More particularly, the invention relates to the use of a nucleotide sequence to modulate the expression of the chimeric gene DefH9-iaaM which induces the parthenocarpic trait in transgenic plants transformed by means of the same, but also induces, in some species and/or lines, undesired malformations in fruits.

When environmental conditions are not favorable, the setting and development of fruits up to reaching commercial features are often facilitated by agronomic practices, as for instance heating, culturing under protective conditions, treatment with phyto-regulation compounds, such practices being employable only with suitable genotypes. Genetic selection among cultivated species and, within a given species, among varieties and/or lines, for their fitness to such treatments is, and has been, the object of study of classic genetics.

An advantageous genetic solution is the selection of the parthenocarpy trait, i. e., of the capability for setting and developing fruits in the absence of fertilisation and, then, under limiting environmental conditions. The solution is the least expensive from the economic standpoint, as well as the most respectful to the environment.

Tomato (Lycopersicon esculentum) is the horticular species for which the research has been the most intensive one, for the commercial exploitation both of

parthenocarpic genetic mutants (the pat genes series) and of mutants that respond in different ways to exogenous application of phytohormones (auxins and gibberellins) with setting activity. Thus, genotypes have been identified and commercial varieties have been selected with different sensitivity to the exogenous application of phytohormones.

Tomato varieties, which are usually cultivated in cold greenhouses for winter production, tolerate phytohormonal treatment of flowers, and set fruits which do not show, at least in a considerable way, typical defects caused by hypersensitivity to auxin.

On the contrary, many valuable varieties, because of the characteristics of plants and/or of those shown by fruits, do not tolerate hormonal treatment with auxin compounds, both of natural and of synthetic origin.

Disturbances show in the growth habitus and in the extrinsic and intrinsic properties of fruits (Cartin et al., 1971). A very evident defect, caused by hypersensitivity to auxin, consists in the formation and/or the abnormal accentuation of the umbone in the apical part of the fruit. Such abnormal prominence (called by the authors of the invention the "Pickelhauben"phenotype, when it shows a longer length with respect to the polar diameter of the fruit and, mainly, it ends with a point) gives problems of fitness for presentation to the consumer in the case of varieties intended for consumption in the fresh condition, and it remarkably increases the possibility of breaks and fissures, with consequent exposition of the mesocarp to fungal and bacterial infections which cause fruits to rot. Disadvantages can be summarized into: a) limitation

of transportation and stockage possibilities of the product, both for consumption in the fresh condition and for industrial transformation; b) easier occurrence of fruit rotting phenomena; c) decrease of commercial value of the product, both in the case of the fresh consumption product and in the case of products to be employed for conservation/transformation industry.

Another negative effect concerning fruits, which manifests itself in the auxin-hypersensitive genotypes, consists in the formation of"box-shaped"fruits, and in a remarkable accentuation of ribs, which malformations are often associated with the Pickelhauben phenotype.

After all, the appearance of such a set of malformations causes the loss of phenotypical features, which are peculiar to the cultivated genotype.

Taking into account the vegetative habitus, the most prominent effect consists in an increase of the plant height, which is mainly caused by a lengthening of internodes. This modification gives rise, mainly in greenhouse cultivations, to a decrease in the exploitation efficiency of the space and therefore to a diminished productivity.

Recently a biotechnological method has been realized (Rotino et al., 1997; W098/28430) for engineering the parthenocarpic development of the fruit. The method is based on the employment of the chimeric gene DefH9-iaaM, that is made up of the DefH9 gene regulating region (from Antirrhinum majus), or of its homologues with a high expression specificity in the placenta and ovules. The DefH9 gene regulating region determines the specificity of expression of the coding region of the iaaM gene of Pseudomonas savastonoi coding for the enzyme tryptophan

monooxygenase, that converts tryptophan into indol- acetamide, which in its turn gives rise chemically and/or enzymatically to auxin IAA (indolacetic acid).

