AMYLOID-BETA PROTEIN PRODUCTION

Field of the Invention

This invention relates to the field of mammalian neuronal cell disorders, and in particular, to methods for identifying effective compounds, and therapies and compositions using such compounds, useful for the prevention and treatment of diseases associated with progressive loss of intellectual capacities in humans.

Background of the invention

The neurological disorder that is most widely known for its progressive loss of intellectual capacities is Alzheimer's disease (AD). Worldwide, about 20 million people suffer from Alzheimer's disease. AD is clinically characterized by the initial loss of memory, followed by disorientation, impairment of judgment and reasoning, which is commonly referred to as cognitive impairment, and ultimately by mil dementia. AD patients finally lapse into a severely debilitated, immobile state between four and twelve years after onset of the disease.

The key pathological evidence for AD is the presence of extracellular amyloid plaques and intracellular taα tangles in the brain, which are associated with neuronal degeneration (Ritchie and Lovestone (2002)). The extracellular amyloid plaques are believed to result from an increase in the insoluble amyloid beta peptide 1-42 produced by the metabolism of amyloid-beta precursor protein (APP). Following secretion, these amyloid beta 1-42 peptides form amyloid fibrils more readily than the amyloid beta 1-40 peptides, which are predominantly produced in healthy people. It appears that the amyloid beta peptide is on top of the neurotoxic cascade: experiments show that amyloid beta fibrils, when injected into the brains of P301L tau transgenic mice, enhance the formation of neurofibrillary tangles (Gotz et al. (2001)). In fact, a variety of amyloid beta peptides have been identified as amyloid beta peptides 1-42, 1-40, 1-39, 1-38, 1-37, which can be found in plaques and are often seen in cerebral spinal fluid.

The amyloid beta peptides are generated (or processed) from the membrane anchored APP, after cleavage by beta secretase and gamma secretase at position 1 and 40 or 42, respectively (Figure l)(Annaert and De Strooper (2002)). In addition, high activity of beta secretase results in a shift of the cleavage at position 1 to position 11. Cleavage of amyloid- beta precursor protein by alpha secretase activity at position 17 and gamma secretase activity at 40 or 42 generates the non-pathological p3 peptide. Beta secretase was identified as the membrane anchored aspartyl protease BACE, while gamma secretase is a protein complex comprising presenilin 1 (PSl) or presenilin 2 (PS2), nicastrin, Anterior Pharynx Defective 1 (APHl) and Presenilin Enhancer 2 (PEN2). Of these proteins, the presenilins are widely thought to constitute the catalytic activity of the gamma secretase, while the other components play a role in the maturation and localization of the complex. The identity of the alpha secretase is still illustrious, although some results point towards the proteases ADAM 10 and TACE, which could have redundant Junctions.

A small fraction of AD cases (mostly early onset AD) are caused by autosomal dominant mutations in the genes encoding presenilin 1 and 2 (PSl; PS2) and the amyloid- beta precursor protein (APP), and it has been shown that mutations in APP, PSl and PS2 alter the metabolism of amyloid-beta precursor protein leading to such increased levels of amyloid beta 1-42 produced in the brain. Although no mutations in PSl, PS2 and amyloid- beta precursor protein have been identified hi late onset AD patients, the pathological characteristics are highly similar to the early onset AD patients. These increased levels of amyloid beta peptide could originate progressively with age from disturbed amyloid-beta precursor protein processing (e.g. high cholesterol levels enhance amyloid beta peptide production) or from decreased amyloid beta peptide catabolism. Therefore, it is generally accepted that AD in late onset AD patients is also caused by aberrant increased amyloid peptide levels in the brains. The level of these amyloid beta peptides, and more particularly amyloid-beta peptide 1-42, is increased in Alzheimer patients compared to the levels of these peptides in healthy persons. Thus, reducing the levels of these amyloid beta peptides is likely to be beneficial for patients with cognitive impairment.

Reported Developments

The major current AD therapies are limited to delaying progressive memory loss by inhibiting the acetylcholinesterase enzyme, which increases acetylcholine neurotransmitter levels, which fall because the cholinergic neurons are the first neurons to degenerate during AD. This therapy does not halt the progression of the disease. Therapies aimed at decreasing the levels of amyloid beta peptides in the brain, are increasingly being investigated and focus on the perturbed amyloid-beta precursor protein processing involving the beta- or gamma secretase enzymes.

The present invention is based on the discovery that certain known polypeptides are factors in the up-regulation and/or induction of amyloid beta precursor processing in neuronal cells, and that the inhibition of the function of such polypeptides are effective in reducing levels of amyloid beta peptides.

Summary of the Invention

The present invention relates to the relationship between the function of melanocortin receptors and amyloid-beta precursor protein processing in mammalian cells. The invention in particular relates to decreasing the expression and/or activity of the G-protein coupled melanocortin receptors, in particular the melanocortin 3 and 4 receptors (MC3R and MC4R).

One aspect of the present invention is a method for identifying a compound that inhibits the processing of amyloid-beta precursor protein in a mammalian cell, comprising

(a) contacting a compound with a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3 or 4; and

(b) measuring a compound-polypeptide property related to the production of amyloid-beta peptide.

Aspects of the present method include the in vitro assay of compounds using melanocortin receptors and/or polypeptide domains thereof, and cellular assays wherein inhibition is followed by observing indicators of efficacy, including second messenger levels and/or amyloid beta peptide levels.

Another aspect of the invention is a method of treatment or prevention of a condition involving cognitive impairment, or a susceptibility to the condition, of a subject suffering or susceptible thereto, by administering a pharmaceutical composition comprising an effective amyloid-beta precursor processing-inhibiting amount of a melanocortin receptor antagonist or inverse agonist.

A further aspect of the present invention is a pharmaceutical composition for use in said method wherein said inhibitor comprises a polynucleotide selected from the group of an antisense polynucleotide, a ribozyme, and a small interfering RNA (siRNA), wherein said inhibitor comprises a nucleic acid sequence complementary to, or engineered from, a naturally occurring polynucleotide sequence encoding a polypeptide, comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3 or 4, or a fragment thereof.

Another further aspect of the present invention is a pharmaceutical composition comprising a therapeutically effective amyloid-beta precursor processing-inhibiting amount of a melanocortin receptor antagonist or inverse agonist or its pharmaceutically acceptable salt, hydrate, solvate, or prodrug thereof in admixture with a pharmaceutically acceptable carrier. The present polynucleotides and compounds are also useful for the manufacturing of a medicament for the treatment of Alzheimer's disease.

Brief Description of the Drawings

Figure 1: APP processing: The membrane anchored amyloid precursor protein (APP) is processed by two pathways: the amyloidogenic and non amyloidogenic pathway. In the latter pathway, APP is cleaved first by alpha secretase and then by gamma secretase, yielding the p3 peptides (17-40 or 17-42). The amyloidogenic pathway generates the pathogenic amyloid beta peptides (A beta) after cleavage by beta- and gamma-secretase respectively. The numbers depicted are the positions of the amino acids comprising the A beta sequences.

Figure 2: Evaluation of the APP processing assay: Positive (PS1G384L; PS1L392V and BACEl) and negative (eGFP, LacZ and empty) control viruses are infected in Hek293APPwt at random MOI, mimicking a screening. A and B: Transduction is performed respectively with 1 and 0.2 μl of virus and amyloid beta 1-42 levels are performed. Data are represented as relative light units and correlate to pM of amyloid beta 1-42.

Figure 3: Involvement of MC4R in APP processing. HEK293 APPwt cells are transduced with Ad5/MC4R and with negative control viruses (Ad5/emρty, Ad5/eGFP and Ad5/luciferase) at different MOIs (2, 10, 50, 250). Resulting amyloid beta 1-42, 1- 40, peptides were measured with the appropriate ELISA's. Data are represented in pM or as relative light units (rlu), which correlates to pM of amyloid beta.

Figure 4: Agonist antagonist experiment MC4R. HEK293 APPwt cells are transduced with Ad5/MC4R and with Ad5/Empty (negative control). 24 h after infections the medium is replaced with medium containing ligands in increasing concentrations. After 24 h amyloid beta peptide 1-42 is determined with a specific ELISA. Data are presented in pM amyloid beta secreted.

Figure 5: ClustalW protein sequence alignment of MC4R and MC3R.

Figure 6: Validation of MC4R by assessing amyloid beta production when cells are challenged with MC4R specific agonists and antagonists.

Figure 7: Stimulation of isolated mouse primary neurons with the MC4R agonist MTU results in increased amyloid beta 1-42 levels.

Detailed Description

The following terms are intended to nave the meanings presented therewith below and are useful in understanding the description of and intended scope of the present invention.

Definitions:

The term "agonist" refers to a ligand that activates the intracellular response of the receptor to which the agonist binds.

The term "amyloid beta peptide" means amyloid beta peptides processed from the amyloid beta precursor protein (APP). The most common peptides include amyloid beta peptides 1-40, 1-42, 11-40 and 11-42. Other species less prevalent amyloid beta peptides are •''' described as y-42, whereby y ranges from 2-17, and 1-x whereby x ranges from 24-39 and 41.

The term "antagonist" means a moiety that binds competitively to the receptor at the same site as the agonists but which do not activate the intracellular response initiated by the active form of the receptor, and can thereby inhibit the intracellular response by agonists. Antagonists do not diminish the baseline intracellular response in the absence of an agonist or partial agonist.

The term "carrier" means a non-toxic material used in the formulation of pharmaceutical compositions to provide a medium, bulk and/or useable form to a pharmaceutical composition. A carrier may comprise one or more of such materials such as an excipient, stabilizer, or an aqueous pH buffered solution. Examples of physiologically acceptable carriers include aqueous or solid buffer ingredients including phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counter ions such as sodium; and/or nonionic surfactants such as TWEEN.TM., polyethylene glycol (PEG), and PLURONICS.TM.

The term "compound" is used herein in the context of a "test compound" or a "drug candidate compound" described in connection with the assays of the present invention. As such, these compounds comprise organic or inorganic compounds, derived synthetically or from natural sources. The compounds include inorganic or organic compounds such as polynucleotides, lipids or hormone analogs that are characterized by relatively low molecular weights. Other biopolymeric organic test compounds include peptides comprising from about 2 to about 40 amino acids and larger polypeptides comprising from about 40 to about 500 amino acids, such as antibodies or antibody conjugates.

The term "constitutive receptor activation" means stabilization of a receptor in the active state by means other than binding of the receptor with its endogenous ligand or a chemical equivalent thereof.

The term "contact" or "contacting" means bringing at least two moieties together, whether in an in vitro system or an in vivo system.

The term "condition" or "disease" means the overt presentation of symptoms (i.e., illness) or the manifestation of abnormal clinical indicators (e.g., biochemical indicators), resulting from defects in one amyloid beta protein precursor processing. Alternatively, the term "disease" refers to a genetic or environmental risk of or propensity for developing such symptoms or abnormal clinical indicators.

