Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF CENTRAL NERVOUS SYSTEM AUTOIMMUNE DISEASES
Document Type and Number:
WIPO Patent Application WO/2017/070589
Kind Code:
A1
Abstract:
Disclosed herein are compositions and methods for the diagnosis and treatment of CNS autoimmune diseases such as MS. The methods of treatment may include administering to the subject at least one of an LTβR inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof. The method of diagnosing Type B MS may include determining the expression of at least one of CXCR2, CXCR1, Ltbr, and Sema6B in a sample from the subject, wherein an increase of the expression relative to a control indicates a diagnosis that the subject is afflicted with Type B MS.

Inventors:
SHINOHARA, Mari, L. (2822 Picket Road, Unit 163Durham, NC, 27705, US)
INOUE, Makoto (3018 Cherry Hills Drive, Champaign, IL, 61822, US)
Application Number:
US2016/058285
Publication Date:
April 27, 2017
Filing Date:
October 21, 2016
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
DUKE UNIVERSITY (2812 Erwin Road, Suite 306Durham, NC, 27705, US)
International Classes:
A61K38/20; A61P25/28; C07K14/52
Domestic Patent References:
2014-08-21
2014-10-23
Foreign References:
US20120046243A12012-02-23
US20120177632A12012-07-12
US20110177094A12011-07-21
US20100256157A12010-10-07
US20060003327A12006-01-05
Attorney, Agent or Firm:
COX, Julia, M. (Michael Best & Friedrich LLP, 100 East Wisconsin Avenue Suite 330, Milwaukee WI, 53202-4108, US)
Download PDF:
Claims:
CLAIMS

1. A method of treating a central nervous system (CNS) autoimmune disease in a subject, the method comprising administering to the subject at least one of an LT R inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof.

2. The method of claim 1 , wherein the inhibitor comprises siRNA, an antibody, or a small molecule.

3. The method of claim 1 or 2, wherein the CNS autoimmune disease comprises multiple sclerosis (MS).

4. The method of claim 3, wherein the MS is not responsive to treatment with ΙΡΝβ.

5. The method of claim 3, wherein the MS comprises NLRP3-independent MS.

6. The method of claim 3, wherein the MS comprises Type B MS.

7. The method of claim 3, wherein the subject has irreversible neuronal damage, demyelination, or a combination thereof.

8. The method of claim 7, wherein the irreversible neuronal damage, demyelination, or a combination thereof, is in the brain or optic nerve.

9. The method of claim 6, wherein the Type B MS is characterized by at least one of: irreversible neuronal damage, demyelination, or a combination thereof;

irresponsiveness to treatment with ΙΡΝβ;

lack of activation of the NLRP3 inflammasome;

increased expression of Ltbr, CXCR2, CXCR1 , or Sema6B;

increased levels of B cells in the DLNs; or

a combination thereof, relative to a control.

10. The method of claim 9, wherein the expression of CXCR2 is increased in neutrophils, CD4+ cells, or a combination thereof.

11. A method of diagnosing Type B MS in a subject, the method comprising:

determining the expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in a sample from the subject, wherein an increase of the expression relative to a control indicates a diagnosis that the subject is afflicted with Type B MS.

12. The method of claim 11 , further comprising diagnosing the patient as having Type B MS when the expression is increased relative to the control.

13. The method of claim 11 , further comprising administering treatment with one or more pharmaceutical compositions, to the subject diagnosed as having Type B MS.

14. The method of claim 13, wherein the treatment comprises at least one of an L I^R inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof.

15. A method of diagnosing Type B MS in a subject, the method comprising:

(a) contacting a sample from the subject with an agent for specifically detecting expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample;

(b) determining a level of expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; and

(c) comparing the level of expression in the sample with a control level of expression to diagnose Type B MS.

16. The method of claim 15, wherein the agent comprises a polynucleotide probe that hybridizes specifically with RNA transcribed from gene encoding at least one of CXCR2, CXCR1 , Ltbr, and Sema6B present in the subject.

17. The method of claim 15, wherein the agent comprises an antibody that binds to at least one of CXCR2, CXCR1 , Ltbr, and Sema6B.

18. The method of any one of claims 15-17, further comprising diagnosing the patient as having Type B MS when the level of expression is increased relative to the control.

19. The method of any one of claims 15-18, further comprising administering treatment with one or more pharmaceutical compositions, to the subject diagnosed as having Type B MS.

