CONSTRUCTS CAPABLE OF SAME

FIELD AND BACKGROUND OF THE INVENTION The present invention, in some embodiments thereof, relates to methods of analyzing A-I editing both in vitro and in vivo.

RNA editing by adenosine (A) to inosine (I) modification generates RNA and protein diversity in higher eukaryotes selectively altering both coding and non-coding sequences in nuclear transcripts. The enzymes responsible for A-to-I editing, the adenosine deaminases acting on RNA (ADARs), are ubiquitously expressed in mammals and specifically recognize partially double-stranded (ds) RNA structures where they modify individual adenosines depending on the local structure and sequence environment.

Since the initial cloning of the first RNA-specific adenosine deaminase, ADARl, a family of A-to-I editing enzymes (ADARl-3) has emerged. Both ADARl and ADAR2 are detected in many tissues, whereas ADAR3 is expressed only in restricted regions of the brain. Members of the ADAR gene family share common structural features such as two or three repeats of a dsRNA binding motif and a separate deaminase or catalytic domain. Certain structural features are unique to particular ADAR members. For instance, ADARl contains two Z-DNA binding motifs, whereas ADAR3 includes an arginine-rich, single-stranded RNA binding domain at the N terminus.

Adarl-knockout mice show an embryonic lethal phenotype whereas Adar2- knockout mice suffer from generalized epilepsy and die at few weeks of age. In vitro RNA editing studies have revealed a significant difference in site selectivity displayed by ADARl and ADAR2, whereas no RNA editing activity has been demonstrated yet for ADAR3. Orthologues of the mammalian ADARs have also been characterized and cloned from fruit fly and worms, and related genes have been identified in fish genomes. ADARs specifically target single nucleotides for editing within the partially double-stranded pre-mRNAs of their substrates, such as neuronal glutamate and serotonin receptor transcripts. Since inosine is read as guanosine by the translation machinery, A-to-I editing may lead to codon changes that result in the alteration of protein function.

The best studied A-to-I RNA editing event accrues in the AMPA glutamate receptor subunit GluR2 Q/R site. Virtually 100 % of the transcripts of this gene are edited at this site such that the mRNA contains an arginine (R) codon (CIG) in place of the genomic glutamate (Q) codon (CAG). Underediting of the GluR2 Q/R Q/R site greatly increases the Ca2+ permeability of AMPA receptors. The increase in Ca2+ influx through the receptor channel may cause neural cell death. Heterozygous mice, carriers of a modified GluR2 which can not be edited, show increased AMPAR Ca2+ permeability causing epileptic seizures and premature death. In 2004 Kawahara and his colleagues published a study showing a defect in the RNA editing of the glutamate receptor in ALS patients [Nature, VoI 427, Feb 2004]. They found that the editing efficiency varied between 0 % and 100 % in the motor neurons from each individual with ALS, and was incomplete in 56 % of them. All the control motor neurons derived from healthy patients examined showed 100 % editing efficiency. When they examined the editing efficiency in Purkinji cells (non-affected cells) from these patients they saw no difference between the ALS patients and the normal group.

Until recently, only a handful of A-to-I editing sites were known in the human transcriptome. However, several years ago, it was revealed that the extent of editing is much larger, affecting tens of thousands of sites and more than 1,600 different genes

Using an inosine-specific cleavage reaction, Morse et al. [Proc. Natl. Acad. Sci. U. S. A. 99(2002) 7906-7911] conducted a targeted search for additional A-to-I substitutions and revealed clusters of editing sites in 19 human brain derived mRNAs. Of the clusters, 15 out of 19 occurred in repetitive elements, mainly in AIu sequences, within non-coding sequences. In addition, three independent groups performed systematic searches using computational algorithms that corroborated the existence and extent of abundant A-to-I editing modifications, mainly in AIu repetitive elements in non-coding regions, such as introns and untranslated regions [E. Y. Levanon, et al., Nat. Biotechnol. 22 (2004), 1001-1005; Athanasiadis et al., PLoS Biol. 2004 December; 2(12); D.D. Kim et al., Genome Res. 14 (2004) 1719-1725].

Therefore, A to I editing events can also affect splicing, RNA localization (such as retention in the nucleus), RNA stability and translation. Since RNA editing acts on double stranded RNA, it can also affect other basic processes such as RNA interference and microRNA both of which depend on double stranded RNA.

Chen et al [EMBO Journal 2008, 27, 1694-1705] teaches nucleic acid constructs which are capable of assaying ADAR activity, whereby a localization of an encoded marker protein correlates with the presence of ADAR.

SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising a first nucleic acid sequence encoding a detectable expression product operably linked to a second nucleic acid sequence comprising a 3' UTR of HFE.

According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising a first nucleic acid sequence encoding a detectable expression product, and a second nucleic acid sequence being capable of regulating expression of the detectable expression product in an ADAR (adenosine deaminase acting on RNA) -sensitive fashion.

According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct system comprising:

(i) the nucleic acid construct of claim 1, wherein the second nucleic acid sequence comprises a target sequence for a miRNA; and

(ii) an additional nucleic acid construct comprising a nucleic acid sequence encoding the miRNA, the miRNA being a target for ADAR editing.

According to an aspect of some embodiments of the present invention there is provided an isolated cell comprising the nucleic acid construct of the present invention. According to an aspect of some embodiments of the present invention there is provided an isolated cell comprising the nucleic acid construct system of the present invention.