The term "endogenous" shall mean a material that a mammal naturally produces. Endogenous in reference to, for example and not limitation, the term "receptor" shall mean that which is naturally produced by a mammal (for example, and not limitation, a human) or a virus. In contrast, the term non-endogenous in this context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human) or a virus. For example, and not limitation, a receptor which is not constitutively active in its endogenous form, but when manipulated becomes constitutively active, is most preferably referred to herein as a "non-endogenous, constitutively activated receptor." Both terms can be utilized to describe both "in vivo" and "in vitro" systems. For example, and not a limitation, in a screening approach, the endogenous or non-endogenous receptor may be in reference to an in vitro screening system. As a further example and not limitation, where the genome of a mammal has been manipulated to include a non-endogenous constitutively activated receptor, screening of a candidate compound by means of an in vivo system is viable.

The term "expression" comprises both endogenous expression and overexpression by transduction.

The term "expressible nucleic acid" means a nucleic acid coding for a proteinaceous molecule, an RNA molecule, or a DNA molecule.

The term "hybridization" means any process by which a strand of nucleic acid binds with a complementary strand through base pairing. The term "hybridization complex" refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary bases. A hybridization complex may be formed in solution (e.g., C.sub.Ot or R.sub.0t analysis) or formed between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g., paper, membranes, filters, chips, pins or glass slides, or any other appropriate substrate to which cells or their nucleic acids have been fixed). The term "stringent conditions" refers to conditions that permit hybridization between polynucleotides and the claimed polynucleotides. Stringent conditions can be defined by salt concentration, the concentration of organic solvent, e.g., formamide, temperature, and other conditions well known in the art. Ih particular, reducing the concentration of salt, increasing the concentration of formamide, or raising the hybridization temperature can increase stringency.

The term "inhibit" or "inhibiting", hi relationship to the term "response" means that a response is decreased or prevented in the presence of a compound as opposed to hi the absence of the compound.

The term "inverse agonist" means a moiety that binds the endogenous form of the receptor, and which inhibits the baseline intracellular response initiated by the active endogenous form of the receptor below the normal base level of activity that is observed in the absence of the endogenous ligand, or agonist. Preferably, the baseline intracellular response is decreased in the presence of the inverse agonist by at least 30%, more preferably at least 50%, and most preferably by at least 75%, as compared with the baseline response in the absence of the inverse agonist. The term "ligand" means an endogenous, naturally occurring molecule specific for an endogenous, naturally occurring receptor.

The term "pharmaceutically acceptable prodrugs" as used herein means the prodrugs of the compounds useful in the present invention, which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of patients with undue toxicity, irritation, allergic response commensurate with a reasonable benefit/risk ratio, and effective for their intended use of the compounds of the invention. The term "prodrug" means a compound that is transformed in vivo to yield an effective compound useful in the present invention or a pharmaceutically acceptable salt, hydrate or solvate thereof. The transformation may occur by various mechanisms, such as through hydrolysis in blood. The compounds bearing metabolically cleavable groups have the advantage that they may exhibit improved bioavailability as a result of enhanced solubility and/or rate of absorption conferred upon the parent compound by virtue of the presence of the metabolically cleavable group, thus, such compounds act as pro-drugs. A thorough discussion is provided in Design of Prodrugs, H. Bundgaard, ed., Elsevier (1985); Methods in Enzymology; K. Widder et al, Ed., Academic Press, 42, 309-396 (1985); A Textbook of Drug Design and Development, Krogsgaard-Larsen and H. Bandaged, ed., Chapter 5; "Design and Applications of Prodrugs" 113-191 (1991); Advanced Drug Delivery Reviews, H. Bundgard, 8 , 1-38, (1992); J. Pharm. Sci., 77,285 (1988); Chem. Pharm. Bull., N. Nakeya et al, 32, 692 (1984); Pro-drugs as Novel Delivery Systems, T. Higuchi and V. Stella, 14 A.C.S. Symposium Series, and Bioreversible Carriers in Drug Design, E.B. Roche, ed., American Pharmaceutical Association and Pergamon Press, 1987, which are incorporated herein by reference. An example of the prodrugs is an ester prodrug. "Ester prodrug" means a compound that is convertible in vivo by metabolic means (e.g., by hydrolysis) to an inhibitor compound according to the present invention. For example an ester prodrug of a compound containing a carboxy group may be convertible by hydrolysis in vivo to the corresponding carboxy group.

The term "pharmaceutically acceptable salts" refers to the non-toxic, inorganic and organic acid addition salts, and base addition salts, of compounds of the present invention. These salts can be prepared in situ during the final isolation and purification of compounds useful in the present invention.

The term "polynucleotide" means a polynucleic acid, in single or double stranded form, and in the sense or antisense orientation, complementary polynucleic acids that hybridize to a particular polynucleic acid under stringent conditions, and polynucleotides that are homologous in at least about 60 percent of its base pairs, and more preferably 70 percent of its base pairs are in common, most preferably 90 per cent, and in a special embodiment 100 percent of its base pairs. The polynucleotides include polyribonucleic acids, polydeoxyribonucleic acids, and synthetic analogues thereof. The polynucleotides are described by sequences that vary in length, that range from about 10 to about 5000 bases, preferably about 100 to about 4000 bases, more preferably about 250 to about 2500 bases. A preferred polynucleotide embodiment comprises from about 10 to about 30 bases in length. A special embodiment of polynucleotide is the polyribonucleotide of from about 10 to about 22 nucleotides, more commonly described as small interfering RNAs (siRNAs). Another special embodiment are nucleic acids with modified backbones such as peptide nucleic acid (PNA), polysiloxane, and 2'-0-(2-methoxy)ethylphosphorothioate, or including non-naturally occurring nucleic acid residues, or one or more nucleic acid substituents, such as methyl-, thio-, sulphate, benzoyl-, phenyl-, amino-, propyl-, chloro-, and methanocarbanucleosides, or a reporter molecule to facilitate its detection.

The term "polypeptide" relates to proteins, proteinaceous molecules, fractions of proteins, peptides and oligopeptides.

The term "solvate" means a physical association of a compound useful in this invention with one or more solvent molecules. This physical association includes hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. "Solvate" encompasses both solution-phase and isolable solvates. Representative solvates include hydrates, ethanolates and methanolates.

The term "subject" includes humans and other mammals.

The term "effective amount" or "therapeutically effective amount" means that amount of a compound or agent that will elicit the biological or medical response of a subject that is being sought by a medical doctor or other clinician. In particular, with regard to treating an neuronal disorder, the term "effective amount " is intended to mean that effective amyloid- beta precursor processing inhibiting amount of an compound or agent that will bring about a biologically meaningful decrease in the levels of amyloid beta peptide in the subject's brain tissue. The term "treating" means an intervention performed with the intention of preventing the development or altering the pathology of, and thereby alleviating a disorder, disease or condition, including one or more symptoms of such disorder or condition. Accordingly, "treating" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treating include those already with the disorder as well as those in which the disorder is to be prevented. The related term "treatment," as used herein, refers to the act of treating a disorder, symptom, disease or condition, as the term "treating" is defined above.

Background of the melanocortin receptors

In 1993, Gantz et al. (1993) cloned the human melanocortin 4 receptor (MC4R). Together with MCl, MC2, MC3 and MC5, the MC4 receptor forms the family of the melanocortin receptors. All melanocortin receptor subtypes are coded on a single exon. These receptors all belong to the class of the G protein-coupled receptors. All melanocortin receptors couple to the Gs class of G-proteins and elevate intracellular cAMP levels. Ih contrast to the MCl, -2 and -5 receptors the MC3 and -4 receptors are exclusively expressed in the Central Nervous System (CNS), whereas the other 3 receptors are expressed only in the periphery. The MC4R is widely expressed in the CNS, although concentrated expression is seen in the hypothalamus and brainstem. Disruption or antagonism of this receptor causes an obesity syndrome characterized by moderate hyperphagia and obesity, mild hyperinsulinemia, increased linear growth, but otherwise relatively normal neuroendocrine functions. This receptor is clearly important in coordinating energy expenditure with energy intake in response to both short term and long-term peripheral metabolic signals; haploinsufficiency of the MC4R is responsible for at least 5% of severe human obesity.

The melanocortin peptides are processed from three different regions of POMC, each of which contains a conserved sequence, -His-Phe-Arg-Trp-, that serves as the pharmacophore for melanocortin receptor activation. Peptides derived from the amino terminus of POMC are called γ-MSH (γ-Melanocyte stimulating hormone) peptides. Adrenocorticotropic hormone (ACTH) and α-MSH are overlapping peptides cleaved from the middle portion and consist of amino acids 1-39 and 1-13 of this middle region, respectively. β-MSH, β-LPH (β-lipotropin) and γ-LPH all derive from the carboxy-terminal portion of the POMC precursor. A curious feature of the melanocortin receptors is the existence of a family of endogenous antagonists, the agouti proteins. Agouti is a 131 amino acid peptide made by dermal follicular cells that acts as a specific high affinity antagonist of the MClR. Agouti related protein (AGRP), a homologue made in the arcuate nucleus of the hypothalamus and the adrenal gland, is an antagonist of the central MC3R and MC4R (Ollmann et al. 1997).

This invention relates to the targeting of the melanocortin 3 and 4 receptors (MC3R and MC4R) and to the knock-down of these receptors, which typically results in a reduction of amyloid beta 1-42 levels in the conditioned medium of transduced cells.

Compounds that reduce or inhibit the activity of MC3R and/or MC4R have never been associated with treatment or prevention of a pathological condition involving cognitive impairment, such as AD. The present invention clearly indicates that reduction of expression or reduction of activity of these receptors, in particular MC4R, is related to the reduction of the amyloid-beta peptide level.

Ih addition, the presence of MC3R and MC4R in the central nervous system renders these GPCRs as putative drug targets for the (prophylactic) treatment and/or the diagnosis of Alzheimer's disease (AD).

As noted above, the present invention is based on the present inventors' discovery that melanocortin receptors are factors in the up-regulation and/or induction of amyloid beta precursor processing in mammalian, and principally, neuronal cells, and that the inhibition of the function of such polypeptides is effective in reducing levels of amyloid beta protein peptides.

As discussed in more detail in the Experimental section below, the present inventors demonstrate that the overexpression of MC4R increases, and the knockdown of MC4R reduces amyloid beta 1-42 in the conditioned medium of transduced cells. The present invention is based on these findings and the recognition that the melanocortin receptors may be putative drug targets for Alzheimer's disease.