The increase in the amount and/or the activity of IAA in the placenta and in the ovules can support the development of fruits in the plants of tobacco and eggplants (Rotino et al., 1997), of tomatoes (Ficcadenti et al., 1999), of melon and of chicory. In all of analyzed transgenic plants, the effects of the DefH9-iaaM gene are evident exclusively in the female reproductive organs and, consequently, in the formation of the fruit, whose development is complete even in the absence of fertilisation. The DefH9-iaaM transgene substitutes the increase in activity and/or in the amount of auxin, which is caused by the pollination, fertilisation, and embryo formation processes; on the contrary, no effect is evident as far as the vegetative apparatus is concerned.

Effects similar to fruit malformations following the exogenous applications of phythormones have been evidenced in some transgenic tomato plants of the L276 line, parental of the commercial hybrid"Giasone"and above all of the UC82 cultivar. The L276 line is particularly fit for the formation of tomato hybrids of the"smooth round"type, to be employed in full field cultivations. The UC82 cultivar, featuring a determined development, is grown for industrial transformation of the product.

The parthenocarpic trait would be very useful also in tomato genotypes that are cultivated in the full field and are intended both for industrial transformation and for consumption in the fresh condition. In both kinds of exploitation, such types would ensure the setting of

fruits in suboptimal environmental conditions (low temperatures and high humidity for the first bunches; high temperatures and dryness during the cultivation cycle). Moreover, in the types for industrial exploitation the absence of seeds would simplify the processes for the preparation of mashes, ready sauces, peeled and minced tomato products.

As to the DefH9-iaaM gene effect, only genotypes which are tolerant to auxin, within the range of those fit for greenhouse cultivation, are likely not to show the malformations which are typical of hormonal treatment of flowers. This is a strong limitation to the employment of the gene DefH9-iaaM, for the induction of the parthenocarpic development in tomato plants.

Also in the case of melon (Cucumis melo), the agronomical evaluation during tests of protected cultivation (Notification B/IT/99/01) of transgenic melons for the gene DefH9-iaaM showed that transgenic hybrids, but not controls, are capable of setting and developing fruits in the absence of match-promoting insects. The tests however also put into evidence some problems in connection with fruit hypersensitivity to auxin, at least for genotypes and under the cultivation conditions employed. Transgenic fruits have indeed a remarkably faster growth rate with respect to those not transformed, but they show fissures (when the fruit is not yet ripe) from the peduncle zone down to the central zone. This drawback is even more important with respect to the disadvantages of the tomato varieties, as malformed fruits are of no commercial use. The extent of malformations points out that the methodology based on

the chimeric gene DefH9. iaaM is not an optimal one for many genotypes of the species Cucumis melo.

From the examples shown above, it is evident that among species, and among varieties of a species, there is a difference concerning the tolerance of female reproductive organs to the amount and/or activity of auxin compounds, and that such phenomenon represents a limitation for the application of the method based on the DefH9-iaaM gene described in W098/28430 for obtaining parthenocarpic fruits.

The authors of the instant invention have provided a solution to the above problems, regarding the development of fruits caused by the expression of the DefH9-iaaM gene in plant species and/or lines and/or varieties with fruits hypersensitive to auxin, and they succeeded in modulating the gene expression of the transgene.

The authors of the invention have realized a modulation system of the post-transcriptional regulation, employing a sequence of 85 bases which is derived from the sequence corresponding to the intron of the gene rolA, one of the genes of the T-DNA of the plasmid RI of Agrobacterium rhizogenes. The sequence is disclosed in the patent EP 86400855, where it was erroneously indicated as a putative eukaryotic promoter. Then Dehio and Schell (1993) have rightly pointed out that the eukaryotic transcription starting site is 100 bases before the AUG starting codon; Magrelli et al. (1994) have shown that in the region 5'transcripted but untranslated of the mRNA of the rolA gene there is an intron of about 85 bases which is processed in plant cells of Arabidopsis and in tobacco (Spena and Langenkemper, 1995). Mutations in the AG splicing site of