According to an aspect of some embodiments of the present invention there is provided a transgenic non-human animal comprising the nucleic acid construct of the present invention. According to an aspect of some embodiments of the present invention there is provided a transgenic non-human animal comprising the nucleic acid construct system of the present invention.

According to an aspect of some embodiments of the present invention there is provided a method of assaying ADAR activity, the method comprising:

(a) introducing the nucleic acid construct of the present invention into cells; and

(b) analyzing an expression of the detectable expression product in the cells, whereby an expression of the detectable expression product is indicative of the activity of ADAR. According to an aspect of some embodiments of the present invention there is provided a method of assaying ADAR activity, the method comprising:

(a) introducing the nucleic acid construct system of the present invention into cells; and

(b) analyzing an expression of the detectable expression product in the cells, whereby an expression of the detectable expression is indicative of the activity of

ADAR.

According to an aspect of some embodiments of the present invention there is provided a method of identifying an agent capable of altering ADAR activity, the method comprising: (a) expressing the nucleic acid construct of the present invention in a cell;

(b) contacting the cell with the agent; and

(c) measuring a level of detectable expression product following (b) and optionally prior to (b), wherein a change in expression of the detectable expression product is indicative of an agent capable of altering ADAR activity. According to an aspect of some embodiments of the present invention there is provided a method of identifying an agent capable of altering ADAR activity, the method comprising:

(a) expressing the nucleic acid construct system of the present invention in a cell; (b) contacting the cell with the agent; and (c) measuring a level of detectable expression product following (b) and optionally prior to (b), wherein a change in expression of the detectable expression product is indicative of an agent capable of altering ADAR activity.

According to some embodiments of the invention, the ADAR is ADAR-I. According to some embodiments of the invention, the second nucleic acid sequence encodes a target for the ADAR.

According to some embodiments of the invention, the second nucleic acid sequence hybridizes with the first nucleic acid sequence to generate a target for the ADAR. According to some embodiments of the invention, the target for the ADAR is comprised in a post- transcriptional regulatory site.

According to some embodiments of the invention, the post-transcriptional regulatory site is selected from the group consisting of a splice site, a miRNA binding site, a translation initiation site and a nuclear localization signal. According to some embodiments of the invention, the post-transcriptional regulatory site is a miRNA binding site.

According to some embodiments of the invention, the nucleic acid construct further comprises a nucleic acid sequence encoding the miRNA, the miRNA being a target for ADAR editing. According to some embodiments of the invention, the second nucleic acid sequence is of a 3' UTR of a gene selected from the group consisting of hemochromatosis (HFE), Malonyl CoA:ACP acyltransferase (mCAT), Lamina- associated polypeptide 2beta (Lap2beta) and Lin 28.

According to some embodiments of the invention, the second nucleic acid sequence comprises a 3' UTR of HFE.

According to some embodiments of the invention, the second nucleic acid sequence is as set forth in SEQ ID NO: 1.

According to some embodiments of the invention, the introducing is effected in vitro. According to some embodiments of the invention, the introducing is effected in vivo. According to some embodiments of the invention, the introducing is effected ex vivo.

According to some embodiments of the invention, a presence of the expression of the detectable expression product is indicative of ADAR activity. According to some embodiments of the invention, an absence of the expression of the detectable expression product is indicative of ADAR activity.

BRIEF DESCRIPTION OF THE DRAWINGS Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying images. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced. In the drawings:

FIG. 1 is a photograph illustrating long and short PCR products of the HFE 3'UTR. The large form was detected using primers designed to recognize the intron in the HFE 3 ' UTR. The short form was detected using primer designed to recognize both exons in the HFE 3 ' UTR.

FIGs. 2A-D are fluorescent microscope images illustrating the localization of endogenous HFE transcript with or without IFNα tratment. HepG2 cells were either not treated (A ₅ C) or treated with 2000 IU IFNα for 24 hours (B,D) fixed and hybridized to cye3 fluorescent probe designed against the long, un-spliced form of the HFE 3'UTR (A,B) or to a probe designed against the short spliced form of the HFE 3 'UTR.

FIGs. 3A-F are fluorescent microscope images illustrating YFP-3'UTR expression in HepG2 cells with either knockdown or over-expression of the ADARl. Figure 3A: YFP-HFE 3'UTR transfected to naϊve cells, Figure 3B: YFP-HFE 3'UTR transfected to naϊve cells treated with IFNα afterwards Figure 3C: YFP-HFE 3'UTR transfected to ADARl knock down cells: Figure 3D: YFP-HFE 3'UTR transfected to ADARl knock down cells and treated with IFNα afterwards. Figure 3E: HepG2 cells were co-transfected with YFP-3'UTR and mock PcDNA3 vector. Figure 3F: HepG2 cells were co-transfected with ADARl over expression vector and with YFP-3'UTR. 48 hours post transfection, the cells were fixed and stained with DAPI. The pictures were taken using Olympus light microscope.

FIG. 4 is a bar graph illustrating CFP-3'UTR expression in cells transfected with mutated CFP-3'UTR. The CFP-3'UTR was mutated in the 7 predicted editing sites of the HFE 3' UTR. a-No mutation, b- Mutations in the first site. c-Second site d- Third site, e- Fourth site. f. Fifth site, g- Sixth site, h- Seventh site.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION The present invention, in some embodiments thereof, relates to methods of methods of analyzing A-I editing both in vitro and in vivo and, more particularly, but not exclusively, to nucleic acid constructs capable of same.