One aspect of the present invention is a method for identifying a compound that inhibits the processing of amyloid-beta precursor protein in a mammalian cell, and may therefore be useful in reducing amyloid beta peptide levels in a subject. The present method comprises contacting a drug candidate compound with a melanocortin receptor polypeptide, or a fragment of said polypeptide, and measuring a compound-polypeptide property related to the production of amyloid-beta protein. The "compound-polypeptide property" is a measurable phenomenon chosen by the person of ordinary skill in the art, and based on the recognition that melanocortin receptor activation and deactivation is a causative factor in the activation and deactivation, respectively, of amyloid beta protein precursor processing, and an increase and decrease, respectively, of amyloid beta peptide levels. The measurable property may range from the binding affinity for a peptide domain of the melanocortin receptor polypeptide, to the level of any one of a number of "second messenger" levels resulting from the activation or deactivation of the melanocortin receptor, to a reporter molecule property directly linked to the aforesaid second messenger, and finally to the level of amyloid beta peptide secreted by the mammalian cell contacted with the compound.

Depending on the choice of the skilled artisan, the present assay method may be designed to function as a series of measurements, each of which is designed to determine whether the drug candidate compound is indeed acting on the melanocortin receptor to amyloid beta peptide pathway. For example, an assay designed to determine the binding affinity of a compound to melanocortin receptor, or fragment thereof, may be necessary, but not sufficient, to ascertain whether the test compound would be useful for reducing amyloid beta peptide levels when administered to a subject. Nonetheless, such binding information would be useful in identifying a set of test compounds for use in an assay that would measure a different property, further down the biochemical pathway. Such second assay may be designed to confirm that the test compound, having binding affinity for a melanocortin receptor peptide, actually down-regulates or inhibits, as an antagonist or inverse agonist, melanocortin receptor function in a mammalian cell. This further assay may measure a second messenger that is a direct consequence of the activation or deactivation of the receptor, or a synthetic reporter system responding thereto. Measuring a different second messenger, and/or confirming that the assay system itself is not being affected directly in contrast to the melanocortin receptor pathway may further validate the assay. In this latter regard, suitable controls should always be in place to insure against false positive readings.

The order of taking these measurements is not believed to be critical to the practice of the present invention, which may be practiced in any order. For example, one may first perform a screening assay of a set of compounds for which no information is known respecting the compounds' binding affinity for melanocortin receptors. Alternatively, one may screen a set of compounds identified as having binding affinity for a melanocortin receptor peptide domain, or a class of compounds identified as being an agonist or inverse agonist of a melanocortin receptor. However, for the present assay to be meaningful to the ultimate use of the drug candidate compounds, a measurement of the second messenger(s), or the ultimate amyloid beta peptide levels, is necessary. Validation studies including controls, and measurements of binding affinity to melanocortin are nonetheless useful in identifying a compound useful in any therapeutic or diagnostic application.

The present assay method may be practiced in vitro, using one or more of the melanocortin receptor proteins, or fragments thereof. The amino acid sequences of the melanocortin receptors are found in SEQ ID NO: 3 and 4. The binding affinity of the compound with the polypeptide can be measured by methods known in the art, such as using surface plasmon resonance biosensors (Biacore), by saturation binding analysis with a labeled compound (e.g. Scatchard and Lindmo analysis), by differential UV spectrophotometer, fluorescence polarization assay, Fluorometric Imaging Plate Reader (FLIPR®) system, Fluorescence resonance energy transfer, andBioluminescence resonance energy transfer. The binding affinity of compounds can also be expressed in dissociation constant (Kd) or as IC50 or EC50. The IC50 represents the concentration of a compound that is required for 50% inhibition of binding of another ligand to the polypeptide. The EC50 represents the concentration required for obtaining 50% of the maximum effect in any assay that measures receptor function. The dissociation constant, Kd, is a measure of how well a ligand binds to the polypeptide, it is equivalent to the ligand concentration required to saturate exactly half of the binding-sites on the polypeptide. Compounds with a high affinity binding have low Kd, IC50 and EC50 values, i.e. in the range of 100 nM to 1 pM; a moderate to low affinity binding relates to a high Kd, IC50 and EC50 values, i.e. in the micromolar range.

The present assay method may also be practiced in a cellular assay, A host cell expressing a melanocortin receptor can be a cell with endogenous expression or a cell over- expressing the melanocortin receptor e.g. by transduction. When the endogenous expression of the polypeptide is not sufficient to determine a baseline that can easily be measured, one may use using host cells that over-express melanocortin receptors. Over-expression has the advantage that the level of the second messenger substrate is higher than the activity level by endogenous expression. Accordingly, measuring such levels using presently available techniques is easier. In such cellular assay, the biological activity of the melanocortin receptor may be measured may be measured using a second messenger, such as cyclic AMP or Ca2+, cyclic GMP, inositol triphosphate (IP3) and/or diacylglycerol (DAG). Cyclic AMP or Ca2+ are preferred second messengers to measure. Second messenger activation may be measured by several different techniques, either directly by ELISA or radioactive technologies or indirectly by reporter gene analysis, discussed below. Preferably the method further comprises contacting the host cell with an agonist for a melanocortin receptor before determining the baseline level. The addition of an agonist further stimulates the melanocortin receptor, thereby further increasing the activity level of the second messenger. Several such agonists (ligands) are known in the art, such as, but not limited to, alpha-MSH, beta-MSH, gamma-MSH, beta-LPH, gamma-LPH, ACTH, Ro 27-3225 and MTH. Preferred agonists are Ro273225, MTU and alpha-MSH. The melanocortin receptor polypeptides, when overexpressed or activated increase the level of secreted amyloid beta peptides.

The present invention further relates to a method for identifying a compound that inhibits amyloid-beta precursor protein processing in a mammalian cell comprising:

(a) contacting a compound with a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3 or 4,

(b) determining the binding affinity of the compound to the polypeptide,

(c) contacting a population of mammalian cells expressing said polypeptide with the compound that exhibits a binding affinity of at least 10 micromolar, and

(d) identifying the compound that inhibits the amyloid-beta precursor protein processing in the cells.

A further embodiment of the present invention relates a method to identify a compound that inhibits the amyloid-beta precursor protein processing in a cell, wherein the activity level of the melanocortin receptor polypeptide is measured by determining the level of one or more second messengers, wherein the level of the one or second messenger is determined with a reporter controlled by a promoter, which is responsive to the second messenger. The reporter is a reporter gene under the regulation of a promoter that responds to the cellular level of second messengers. Such preferred second messengers are Cyclic AMP or Ca2+. The reporter gene should have a gene product that is easily detected, and that may be stably infected in the host cell. Such methods are well known by any person with ordinary skill in the art.

The reporter gene may be selected from alkaline phosphatase, green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), destabilized green fluorescent protein (dGFP), luciferase, beta-galactosidase among others. The reporter is preferably luciferase or beta-galactosidase, which are readily available and easy to measure over a large range The promoter in the reporter construct is preferably a cyclic AMP-responsive promoter, an NF-KB responsive promoter, or a NF-AT responsive promoter. The cyclic- AMP responsive promoter is responsive to the cyclic- AMP levels in the cell. The NF-AT responsive promoter is sensitive to cytoplasmic Ca2+-levels in the cell. The NF-KB responsive promoter is sensitive for activated NF-κB levels in the cell.

A further embodiment of the present invention relates a method to identify a compound that inhibits the amyloid-beta precursor protein processing in a cell, wherein the activity level of the melanocortin receptor polypeptide is measured by determining the level of amyloid beta peptides. The levels of these peptides may be measured with specific ELISAs using antibodies specifically recognizing the different amyloid beta peptide species (see e.g. Example 1). Secretion of the various amyloid beta peptides may also be measured using antibodies that bind all peptides. Levels of amyloid beta peptides can also be measured by Mass spectrometry analysis.

For high-throughput purposes, libraries of compounds may be used such as antibody fragment libraries, peptide phage display libraries, peptide libraries (e.g. LOP AP™, Sigma Aldrich), lipid libraries (BioMol), synthetic compound libraries (e.g. LOP AC™, Sigma Aldrich) or natural compound libraries (Specs, TimTec).

Preferred drug candidate compounds are low molecular weight compounds. Low molecular weight compounds, i.e. with a molecular weight of 500 Dalton or less, are likely to have good absorption and permeation in biological systems and are consequently more likely to be successful drug candidates than compounds with a molecular weight above 500 Dalton (Lipinski et al. (1997)). Peptides comprise another preferred class of drug candidate compounds, since peptides are known GPCRs antagonists. Peptides may be excellent drug candidates and there are multiple examples of commercially valuable peptides such as fertility hormones and platelet aggregation inhibitors. Natural compounds are another preferred class of drug candidate compound. Such compounds are found in and extracted from natural sources, and which may thereafter be synthesized. The lipids are another preferred class of drug candidate compound. Lipids may be antagonists of the melanocortin receptors listed in Table 1 (SEQ ID NO: 3 or 4).

Another preferred class of drug candidate compounds is an antibody. The present invention also provides antibodies directed against the extracellular domains of the melanocortin receptors. These antibodies should specifically bind to one or more of the extra-cellular domains of the melanocortin receptors, or as described further below, engineered to be endogenously produced to bind to the intra-cellular melanocortin receptor domain. These antibodies may be monoclonal antibodies or polyclonal antibodies. The present invention includes chimeric, single chain, and humanized antibodies, as well as FAb fragments and the products of a FAb expression library, and Fv fragments and the products of an Fv expression library.

In certain embodiments, polyclonal antibodies may be used in the practice of the invention. The skilled artisan knows methods of preparing polyclonal antibodies. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. Antibodies may also be generated against the intact melanocortin receptor protein or polypeptide, or against a fragment such as its extracellular domain peptides, derivatives including conjugates, or other epitope of the melanocortin receptor protein or polypeptide, such as the melanocortin receptors embedded in a cellular membrane, or a library of antibody variable regions, such as a phage display library.

It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants that may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). One skilled in the art without undue experimentation may select the immunization protocol.

In some embodiments, the antibodies may be monoclonal antibodies. Monoclonal antibodies may be prepared using methods known in the art. The monoclonal antibodies of the present invention may be "humanized" to prevent the host from mounting an immune response to the antibodies. A "humanized antibody" is one in which the complementarity determining regions (CDRs) and/or other portions of the light and/or heavy variable domain framework are derived from a non-human immunoglobulin, but the remaining portions of the molecule are derived from one or more human immunoglobulins. Humanized antibodies also include antibodies characterized by a humanized heavy chain associated with a donor or acceptor unmodified light chain or a chimeric light chain, or vice versa. The humanization of antibodies may be accomplished by methods known in the art (see, e.g. Mark and Padlan, (1994) "Chapter 4. Humanization of Monoclonal Antibodies", The Handbook of Experimental Pharmacology Vol. 113, Springer- Verlag, New York). Transgenic animals may be used to express humanized antibodies.

Human antibodies can also be produced using various techniques known in the art, including phage display libraries (Hoogenboom and Winter, (1991) J. MoI. BioL 227:381- 8; Marks et al. (1991). J. MoI. Biol. 222:581-97). The techniques of Cole, et al. and Boerner, et al. are also available for the preparation of human monoclonal antibodies (Cole, et al. (1985) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77; Boerner, et al (1991). J. Immunol., 147(l):86-95).