the intron, from AG in AA, block the splicing process making the rolA gene expression null (Magrelli et al., 1994) or lowering such expression drastically (Spena and Langenkemper, 1995). This occurs under the control both of the endogenous eukaryotic promoter (Magrelli et al., 1994) and of the strong promoter 35S of the CaMV (Spena and Langenkemper, 1995). Such reduction is not caused by a significant reduction of the equilibrium level of mRNA, at least in the case of Arabidopsis, but it is correlated with a decrease by about 20-40 times of rolA mRNA translation in an in vitro translation system (Magrelli et al., 1994; Spena and Langenkemper, 1995).

Accordingly, it is the object of this invention the use of a DNA fragment that has substantially the sequence: 5'GGAGAGTTGGTTGTAGGTTCAATTATTACTATTTTTGAAGCT GTGTATTTCCCTTTTTCTAATATGCACCTATTTCATGTTTCAAA3' or of analogous functionals of the same, for regulating the expression of a gene that induces parthenocarpy in a plant, by means of insertion of said fragment in the transcribed but untranslated region at the 5'end of the gene translation starting codon.

It will be obvious to those skilled in the field to modify the sequence of the invention, for instance by removing one or both of ATGs, respectively at-10 and-23 position from the 3'end of the sequence pointed out above and out of reading phase of the gene rolA, so as to have the possibility of obtaining intermediate translation levels. Similarly, an extra ATG could be created in order to further reduce gene expression. The context about ATG might be further modified so as to modulate the translation.

Similarly, it will be obvious to those skilled in the field to modify the sequence of the invention, for instance modifying one splicing site only, so as to block and/or reduce the efficiency of the splicing process.

Thus, the gene expression will be affected in a way similar to the use of the sequence mutated in the two splicing sites.

Preferably, the parthenocarpy inducing gene in a plant gives rise to an increase in the content and/or the activity of at least one type of auxin. More preferably, the gene codes for a protein involved in biosynthesis of auxin in plant cells. Even more preferably, the gene coding region derives from the iaaM gene of Pseudomonas syringe or from a gene that codes for a protein having an equivalent function from another organism (e. g., tmsl of A. tumefaciens or fuctional homologues of A. rhizogenes).

The preferred gene for inserting the sequence of the invention is the chimeric gene DefH9-iaaM or a derivative thereof, which is able to be expressed in the placenta, in ovules and in ovule-derived tissues as well.

It is within the scope of the invention a recombinant DNA molecule that comprises in a contiguous way from 5'end to 3'end: a) the regulating (promoting) region of the DefH9-iaaM gene from A. majus; b) a DNA fragment having substantially the sequence according to claim 1, or analogous functionals thereof; c) a coding sequence that, if expressed in plant cells, causes an increase in the content and/or the activity of at least one type of auxin.

It is another object of the invention a vector for the transformation of plants that comprises the recombinant DNA molecule described.

It is another object of the invention a plant transformed by means of the vector of the invention, or its progeny, preferably belonging to a fruit-growing and/or a horticultural species, more preferably belonging to the tomato species, and alternatively to the melon species.

It is another object of the invention a method for transformation of a plant that comprises the introduction of the vector of the invention.

As already mentioned above, the invention is based on the use of the 85 bases of the rolA gene intron in order to reduce the expression of heterologous genes. The DNA sequence of 85 base pairs has been mutated in the two splicing sites, so as to block the intron splicing from the pre-mRNA. In order to reduce the expression of the DefH9-iaaM gene, the sequence of 85 bases has been introduced upstream the ATG starting codon of the gene iaaM of Pseudomonas savastanoi, and downstream the KpnI site at 3'end of control sequences of the gene DefH9, substituting the 52 bases of the 5'end untranslated region of mRNA of the gene DefH9-iaaM, between the KpnI site and the translation starting codon.

Accordingly, the new construct comprises 87 bases (one G at 5'end and one A at 3'end are added to the 85 bases of the gene rolA) pointed out in Table 1 and it has been called DefH9-RI-iaaM.