20. A method of predicting responsiveness of a subject with MS to treatment with ΙΡΝβ, the method comprising:

(a) contacting a sample from the subject with an agent for specifically detecting expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample;

(b) determining a level of expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample;

(c) comparing the level of expression in the sample with a control level of expression; and

(d) determining that the subject is not responsive to treatment with ΙΡΝβ when the level of expression is increased, and that the subject is responsive to treatment with ΙΡΝβ when the level of expression is the same or decreased.

21. The method of any one of claims 9-20, wherein the expression is measured by determining at least one of mRNA levels, protein levels, or protein activity levels.

22. The method of any one of claims 11-21 , wherein the determining step comprises at least one of PCR or antibody binding.

23. The method of any one of claims 11-22, wherein the sample comprises peripheral blood mononuclear cells (PBMCs).

Description:
METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF

CENTRAL NERVOUS SYSTEM AUTOIMMUNE DISEASES

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 62/244,885, filed October 22, 2015, which is incorporated herein by reference in its entirety.

FIELD

[0002] This disclosure relates to central nervous system autoimmune diseases such as multiple sclerosis and diagnosis and treatment thereof.

INTRODUCTION

[0003] Multiple sclerosis (MS) is a chronic inflammatory autoimmune disease accompanied by demyelination of the central nervous system (CNS). Some MS patients show CNS axonal damage, which may occur independently of chronic demyelination. Disease heterogeneity also extends to drug response. For example, ΙΡΝβ, a first-line treatment to MS patients for over 15 years in progressive and relapsing-remitting MS (RRMS), is not effective for 7-49% of RRMS patients. The mechanism of how the pathophysiology of the two subtypes is distinct is not known. There is a need to understand these mechanisms and subtype distinctions for improved treatments.

SUMMARY

[0004] In an aspect, the disclosure relates to methods of treating a central nervous system (CNS) autoimmune disease in a subject. In some embodiments, the method includes administering to the subject at least one of an LTβR inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof. In some embodiments, the inhibitor includes siRNA, an antibody, or a small molecule. In some embodiments, the CNS autoimmune disease includes multiple sclerosis (MS). In some embodiments, the MS is not responsive to treatment with ΙΡΝβ. In some embodiments, the MS includes NLRP3-independent MS. In some embodiments, the MS includes Type B MS. In some embodiments, the subject has irreversible neuronal damage, demyelination, or a combination thereof. In some embodiments, the irreversible neuronal damage, demyelination, or a combination thereof, is in the brain or optic nerve. In some embodiments, the Type B MS is characterized by at least one of: irreversible neuronal damage, demyelination, or a combination thereof; irresponsiveness to treatment with ΙΡΝβ; lack of activation of the NLRP3 inflammasome; increased expression of Ltbr, CXCR2, CXCR1 , or Sema6B; increased levels of B cells in the DLNs; or a combination thereof, relative to a control. In some embodiments, the expression of CXCR2 is increased in neutrophils, CD4+ cells, or a combination thereof.

[0005] In a further aspect, the disclosure relates to methods of diagnosing Type B MS in a subject. In some embodiments, the method includes: determining the expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in a sample from the subject, wherein an increase of the expression relative to a control indicates a diagnosis that the subject is afflicted with Type B MS. In some embodiments, the method further includes diagnosing the patient as having Type B MS when the expression is increased relative to the control. In some embodiments, the method further includes administering treatment with one or more pharmaceutical compositions, to the subject diagnosed as having Type B MS. In some embodiments, the treatment includes at least one of an LTβR inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof.

[0006] Another aspect of the disclosure provides methods of diagnosing Type B MS in a subject. In some embodiments, the method includes: (a) contacting a sample from the subject with an agent for specifically detecting expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; (b) determining a level of expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; and (c) comparing the level of expression in the sample with a control level of expression to diagnose Type B MS. In some embodiments, the agent includes a polynucleotide probe that hybridizes specifically with RNA transcribed from gene encoding at least one of CXCR2, CXCR1 , Ltbr, and Sema6B present in the subject. In some embodiments, the agent includes an antibody that binds to at least one of CXCR2, CXCR1 , Ltbr, and Sema6B.