Techniques known in the art for the production of single chain antibodies can be adapted to produce single chain antibodies to the melanocortin receptor polypeptides and proteins of the present invention. The antibodies may be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain cross-linking. Alternatively; the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent cross-linking.

Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens and preferably for a cell-surface protein or receptor or receptor subunit. In the present case, one of the binding specificities is for one extracellular domain of the melanocortin receptor, the other one is for another extracellular domain of the same or different melanocortin receptor.

Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities (Milstein and Cuello, (1983) Nature 305:537-9). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. Affinity chromatography steps usually accomplish the purification of the correct molecule. Similar procedures are disclosed in Trauneeker, et al. (199I) EMBO J. 10:3655-9. According to another preferred embodiment, the assay method comprise using a drag candidate compound identified as having a binding affinity for the melanocortin receptors, and/or has already been identified as having down-regulating activity such as antagonist or inverse agonist activity vis-a-vis one or more melanocortin receptors. Examples of such compounds are the compounds that are described in US patents 6,699,873 and 6,693,165 hereby incorporated by reference with respect to the compounds disclosed herein. It is preferred that the compounds are able to pass the blood-brain barrier.

Another aspect of the present invention relates to a method for reducing amyloid-beta precursor protein processing in a mammalian cell, comprising by contacting said cell with an expression-inhibiting agent that inhibits the translation in the cell of a polyribonucleotide encoding a melanocortin receptor polypeptide (SEQ ID No: 3 or 4). A particular embodiment relates to a composition comprising a polynucleotide including at least one antisense strand that functions to pair the agent with the target melanocortin receptor mRNA, and thereby down-regulates or blocks the expression of melanocortin receptor polypeptide. The inhibitory agent preferably comprises antisense polynucleotide, a ribozyme, and a small interfering RNA (siRNA), wherein said agent comprises a nucleic acid sequence complementary to, or engineered from, a naturally occurring polynucleotide sequence encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3 or 4.

A special embodiment of the present invention relates to a method wherein the expression-inhibiting agent is selected from the group consisting of antisense RNA, antisense oligodeoxynucleotide (ODN), a ribozyme that cleaves the polyribonucleotide coding for SEQ ID NO: 3 or 4, a small interfering RNA (siRNA) that is sufficiently homologous to a portion of the polyribonucleotide corresponding to SEQ ID NO: 3 or 4 such that the siRNA interferes with the translation of the melanocortin receptor polyribonucleotide to the melanocortin receptor polypeptide.

Another embodiment of the present invention relates to a method wherein the expression-inhibiting agent is a nucleic acid expressing the antisense RNA, antisense oligodeoxynucleotide (ODN), a ribozyme that cleaves the polyribonucleotide coding for SEQ ID NO: 3 or 4, a small interfering RNA (siRNA) that is sufficiently homologous to a portion of the polyribonucleotide corresponding to SEQ ED NO: 3 or 4 such that the siRNA interferes with the translation of the melanocortin receptor polyribonucleotide to the melanocortin receptor polypeptide. Preferably the expression-inhibiting agent is an antisense RNA, ribozyme, antisense oligodeoxynucleotide, or siRNA comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 5-170.

The down regulation of gene expression using antisense nucleic acids can be achieved at the translational or transcriptional level. Antisense nucleic acids of the invention are preferably nucleic acid fragments capable of specifically hybridizing with all or part of a nucleic acid encoding a melanocortin receptor polypeptide or the corresponding messenger RNA. In addition, antisense nucleic acids may be designed which decrease expression of the nucleic acid sequence capable of encoding a melanocortin receptor polypeptide by inhibiting splicing of its primary transcript. Any length of antisense sequence is suitable for practice of the invention so long as it is capable of down-regulating or blocking expression of a nucleic acid coding for a melanocortin receptor. Preferably, the antisense sequence is at least about 17 nucleotides in length. The preparation and use of antisense nucleic acids, DNA encoding antisense RNAs and the use of oligo and genetic antisense is known in the art.

One embodiment of expression-inhibitory agent is a nucleic acid that is antisense to a nucleic acid comprising SEQ ID NO: 1 or 2. For example, an antisense nucleic acid (e.g. DNA) may be introduced into cells in vitro, or administered to a subject in vivo, as gene therapy to inhibit cellular expression of nucleic acids comprising SEQ ID NO: 1 or 2. Antisense oligonucleotides preferably comprise a sequence containing from about 17 to about 100 nucleotides and more preferably the antisense oligonucleotides comprise from about 18 to about 30 nucleotides. Antisense nucleic acids may be prepared from about 10 to about 30 contiguous nucleotides selected from the sequences of SEQ ID NO: 1 or 2, expressed in the opposite orientation.

The antisense nucleic acids are preferably oligonucleotides and may consist entirely of deoxyribo-nucleotides, modified deoxyribonucleotides, or some combination of both. The antisense nucleic acids can be synthetic oligonucleotides. The oligonucleotides may be chemically modified, if desired, to improve stability and/or selectivity. Since oligonucleotides are susceptible to degradation by intracellular nucleases, the modifications can include, for example, the use of a sulfur group to replace the free oxygen of the phosphodiester bond. This modification is called a phosphorothioate linkage. Phosphorothioate antisense oligonucleotides are water soluble, polyanionic, and resistant to endogenous nucleases. In addition, when a phosphorothioate antisense oligonucleotide hybridizes to its target site, the RNA-DNA duplex activates the endogenous enzyme ribonuclease (RNase) H, which cleaves the mRNA component of the hybrid molecule. In addition, antisense oligonucleotides with phosphoramidite and polyamide (peptide) linkages can be synthesized. These molecules should be very resistant to nuclease degradation. Furthermore, chemical groups can be added to the 2' carbon of the sugar moiety and the 5 carbon (C-5) of pyrimidines to enhance stability and facilitate the binding of the antisense oligonucleotide to its target site. Modifications may include 2'-deoxy, O-pentoxy, O-propoxy, O-methoxy, fluoro, methoxyethoxy phosphorothioates, modified bases, as well as other modifications known to those of skill in the art.

Another type of expression-inhibitory agent that reduces the levels of melanocortin receptors are ribozymes. Ribozymes are catalytic RNA molecules (RNA enzymes) that have separate catalytic and substrate binding domains. The substrate binding sequence combines by nucleotide complementarity and, possibly, non-hydrogen bond interactions with its target sequence. The catalytic portion cleaves the target RNA at a specific site. The substrate domain of a ribozyme can be engineered to direct it to a specified mRNA sequence. The ribozyme recognizes and then binds a target mRNA through complementary base-pairing. Once it is bound to the correct target site, the ribozyme acts enzymatically to cut the target mRNA. Cleavage of the mRNA by a ribozyme destroys its ability to direct synthesis of the corresponding polypeptide. Once the ribozyme has cleaved its target sequence, it is released and can repeatedly bind and cleave at other mRNAs.

Ribozyme forms include a hammerhead motif, a hairpin motif, a hepatitis delta virus, group I intron or RNaseP RNA (in association with an RNA guide sequence) motif or Neurospora VS RNA motif. Ribozymes possessing a hammerhead or hairpin structure are readily prepared since these catalytic RNA molecules can be expressed within cells from eukaryotic promoters (Chen, et al. (1992) Nucleic Acids Res. 20:4581-9). A ribozyme of the present invention can be expressed in eukaryotic cells from the appropriate DNA vector. If desired, the activity of the ribozyme may be augmented by its release from the primary transcript by a second ribozyme (Ventura, et al. (1993) Nucleic Acids Res. 21 :3249-55).

Ribozymes may be chemically synthesized by combining an oligodeoxyribonucleotide with a ribozyme catalytic domain (20 nucleotides) flanked by sequences that hybridize to the target mRNA after transcription. The oligodeoxyribonucleotide is amplified by using the substrate binding sequences as primers. The amplification product is cloned into a eukaryotic expression vector. Ribozymes are expressed from transcription units inserted into DNA, RNA, or vkal vectors. Transcription of the ribozyme sequences are driven from a promoter for eukaryotic RNA polymerase I (pol Q), RNA polymerase II (pol II), or RNA polymerase III (pol HI). Transcripts from pol II or pol HI promoters will be expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type will depend on nearby gene regulatory sequences. Prokaryotic RNA polymerase promoters are also used, providing that the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells (Gao and Huang, (1993) Nucleic Acids Res. 21 :2867-72). It has been demonstrated that ribozymes expressed from these promoters can function in mammalian cells (Kashani-Sabet, et al. (1992) Antisense Res. Dev. 2:3-15).

A particularly preferred inhibitory agent is a small interfering RNA (siRNA). siRNAs mediate the post-transcriptional process of gene silencing by double stranded RNA (dsRNA) that is homologous in sequence to the silenced RNA. siRNA according to the present invention comprises a sense strand of 17-25 nucleotides complementary or homologous to a contiguous 17-25 nucleotide sequence selected from the group of sequences described in SEQ ID NO: 1-3 and an antisense strand of 17-23 nucleotides complementary to the sense strand. The most preferred siRNA comprises sense and anti-sense strands that are 100 per cent complementary to each other and the target polynucleotide sequence. Preferably the siRNA further comprises a loop region linking the sense and the antisense strand.

A self-complementing single stranded siRNA molecule polynucleotide according to the present invention comprises a sense portion and an antisense portion connected by a loop region linker. Preferably, the loop region sequence is 4-30 nucleotides long, more preferably 5-15 nucleotides long and most preferably 8 nucleotides long. In a most preferred embodiment the linker sequence is GTTTGCTATAAC (SEQ ID NO: 171). SeIf- complementary single stranded siRNAs form hairpin loops and are more stable than ordinary dsRNA. Ih addition, they are more easily produced from vectors.

Analogous to antisense RNA, the siRNA can be modified to confirm resistance to nucleolytic degradation, or to enhance activity, or to enhance cellular distribution, or to enhance cellular uptake, such modifications may consist of modified internucleoside linkages, modified nucleic acid bases, modified sugars and/or chemical linkage the SiRNA to one or more moieties or conjugates. The nucleotide sequences are selected according to siRNA designing rules that give an improved reduction of the target sequences compared to nucleotide sequences that do not comply with these siRNA designing rules (For a discussion of these rules and examples of the preparation of siRNA, WO2004094636, published November 4, 2004, and UA20030198627, are hereby incorporated by reference.

The present invention also relates to compositions, and methods using said compositions, comprising a DNA expression vector capable of expressing a polynucleotide capable of inhibiting amyloid beta protein precursor processing and described hereinabove as an expression inhibition agent

A special aspect of these compositions and methods relates to the down-regulation or blocking of the expression of a melanocortin receptor polypeptide by the induced expression of a polynucleotide encoding an intracellular binding protein that is capable of selectively interacting with the melanocortin polypeptide. An intracellular binding protein includes any protein capable of selectively interacting, or binding, with the polypeptide in the cell in which it is expressed and neutralizing the function of the polypeptide. Preferably, the intracellular binding protein is a neutralizing antibody or a fragment of a neutralizing antibody having binding affinity to an intra-cellular domain of the melanocortin receptor polypeptide of SEQ ED NO: 3 or 4. More preferably, the intracellular binding protein is a single chain antibody.