RNA editing is catalyzed by the Adenosine Deaminase Acting on RNA (ADAR) group of enzymes that are capable of converting adenosine to inosine at a specific location in a double-stranded RNA structure. RNA editing has recently emerged as a global post-transcriptional modification that affects thousands of transcripts. Most of these editing sites reside in 5' and 3' untranslated regions (UTRs) and intronic sequences. Accordingly, RNA editing can affect a wide range of post-transcriptional events including, RNA localization, splicing, gene silencing and miRNAs biogenesis. Alterations in RNA editing have now been linked to various human diseases including inflammation, epilepsy, depression, amyotrophic lateral sclerosis and cancer.

Since editing plays an important role both in normal development and disease onset, the present inventors have rationalized that development of tools that will enable monitoring levels of A-I RNA will be important for identifying inhibitors or activators of ADAR enzymes of therapeutic efficacy.

Whilst reducing the present invention to practice, the present inventors postulated that a nucleic acid sequence capable of regulating expression of a reporter polypeptide in an ADAR-sensitive fashion may be used for the construction of such a tool. The present inventors selected a sequence comprised in the 3' untranslated region (UTR) of the HFE gene (which had been shown by bioinformatic analyses to undergo A to I editing) and linked it to a polynucleotide encoding a reporter polypeptide. Following expression of this construct in a cell system, the present inventors showed that when A to I editing took place, the reporter polypeptide was expressed (Figures 3B and 3F). However, in the absence of A to I editing, no reporter polypeptide was expressed (Figures 3A and 3C).

Thus, according to one aspect of the present invention there is provided a nucleic acid construct comprising a first nucleic acid sequence encoding a detectable expression product, and a second nucleic acid sequence being capable of regulating expression of the detectable expression product in an ADAR-sensitive fashion.

As used herein, the term "ADAR" (an abbreviation of "adenosine deaminase acting on RNA") refers to an enzyme which is a member of a family of enzymes that deaminate adenosine to inosine in a double stranded RNA. Typically, ADARs share a common modulator organization which consists of a variable N-terminal region, a double stranded RNA binding domain and a zinc containing catalytic domain. Accordingly, the ADAR may be ADAR 1, 2 or 3 (EC 3.5.4). Exemplary sequences of ADARs are provided, by the following accession numbers: NP001033821, NP726761, NP569940, NP062629, NP001033676, NP056656, NP056655, NP00102 and NP112268.

According to one embodiment, the ADAR is a human ADAR. As mentioned, the nucleic acid constructs of the present invention typically comprise two segments, a first segment encoding a detectable expression product and a second segment, operably linked to the first segment being capable of regulating expression of the detectable expression product in an ADAR-sensitive fashion.

According to one embodiment the detectable expression product comprises a detectable moiety. Polypeptides comprising detectable moieties (e.g. fluorescent or phosphorecent moieties) are well known to those of skill in the art. They include, but are not limited to, bacterial chloramphenicol acetyl transferase (CAT), beta- galactosidase, green fluorescent protein (GFP), yellow fluorescent protein (YFP) and other fluorescent proteins, various bacterial luciferases, e.g., the luciferases encoded by Vibrio harveyi, Vibrio fischeri, and Xenorhabdus luminescens, the firefly luciferase FFlux, antigenic tags, and the like. It will be appreciated that the detectable expression- product may also be detected even in the absence of a "traditional" detectable moiety, such as those listed above. Generally the transcription, translation, or activity of any gene can routinely be detected. Thus, for example, a detectable expression product may be detected by methods including, but not limited to, Northern blots, amplification techniques (e.g. PCR), and the like. Similarly, the translated protein product can be detected by detecting the characteristic activity of the protein or by detecting the protein product itself (e.g. via Western blot, capillary electrophoresis, and the like).

As mentioned, the second segment of the expression construct is capable of regulating expression of the detectable expression product in an ADAR-sensitive fashion.

The present invention contemplates that the detectable expression product serves as an indicator of ADAR activity in a present/absent mode (i.e. qualitiative) or by degree (i.e. quantitiative). Further the detectable expression product may be proportional or inversely proportional to ADAR activity. The present invention further contemplates a change in localization of the detectable expression product as an indicator of ADAR activity. The phrase "ADAR activity" refers to the ability of the ADAR to deaminate adenosine to inosine in double stranded RNA.

According to one embodiment, following transcription from the regulatory region of the expression construct, a RNA is generated that comprises a target for ADAR. As mentioned, the target is an adenine residue comprised in a double stranded RNA.

Various sequences are contemplated for the second nucleic acid sequence such that it is capable of regulating expression of the detectable expression product in an

ADAR-sensitive fashion. For example, ADAR activity may create or destroy a post- transcriptional regulatory site in the transcribed RNA molecule, which in turn effects the expression and/or localization of the operably linked detectable expression product.

A splice site is one contemplated post-transcriptional site which may be comprised or created in the transcript of the regulatory region of the expression construct of the present invention.

As used herein, the term "splice site" refers to any site which directs shortening of the polypeptide. Accordingly, the "splice site" may refer to both canonical and non- canonical splice sites. Introns are typically flanked by "GT" and "AG" which serve as splice sites.

Accordingly, if the "A" of the "AG" sequence is deaminated by ADAR, the splice site may be destroyed. Alternatively if an intron is flanked by "AT" and "AA", deamination of the first A may serve to create a splice site. Thus, a splice site may be created upon ADAR activity wherein, the long, non- edited transcript is retained in the nucleus and therefore not expressed, whereas the short, edited transcript is transported to the cytoplasm and subsequently expressed.