[0007] In some embodiments, the methods further include diagnosing the patient as having Type B MS when the level of expression is increased relative to the control. In some

embodiments, the methods further include administering treatment with one or more

pharmaceutical compositions, to the subject diagnosed as having Type B MS. In some embodiments, the treatment includes at least one of an LTβR inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof. [0008] In a further aspect, the disclosure relates to methods of predicting responsiveness of a subject with MS to treatment with ΙΡΝβ. In some embodiments, the method includes (a) contacting a sample from the subject with an agent for specifically detecting expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; (b) determining a level of expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; (c) comparing the level of expression in the sample with a control level of expression; and (d) determining that the subject is not responsive to treatment with ΙΡΝβ when the level of expression is increased, and that the subject is responsive to treatment with ΙΡΝβ when the level of expression is the same or decreased. In some embodiments, the method further includes administering treatment with one or more pharmaceutical compositions, to the subject determined to be not responsive to treatment with ΙΡΝβ. In such embodiments, the treatment may include at least one of an LTβR inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof. In some embodiments, the method further includes administering treatment with one or more pharmaceutical compositions, to the subject determined to be responsive to treatment with ΙΡΝβ. In such embodiments, the treatment may include ΙΡΝβ.

[0009] In some embodiments, the expression is measured by determining at least one of mRNA levels, protein levels, or protein activity levels. In some embodiments, the determining step includes at least one of PCR or antibody binding. In some embodiments, the sample includes peripheral blood mononuclear cells (PBMCs).

[00010] The disclosure provides for other aspects and embodiments that will be apparent in light of the following detailed description and accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS

[00011] FIG. 1 shows that type-B EAE develops independent of the NLRP3 inflammasome and is resistant to ΙΡΝβ treatment. (A) EAE scores after Type-B EAE induction (n=5). AUC was calculated from Type-A and Type-B EAE data between day 0-23 dpi. (B,C) Numbers of total CD4+ T cells (B) and Th17 cells (C) in the brains and spinal cords of mice with Type-B EAE at 17-dpi, n=4. (D, E) Serum levels of I L-1 β and ΙΡΝβ in naive mice, Type-A and Type-B EAE mice at 9-dpi. (F) EAE scores of Type-B EAE mice with or without ΙΡΝβ treatment (n=5, AUC between 0-30 dpi). (G) EAE scores of WT and Nlrp3-1 mice immunized with a Type-A EAE induction method with MHV68 infection (left panel), and WT Type-A EAE mice infected with MHV68 with or without ΙΡΝβ treatment (right panel). MHV68 (105 pfu/mouse) was i.v. administered at the same time as Type-A EAE immunization (n=5). (H) Cell number ratios shown as brain-infiltrated cells divided by spinal-cord infiltrated cells (n=7). (I) Representative LFB-stained images with red arrows indicating regions of demyelination. All the CNS samples were harvested at 17-dpi (*; p<0.05). (J) T2 FLAIR MRI analysis of brain obtained from mice at 18-dpi. Yellow arrows indicate cortical region and external capsule. Image from Type B EAE mice exhibits the potential loss of myelin. Disease scores were presented as mean ± SEM for each group.

[00012] FIG. 2 shows that ml_T is a key initiator of Type-B EAE. (A) Expression levels of Lta mRNA) in DCs obtained front DLNs of naive mice or mice at 9 dpi. (B) Percentages of DCs, positive for cell surface LTa expression, in DLNs of naive mice or mice with EAE at 9-dpi, determined by flow cytometry. (C) Methylation analysis by bisulfite conversion with DCs obtained from DLNs, pooled from eight WT mice, Type-A and Type-B EAE at 9-dpi. Methylated and unmethylated CpG were shown with black and gray boxes, respectively. (D) EAE scores of WT mice after Type-A and Type-B induction with or without LTβR-Fc treatment (n=5-9). (E) Nlrp3-1 mice were immunized with the Type-A EAE induction method and treated with or without rLT. rLT (10 μg/kg) was i.p. administrated daily between 0-9 dpi (n=5). (F) rLT-treated WT B6 mice induced for Type-A EAE were treated with or without ΙΡΝβ (n=5). (G) Ratio of infiltrated cell numbers in the brain versus spinal cord at 17-dpi. (H) Lta mRNA expression in DCs treated with rlL-17 (10 ng/mL) or rlFNv (10 ng/mL) for 3 h. DCs were obtained from naive WT mice (*; p<0.05). (I) Th17-mediated passive EAE in WT (with or without LTβR-Fc treatment) and Asc-1 mice (n=5).

[00013] FIG. 3. Gene expression profile of CD4+ T cells between Type-A and Type-B. CD4+ T cells were FACS-purified from spleens at 9-dpi and submitted for the RNA-seq analysis. (A) Heatmap of 1846 differentially expressed genes (P<0.05; log2FC >l or <-1) between CD4+ T cells from Type-A and Type-B EAE mice. (B) Scatter plot comparing transcriptome. (C)

Selected genes from pools with P<-0.01 , log2FC >1 or <-1 , and a log2CPM>1.

