independent experiments run in duplicate. HIV- EBOV RNA preparations were also quantified using Ebola virus NP or L specific primers and probes (qRT-PCR np/l) and copies per mL were inferred using standard curves obtained by serial dilutions of the lentiviral plasmids used to produce the particles. NP-specific primers and probe were also used in a ddRT-PCR. HIV-EBOV RNA high titre were also analysed by NTA. Results are reported as average concentrationistandard deviation calculated on 5 acquisitions of a 1 : 10 dilution in universal buffer. Where results are reported as 'copies/mL, the relationship to genuine genome equivalence numbers is unknown.

EXAMPLE 4

Stability study of the HIV-EBOV RNA reference materials

Stability of the HIV-EBOV RNA reference materials at different temperatures was investigated to simulate shipping conditions. Three vials for each preparation were stored at different temperatures from -70°C to 56°C and tested after two weeks in parallel using in- house qRT-PCR for the np and / genes. Each freeze-dried preparation was easily reconstituted. The results are reported as average of the difference in the threshold cycle (ACt) in comparison to the values obtained when the samples were stored at -70°C (Table 4). Student t test was performed on each set of data and both high titre standards at 45°C and 56°C and the LW_VP40-L low titre at 56°C were found significantly different from the baseline. Results obtained from this initial stability study indicate that the reference materials are suitably stable for storage at -20°C and short-term shipment at ambient temperatures up to 37°C. It is noteworthy that the low titre preparations are more stable at higher temperatures (Table 4). For future development, we aim to optimise the filling and freeze- drying conditions in order to further improve the stability of the HIV-EBOV RNA reference preparations.

Table 4. Stability of the freeze-dried preparations after two weeks of storage at different temperatures

Samples were assessed by quantitative RT-PCR against np or / gene and ACt are calculated as the difference: Ct (°T)-Ct (-70°C). The data in the table represent the average of three independent experiments. In bold the ACt values which were significant by Student t test (pO.001).

Discussion

Nucleic acid amplification based diagnostic techniques have a crucial role during the ongoing Ebola virus outbreak in West Africa. Reference materials are needed to assess the validity of the assays used, to compare results across assays and to provide guidance to the regulatory agencies in the evaluation of new assays. It is crucially important that Ebola virus NAT reference materials standardise and control the entire process from the extraction to the final amplification and detection reaction.

The Examples above demonstrate the development of safe, non-infectious, stable reference materials for Zaire ebolavirus NAT-based assays. This has been achieved by incorporating Ebola virus RNA into HIV-1 like particles. These chimaeric particles, resembling HIV-1 spherical particles on the outside, have an internal core containing, as genome, Zaire ebolavirus genes as negative sense RNA within the two HIV-1 LTRs. The lack of any viral Envelope protein and HIV-1 structural genes renders this material non-infectious and unable to replicate. To further increase the safety of these preparations, the cloned Ebola virus gene sequences were designed to lack the start codon and contained random stop codons, ensuring that full length Ebola virus protein could not be produced. The plasmids used to generate the particles were fully sequenced.

Four freeze-dry reference materials were produced: two high-titre materials containing either np-vp35-gp (LW_NP-VP35-GP) or vp40-l (LW_VP40-L) sequences, and two corresponding low-titre materials representing 10,000-fold dilutions of the high titre materials. The high-titre materials would be suitable as a standard for the characterisation and calibration of diagnostic NAT assays, while the low-titre preparations were designed to serve as external in-run controls. When tested in quantitative RT-PCR assays, the reference materials were shown to be suitable for purpose. Cross-contamination between the two types of preparations was not observed. DNA contamination was detectable at a dilution of 1 : 10,000. Similar results were obtained with the 3 ^rd HIV-1 International Standard.

The freeze-dried HIV-EBOV RNA reference materials were stable at temperatures up to 37°C for 2 weeks, making them suitable for shipping at ambient temperature.

The lentiviral packaging system represents a safe, stable and rapid tool to create reference materials for highly pathogenic RNA viruses which can also be employed in the face of future outbreaks.