Exemplary sequences which may be used according to this embodiment include, but are not limited the 3' UTR of a gene selected from the group consisting of hemochromatosis (HFE; NM_139003) (e.g. SEQ ID NO: 1), Lamina-associated polypeptide 2beta (Lap2beta; NM_001032283, e.g. SEQ ID NO: 2) and nicolin (e.g.

SEQ ID NO: 3; NM_032316). Other contemplated sequences include but are not limited to Malonyl CoA:ACP acyltransferase (mCAT; NM_001030014) and Lin 28

(NM_024674). According to this embodiment, the second nucleic acid sequence comprising the

3'UTR is devoid of the associated coding region (i.e. does not comprise the HFE coding region etc.).

Alternatively, a splice site may be destroyed upon ADAR activity, wherein the long edited transcript is not expressed and the short non-edited transcript is expressed. A miRNA binding sequence is another contemplated post-transcriptional site which may be generated in the transcript of the regulatory region of the expression construct of the present invention.

According to one embodiment, the regulatory region of the expression construct may be engineered such that upon transcription, the RNA comprises a target sequence for a miRNA. (see Liang H and Landweber L RNA (2007) 13:463-467, incorporated by reference herein). For Example, the regulatory region may comprise the sequence

AAGCAAT (SEQ ID NO: 4), a known binding site for miRNA 137 (SEQ ID NO: 5).

In the absence of ADAR activity, the miRNA target sequence is not affected and remains intact and, in the presence of the miRNA, expression of the detectable expression product will be down-regulated. However, in the presence of ADAR activity, the miRNA target sequence is destroyed (e.g. it becomes AAGCGAT -SEQ ID

NO: 6), and the detectable expression product is expressed. Another contemplated sequence which serves as a target for miRNA is miRNA124 (SEQ ID NO: 7) is GCCTTA (SEQ ID NO: 8) which in the presence of ADAR activity would become GCCTTG (SEQ ID NO: 9).

According to another embodiment, the regulatory region of the expression construct may be engineered such that upon ADAR activity a miRNA target sequence is created.

Thus, for example, the expression construct may be engineered such that upon transcription, the RNA comprises a sequence that upon adenylation can create a miRNA 145 target sequence - e.g. GCAAAAAA (SEQ ID NO: 10). In the absence of ADAR activity, this sequence is not affected and has no regulatory effect on the detectable expression product. However, in the presence of ADAR. activity, a miRNA 129 target sequence may be created (e.g. it becomes GCAAAAAG (SEQ ID NO: 11), and the detectable expression product is down-regulated.

Alternatively the expression construct may be engineered such that upon transcription, the RNA comprises a sequence that upon adenylation can create a miRNA 145 target sequence. Thus for example, the RNA may comprise the following sequence: ACTGGAA (SEQ ID NO: 12). In the absence of ADAR activity, this sequence is not affected and has no regulatory effect on the detectable expression product. However, in the presence of ADAR activity, a miRNA 145 target sequence may be created (e.g. it becomes ACTGGAG (SEQ ID NO: 13), and the detectable expression product is down-regulated [Kawahara, Y et al., Science 315: 1137-1140].

It will be appreciated that this embodiment of this aspect of the present invention requires expression of the miRNA. Accordingly, the ADAR activity must either by assayed in cells known to express the particular miRNA or the miRNA may be introduced into the cell using the same expression construct as that used to introduce the detectable expression product into the cell or alternatively, using an additional expression construct.

Translation initiation sites and nuclear localization signals (NLS) are other contemplated post-transcriptional sites which may be comprised or created in the regulatory region of the expression construct of the present invention. Prasanth et al (Cell, 123, 249-263, 2005, incorporated herein by reference) have identified a sequence in the mouse cationic amino-acid transported 2 (mCAT) 3 ¹ UTR which upon ADAR activity acts to retain the RNA in the nucleus. Such a sequence is contemplated by the present invention. Other contemplated constructs are those described in Chen et al [EMBO Journal 2008, 27, 1694-1705].

As well as expression constructs comprising regulatory regions that upon ADAR activity creates or destroys a post-transcriptional regulatory site, the present inventors also contemplate other permutations and combinations of expression constructs that may be used to detect ADAR activity, a selection of which are summarized below. 1. creation or destruction ofmiKNA *

According to this embodiment, the expression construct of the present invention is constructed such that the RNA transcribed therefrom comprises a target sequence of a miRNA, the targeting miRNA itself comprising an ADAR targeting sequence. Thus, for example the RNA transcribed therefrom may comprise a target sequence for a non- ADAR compromised miRNA e.g. mil231 (SEQ ID NO: 14), the targeting sequence being for example, AGCCGCC (SEQ ID NO: 15). In the presence of ADAR, miRNA 1231 may be adenylated such that it no longer binds to the target sequence and expression of the detectable expression product is unaffected. In the absence of ADAR, miRNA 1231 may bind to the target sequence and expression of the detectable expression product is down-regulated. According to another example, the RNA which is transcribed from the expression construct may comprise a target sequence for a non- ADAR compromised miRNA136 (SEQ ID NO: 16), e.g. ACCACCAA (SEQ ID NO: 17). In the presence of ADAR, miRNA 136 may be adenylated such that it no longer binds to the target sequence and expression of the detectable expression product is unaffected. In the absence of ADAR, miRNA 1231 may bind to the target sequence and expression of the detectable expression product is down-regulated. According to another embodiment, the RNA which is transcribed from the expression construct may comprise a target sequence for an ADAR compromised miRNA e.g. miRNA 424 (SEQ D NO: 18), the targeting sequence being for example ACGAACCG (SEQ ID NO: 19). In the presence of ADAR, miRNA 424 may be adenylated such that it binds to the target sequence and expression of the detectable expression product is down-regulated. In the absence of ADAR, miRNA 424 cannot bind to the target sequence and expression of the detectable expression product is unaffected. According to another example, the RNA transcribed from the expression construct may comprise a target sequence for miRNA 134 (SEQ ID NO: 20), the targeting sequence being for example TCCGGCCA (SEQ ID NO: 21). In the presence of ADAR, miRNA 134 may be adenylated such that it binds to the target sequence and expression of the detectable expression product is down-regulated. In the absence of ADAR, miRNA 134 cannot bind to the target sequence and expression of the detectable expression product is unaffected.