[00014] FIG. 4. Expression of Cxcr2, Cxcrl , and Ltbr to characterize ΙΡΝβ-Γβ3ί3ί3ηί EAE and MS. (A) Cell numbers for indicated cell populations in DLNs and spleen at 9-dpi (n=7) from mice with either Type-A or Type-B EAE. (B) mRNA levels of Cxcr2, Cxcrl , and Ltbr in splenic CD4+ T cells obtained from naive mice and mice with Type-A or Type-B EAE induction at 9-dpi determined by qPCR. (C) Levels of Cxcr2, Cxcrl , and Ltbr mRNA in CD4+ T 6 h after rLT1 treatment at indicated concentrations. (D) Proportions of CXCR2-positive cells and MFI of CXCR2 staining in splenic CD+ T cells obtained from naive mice and mice with Type-A or Type- B EAE induction at 9-dpi determined by flow, cytometry. (E) Relative expression of Cxcr2, Cxcrl , and Ltbr normalized by Vcaml in total PBMCs from IFIS^-responder and non-responder RRMS patients. One circle denotes one patient (*; p<0.05).

[00015] FIG. 5. Involvement of the CXCL1 and CXCR2 in Type-B EAE development. (A) Transwell migration assay towards rCXCL.1 using splenic CD4+ T cells harvested from indicated mice (n=4). (B) Levels of CXCL1 in serum from naive mice or mice with Type-A or Type-B EAE mice on 9-dpi determined by ELISA. (C) CXCL1 staining in the choroid plexus on 9-dpi. (D) Levels of CXCL1 in serum from Type-B EAE with or without LTβR-Fc treatment on 9 dpi. (E) Score of Type-A or Type-B EAE treated with or without SB225002 (n=5-7). (F) EAE score in Lck-Cre Cxcr2 l mice (CXCR2-cKO) and Cxcr2 fl fl mice (control)(*; p<0.05).

[00016] FIG. 6. Persistent disease severity and spinal transected neurites in Type-B EAE mice. (A) EAE scores in WT mice after Type-A and Type-B EAE induction (n=9). (B)

Representative LFB-stained images of spinal cord sections. Yellow lines indicate regions of demyelination. (C) Representative silver staining images to show neurons in spinal cord sections. Areas within the yellow rectangles were enlarged. (D) Motor neuron stereology. Total Niss1 + and a-motor neuron in lumber region of the spinal ventral horn were evaluated. All the CNS samples were harvested on 70-dpi.

[00017] FIG. 7. Type-B EAE-derived T cells cause neuronal retraction. (A-C) CD4+ T cells were obtained from spleens of either naive, Type-A EAE, or Type-B EAE mice; then, co-cultured with neurons. Representative images of hippocampal neuron stained with MAP2 (red) and DAPI (blue) one day after co-culture with indicated CD4+ T cells (A). Scale bars denote 50 μηι. (B) Average numbers of axon and dendrite branches per neuron (left panel) and distributions of branch numbers (right panel)(C). (D) mRNA expression levels of genes encoding proteins in semaphorin and ephrin families in CD4+ T cells from Type-A and Type-B EAE mice at 9-dpi. Data denote as ratio of gene expression in CD4+ T cells from naive mice. (E, F) CD4+ T cells were obtained from either naive or Type-B EAE mice, and Sema6b mRNA was knocked down by shRNA in the indicated group. T cells were then co-cultured with neurons. Representative images of neurons stained with MAP2 (red) and DAPI (blue)(E). Average neurite lengths (F, left panel) and average numbers of axon and dendrite branches per neuron (F, right panel).

Results are expressed as the mean ± SEM by three independent experiments. (G) Expression levels of Sema6b mRNA in CD4+ T cells isolated from Type-A EAE mice with or without rLT treatment for 6 h. (H) Representative images of MAP2-stained neurons in co-culture with rl_T- treated T cell. Average neurite lengths and numbers of axon and dendrites branches per neuron were analyzed and shown. One-hundred % denotes the values obtained from neurons co-cultured with naive T cells (n=3; scale bars, 50 μηι).

[00018] FIG. 8. EAE induced by several immunization methods and phenotypic effects on cell migration, demyelination and nociceptive sensitivity in mice with type A and type B EAE.