Table 1 Nucleotide sequence of the 87 bp region 5'GGAGAGTTGGTTGTAGGTTCAATTATTACTATTTTTGAAGCT GTGTATTTCCCTTTTTCTAATATGCACCTATTTCATGTTTCAAA3' Splicing sites (in bold) have been mutated (respectively GT-+GA and AG-+AA).

The invention will be now disclosed by means of some non-limitative examples, in which reference will be made to Figure 1-A photographic representation of tomato fruits of the L276 and UC82 lines transformed with the gene DefH9-iaaM (at the top) or with the gene DefH9-RI- iaaM (at the bottom). Fruits produced by transgenic plants with DefH9-iaaM are malformed, and they feature a very remarkable umbone (the Pickelhauben phenotype).

MATERIALS AND METHODS 1. Bacterial strains and cultures E. coli DH5a cells have been employed for propagating recombinant plasmids. All recombinant plasmids have been introduced in the Agrobacterium tumefaciens GV3101 or GV2260 strains by electroporation or conjugation, employing standard procedures (Koncz and Schell, 1986).

2. Construction of the recombinant plasmid and construct Recombinant plasmids and constructs have been obtained by standard molecular biology procedures (Maniatis at al., 1982).

In particular, the AG splicing site of the DNA sequence corresponding to the intron of the gene rolA has been mutated by PCR method. Primers utilised were: 5'GGGGTACCGGTGAGTGTGGTTGTAGGTTC 3', and 5'GGGTGAATTAAAATGGTCATACATTTTGAAACATGAAATAGGTGCATATTA 3'.

The 5'end transcripted untranslated region of the iaaM gene has been substituted by the sequence disclosed

in Table 1 by PCR gene fusion. Primers employed for the preparation of the second fragment used in the gene fusion are: 5'TATGCACCTATTTCATGTTTCAAAATGTATGACCATTTTAATTCAC 3'and 5'CTCCGTGTCCACCACACC 3'.

The PCR used for the gene fusion has utilised two amplicons produced by the two PCR reactions described above, and primers at 5'end of the amplicon containing the sequence derived from the intron of the gene rolA, and at 3'end of the amplicon corresponding to the part of the region coding for the gene iaaM.

The mutation of the GT splicing site has been obtained by means of PCR, with the primers: 5'GGGGTACCGGAGAGTGTGGTTGTAGGTTC3'and 5'CTCCGTGTCCACCACACC 3' using as template the amplicon with the AG splicing site mutated in AA, as described above. The amplicon obtained has been sequenced to check the DNA sequence for containing the desired modifications. After cutting with KpnI and BamHI, the fragment has been ligated with the KpnI/BamHI fragment of the gene DefH9-iaaM.

3. In vitro cultures of plant explants and their trans- formation 3.1 Genetic transformation in tomato plants Tomato varieties have been transformed essentially as described by Cirillo et al. (1997). Briefly, cotyledon explants drawn from in vitro cultured plantlets were cultured for 48 hrs in Petri dishes containing the regeneration medium T210, macro-and micro-elements MS (Murashige and Skoog, 1962), vitamins (Gamborg, 1968), 30 g/1 glucose, 1 mg/1 zeatin and 0.1 mg/1 indolacetic acid, acetosyringone 20 M, 0.5 g/1 MES, 5.4 g/1 agar, pH 5.5.

Bacteria hade been grown on liquid medium LB (Luria and Bertani) containing suitable antibiotics and incubated in the dark at 28°C, under stirring at 200 rpm till reaching the logarithmic phase (O. D. 600 0. 8-1.0). The bacterial pellet was resuspended in liquid medium MS containing 2% glucose and 200 ZM acetosyringone, 0.5 g/1 MES, pH 5.5.