It will be appreciated that similarly to the previously described embodiment, this embodiment of this aspect of the present invention also requires expression of the miRNA. Accordingly, the ADAR activity must either by assayed in cells known to express the particular miRNA or the miRNA may be introduced into the cell using the same expression construct as that used to introduce the detectable expression product into the cell or alternatively, using an additional expression construct.

2. A construct wherein the second nucleic acid sequence hybridizes with the first nucleic acid sequence to generate a target for the ADAR. According to this embodiment the second nucleic acid sequence is engineered such that its transcription product is capable of hybridizing to the transcription product of the first nucleic acid sequence at a position where it interferes with post- transcriptional processing and in doing so, creates a target for ADAR. In the presence of ADAR, the second nucleic acid sequence no longer fully hybridizes with the first nucleic acid sequence and the post transcriptional processing is no longer masked.

3. A construct wherein the second nucleic acid sequence comprises an AIu sequence which is sensitive to ADAR.

Such constructs are described for example by Chen et al [EMBO Journal 2008, 27, 1694-1705]. It will be appreciated that the present invention also contemplates other combinations and permutations of these sequences and the constructs of the present invention are not limited by the above examples.

The nucleic acid constructs of the present invention comprise promoters to allow for transcription of the detectable expression product. Constitutive promoters suitable for use with this embodiment of the present invention include sequences which are functional (i.e., capable of directing transcription) under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV).

Inducible promoters suitable for use with this embodiment of the present invention include for example the tetracycline-inducible promoter (Srour, M.A., et al., 2003. Thromb. Haemost. 90: 398-405).

Preferably, the promoter utilized by the nucleic acid construct of the present invention is active in the specific cell population transformed. Examples of cell type- specific and/or tissue-specific promoters include promoters such as albumin that is liver specific [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulins; [Banerji et al. (1983) Cell 33729-740], neuron-specific promoters such as the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], pancreas- specific promoters [Edlunch et al. (1985) Science 230:912-916] or mammary gland- specific promoters such as the milk whey promoter (U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166).

In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

The nucleic acid constructs may include additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). Typical cloning vectors contain transcription and translation initiation sequences (e.g., promoters, enhances) and transcription and translation terminators (e.g., polyadenylation signals).

Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated. Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.

Polyadenylation sequences can also be added to the nucleic acid construct in order to increase the translation efficiency of a polypeptide expressed from the expression vector of the present invention. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals that are suitable for the present invention include those derived from S V40.

In addition to the elements already described, the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.

The nucleic acid construct may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid. The nucleic acid construct of the present invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single RNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide. Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/-), ρGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.

Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can also be used by the present invention. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pB V- IMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009/A ⁺ , pMTO10/A ⁺ , pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells. The nucleic acid constructs may also be engineered such that they are capable of homologous recombination in embryonic stem (ES) cells (See Example 1 of the Examples section, herein below). This is particularly useful for the generation of transgenic animals, or knock in animals (e.g. knock-in mice), as further described herein below. As mentioned, the nucleic acid constructs of the present invention are engineered for assaying cellular ADAR activity.

Thus, according to another aspect of the present invention, there is provided a method of assaying ADAR activity, the method comprising:

(a) introducing the nucleic acid construct of the invention into cells; and (b) analyzing an expression of the detectable expression product in the cells, whereby an expression of the detectable expression product is indicative of an activity of ADAR. The present inventors conceive that any cell type may be analyzed according to this aspect of the present invention provided it is capable of being transfected with the constructs of the present invention and provided it is in an environment suitable for detecting the detectable expression product. Thus, the cells may be isolated cells or non-isolated cells (i.e. comprised in tissues, organs or organisms); primary cells or cell lines; diseased cells or healthy cells; animal cells (e.g. human or mouse) or plant cells.

The preparation of transgenic mammals that express the constructs of the present invention requires introducing the nucleic acid constructs into an undifferentiated cell type. Thus according to one embodiment of this aspect of the present invention, the cell is an embryonic stem (ES) cell. The transformed ES cell is then injected into a mammalian embryo, where it will integrate into the developing embryo. The embryo is then implanted into a foster mother for the duration of gestation.

Embryonic stem cells are typically selected for their ability to integrate into and become part of the germ line of a developing embryo so as to create germ line transmission of the heterologous gene construct. Thus, any ES cell line that has this capability is suitable for use herein. One mouse strain that is typically used for production of ES cells is the 129 J strain. A preferred ES cell line is murine cell line D3 (American Type Culture Collection catalog no. CRL 1934). The cells are cultured and prepared for DNA insertion using methods well known in the art, such as those set forth by Robertson (Robertson, In: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed., IRL Press, Washington, D.C., 1987.).