A special embodiment of this composition comprises the expression-inhibiting agent selected from the group consisting of antisense ENA, antisense oligodeoxynucleotide (ODN), a ribozyme that cleaves the polyribonucleotide coding for SEQ ID NO: 3 or 4, and a small interfering KNA (siRNA) that is sufficiently homologous to a portion of the polyribonucleotide corresponding to SEQ ID NO: 3 or 4 such that the siRNA interferes with the translation of the melanocortin receptor polyribonucleotide to the melanocortin polypeptide.

The polynucleotide expressing the expression-inhibiting agent or the encoding an intracellular binding protein is preferably included within a vector. The polynucleic acid is operably linked to signals enabling expression of the nucleic acid sequence and is introduced into a cell utilizing, preferably, recombinant vector constructs, which will express the antisense nucleic acid once the vector is introduced into the cell. A variety of viral-based systems are available, including adenoviral, retroviral, adeno-associated viral, lentiviral, herpes simplex viral or a sendaviral vector systems, and all may be used to introduce and express polynucleotide sequence for the expression-inhibiting agents in target cells.

Preferably, the viral vectors used in the methods of the present invention are replication defective. Such replication defective vectors will usually lack at least one region that is necessary for the replication of the virus in the infected cell. These regions can either be eliminated (in whole or in part), or be rendered non-functional by any technique known to a person skilled in the art. These techniques include the total removal, substitution, partial deletion or addition of one or more bases to an essential (for replication) region. Such techniques may be performed in vitro (on the isolated DNA) or in situ, using the techniques of genetic manipulation or by treatment with mutagenic agents. Preferably, the replication defective virus retains the sequences of its genome, which are necessary for encapsidating, the viral particles.

In a preferred embodiment, the viral element is derived from an adenovirus. Preferably, the vehicle includes an adenoviral vector packaged into an adenoviral capsid, or a functional part, derivative, and/or analogue thereof. Adenovirus biology is also comparatively well known on the molecular level. Many tools for adenoviral vectors have been and continue to be developed, thus making an adenoviral capsid a preferred vehicle for incorporating in a library of the invention. An adenovirus is capable of infecting a wide variety of cells. However, different adenoviral serotypes have different preferences for cells. To combine and widen the target cell population that an adenoviral capsid of the invention can enter in a preferred embodiment, the vehicle includes adenoviral fiber proteins from at least two adenoviruses.

In a preferred embodiment, the nucleic acid derived from an adenovirus includes the nucleic acid encoding an adenoviral late protein or a functional part, derivative, and/or analogue thereof. An adenoviral late protein, for instance an adenoviral fiber protein, may be favorably used to target the vehicle to a certain cell or to induce enhanced delivery of the vehicle to the cell. Preferably, the nucleic acid derived from an adenovirus encodes for essentially all adenoviral late proteins, enabling the formation of entire adenoviral capsids or functional parts, analogues, and/or derivatives thereof. Preferably, the nucleic acid derived from an adenovirus includes the nucleic acid encoding adenovirus E2A or a functional part, derivative, and/or analogue thereof. Preferably, the nucleic acid derived from an adenovirus includes the nucleic acid encoding at least one E4-region protein or a functional part, derivative, and/or analogue thereof, which facilitates, at least in part, replication of an adenoviral derived nucleic acid in a cell. The adenoviral vectors used in the examples of this application are exemplary of the vectors useful in the present method of treatment invention.

Certain embodiments of the present invention use retroviral vector systems. Retroviruses are integrating viruses that infect dividing cells, and their construction is known 82 24

in the art. Retroviral vectors can be constructed from different types of retrovirus, such as, MoMuLV ("murine Moloney leukemia virus" MSV ("murine Moloney sarcoma virus"), HaSV ("Harvey sarcoma virus"); SNV ("spleen necrosis virus"); RSV ("Rous sarcoma virus") and Friend virus. Lentiviral vector systems may also be used in the practice of the present invention. Retroviral systems and herpes virus system may be preferred vehicles for transfection of neuronal cells.

In other embodiments of the present invention, adeno-associated viruses ("AAV") are utilized. The AAV viruses are DNA viruses of relatively small size that integrate, in a stable and site-specific manner, into the genome of the infected cells. They are able to infect a wide spectrum of cells without inducing any effects on cellular growth, morphology or differentiation, and they do not appear to be involved in human pathologies.

In the vector construction, the polynucleotide agents of the present invention may be linked to one or more regulatory regions. Selection of the appropriate regulatory region or regions is a routine matter, within the level of ordinary skill in the art. Regulatory regions include promoters, and may include enhancers, suppressors, etc.

Promoters that may be used in the expression vectors of the present invention include both constitutive promoters and regulated (inducible) promoters. The promoters may be prokaryotic or eukaryotic depending on the host. Among the prokaryotic (including bacteriophage) promoters useful for practice of this invention are lac, lacZ, T3, T7, lambda P.sub.r, P.sub.1 , and trp promoters. Among the eukaryotic (including viral) promoters useful for practice of this invention are ubiquitous promoters (e.g. HPRT, vimentin, actin, tubulin), intermediate filament promoters (e.g. desmin, neurofilaments, keratin, GFAP), therapeutic gene promoters (e.g. MDR type, CFTR, fector VHI), tissue-specific promoters (e.g. actin promoter in smooth muscle cells, or Fit and FIk promoters active in endothelial cells), including animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift, et al. (1984) CeU 38:639-46; Ornitz, et al. (1986) Cold Spring Harbor Symp. Quant. Biol. 50:399-409; MacDonald, (1987) Hepatology 7:425-515); insulin gene control region which is active in pancreatic beta cells (Hanahan, (1985) Nature 315:115-22), immunoglobulin gene control region which is active in lymphoid cells (Grosschedl, et al. (1984) Cell 38:647-58; Adames, et al. (1985) Nature 318:533-8; Alexander, et al. (1987) MoI. Cell. Biol. 7:1436-44), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder, et al. (1986) Cell 45:485-95), albumin gene control region which is active in liver (Pinkert, et al. (1987) Genes and Devel. 1:268-76), alpha-fetoprotein gene control region which is active in liver (Krumlauf, et al. (1985) MoI. Cell. Biol., 5:1639-48; Hammer, et al. (1987) Science 235:53-8), alpha 1 -antitrypsin gene control region which is active in the liver (Kelsey, et al. (1987) Genes and Devel., 1: 161-71), beta-globin gene control region which is active in myeloid cells (Mogram, et al. (1985) Nature 315:338-40; Kollias, et al. (1986) Cell 46:89- 94), myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead, et al. (1987) Cell 48:703-12), myosin light chain-2 gene control region which is active in skeletal muscle (Sani, (1985) Nature 314.283-6), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason, et al. (1986) Science 234:1372-8).

Other promoters which may be used in the practice of the invention include promoters which are preferentially activated in dividing cells, promoters which respond to a stimulus (e.g. steroid hormone receptor, retinoic acid receptor), tetracycline-regulated transcriptional modulators, cytomegalovirus immediate-early, retroviral LTR, metallothionein, SV-40, EIa, and MLP promoters.

The vectors may also include other elements, such as enhancers, repressor systems,, and localization signals. A membrane localization signal is a preferred element when expressing a sequence encoding an intracellular binding protein, which junctions by contacting the intracellular domain of the melanocortin receptor and is most effective when the vector product is directed to the inner surface of the cellular membrane, where its target resides. Membrane localization signals are well known to persons skilled in the art. For example, a membrane localization domain suitable for localizing a polypeptide to the plasma membrane is the C-terminal sequence CaaX for farnesylation (where "a" is an aliphatic amino acid residue, and "X" is any amino acid residue, generally leucine), for example, Cysteine-Alanine-Alanine-Leucine, or Cysteine-Isoleucine-Valine-Methionine. Other membrane localization signals include the putative membrane localization sequence from the C-terminus of Bcl-2 or the C-terminus of other members of the Bcl-2 family of proteins.

Additional vector systems include the non-viral systems that facilitate introduction of polynucleotide agents into a patient For example, a DNA vector encoding a desired sequence can be introduced in vivo by lipofection. Synthetic cationic lipids designed to limit the difficulties encountered with liposome-mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al. (1987) Proc. P2005/051882 26

Natl. Acad Sci. USA 84:7413-7); see Mackey, et al. (1988) Proc. Natl. Acad. Sci. USA 85:8027-31; Ulmer, et al. (1993) Science 259:1745-8). The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner and Ringold, (1989) Nature 337:387-8). Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in International Patent Publications WO 95/18863 and WO 96/17823, and in U.S. Pat. No. 5,459,127. The use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages and directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, for example, pancreas, liver, kidney, and the brain. Lipids may be chemically coupled to other molecules for the purpose of targeting. Targeted peptides, e.g., hormones or neurotransmitters, and proteins for example, antibodies, or non-peptide molecules could be coupled to liposomes chemically. Other molecules are also useful for facilitating transfection of a nucleic acid in vivo, for example, a cationic oligopeptide (e.g., International Patent Publication WO 95/21931), peptides derived from DNA binding proteins (e.g., International Patent Publication WO 96/25508), or a cationic polymer (e.g., International Patent Publication WO 95/21931).

It is also possible to introduce a DNA vector in vivo as a naked DNA plasmid (see U.S. Pat. Nos. 5,693,622, 5,589,466 and 5,580,859). Naked DNA vectors for therapeutic purposes can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, e.g., Wilson, et al. (1992) J. Biol. Chem. 267:963-7; Wu and Wu, (1988) J. Biol. Chem. 263:14621-4; Hartmut, et al. Canadian Patent Application No. 2,012,311, filed Mar. 15, 1990; Williams, et al (1991). Proc. Natl. Acad. Sci. USA 88:2726-30). Receptor-mediated DNA delivery approaches can also be used (Curiel, et al. (1992) Hum. Gene Ther. 3:147- 54; Wu and Wu, (1987) J. Biol. Chem. 262:4429-32).

The present invention also provides biologically compatible compositions comprising the compounds identified as antagonists and/or inverse agonists of the melanocortin receptors, in particular MC3R or MC4R, and the expression-inhibiting agents as described hereinabove.

A biologically compatible composition is a composition, that may be solid, liquid, gel, or other form, in which the compound, polynucleotide, vector, and antibody of the invention is maintained in an active form, e.g., in a form able to effect a biological activity. For example, a compound of the invention would have inverse agonist or antagonist activity on the melanocortin receptor; a nucleic acid would be able to replicate, translate a message, or hybridize to a complementary mϋRNA of a melanocortin receptor; a vector would be able to transfect a target cell and expression the antisense, antibody, ribozyme or siRNA as described hereinabove; an antibody would bind a melanocortine receptor polypeptide domain.