Cotyledon pieces were dipped into the bacterial suspension for 5 minutes, then dried on filter paper and placed again on the same medium T210. After 48 hours of culture with Agrobacterium, cotyledons were transferred into the selection medium made up of T210 KmCf (T210 without acetosyringone and containing 500 mg/1 cefotaxime and 50 mg/1 kanamycin). Each 20-30 days, cotyledons and callus were recultured in T210 KmCf. Sprouts were allowed to grow longer on the T20 KmCf medium (T210 without IAA, 300 mg/1 cefotaxime and 100 mg/1 kanamycin), and when they reached a length of 2.0-2.5 cm, they were removed from their callus and placed in the rooting medium k MS containing 200 mg/1 cefotaxime and 50 mg/1 kanamycin.

Rooted plants were then multiplied in vitro and, after a period of adaptation to the environment, they were grown in a greenhouse for their phenotypical characterization.

3.2 Genetic transformation of melon plants For experiments of genetic transformation, pure line and cultivars belonging to the botanic varieties reticulatus and inodorus were employed. Seeds deprived of their tegument were disinfected in 70% ethanol for 45 sec, sterilized in sodium hypochloride (5% w/v active chlorine) for 15 minutes and then they were rinsed three times in sterilized distilled water. Seeds were then cultivated on the MS base substrate added with 3% sucrose and 0.7% agar. After 3 days of culturing, cotyledons were

excised, then cut into pieces of 5 mm2 and precultured for three days on substrate MS added with 4.4 pM BA, 1 pM ABA, 20 FM acetosyringone, 3% sucrose and 0.7% agar (pH 5.8) and incubated in a growth chamber at 25 2°C at 2000 lux with a photoperiod of 16/8 hours of light and darkness. Bacteria were grown on liquid LB substrate containing the suitable antibiotics and incubated for 24 hours in the dark at 28°C and kept under stirring at 200 rpm till reaching the logarithmic phase (O. D. 600 0.8- 1.0). The bacterial pellet was resuspended in MS containing 2% sucrose and 200 pM acetosyringone (pH 5.5).

Infection was carried out by dipping the explants into a solution containing the bacterial suspension for 5 minutes and then dried on sterilized filter paper and placed in co-culture on the same preculture medium for 3 days in the dark at 25°C. The material after the co- cultivation period was transferred onto a selective regeneration substrate containing the antibiotics kanamycin (100 mg/1) and cefotaxime (500 mg/1). Each 2-3 weeks explants were transferred with fresh selective medium. Sprouts regenerated from each somatic explants were placed on disks of sterile paper of 3 mm thickness in Petri dishes of diameter 60 x 14 mm containing 5 ml of liquid MS added with 5 ZM of zeatin, 100 mg/1 kanamycin and 500 mg/1 cefotaxime. Sprouts of about 2 cm were transferred for rooting in magenta boxes containing MS without hormones with 300 mg/1 of cefotaxime. One sprout for each explant was led to rooting. Plants were then transferred into small plastic pots containing a sterile mixture of soil and peat (1: 1, v/v) and kept in a growth

chamber for two weeks to get acclimatized and then transferred into a greenhouse for being evaluated.

4. Phenotypic analysis of parthenocarpic development of fruits 4.1 Tomato Phenotypic expressivity of the parthenocarpic trait was checked by evaluating the capability of flowers of setting and of developing fruits in the absence of fertilisation. Accordingly, flowers of transgenic plants for the gene DefH9-iaaM, or for the gene DefH9-RI-iaaM, or derived from the seed of the L276 line and of the variety UC82 (untransformed control samples), were emasculated before dehiscence of pollen and covered with small paper envelope. The emasculation operations were carried out in a greenhouse with a minimum warranted temperature of 16°C and without artificial lighting, i. e. under very limiting conditions for tomato fruits to set.

4.2 Melon Phenotypic expressivity of the gene DefH9-iaaM was evaluated in F1 hybrids obtained from crossbreed between a transgenic line and untransformed control lines, grown in protected anticipated culture (Notification B/IT/99/01) at the section of Monsampolo del Tronto of the Istituto Sperimentale di Orticoltura. The tunnel greenhouse was supplied with an anti-insect net so that plants did not use the action of match-promoting insects which are indispensable for melon plant pollination grown inside the prepared apparatus.