Various methods can be used to introduce the expression vector of the present invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods. Introduction of nucleic acids by infection offers several advantages over the other listed methods. Higher efficiency can be obtained due to their infectious nature. Moreover, viruses are very specialized and typically infect and propagate in specific cell types. Thus, their natural specificity can be used to target the vectors to specific cell types in vivo or within a tissue or mixed culture of cells. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through receptor mediated events.

In addition, recombinant viral vectors are useful for in vivo expression of a desired nucleic acid because they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.

Currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems. Useful lipids for lipid- mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Choi [Tonkinson et al., Cancer Investigation, 14(1): 54-65 (1996)]. The most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses. A viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger. Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct. In addition, such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed. Preferably the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of the present invention. Optionally, the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof. Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.

Transformed cells are cultured under effective conditions, which allow for the expression of the detectable expression product. Effective in vitro culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit protein production. An effective medium refers to any medium in which a cell is cultured to produce the recombinant polypeptide of the present invention. Such a medium typically includes an aqueous solution having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins. Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.

Analysis of the detectable expression product expressed in the cells is dependent upon the type of detectable moiety comprised in the expression product and also upon the environment in which the cells are situated. Thus, for example an expression product may be analyzed using a fluorescent microscope if it comprises a fluorescent moiety, or a luminescent reader if it comprises a luminescent moiety.

Detectable expression products produced within a cell of a transgenic animal are capable of being imaged or detected by a variety of means well known in the art. Since the imaging, or measuring photon emission from the subject, may last up to tens of minutes, the subject is desirably immobilized during the imaging process. Imaging of the light-generating polypeptide moiety involves the use of, e.g., a photodetector capable of detecting extremely low levels of light—typically single photon events—and integrating photon emission until an image can be constructed. Examples of such sensitive photodetectors include devices that intensify the single photon events before the events are detected by a camera, and cameras (cooled, for example, with liquid nitrogen) that are capable of detecting single photons over the background noise inherent in a detection system.

Once a photon emission image is generated, it is typically superimposed on a

"normal" reflected light image of the subject to provide a frame of reference for the source of the emitted photons (i.e., localize the light-generating fusion proteins with respect to the subject). A "composite" image formed by the superimposition of the photon emission image on the reflected light image is then analyzed to determine the location and/or amount of a target in the subject.

The "photodetector device" used should have a high enough sensitivity to enable the imaging of faint light from within an animal in a reasonable amount of time, and to use the signal from such a device to construct an image.

In cases where it is possible to use detectable expression products which are extremely bright, and/or to detect expression products localized near the surface of the animal being imaged, a pair of "night-vision" goggles or a standard high-sensitivity video camera, such as a Silicon Intensified Tube (SIT) camera (e.g., from Hammamatsu

Photonic Systems, Bridgewater, N.J.), may be used. More typically, however, a more sensitive method of light detection is required.

In extremely low light levels the photon flux per unit area becomes so low that the scene being imaged no longer appears continuous. Instead, it is represented by individual photons which are both temporally and spatially distinct form one another.

Viewed on a monitor, such an image appears as scintillating points of light, each representing a single detected photon. By accumulating these detected photons in a digital image processor over time, an image can be acquired and constructed. In contrast to conventional cameras where the signal at each image point is assigned an intensity value, in photon counting imaging the amplitude of the signal carries no significance.

The objective is to simply detect the presence of a signal (photon) and to count the occurrence of the signal with respect to its position over time.

At least two types of photodetector devices, described below, can detect individual photons and generate a signal which can be analyzed by an image processor. Reduced-Noise Photodetection Devices achieve sensitivity by reducing the background noise in the photon detector, as opposed to amplifying the photon signal. Noise is reduced primarily by cooling the detector array. The devices include charge coupled device (CCD) cameras referred to as "backthinned", cooled CCD cameras. In the more sensitive instruments, the cooling is achieved using, for example, liquid nitrogen, which brings the temperature of the CCD array to approximately -120. degree. C. "Backthinned" refers to an ultra-thin backplate that reduces the path length that a photon 5 follows to be detected, thereby increasing the quantum efficiency. A particularly sensitive backthinned cryogenic CCD camera is the "TECH 512", a series 200 camera available from Photometries, Ltd. (Tucson, Ariz.).

"Photon amplification devices" amplify photons before they hit the detection screen. This class includes CCD cameras with intensifiers, such as microchannel

10 intensifiers. A microchannel intensifier typically contains a metal array of channels perpendicular to and co-extensive with the detection screen of the camera. The microchannel array is placed between the sample, subject, or animal to be imaged, and the camera. Most of the photons entering the channels of the array contact a side of a channel before exiting. A voltage applied across the array results in the release of many

15 electrons from each photon collision. The electrons from such a collision exit their channel of origin in a "shotgun" pattern, and are detected by the camera.

Other methods for detecting expression products in animals are described in detail in U.S. Patent No. 7,176,345, incorporated herein by reference.

As mentioned, alterations in RNA editing have now been linked to various 20 human diseases including inflammation, epilepsy, depression, amyotrophic lateral sclerosis and cancer.

Accordingly, the nucleic acid constructs of the present invention may be used to identify therapeutic agents for the treatment of such diseases.

Thus, according to another aspect of the present invention, there is provided a 25 method of identifying an agent capable of altering ADAR activity, the method comprising:

(a) expressing the nucleic acid construct of the present invention in a cell;.