A preferred biologically compatible composition is an aqueous solution that is buffered using, e.g., Tris, phosphate, or HEPES buffer, containing salt ions. Usually the concentration of salt ions will be similar to physiological levels. Biologically compatible solutions may include stabilizing agents and preservatives. In a more preferred embodiment, the biocompatible composition is a pharmaceutically acceptable composition. Such compositions can be formulated for administration by topical, oral, parenteral, intranasal, subcutaneous, and intraocular, routes. Parenteral administration is meant to include intravenous injection, intramuscular injection, intraarterial injection or infusion techniques. The composition may be administered parenterally in dosage unit formulations containing standard, well known non-toxic physiologically acceptable carriers, adjuvants and vehicles as desired.

A particularly preferred embodiment of the present composition invention is a cognitive-enhancing pharmaceutical composition comprising a therapeutically effective amount of an expression-inhibiting agent as described hereinabove, in admixture with a pharmaceutically acceptable carrier. Another preferred embodiment is a pharmaceutical composition for the treatment or prevention of a condition involving cognitive impairment or a susceptibility to the condition, comprising an effective amyloid beta peptide inhibiting amount of a melanocortin receptor antagonist or inverse agonist its pharmaceutically acceptable salts, hydrates, solvates, or prodrugs thereof in admixture with a pharmaceutically acceptable carrier. A particularly preferred class of such compositions comprise a low molecular weight compound as described in US patents 6,699,875 and 6,693,165. It is preferred that the compounds are able to pass the blood-brain barrier.

Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient. Pharmaceutical compositions for oral use can be prepared by combining active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethyl-cellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Dragee cores may be used in conjunction with suitable coatings, such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinyl¬ pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.

Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.

Preferred sterile injectable preparations can be a solution or suspension in a non-toxic parenterally acceptable solvent or diluent. Examples of pharmaceutically acceptable carriers are saline, buffered saline, isotonic saline (e.g. monosodium or disodium phosphate, sodium, potassium; calcium or magnesium chloride, or mixtures of such salts), Ringer's solution, dextrose, water, sterile water, glycerol, ethanol, and combinations thereof 1,3-butanediol and sterile fixed oils are conveniently employed as solvents or suspending media. Any bland fixed oil can be employed including synthetic mono- or di-glycerides. Fatty acids such as oleic acid also find use in the preparation of injectables.

The composition medium can also be a hydrogel, which is prepared from any biocompatible or non-cytotoxic homo- or hetero-polymer, such as a hydrophilic polyacrylic acid polymer that can act as a drug absorbing sponge. Certain of them, such as, in particular, those obtained from ethylene and/or propylene oxide are commercially available. A hydrogel can be deposited directly onto the surface of the tissue to be treated, for example during surgical intervention.

Embodiments of pharmaceutical compositions of the present invention comprise a replication defective recombinant viral vector encoding the polynucleotide inhibitory agent of the present invention and a transfection enhancer, such as poloxamer. An example of a poloxamer is Poloxamer 407, which is commercially available (BASF, Parsippany, NJ.) and is a non-toxic, biocompatible polyol. A poloxamer impregnated with recombinant viruses may be deposited directly on the surface of the tissue to be treated, for example during a surgical intervention. Poloxamer possesses essentially the same advantages as hydrogel while having a lower viscosity.

The active expression-inhibiting agents may also be entrapped in microcapsules prepared, for example, by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences (1980) 16th edition, Osol, A. Ed.

Sustained-release preparations may be prepared. Suitable examples of sustained- release preparations include semi-permeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or ρoly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, non- degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT™, (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37.degree. C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.

The present invention also provides methods of inhibiting the processing of amyloid- beta precursor protein in a subject suffering or susceptible to the abnormal processing of said protein, which comprise the administration to said subject a therapeutically effective amount of an expression-inhibiting agent of the invention. Another aspect of the present method invention is the treatment or prevention of a condition involving cognitive impairment or a susceptibility to the condition. A special embodiment of this invention is a method wherein the condition is Alzheimer's disease.

As defined above, therapeutically effective dose means that amount of protein, polynucleotide, peptide, or its antibodies, agonists or antagonists, which ameliorate the symptoms or condition. Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50. Pharmaceutical compositions that exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.

For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans. The exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state, age, weight and gender of the patient; diet, desired duration of treatment, method of administration, time and frequency of administration, drug combination^), reaction sensitivities, and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation.

The pharmaceutical compositions according to this invention may be administered to a subject by a variety of methods. They may be added directly to target tissues, complexed with cationic lipids, packaged within liposomes, or delivered to target cells by other methods known in the art. Localized administration to the desired tissues may be done by catheter, infusion pump or stent. The DNA, DNA/vehicle complexes, or the recombinant virus particles are locally administered to the site of treatment. Alternative routes of delivery include, but are not limited to, intravenous injection, intramuscular injection, subcutaneous injection, aerosol inhalation, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal delivery. Examples of ribo2yme delivery and administration are provided in Sullivan et al. WO 94/02595.

Antibodies according to the invention may be delivered as a bolus only, infused over time or both administered as a bolus and infused over time. Those skilled in the art may employ different formulations for polynucleotides than for proteins. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.

As discussed hereinabove, recombinant viruses may be used to introduce DNA encoding polynucleotide agents useful in the present invention. Recombinant viruses according to the invention are generally formulated and administered in the form of doses of between about 10.sup.4 and about 10.sup.14 pfu. In the case of AAVs and adenoviruses, doses of from about lθ.sup.6 to about 10.sup.ll pfu are preferably used. The term pfii ("plaque-forming unit") corresponds to the infective power of a suspension of virions and is determined by infecting an appropriate cell culture and measuring the number of plaques formed. The techniques for determining the pfu titre of a viral solution are well documented in the prior art.

Still another aspect or the invention relates to a method for diagnosing a pathological condition involving cognitive impairment or a susceptibility to the condition in a subject, comprising determining the amount of polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3 or 4 in a biological sample, and comparing the amount with the amount of the polypeptide in a healthy subject, wherein an increase of the amount of polypeptide compared to the healthy subject is indicative of the presence of the pathological condition. TABLE 1. GPCRs involved in APP processing (SEQ ID NO:1 relates to the nucleic acid

sequence of MC4R, SEQ ID NO.2 to the nucleic acid sequence of MC3R, SEQ ID NO:3 to the amino acid sequence of MC4R and SEQ ID NO:4 to the amino acid sequence of MC3R).

Sequences for the compounds (or the expression inhibitory agents are given in SEQ ID

NO:5-105 for MC4R and in SEQ ID NO:106-170 for MC3R). The preferred hairpin loop sequence is provided by SEQ ID NO: 171.

TABLE 2: buffers and solutions used for ELISA

TABLE 3: Primers used in the quantitative real time PCR analysis for MC4R expression

levels.

SEQ ID Ξene Primer name NO: Yimer sequence MC4R MC4R_Hs_For 172 GGAACCGCAGCAGTTACAGACT MC4R Hs Rev 173 frcGTAGCACCCTCCATCAGAGT TABLE 4: Ct values obtained during quantitative real time PCR: human cerebral cortex or human hippocampus RNA is tested for the presence of MC4R mRNA via quantitative real time PCR. GAPDH RNA is used to normalize all samples (ΔCt).

TABLE 5: Antagonist of MC4R used in this study

Name compound Reference compound N 056,699,873 compound 7 Vos et al., 2004 HS024 Tocris, UK cat nr 1832

EXAMPLES

EXAMPLE 1. MC4R increases amyloid beta 1-42 levels.

To identify novel drug targets that change the APP processing, a stable cell line overexpressing APP, Hek293 APPwt, was transduced with adenoviral cDNA libraries and the resulting amyloid beta 1-42 levels were detected via ELISA. This stable cell line was created after transfection of Hek293 cells with the APP770wt cDNA cloned in pcDNA3.1 and selection with G418 during 3 weeks. At this time point colonies were picked and stable clones were expanded and tested for then* secreted amyloid beta peptide levels.

The assay was performed as follows. Cells seeded in collagen-coated plates at a cell density of 15,000 cells/well (384 well plate) in DMEM 10%FBS, were infected 24 h later with 1 μl or 0.2 μl of adenovirus (corresponding to an average multiplicity of infection (MOI) of 120 and 24 respectively). The following day, the virus was washed away and DMEM 25 mM Hepes 10%FBS was added to the cells. Amyloid beta peptides were allowed to accumulate during 24h. The ELISA plate was prepared by coating the capture antibody (JRF/cAbeta42/26) (obtained from M Mercken, Johnson and Johnson Pharmaceutical Research and Development, B-2340 Beerse, Belgium) overnight in buffer 42 (table 2) at a concentration of 2,5 μg/ml. The excess capture antibody was washed away the next morning with PBS and the ELISA plate was then blocked overnight with casein buffer (table 2) at 4°C. Upon removal of the blocking buffer, 30 μl of the sample was transferred to the ELISA plate and incubated overnight at 4°C. After extensive washing with PBS-Tween20 and PBS3 30 μl of the horse reddish peroxidase (HRP) labeled detection antibody (Peroxidase Labeling Kit, Roche), JRF/AbetaN/25-HRP (obtained from M Mercken, Johnson and Johnson Pharmaceutical Research and Development, B-2340 Beerse, Belgium) was diluted 1/5000 in buffer C (table 2) and added to the wells for another 2h. Following the removal of excess detection antibody by a wash with PBS-Tween20 and PBS, HRP activity was detected via addition of luminol substrate (Roche), which was converted into a chemiluminescent signal by the HRP enzyme.

In order to validate the assay, the effect of adenoviral overexpression with random titre of two clinical PSl mutants and BACE on amyloid beta 1-42 production was evaluated in the Hek293 APPwt cells. As is shown in Figure 2, all constructs induce amyloid beta 1-42 levels as expected.

An adenoviral cDNA library containing almost all GPCRs was constructed as follows. DNA fragments covering the full coding region of the GPCRs, were amplified by PCR from a pooled placental and fetal liver cDNA library (thvitroGen). All fragments were cloned into an adenoviral vector as disclosed in US 6,340,595 and subsequently adenoviruses were made harboring the corresponding cDNAs. This GPCR library was screened according the above-described procedure with the exception that during the 24 h. A specific agonist for each receptor was added. Every non-orphan GPCR was screened in quadruple with four different agonist concentrations (250 nM, 25 nM, 2.5 nM and in the absence). During the screening of the adenoviral GPCR library in the Hek293 APPwt cells, MC4R was identified as a modulator of APP processing. These results indicate that overexpression and activation of MC4R leads to increased levels of amyloid beta 1-42 peptides in the conditioned medium of Hek293 APPwt cells, showing that this GPCR modulates APP processing.