RESULTS EXAMPLE 1 Construction of the plasmid pPCV002-DefH9-RI- iaaM

The plasmid pPCV002-DefH9-RI-iaaM was obtained by ligating the 3480 bp EcoRI-KpnI fragment, containing the promoter (2250 bp) and regulative sequences (1212 bp) of the gene DefH9 of Antirrhinum majus, described in W098/28430 and in the doctorate thesis of Dr. Rolf Hansen (Faculty of Sciences, University of Cologne, 1993), with a 1807 bp KpnI-SpHI fragment (87+1671+49), that comprises the 87 bp sequence obtained from the 85 bases corresponding to the intron of the rolA gene of Agrobacterium rhizogenes A4 (Table 1), the region coding for the iaaM gene of Pseudomonas syringe pv. Savastanoi (1671 bp) and 49 bp at the 3'end coding region of the iaaM gene (TAA stop codon and 46 successive bp).

The iaaM gene was characterized and described by Yamada et al. (1985). The termination sequences of the gene employed either the terminator of the 35S transcript of the CAMV (Application EP 0469273) or of the rolC gene of Agrobacterium rhizogenes (Slightom et al., 1986). The terminator sequence of the rolC gene employed is 222 bp long. An SphI site and a HindIII site were added by means of PCR, respectively at the 5'end and 3'end of the amplicon.

The pPCV002-DefH9-RI-iaaM plasmid so obtained is made up of the following: -2250 bp of the promoter DefH9 of Antirrhinum majus (with an EcoRI adaptor at 5'); -1212 bp of regulation sequence present in the leader region transcripted but untranslated of the gene DefH9 of A. majus; -6 bp added as KpnI linker;

-87 bp of transcripted but untranslated region obtained modifying the 85 bp sequence corresponding to the Agrobacterium rhizogenes rolA gene intron; -1671 bp of the coding region of the iaaM gene from Pseudomonas syringe pv Savastanoi; -49 bp (46+3 of the stop codon) of the trailer un- translated region of the iaaM gene from Pseudomonas syringe pv Savastanoi; -222 bp containing transcription termination sequences from the rolC gene of Agrobacterium rhizogenes.

EXAMPLE 2 Biological effect of the gene DefH9-RI-iaaM in tomato plants of the UC82 line The modification of the chimeric gene DefH9-iaaM described in the patent application W098/28430, obtained by introducing the 87 bp sequence of Table 1, gave rise the DefH9-RI-iaaM gene. Such modification did not produce any change in the expression specificity of the regulation sequence DefH9. Indeed, transgenic plants are indistinguishable, as to their vegetative status, from control untransformed plants. Phenotypically, the setting occurs in the absence of fertilisation and it involves the production of fruits of normal shape and size.

Transgenic plants were obtained with the UC82 tomato line. 16 tomato plants of the UC82 line, which are transgenic for the DefH9-RI-iaaM gene, were regenerated and analyzed to assess the presence or the absence of deformations of fruits. Just one out of the 16 plants obtained shows parthenocarpic fruits with malformations similar to those induced by the auxin hypersensitivity.

All of five plants analyzed up to now by means of the emasculation technique show parthenocarpic development of fruits and absence of malformations.

On the contrary, in all of 35 transgenic plants obtained with the DefH9-iaaM gene, a parthenocarpic development of fruits was observed, which was concomitant with the deformation of fruits (the Pickelhauben phenotype). Figure 1 shows the deformation type that generally manifests itself in fruits, but in some cases defects were much more remarkable.

Accordingly, it was shown that fruits of tomato plants of the UC82 line, which are transgenic for the DefH9-RI-iaaM gene, are parthenocarpic and do not show any alterations of fruits, such as umbones (the Pickelhauben phenotype) and"box-shape", which are present in fruits obtained from plants of the same line (i. e. the UC82 line) which are transgenic for the DefH9- iaaM gene. The frequency of plants showing malformed fruits employing the DefH9-RI-iaaM gene is such (6% till now) as to make it easy anyway to identify plants without malformations and with a good expressivity of the parthenocarpic trait.