EXAMPLE 5

Lentiviral vector containing Marburg virus np-vp35-gp genes

Marburg virus nucleotide sequences for genes np-vp35-gp are derived from Lake Victoria isolate (GenBank acc. number DQ447649; Towner.J.S et al Marburg virus genomics and association with a large hemorrhagic fever outbreak in Angola; J Virol. 2006, 80(13): 6497- 6516). Sequences are modified to contain random stop codons and enzymatic restriction sites at 5' end and 3' to allow for the subcloning. Each gene is synthesised by GeneWiz Inc. and cloned into pUC57-Kan plasmid. Lentiviral vector pSF-lenti-PGK-FLuc, is a customised version of the pSF-lenti (OG269, Oxford Genetics). Each Marburg virus gene is sequentially subcloned from pUC57-Kan plasmid into the pSF-lenti-PGK-Fluc using standard molecular techniques. Final plasmid sequences pSF-MARV_NP-VP35-GP are confirmed by sequencing using Nextera XT kit (lllumina) following manufacturer's instructions, and run on an MiSeq 2 ^χ 251 paired-end v2 Flow Cell (lllumina). Results are analysed using Genious R7 version 7.1.7(Biomatters). Lentiviral particles are generated by transfection of 5x10 ⁶ HEK 293T-17 (ATCC CRL-1 1268 ) cells in a 10cm dish with a mixture of 18 μΙ_ of FuGene-6 transfection reagent (Promega) and 1.5 μg of p8.9 and 2 μg of pSF-MARV-NP-VP35-GP in 200 uL of Optimem (Gibco). After 20 minutes at room temperature, the mixture is added drop-wise to the cells in 8 ml_ of Dulbecco modified essential media (DM EM, Gibco) supplemented with 10% foetal calf serum (PAA) and the cells are cultivated at 37°C with 5% C02. Supernatant is harvested at 48 and 72 hours post transfection and filtered using a 0.45 μηι filter (Millipore). Supernatant at the different time points is pooled together and treated for 1 hour at 37°C with 500 U/mL of DNase I (Life Technologies). High and low titre reference material preparation are purified, diluted and freeze-dried as described for Zaire ebolavirus (e.g. in Example 2) and as detailed in the Materials and Methods section "Freeze-drying procedure" herein. Preparations are tested upon reconstitution by adding 1 mL of molecular-grade water. High titre preparations are 10-fold serially diluted in universal buffer. 140 μί of each sample are extracted using QIAamp viral RNA mini kit (Qiagen) following manufacturer's instructions, and eluted in 60 μί AE buffer. All the reactions are performed using RNA UltraSense One-Step Quantitative RT-PCR system (Life Technologies), following manufacturer's instructions and adding 10 uL of the extracted viral RNA, 0.2 μΜ of primers F1788 (5 -TTATATGCTCAGGAAAAGAGA CAGG-3') and R1864 (5 -CCAATACTGCCAAAGGGATCTTG-3') and 0.1 μΜ of probe (FAM- CCCATACAGCATCCAGCCGTGAGC-BHQ) as previously described (Trombley A.R. et al. Comprehensive Panel of Real-Time TaqMan™ Polymerase Chain Reaction Assays for Detection and Absolute Quantification of Filoviruses, Arenaviruses, and New World Hantaviruses. Am J Trop Med Hyg. 2010 May; 82(5): 954-96). EXAMPLE 6

Lentiviral vector containing Ebola Sudan virus np-vp35-gp genes.

Ebola Sudan virus nucleotide sequences for genes np-vp35-gp are derived from Sudan ebolavirus strain Gulu (GenBank acc. number AY729654; Sanchez, A. and Rollin.P.E. Complete genome sequence of an Ebola virus (Sudan species) responsible for a 2000 outbreak of human disease in Uganda; Virus Res. 2005, 1 13(1): 16-25). Sequences are modified to contain random stop codons and enzymatic restriction sites at 5' end and 3' to allow for the subcloning. Each gene is synthesised by GeneWiz Inc. and cloned into pUC57- Kan plasmid. Lentiviral vector pSF-lenti-PGK-FLuc, is a customised version of the pSF-lenti (OG269, Oxford Genetics). Each Ebola Sudan virus gene is sequentially subcloned from pUC57-Kan plasmid into the pSF-lenti-PGK-Fluc using standard molecular techniques. Final plasmid sequences pSF-SEBOV_NP-VP35-GP are confirmed by sequencing using Nextera XT kit (lllumina) following manufacturer's instructions, and run on an MiSeq 2 ^χ 251 paired- end v2 Flow Cell (lllumina). Results are analysed using Genious R7 version 7.1.7(Biomatters). Lentiviral particles are generated by transfection of 5x10 ⁶ HEK 293T-17 (ATCC CRL-1 1268 ) cells in a 10cm dish with a mixture of 18 μΙ_ of FuGene-6 transfection reagent (Promega) and 1.5 μg of p8.9 and 2 μg of pSF-SEBOV-NP-VP35-GP in 200 uL of Optimem (Gibco). After 20 minutes at room temperature, the mixture is added drop-wise to the cells in 8 ml_ of Dulbecco modified essential media (DM EM, Gibco) supplemented with 10% foetal calf serum (PAA) and the cells are cultivated at 37°C with 5% C02. Supernatant is harvested at 48 and 72 hours post transfection and filtered using a 0.45 μηι filter (Millipore). Supernatant at the different time points is pooled together and treated for 1 hour at 37°C with 500 U/mL of DNase I (Life Technologies). High and low titre reference material preparation are purified, diluted and freeze-dried as described for Zaire ebolavirus (e.g. in Example 2) and as detailed in the Materials and Methods section "Freeze-drying procedure" herein. Preparations are tested upon reconstitution by adding 1 mL of molecular-grade water. High titre preparations are 10-fold serially diluted in universal buffer. 140 μί of each sample are extracted using QIAamp viral RNA mini kit (Qiagen) following manufacturer's instructions, and eluted in 60 μί AE buffer. All the reactions are performed using RNA UltraSense One-Step Quantitative RT-PCR system (Life Technologies), following manufacturer's instructions and adding 10 uL of the extracted viral RNA, 0.2 μΜ of primers F1051 (5'- CAT GCA GAA CAA GGG CTC ATT C-3') and R1 130 (5'- CTC ATC AAA CGG AAG ATC ACC ATC-3')and 0.1 μΜ of probe (FAM- CAA CTT CCT GGC AAT-BHQ) as previously described (Trombley A.R. et al. Comprehensive Panel of Real-Time TaqMan™ Polymerase Chain Reaction Assays for Detection and Absolute Quantification of Filoviruses, Arenaviruses, and New World Hantaviruses. Am J Trop Med Hyg. 2010 May; 82(5): 954-96). All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in biochemistry and biotechnology or related fields are intended to be within the scope of the following claims.