The stimulatory effect of MC4R was confirmed upon re-screening of the viruses with a known titer (viral particles/ml), as determined by quantitative real time PCR. MC4R virus was infected at MOIs ranging from 2 to 250 and the experiment was performed as described above. Amyloid beta 1-42 levels were 2 fold higher compared to the negative controls for Ad5/MC4R (Figure 3A). In addition, the effect of MC4R on amyloid beta 1-40, 11-42, 1-x and y-42 levels were checked under similar conditions as above (Figure 3B). The respective ELISA' s were performed as described above, except that the following antibodies were used: for the amyloid beta 1-40 ELISA, the capture and detection antibody were respectively JRF/cAbeta40/10 and JRF/AbetaN/25-HRP (obtained from M Mercken, Johnson and Johnson Pharmaceutical Research and Development, B-2340 Beerse, Belgium), for the amyloid beta 11-42 ELISA, the capture and detection antibody were respectively JRF/cAbeta42/26 and JRF/hAbll/1 (obtained from M Mercken, Johnson and Johnson Pharmaceutical Research and Development, B-2340 Beerse, Belgium), for the amyloid beta y-42 ELISA (y ranges from 1-17), the capture and detection antibody were respectively JRF/cAbeta42/26 and 4G8-HRP (obtained respectively from M Mercken, Johnson and Johnson Pharmaceutical Research and Development, B-2340 Beerse, Belgium and from Signet, USA) while for the amyloid beta 1-x ELISA (x ranges from 24-42) the capture and detection antibodies were JRF/AbetaN/25 and 4G8-HRP, respectively (obtained respectively from M Mercken, Johnson and Johnson Pharmaceutical Research and Development, B-2340 Beerse, Belgium and from Signet, USA). The amyloid beta 1-x ELISA was used for the detection of amyloid peptides with a variable C-terminus (amyloid beta 1-37; 1-38; 1-39; 1- 40; 1-42). The results of these experiments clearly show an increase of amyloid beta 1-40, 11-42, y-42 and 1-x species upon transduction of MC4R (figure 3B-3E). The same procedure is used for the analysis of APP processing by MC3R.

Example 2. Modulation of amyloid beta 1-42 production in HEK293APPwt cells infected with MC4R adenovirus by MC4R ligands.

Demonstrating that the secretion of beta amyloid was modulated by specific ligands of MC4R shows that this GPCR is specifically involved in the secretion of beta amyloid and that interference with the signal transduction pathway of this GPCR affects the beta amyloid secretion. Overexpression of MC4R in HEK293APPwt cells increased the amount of beta amyloid 1-42 secreted in the medium as determined by the ELISA identical to the ELISA used for screening. Stimulation of the MC4R receptor with the MC4R agonist alpha-MSH dose dependently increased the beta amyloid secretion further (Figure 4A). These increased levels of beta amyloid 1-42 are dose dependently decreased by treating the cells with the partial agonist SHU9119 (Figure 4A). The increased basal levels of beta amyloid secretion due to MC4R overexpression were dose dependency reduced by treatment of the cells with Agouti related peptide (Figure 4B) (inverse agonist for MC4R).

EXAMPLE 3. Expression of MC4R in the human brain.

Upon identification of a modulator of APP processing, it is important to evaluate whether the modulator is expressed in the tissue and the cells of interest. This can be achieved by measuring the RNA and/or protein levels. In recent years, RNA levels were being quantified through real time PCR technologies, whereby the RNA is first transcribed to cDNA and then the amplification of the cDNA of interest is monitored during a PCR reaction. The amplification plot and the resulting Ct value are indicators for the amount of RNA present in the sample. Determination of the levels of household keeping genes allows the normalization of RNA levels of the target gene between different RNA samples, represented as delta Ct values.

To assess whether the GPCR of the invention is expressed in the human brain, real time PCR with GAPDH specific primers and specific primers for GPCR of the invention was performed on human cerebral cortex and human hippocampal total RNA (BD Biosciences). GAPDH was detected with a Taqman probe, while for the GPCR SybrGreen was used. In short, 40 ng of RNA was transcribed to DNA using the MultiScribe Reverse Transcriptase (50 U/μl) enzyme (Applied BioSystems). The resulting cDNA was amplified with AmpliTaq Gold DNA polymerase (Applied BioSystems) during 40 cycles using an ABI PRISM® 7000 Sequence Detection System. Cerebral cortex and hippocampal total RNA's were analyzed for the presence of the GPCR transcripts via quantitative real time PCR. For MC4R, the obtained Ct values indicate that it was detected in all RNA samples (table 4).

To gain more insight into the specific cellular expression, immunohistochemistry (protein level) and/or in situ hybridization (ElNA level) were carried out on sections from human normal and Alzheimer's brain hippocampal, cortical and subcortical structures. These results indicate whether expression occurs in neurons, microglia cells or astrocytes. The comparison of diseased tissue with healthy tissue, teaches us whether MC4R is expressed in the diseased tissue and whether its expression level is changed compared to the non- pathological situation. The same procedure is used for expression profiling of MC3R. EXAMPLE 4. Ligand screens for GPCRs.

Reporter gene screen.

Mammalian cells such as HEK293 or CHO-Kl cells are either stably transfected with a plasmid harboring the luciferase gene under the control of a cAMP dependent promoter (CRE elements) or transduced with an adenovirus harboring a luciferase gene under the control of a cAMP dependent promoter. In addition other reporter constructs can be used with the luciferase gene under the control of a Ca2+ dependent promoter (NF-AT elements) or a promoter that is controlled by activated NF-κB. These cells, expressing the reporter construct, are then transduced with an adenovirus harboring the cDNA of the GPCR of the present invention. 24 to 40 h after transduction the cells are treated with.

An agonist for the receptor (e.g. alpha-MSH or MTET) and screened against a large collection of reference compounds comprising peptides (LOPAP, Sigma Aldrich), lipids (Biomol, TimTech), carbohydrates (Specs), natural compounds (Specs, TimTech), and small chemical compounds (Tocris, Biofocus, Evotec), or

Compounds, which decrease the agonist induced increase in luciferase activity, are considered to be antagonists or inverse agonists for the MC4R. These compounds are screened again for verification and screened against their effect on secreted amyloid beta peptide levels.

In addition, cells expressing the NF-AT reporter gene can be transduced with an adenovirus harboring the cDNA encoding the α-subunit of G-alphal5 or chimerical Ga subunits. G15 is a promiscuous G protein of the Gq class that couples to many different GPCRs and as such re-directs their signaling towards the release of intracellular Ca2+ stores. The chimerical G alpha subunits are members of the Gs and G1Z0 family by which the last 5 C- terminal residues are replaced by those of Gαq, these chimerical G-proteins also redirect cAMP signaling to Ca2+ signaling. FLIPR screen.

Mammalian cells such as HEK293 or CHO-Kl cells are stably transfected with an expression plasmid construct harboring the cDNA of a GPCR of the present invention. Cells are seeded and grown until sufficient stable cells can be obtained. Cells are loaded with a Ca2+ dependent fluorophore such as Fura3 or Fura4. After washing away the excess of fluorophore the cells are screened against a large collection of reference compounds comprising peptides (LOPAP, Sigma Aldrich), lipids (Biomol, TimTech), carbohydrates (Specs), natural compounds (Specs, TimTech), and small chemical compounds (Tocris, Biofocus, Evotec) by simultaneously adding an agonist and a compound to the cells. As a reference just the agonist is added. Activation of the receptor is measured as an almost instantaneously increase in fluorescence due to the interaction of the fluorophore and the Ca2+ that is released. Compounds that reduce or inhibit the agonist induced increase in fluorescence are considered to be antagonists or inverse agonists for the receptor they are screened against. These compounds will be screened again to measure the effect on secreted amyloid beta peptide.

AequoScreen.

CHO cells, stably expressing Apoaequorin are stably transfected with a plasmid construct1 harboring the cDNA of a GPCR. Cells are seeded and grown until sufficient stable cells can be obtained. The cells are loaded with coelenterazine, a cofactor for apoaequorin. Upon receptor activation intracellular Ca2+ stores will be emptied and the aequorin will react with the coelenterazine in a light emitting process. The emitted light is a measure for receptor activation. The CHO, stable expressing both the apoaequorin and the receptor are screened against a large collection of reference compounds comprising peptides (LOPAP, Sigma Aldrich), lipids (Biomol, TimTech), carbohydrates (Specs), natural compounds (Specs, TimTech), and small chemical compounds (Tocris, Biofocus, Evotec, Euroscreen) by simultaneously adding an agonist and a compound to the cells or by only adding a compound. As a reference just the agonist is added. Activation of the receptor is measured as an almost instantaneously light flash due to the interaction of the apoaequorin, coelenterazine and the Ca2+ that is released. Compounds that reduce or inhibit the agonist induced increase in light are considered to be antagonists or inverse agonists for the receptor they are screened against. These compounds will be screened again for verification and effect they have on secreted amyloid beta levels.

In addition, CHO cells stable expressing the apoaequorin gene are stably transfected with a plasmid construct harboring the cDNA encoding the α-sύbunit of G15 or chimerical Gα subunits. G1S is a promiscuous G protein of the Gq class that couples to many different GPCRs and as such redirect their signaling towards the release of intracellular Ca2+ stores. The chimerical G alpha subunits are members of the Gs and Gy0 family by which the last 5 C- terminal residues are replaced by those of Gαq, these chimerical G-proteins also redirect cAMP signaling to Ca2+ signaling.

Screening for compounds that interact with MC3R and/or MC4R (displacement experiment)

Compounds are screened for binding. The affinity of the compounds to the polypeptides is determined in a displacement experiment. In brief, the polypeptides of the present invention are incubated with a labeled (radiolabeled, fluorescent labeled) ligand that is known to bind to the polypeptide and with an unlabeled compound. The displacement of the labeled ligand from the polypeptide is determined by measuring the amount of labeled ligand that is still associated with the polypeptide. The amount associated with the polypeptide is plotted against the concentration of the compound to calculate IC50 values. This value reflects the binding affinity of the compound to its target, Le. the polypeptides of the present invention. Strong binders have an IC50 in the nanomolar and even picomolar range. Compounds that have an IC50 of at least 10 micromol or less (nmol to pmol) are applied in beta amyloid secretion assay to check for their effect on the beta amyloid secretion and processing. The polypeptides of the present invention can be prepared in a number of ways depending on whether the assay will be run on cells, cell fractions or biochemically, on purified proteins.