(A) EAE severity in Nlrp mice was evaluated. EAE was induced with 6 different methods. (B) AUC between 0 and 20-dpi. Method 1 (n=4), Method 2-6 (n=5). (C) Numbers of total immune cells were evaluated in the brains and spinal cords (S.C.) of mice with Type-B EAE at 17-dpi. n=4. (D) ΙΡΝβ treatment on Nlrp3' ~ mice with Type-B EAE induced with Method 6. ΙΡΝβ (3x10 4 unit/mouse) were i.p. injected every other day from day 0 to 8 as previously performed. (E) Time course on body weight change in Type-A and Type-B EAE. (E) Infiltrated cell numbers in the brain and spinal cord (n=7). (F) T2 FLAIR MRI analysis of spinal cords obtained from mice at 18-dpi. Yellow arrows indicate areas of potential myelin loss. (G) Thermal sensitivity evaluated by a hot-plate test in 9-dpi mice, which did not show any EAE symptoms and motor dysfunction (n=8; *, p<0.05) All statistical analyses in this figure were performed by two-tailed unpaired Student's f-test. All the experimental data and images are representatives from at least 2 similar experiments for each.

[00019] FIG. 9. ml_T expression on DC. (A) Flow charts showing ml_T expression in DC (CD1 1c + gated) obtained from naive mice, Type-A EAE mice, and Type-B EAE mice at 9-dpi.

(B) Methylation analysis was carried out by bisulfite conversion on the Lta promoter in DCs from naive mice. Methylated and unmethylated CpG were shown with black and gray boxes, respectively. (C) mRNA levels of 111 rn, CxcHO, Ccl9, Cxcr5, and Ltbr in bone marrow-derived DCs (BMDCs) after treatment with rl_T (1 or 10 ng/mL) for 6 h. Levels of mRNA were evaluated by qPCR. Triplicate qPCR for a single mouse. Three mice per group. (D) Ltbr mRNA levels in DCs obtained from naive mice, Type-A EAE mice, and Type-B EAE mice at 9- dpi. (E) 111 rn mRNA levels in DCs with or without LTβR-Fc treatment. DCs were isolated from DLNs at9-dpi (*; p<0.05).

[00020] FIG. 10. RNA-seq analysis. Heatmap for differentially expressed genes in CD4 + T cells isolated from naive, Type-A EAE mice, and Type-B EAE mice at 9-dpi. Genes and samples have been clustered using correlation distance with complete linkage. A gene is listed on the heatmap if it had a p-value <= 0.05 and a log 2 FC >1 or < -1. [00021] FIG. 11. Comparison of cell populations and gene expression in mouse and RRMS patients who have diseases that do not respond to ΙΡΝβ therapies. (A) Numbers of indicated cell types obtained from DLNs and spleen on 17-dpi were evaluated between Type-A and Type- B EAE (n=4). (B, C) Representative flow charts (B) and proportion (C) for GM-CSF-producing Th1 and Th17 cells from Type-A and Type-B EAE at 9-dpi (n=6). Th17: /^0.6568, t(10)=0.4579, Th1 : P=0.3954, t(10)=0.8879. (D) Flow cytometry results showing CXCR2 protein expression on the CD4 + T surface in each group (naive mice, Type-A, or Type-B EAE mice at 9-dpi). (E) Proportions and MFI of CXCR2 + neutrophils and macrophages obtained from naive mice and mice with either Type-A or Type-B EAE at 9-dpi (n=4). (F) Comparison of relative gene expression levels between LTBR and CXCR1, CXCR1 and CXCR2, LTBR and CXCR2, normalized to VCAM1 expression. Total PBMCs from RRMS patients who responded to ΙΡΝβ and those who did not respond to ΙΡΝβ were compared. All statistical analyses in this figure were performed by two-tailed unpaired Student's f-test. All the experimental data sets are representatives from at least 2 similar experiments for each.

[00022] FIG. 12. CXCL1 expression in spinal cords. Shown are representative images of typical CXCL1 staining in spinal cords from naive mice and mice with either Type-A or Type-B EAE at 9-dpi (scale bars, 200 μηι). Images are representatives from 3 similar experiments.

[00023] FIG. 13. Histology of spinal cords in mice with type A or type B EAE. Shown are representative images of typical staining from multiple mice. (A) H/E staining in the spinal cord of Type-A and Type-B EAE mice at 70-dpi. (B) IGF-1 staining in spinal cord of naive mice and mice with either Type-A or Type-B EAE at 22-dpi. (C, D) Golgi's silver staining in spinal cord of naive mice (D), and Type-A and Type-B at 22-dpi (C). All images are representatives from 3 similar experiments.