(b) contacting the cell with the agent; and

(c) measuring a level of detectable expression product following (b) and optionally prior to 30 (b), wherein a change in expression of the detectable expression product is indicative of an agent capable of altering ADAR activity. Examples of agents that may be tested as potential ADAR altering agents according to the method of this aspect of the present invention include, but are not limited to, nucleic acids, e.g., polynucleotides, ribozymes, siRNA and antisense molecules (including without limitation RNA, DNA, RNA/DNA hybrids, peptide nucleic acids, and polynucleotide analogs having altered backbone and/or bass structures or other chemical modifications); proteins, polypeptides (e.g. peptides), carbohydrates, lipids and "small molecule" drug candidates. "Small molecules" can be, for example, naturally occurring compounds (e.g., compounds derived from plant extracts, microbial broths, and the like) or synthetic organic or organometallic compounds having molecular weights of less than about 10,000 daltons, preferably less than about 5,000 daltons, and most preferably less than about 1,500 daltons.

According to this aspect of the present invention, the agents are contacted with the cells for a period long enough to have an effect on ADAR. This time period is typically greater than three hours, e.g. 24 hours or 48 hours. It will be appreciated that the agent may be contacted with the cells either in vitro or in vivo (i.e. in the transgenic model).

It is expected that during the life of a patent maturing from this application many relevant detectable expression products will be developed and the scope of the term detectable expression product is intended to include all such new technologies a priori. Further, it is expected that during the life of a patent maturing from this application many relevant diseases will be identified that are linked to ADAR activity and the constructs of the present invention may be used in the analysis of such diseases and the search for therapeutic products for the treatment of such diseases. As used herein the term "about" refers to + 10 %. The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".

The term "consisting of means "including and limited to". The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure. As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof. As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion. Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific

American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", VoIs. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley- Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. L, ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

EXAMPLE 1

Measurement of A to I editing MATERIALS AND METHODS Construction of CFP-3'UTR HFE and YFP-3 UTR: The 3' UTR of the HFE gene was PCR amplified by using PFU DNA polymerase and primers (3 ¹ UTR HFE F: 5' GGAAGATCTTAAGGGACGTGGCTAGTCATAACCTT 3' (SEQ ID NO: 22) 3' UTR HFE R 5' CCCAAGCTTCAATGTCCCTAGAGTGAAGAAACACG 3' (SEQ ID

NO: 23) that introduced a 5' BgIII and 3' HindIII site. The PCR product was subcloned into pECFP-Cl or pEYFP-Cl (Clontech).

Construction of ROSA26 ERFP-3'UTR HFE: The 3' UTR of the HFE gene was PCR amplified by using PFU DNA polymerase and primers (3' UTR HFE F: 5' GGAAGATCTTAAGGGACGTGGCTAGTCATAACCTT 3' (SEQ ID NO: 22) 3' UTR HFE R 5' CCCAAGCTTCAATGTCCCTAGAGTGAAGAAACACG 3' (SEQ ID NO: 23) that introduced a 5' BgIII and 3' HindIII site. The PCR product was subcloned into pERFP-Cl (Clontech). pBigT contains two LoxP sites that flank a Neo expression cassette and a strong transcriptional stop sequence. After the second LoxP site, there is a multiple cloning site. All these elements are located between unique Pad and Ascl restriction sites. The Rosa-26 PA plasmid contains the Rosa-26 genomic sequence within which is inserted a linker that contains Pad and Ascl sites. In addition, this plasmid contains a diphtheria toxin cassette (PGK-DTA) 3' of the ROSA26 genomic DNA to facilitate selection against nonhomologous recombinants.

To make pBigT-3'UTR HFE-RFP plasmid, ERFP-3'UTR HFE plasmid was cut with Nhel and Apal. The liberated fluorescence cDNA was then ligated into pBig T that had been cut with the same enzymes. The Pacl-Ascl fragment from pBigT- fluorescence containing the floxed neomycin cassette and ERFP-3'UTR HFE cDNA were ligated into pRosa-26PA cut with the same enzymes to make the L-S-L ERFP-3'UTR HFE ROSA26 targeting construct.

Cell Culture Luciferase Assays: HEPG2 cells were transfected with 1 μg of either ERFP-3'UTR HFE or ERFP plasmids using Fugene transfection reagent according to the manufacturer's instructions. The next day, cells were split to 60-mm plates and allowed to recover for 6 hours before treatment INFα or γ (up to 20,000 u) Twenty-four to 72 hours later, the intensity of the fluorescence light was measured using flouresnce microscopy.

In another experiment, HEPG2 cells were co-transfected with 1 μg of either CFP-3'UTR HFE and 1-2 μg of either ADARl or ADAR2, both of which were placed under the control of a CMV promoter. Targeting of the Rosa-26 RFP-HFE-3'UTR in ES Cells: The ROSA26 ERFP-

3'UTR HFE targeting construct was linearized with Kpnl and electroporated into TCl embryonic stem (ES) cells (derived from 129SvEv strain) by using standard techniques. Two of 100 G418-resistant ES clones underwent successful homologous recombination, as determined by Southern blot with a 5' ROSA26 probe (External Probe), and were microinjected into C57/BL6 blastocysts. High-percentage chimeric mice were obtained and bred to FVB-EIIA-Cre mice.

Mice Genotyping: PCR of genomic DNA was performed with AmpliTaq Gold DNA (Applied Biosystems) according to the manufacturer's instruction with forward primer 5'-CGGTATCGTAGAGTCGAGGCC-S' (SEQ ID NO: 24) and reverse primer 5'-GAACAGGTAGCTTCCCAGTAGTGC (SEQ ID NO: 25) from the RFP gene.