Screening for compounds that interact with MC3R and/or MC4R (generic GPCR screening assay)

When a G protein receptor is activated, it binds to a G protein (Gq, Gs, Gi, Go) and stimulates the binding of GTP to the G protein. The G protein then acts as a GTPase and slowly hydrolyses the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated. A non-hydrolyzable analog of GTP5 [35S]GTPyS, can be used to monitor GTP binding to membrane fractions isolated from cells that express a specific GPCR. It is reported that [35S]GTPyS can be used to monitor G protein coupling to membranes in the absence and presence of ligand. Moreover, a preferred approach is the use of Antibodies specific for the various members of the G-alpha-protein family to immune precipitate the G-alpha-protein together with the radiolabelled [35S]GTPγS. The amount of [35S]GTPγS incorporated in the imuunprecipitate is then a direct measure of the degree of receptor activation. Homogenized membranes with MC4R protein are transferred in a 96-well plate. A pin-tool is used to transfer a candidate compound in each well plus [35S]GTPyS, followed by an incubation on a shaker for 60 minutes at room temperature. The assay is stopped by spinning of the plates at 4000 RPM for 15 minutes at 22°C. The membranes are re-suspended and solubilized and the G-alpha-proteins are immunprecipitated. The beads are collected and the amount of radioactivity is determined by scintillation counting. Alternatively scintillation proximity beads from various suppliers can be used for the determination of the amount of radioactivity incorporated. The same procedure is used for analysis of MC3R.

Receptor-ligand binding study on cell surface

The receptor is expressed in mamalian cells (HEK293, CHO, COS7) by adenovirally transducing the cells (see US 6,340,595). The cells are incubated with both labeled ligand (iodinated, tritiated, or fluorescent) and the unlabeled compound at various concentrations, ranging from 10 pM to lOμM (3 hours at 4°C: 25 mM HEPES, 140 mM NaCl, 1 mM CaCl2, 5 mM MgCl2 and 0.2% BSA, adjusted to pH 7.4). Reactions mixtures are rapidly aspirated onto PEI-treated GF/B glass filters using a cell harvester (Packard). The filters are washed twice with ice-cold wash buffer (25 mM HEPES, 500 mM NaCl, 1 mM CaCl2, 5 mM MgCl2, adjusted to pH 7.4). Scintillant (MicroScint-10; 35 μl) is added to dried filters and the filters counted in a (Packard Topcount) scintillation counter. Data are analyzed and plotted using Prism software (GraphPad Software, San Diego, Calif.). Competition curves are analyzed and IC5O values calculated. If one or more datapoints do not fall within the sigmoidal range of the competition curve or close to the sigmoidal range the assay is repeated and concentrations of labeled ligand and unlabeled compound adapted to have more data points close to or in the sigmoidal range of the curve. Receptor-ligand binding studies on membrane preparations

Membrane preparations are isolated from mammalian cells (HEK293, CHO, COS7) overexpressing the receptor and this is done as follows: Medium is aspirated from the transduced cells and cells are harvested in 1 x PBS by gentle scraping. Cells are pelleted (2500 rpm 5 min) and resuspended in 50 mM Tris pH 7.4 (1O x 10E6 cells/ml). The cell pellet is homogenized by sonicating 3 x 5 sec (UP50H; sonotrode MSl; max amplitude: 140 μm; max Sonic Power Density: 125W/cm2). Membrane fractions are prepared by centrifuging 20 min at maximal speed (13000 rpm -15 000 to 20 00Og or rcf). The resulting pellet is resuspended in 500 μl 50 mM Tris pH 7.4 and sonicated again for 3 x 5 sec. The membrane fraction is isolated by centrifugation and finally resuspended in PBS. Binding competition and derivation of IC50 values are determined as described above.

Internalisation screen Cl)

Activation of a GPCR-associated signal transduction pathway commonly leads to translocation of specific signal transduction molecules from the cytoplasma to the plasma membrane or from the cytoplasma to the nucleus. Norak has developed their transfluor assay based on agonist-induced translocation of receptor-β-arrestin-GFP complex from the cytosol to the plasma membrane and subsequent internalization of this complex, which occurs during receptor desensitization. A similar assay uses GFP tagged receptor instead of β-arrestin. HEK293 cells are transduced with a MC4R-eGFP vector that translates for a MC4R-eGFP fusion protein.48 hours after transduction, the cells are set to fresh serum-free medium for 60 minutes and treated with a ligand (e.g. 100 nM alpha-MSH or MTU) for 15, 30, 60 or 120 minutes at 37°C and 5% CO2. After indicated exposure times, cells are washed with PBS and fixed with 5% paraformaldehyde for 20 minutes at RT. GFP fluorescence is visualized with a Zeiss microscope with a digital camera. This method aims for the identification of compounds that inhibit a ligand-mediated (constitutive activity-mediated) translocation of the fusion protein to intracellular compartments. The same procedure is used for analysis of MC3R. Internalisation screen (2)

Various variations on translocation assays exists using β-arrestin and β-galactosidase enzyme complementation and BRET based assays with receptor as energy donor and β- arrestin as energy acceptor. Also the use of specific receptor antibodies labeled with pH sensitive dyes are used to detect agonist induced receptor translocation to acidic lysosomes. All of he translocation assays are used for screening for both agonistic and antagonistic acting ligands.

Melanophore assay (Arena PharmaceuticaD The melanophore assay is based on the ability of GPCRs to alter the distribution of melanin cotaining melanosomes in Xenopus melanophores. The distribution of the melanosomes depends on the exogenous receptor that is either Gi/o or Gs/q coupled. The distribution of the melanosomes (dispersed or aggregated) is easily detected by measuring light absorption. This type of assay is used for both agonist as well as antagonist compound screens.

Example 5. Validation of MC4R by assessing amyloid beta production when cells are challenged with MC4R specific agonists and antagonists.

Antagonists for MC4R were tested to evaluate whether inhibiting the MC4R receptor results in a decrease of the amyloid beta 1-42 levels. For this, Hek293 APPwt cells were infected with respectively Ad5/empty, and Ad5/MC4R_vl over a 24 hours period. Viruses were washed away and fresh medium containing increasing amounts of agonist (α-MSH) in the absence and presence of fixed (1, 3 and 10 μM) concentrations of compound N (Table 5) was added to the cells. 24h later, the conditioned medium was assayed in the amyloid beta 1- 42 ELISA as described in Example 1. As shown in Figure 6A, compound N reduced the amount of amyloid beta 1-42 secreted in the medium in a concentration dependent manner.

In another experiment, HEK293 APPsw cells were infected with Ad5/APPsw in combination with Ad5/empty or Ad5/MC4R_vl over a 24 h period. Viruses were washed away and fresh medium containing increasing amounts of agonist (α-MSH) in the absence and presence of fixed (1 and 10 μM) concentrations of compound 7 (Table 5) was added to the cells. 9 h later, the conditioned medium was assayed in the amyloid beta 1-42 ELISA as described in Example 1. As shown in Figure 6B, compound 7 reduced the amount of Abeta 1-42 secreted in the medium also in a concentration dependent manner. In yet another experiment, Hek293 APPwt cells were infected with Ad5/empty5 or Ad5/MC4R vl over 24 h. Viruses were washed away and fresh medium containing 10 μM α-MSH and increasing amounts of HS024 (Table 5) was added to the cells. 24h later, the conditioned medium was assayed in the amyloid beta 1-42 ELISA as described in Example 1. As shown in Figure 6C, HS024 reduced the amount of Abeta 1-42 secreted in the medium.

EXAMPLE 6. Amyloid beta production in rat primary neuronal cells.

In order to investigate whether the GPCR of the invention affects amyloid beta production in a real neuron, mouse primary hippocampal neurons are treated with an agonist for the MC4R. Amyloid beta levels are determined by ELISA (see EXAMPLE 1). Since rodent APP genes carry a number of mutations in APP compared to the human sequence, they produce less amyloid beta 1-40 and 1-42. In order to achieve higher amyloid beta levels, co-transduction with human wild type APP695 cDNA is performed.

Mouse primary neuron cultures are prepared from brain of E17-E18-day-old fetal FVB mice according to Goslin and Banker (Culturing Nerve cells, second edition, 1998 ISBN 0-262-02438-1). Briefly, single cell suspensions obtained from the hippocampus or cortices are prepared. The number of cells is determined (only taking into account the living cells) and cells are plated on poly-L-lysine-coated plastic 96-well plates in minimal essential medium (MEM) supplemented with 10% horse serum. The cells are seeded at a density of 50,000 cells per well (i.e. about 166,000 cells/cm2). After 3-4 h, culture medium is replaced by 160 μl serum-free neurobasal medium with B27 supplement (GIBCO BRL). Cytosine arabinoside (5 μM) is added 24 h after plating to prevent nonneuronal (glial) cell proliferation.

Neurons are transduced at day 4 after plating. Before adenoviral transduction, 150 μl conditioned medium of these cultures is transferred to the corresponding wells in an empty 96-well plate and 50 μl of the conditioned medium returns to the cells. The remaining 100 μl/well is stored at 4°C. The cells are transduced at an MOI of 2000 by adding an additional 20 μl neurobasal medium containing the purified virus Ad5C01.Att01/A010800-APP_v6. The following day, the virus was removed and the cultures were washed with 100 μl pre- warmed fresh neurobasal medium. After removal of the wash solution, the remaining 100 μl of the stored conditioned medium was incubated at 370C and 5% CO2 and was transferred to the corresponding cells. At day 8, the MC4R agonist MTU was added to the medium at concentrations ranging from IpM to 10OnM. 24h later the conditioned medium was harvested and its amyloid beta 1 -42 concentration was determined by an ELISA detecting human amyloid beta l-42(see EXAMPLE 1). As is shown in figure 7, addition of increasing amounts of MTU to mouse primary neurons induces amyloid beta 1-42 levels in the conditioned medium of the latter cells. These data show that stimulation of the endogenous MC4R modulates amyloid beta levels.

REFERENCES

Annaert, W. and B. De Strooper (2002). "A cell biological perspective on Alzheimer's disease." Annu Rev Cell Dev Biol 18: 25-51.

Cortez-Retamozo et al. 2004. Efficient cancer therapy with a nanobody-based conjugate. Cancer Res. 64: 2853-2857.

Gantz, I. et al. (1993). "Molecular cloning, expression, and gene localization of a fourth melanocortin receptor." J Biol Chem 268(20): 15174-9.

Gotz, J. et al. (2001). "Formation of neurofibrillary tangles in P3011 tau transgenic mice induced by Abeta 42 fibrils." Science 293(5534): 1491-5.

LipinsH, C. A., Lombardo, F., Dominy, B. W., and Feeney, P. J. Adv. Drug. Deliv. Rev., 23, 3-25, 1997

Ollmann, M. M. et al. (1997). "Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein." Science 278(5335): 135-8.

Ritchie, K. and S. Lovestone (2002). "The dementias." Lancet 360(9347): 1759-66. Vos, T. J. et al. (2004). "Identification of 2-[2-[2-(5-bromo-2- methoxyphenyl)-ethyl]-3- fluorophenyl]-4,5-dihydro-lH-inxidazole (ML00253764), a small molecule melanocortin 4 receptor antagonist that effectively reduces tumor-induced weight loss in a mouse model." JMed Chem 47(7): 1602-4.