[00024] FIG. 14. Sema6b shRNA knockdown in T cells. Sema6b expression levels in CD4 + T cells isolated from naive or Type-B EAE mice at 9-dpi were evaluated by qPCR. Sema6b was knocked down by shRNA in the indicated group of CD4 + T cells. Control shRNA (scrambled shRNA sequence) was used for the control group. Values shown are obtained from three independent trials using one mouse per each (n=3).

[00025] FIG. 15. Schematic diagram of the distinct pathology of the two EAE subtypes. Type-A EAE is NLRP3 inflammasome-dependent and ΙΡΝβ-εβηείίίνβ. Type-B EAE is induced by immunization with higher doses of Mtb than Type-A EAE induction, and is NLRP3 inflammasome-independent and ΙΡΝβ-resistant. Type-B EAE can also be induced with Type-A EAE induction methods with MHV68 infection or with rl_T (Γΐ_Τα2β1) injection. In Type-B EAE, Lta gene expression is epigenetically induced in DCs and the expression of membrane-bound LT (ml_T) on DCs are enhanced. ml_T stimulate LT R on CD4 + T cells, resulting in the upregulation of CXCR2 on CD4 + T cells. Blockade of Ι_ΤβΡχ (with LJ^R-Fc) and CXCR2 (with SB225002) selectively inhibits the Type-B EAE progression. ml_T is also involved in the induction of Sema6B in T cells. Sema6B causes neural damages, and this may be a reason for the prolonged and minimal remission in Type-B EAE.

DETAILED DESCRIPTION

[00026] Autoimmune diseases have a heterogeneous nature and often consist of distinct subtypes of diseases. The heterogeneity makes it difficult to treat autoimmune diseases.

Provided herein is a method to diagnose subtypes of CNS autoimmune diseases and to more efficiently treat them by determining the subtype.

[00027] Described herein are methods of diagnosing a newly characterized subtype of MS, referred to as Type B MS. Type B MS is non-responsive to the conventional MS treatment with ΙΡΝβ. Causes for the resistance to ΙΡΝβ treatment and the heterogeneity of MS etiology were largely unknown. However, as detailed herein, the inventors have discovered the biochemical distinction between ΙΡΝβ-responsive MS and ΙΡΝβ-ηοη-responsive MS, thereby facilitating the classification and diagnosis of Type A MS and Type B MS. Described herein are also methods of treating a central nervous system (CNS) autoimmune disease. The methods may include targeting biomarkers in the biochemical pathways that distinguish Type A MS from Type B MS.

1. Definitions

[00028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting. [00029] The terms "comprise(s)," "include(s)," "having," "has," "can," "contain(s)," and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms "a," "and" and "the" include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments "comprising," "consisting of" and "consisting essentially of," the embodiments or elements presented herein, whether explicitly set forth or not.

[00030] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1 , 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[00031] The term "about" as used herein as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain aspects, the term "about" refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11 %, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[00032] The term "administration" or "administering," as used herein, refers to providing, contacting, and/or delivery of an agent or an inhibitor by any appropriate route to achieve the desired effect. These agents or inhibitors may be administered to a subject in numerous ways including, but not limited to, orally, ocularly, nasally, intravenously, topically, as aerosols, suppository, etc. and may be used in combination.

[00033] As used herein, the term "biomarker" refers to a naturally occurring biological molecule present in a subject at varying concentrations that is useful in identifying and/or classifying a disease or a condition. The biomarker can include genes, proteins,

polynucleotides, nucleic acids, ribonucleic acids, polypeptides, or other biological molecules used as an indicator or marker for disease. In some embodiments, the biomarker comprises a disease marker. For example, the biomarker can be a gene that is upregulated or

downregulated in a subject that has a disease. As another example, the biomarker can be a polypeptide whose level is increased or decreased in a subject that has a disease or risk of developing a disease. In some embodiments, the biomarker comprises a small molecule. In some embodiments, the biomarker comprises a polypeptide.