EXAMPLE 3 Quantification of auxin in flower buds of transgenic plants obtained with the UC82 line The IAA concentration in flower buds has been evaluated by gas chromatography followed by mass spectroscopy (GC/MS). Total IAA in all samples has been converted into a volatile derivate by conjugating the Si (CH3) 3group. In each sample 10 M of deuterated IAA has been added; the amount of IAA was calculated as ratio of free or total IAA, divided by the amount of residual deuterated IAA.

Plants used in this analysis were: 1) tomato UC82 untransformed (indicated as wild type); 2) UC82 transformed with the DefH9-iaaM gene construct; 3) UC82

transformed with the DefH9-RI-iaaM gene construct. Flower buds (0.5 cm long) from each plant have been extracted with solvents and derivatized with the group Si (CH3) 3 to convert all the IAA (indole acetic acid) molecule in a volatile derivate. The product has been subjected to a gas chromatographic separation, followed on line by mass spectroscopy analysis. Values of IAA found were expressed per gram of tissue analysed. Free IAA is a fraction of total IAA that is generally conjugated to other compounds such as amino acids. For this reason each sample has been evaluated as free IAA and total IAA. Total IAA here indicates the amount of IAA found after hydrolysis of conjugated IAA. In all cases 10 ZM of deuterated IAA has been added to all samples at the beginning of the extraction. All values are ratios of the IAA pick found divided the amount of residual 10 pM of deuterated IAA.

Results are shown in Table 2.

Table 2 Plant FreeIAA(nM)TotalIAA(nM) Wildtype 0. 03 0.24 DefH9-iaaM 2. 4 15.0 DefH9-RI-iaaM 0. 38 5.0 Then altered tomato fruits (deriving from transgenic plants with the DefH9-iaaM gene) belong to plants having a concentration of IAA at least three times higher than plants harbouring the DefH9-RI-iaaM gene.

These data were confirmed by experiments of in vitro transcription and translation with both constructs.

EXAMPLE 4 Biological effect of the DefH9-RI-iaaM gene in tomato plants of the L276 line

Experiments of Example 2 were repeated with the L276 line. In 12 transgenic plants for the DefH9-RI-iaaM gene, fruits were obtained which did not show any malformations and were similar to control samples derived from seeds.

The same L276 line, when transformed with the DefH9-iaaM gene, produced a remarkable percentage of plants (88%, 37/42) with fruits showing remarkable malformations, typical of auxin hypersensitivity.

The six L276 plants which were transgenic for the DefH9-RI-iaaM gene, that have been phenotypically analyzed till now for their expressivity of the parthenocarpic trait, showed the capability for setting fruits from emasculated flowers. Moreover, it was possible to observe a different expressivity of the trait according to the different transformation events. Three out of the six plants gave fruits of sizes similar to those of fruits obtained by self-fecundation, whereas the other plants gave from emasculated flowers fruits of sizes lower than fruits obtained from pollinated flowers.

BIBLIOGRAPHIC REFERENCES -Carlin AF, Hang TT, Weigle JL, 1971. J. Am. Hort. Sci.

96 (2): 138-141.

-Cirillo C, et al., 1997. Italus Hortus Vol. 4, n. 5: 28- 34 -Gamborg OL, Miller RA, Ojima K, 1968. Exp. Cell. Res.

50: 151-158.

-Koncz and Schell, 1986. Mol. Gentile. Genet. 204,383- 396.

-Maniatis et al., 1982. Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory.

-Murashige T, Skoog F, 1962. Physiol. Plant 15: 473-497.

-Yamada T, et al., 1985. Proc. Natl. Acad. Sci. USA 82: 6522-6526.

-Slightom JL, et al., 1986. J. Biol. Chem. 261: 108-121.