Detecting ERFP Expression in Vivo: Intravital Confocal Laser Scanning Microscopy (CLSM) Imaging. All confocal analyses were carried out using an LSM 510 META (Zeiss, Jena, Germany) confocal laser scanning microscope with the following configurations: 25-mW krypton/ argon (488, 514, and 568 nm) and HeNe (633 nm) lasers, and a Ti-sapphire tunable pulse laser. To overcome the problem of high background fluorescence signals from an intact live mouse or an intact organ, spectral analysis was performed using a META detector. To isolate GFP fluorescence, lambda unmixing algorithm was used. Intravital imaging of live mice was carried out using the above CLSM system. Mice were anesthetized with isoflurane (2.5 % in oxygen), hair from the imaged area was removed using a depilatory cream, and the anesthetized mouse was placed on the microscope stage and kept anesthetized while being imaged. To avoid GFP signal reduction, frozen sections of different tissues were imaged unfixed using the META detector and the lambda unmixing algorithm. Image analysis of average fluorescence intensity per square micrometer was carried out using MICA image analysis software (Cy to view LTD, Petach Tikva, Israel). The statistical difference in average area intensity in the different mice groups was calculated either by Student's t test or by analysis of variance using Microsoft Excel software (Microsoft, Redmond, WA). RESULTS

In order to identify possible A-to-I RNA editing sites in HFE, expressed sequence tags (ESTs) were compared to the HFE genomic sequence using UCSC public data base (www.genomedotucscdotedu/indexdothtml). Sequence analysis revealed 7 A- to-I RNA editing sites in the 3' UTR of HFE. In addition the UCSC gene predictions indicated the presence of putative alternative splicing within the 3' UTR of the HFE gene. To verify these findings the 3' UTR of HFE from human hepatoma cell line (HepG2) was PCR amplified. Two RNA forms of HFE 3 ¹ UTR were detected; the full length form that is identical to the genomic sequence, and a shorter form in which a part of the sequence was removed (Figure 1). The full-length isoform was not edited whereas the short form underwent several editing events in six of the seven predicted A- to-I editing points. These results suggest that the HFE 3'UTR shortening is correlated with A-to-I editing of sites neighboring the splice sites. No canonical splice consensus sequences were identified.

In order to find if the sub-cellular localization of the long, non-edited transcript and the short form versions of HFE are affected by RNA editing, HepG2 cells were treated with IFNα, a known, inducer of the ADARl pi 50 editing mediating enzyme. Quantification of A-to-I RNA editing levels by direct sequencing and PCR analysis of the HFE 3 ¹ UTR long and the short forms in nuclear and cytosolic fractions revealed that both forms are found in the nucleus with and without editing induction by IFNα treatment. However the short form was evident in the cytoplasm only after IFNα treatment. To further explore the localization of the long and short HFE 3 ¹ UTR versions using a complementary, PCR-independent method, RNA FISH was performed on untreated and IFNα- treated HepG2 cells using two probes; a probe specific for the long form, derived from the spliced out sequence, and a probe that recognizes both the short and the long forms (Figures 2A-D). Image analyses of the RNA FISH indicated that the long form is present in the nucleus only, independently of IFNα treatments (Figures 2A, C). On the other hand, in cells treated with IFNα, short transcript expression was up- regulated and localized to the cytoplasm (Figure 2 B ₅ D). To further assess the effect of RNA editing on HFE expression, the full length HFE 3' UTR was cloned downstream to p YFP and pCFP reporter system, producing YFP-HFE-3'UTR and CFP-HFE-3'UTR mini-genes. These mini-genes were utilized to study the effect of IFNα treatments and RNA editing on the expression of HFE by documenting the expression patterns of CFP or YFP (Figures 3 A-F). In untreated cells with the CFP-HFE-3'UTR mini-gene, no fluorescence was observed (Fig 3A), whereas IFNα treatment yielded significant fluorescence in the CFP-HFE3'UTR transfected cells (Figure 3B). In the control CFP transfected cells, high levels of fluorescence were detected with or without IFNα treatment. In order to obtain further support to the role of RNA editing in this phenomenon the experiments were repeated using HepG2 ADARl knock down cells. As can be seen in Figures 3C and D, in ADARl knock down cells transfected with YFP-HFE3'UTR mini-gene no YFP fluorescence was detected even with IFNα treatment. In addition, ADARl over expression, without IFNα treatment, resulted in higher YFP fluorescence levels (Figures 3E,F) compared to mock transfected control. These findings indicate that the IFNg dependent HFE protein expression is regulated by ADARl mediated A-to-I RNA editing of the 3 'UTR of the HFE transcript.

In order to determine which of the editing sites is necessary for the regulation of the HFE expression, each one of the seven putative edited adenosines to guanosine sites were site-directed mutated in the CFP- HFE3'UTR mini-gene. HepG2 cells were transfected separately with each of the different mutated mini-genes and the fluorescence level was measured using confocal microscopy. As can be seen in Figure 4, when adenosines in editing sites number 3, 4 and 7 were mutated, increased levels of fluorescence could be detected even in cells which were not treated with IFN α, whereas the non-mutated CFP-3'UTR as well as the mini-genes mutated in editing sites 1, 2, 5 and 6 generated none, or very low fluorescence. It can be concluded that A-to-I editing of sites 3, 4 and 7 of the HFE-3'UTR is sufficient for the expression of the protein.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.