[00034] The terms "control," "reference level," and "reference" are used herein

interchangeably. The reference level may be a predetermined value or range, which is employed as a benchmark against which to assess the measured result. "Control group" as used herein refers to a group of control subjects. The predetermined level may be a cutoff value from a control group. The predetermined level may be an average from a control group. Cutoff values (or predetermined cutoff values) may be determined by Adaptive Index Model (AIM) methodology. Cutoff values (or predetermined cutoff values) may be determined by a receiver operating curve (ROC) analysis from biological samples of the patient group. ROC analysis, as generally known in the biological arts, is a determination of the ability of a test to discriminate one condition from another, e.g., to determine the performance of each marker in identifying a patient having CRC. A description of ROC analysis is provided in P.J. Heagerty et al. (Biometrics 2000, 56, 337-44), the disclosure of which is hereby incorporated by reference in its entirety. Alternatively, cutoff values may be determined by a quartile analysis of biological samples of a patient group. For example, a cutoff value may be determined by selecting a value that corresponds to any value in the 25th-75th percentile range, preferably a value that corresponds to the 25th percentile, the 50th percentile or the 75th percentile, and more preferably the 75th percentile. Such statistical analyses may be performed using any method known in the art and can be implemented through any number of commercially available software packages (e.g., from Analyse-it Software Ltd., Leeds, UK; StataCorp LP, College Station, TX; SAS Institute Inc., Cary, NC). The healthy or normal levels or ranges for a target or for a protein activity may be defined in accordance with standard practice. A control may be a subject, or a sample therefrom, whose disease state is known. The subject, or sample therefrom, may be healthy, diseased, diseased prior to treatment, diseased during treatment, diseased after treatment, or healthy after treatment, or a combination thereof. The term "normal subject" as used herein means a healthy subject, i.e. a subject having no clinical signs or symptoms of disease. The normal subject is clinically evaluated for otherwise undetected signs or symptoms of infectious disease, which evaluation may include routine physical examination and/or laboratory testing. In some embodiments, the control is a healthy control. In some embodiments, the control comprises Type A MS. In some embodiments, the control comprises Type B MS. [00035] The term "effective dosage" as used herein means a dosage of a drug effective for periods of time necessary, to achieve the desired therapeutic result. An effective dosage may be determined by a person skilled in the art and may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the drug to elicit a desired response in the individual.

[00036] The terms "inhibit" or "inhibiting" mean that an activity is decreased or prevented in the presence of an inhibitor as opposed to in the absence of the inhibitor. The term "inhibition" refers to the reduction or down regulation of a process or the elimination of a stimulus for a process, which results in the absence or minimization of the expression or activity of a biomarker or polypeptide. Inhibition may be direct or indirect. Inhibition may be specific, that is, the inhibitor inhibits a biomarker or polypeptide and not others.

[00037] "Polynucleotide" as used herein can be single stranded or double stranded, or can contain portions of both double stranded and single stranded sequence. The polynucleotide can be nucleic acid, natural or synthetic, DNA, genomic DNA, cDNA, RNA, or a hybrid, where the polynucleotide can contain combinations of deoxyribo- and ribo-nucleotides, and

combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine. Polynucleotides can be obtained by chemical synthesis methods or by recombinant methods.

[00038] A "peptide" or "polypeptide" is a linked sequence of two or more amino acids linked by peptide bonds. The polypeptide can be natural, synthetic, or a modification or combination of natural and synthetic. Peptides and polypeptides include proteins such as binding proteins, receptors, and antibodies. The terms "polypeptide", "protein," and "peptide" are used

interchangeably herein. "Primary structure" refers to the amino acid sequence of a particular peptide. "Secondary structure" refers to locally ordered, three dimensional structures within a polypeptide. These structures are commonly known as domains, e.g., enzymatic domains, extracellular domains, transmembrane domains, pore domains, and cytoplasmic tail domains. Domains are portions of a polypeptide that form a compact unit of the polypeptide and are typically 15 to 350 amino acids long. Exemplary domains include domains with enzymatic activity or ligand binding activity. Typical domains are made up of sections of lesser organization such as stretches of beta-sheet and alpha-helices. "Tertiary structure" refers to the complete three dimensional structure of a polypeptide monomer. "Quaternary structure" refers to the three dimensional structure formed by the noncovalent association of independent tertiary units. [00039] The term "predetermined cutoff" and "predetermined level" as used herein means an assay cutoff value that is used to assess diagnostic, prognostic, or therapeutic efficacy results by comparing the assay results against the predetermined cutoff/level, where the predetermined cutoff/level already has been linked or associated with various clinical parameters (e.g., presence of disease, stage of disease, severity of disease, progression, non-progression, or improvement of disease, etc.). The disclosure provides exemplary predetermined levels.

However, it is well-known that cutoff values may vary depending on the nature of the

immunoassay (e.g., antibodies employed, reaction conditions, sample purity, etc.). It further is well within the ordinary skill of one in the art to adapt the disclosure herein for other

immunoassays to obtain immunoassay-specific cutoff values for those other immunoassays based on the description provided by this disclosure. Whereas the precise value of the predetermined cutoff/level may vary between assays, the correlations as described herein should be generally applicable.

[00040] "Reporter," "reporter group," "label," and "detectable label" are used interchangeably herein. The reporter is capable of generating a detectable signal. The label can produce a signal that is detectable by visual or instrumental means. A variety of reporter groups can be used, differing in the physical nature of signal transduction (e.g., fluorescence, electrochemical, nuclear magnetic resonance (NMR), and electron paramagnetic resonance (EPR)) and in the chemical nature of the reporter group. Various reporters include signal-producing substances, such as chromagens, fluorescent compounds, chemiluminescent compounds, radioactive compounds, and the like. In some embodiments, the reporter comprises a radiolabel.

Reporters may include moieties that produce light, e.g., acridinium compounds, and moieties that produce fluorescence, e.g., fluorescein. In some embodiments, the signal from the reporter is a fluorescent signal. The reporter may comprise a fluorophore. Examples of fluorophores include, but are not limited to, acrylodan (6-acryloy 1-2-dimethylaminonaphthalene), badan (6- bromo-acetyl-2-dimethylamino-naphthalene), rhodamine, naphthalene, danzyl aziridine, 4-[N- [(2-iodoacetoxy)ethyl]-N-methylamino]-7-nitrobenz-2-oxa-1 ,3-diazole ester (IANBDE), 4-[N-[(2- iodoacetoxy)ethyl]-N-methylamino-7-nitrobenz-2-oxa-1 ,3-diazole (IANBDA), fluorescein, dipyrrometheneboron difluoride (BODIPY), 4-nitrobenzo[c][1 ,2,5]oxadiazole (NBD), Alexa fluorescent dyes, and derivatives thereof. Fluorescein derivatives may include, for example, 5- fluorescein, 6-carboxyfluorescein, 3'6-carboxyfluorescein, 5(6)-carboxyfluorescein, 6- hexachlorofluorescein, 6-tetrachlorofluorescein, fluorescein, and isothiocyanate. [00041] The term "risk assessment," "risk classification," "risk identification," or "risk stratification" as used herein interchangeably, means an evaluation of factors including biomarkers, to predict the risk of occurrence of future events including disease onset or disease progression, so that treatment decisions regarding the subject may be made on a more informed basis.

[00042] "Sample" or "test sample" as used herein can mean any sample in which the presence and/or level of a biomarker or target is to be detected or determined. Samples may include liquids, solutions, emulsions, mixtures, or suspensions. Samples may include a medical sample. Samples may include any biological fluid or tissue, such as blood, whole blood, fractions of blood such as plasma and serum, peripheral blood mononuclear cells (PBMCs), muscle, interstitial fluid, sweat, saliva, urine, tears, synovial fluid, bone marrow, cerebrospinal fluid, nasal secretions, sputum, amniotic fluid, bronchoalveolar lavage fluid, gastric lavage, emesis, fecal matter, lung tissue, peripheral blood mononuclear cells, total white blood cells, lymph node cells, spleen cells, tonsil cells, cancer cells, tumor cells, bile, digestive fluid, skin, or combinations thereof. In some embodiments, the sample comprises an aliquot. In other embodiments, the sample comprises a biological fluid. Samples can be obtained by any means known in the art. The sample can be used directly as obtained from a patient or can be pre- treated, such as by filtration, distillation, extraction, concentration, centrifugation, inactivation of interfering components, addition of reagents, and the like, to modify the character of the sample in some manner as discussed herein or otherwise as is known in the art. Samples may be obtained before treatment, before diagnosis, during treatment, after treatment, or after diagnosis, or a combination thereof.

[00043] "Subject" as used herein can mean a mammal that wants or is in need of the herein described conjugates or fusion proteins. The subject may be a human or a non-human animal. The subject may be a mammal. The mammal may be a primate or a non-primate. The mammal can be a primate such as a human; a non-primate such as, for example, dog, cat, horse, cow, pig, mouse, rat, camel, llama, goat, rabbit, sheep, hamster, and guinea pig; or non- human primate such as, for example, monkey, chimpanzee, gorilla, orangutan, and gibbon. The subject may be of any age or stage of development, such as, for example, an adult, an adolescent, or an infant.

[00044] The terms "treat," "treated," or "treating" as used herein refers to a therapeutic wherein the object is to slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results. For the purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (i.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of the condition, disorder or disease; amelioration of the condition, disorder or disease state; and remission (whether partial or total), whether detectable or undetectable, or enhancement or improvement of the condition, disorder or disease. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.

[00045] "Variant" as used herein with respect to a polynucleotide means (i) a portion or fragment of a referenced nucleotide sequence; (ii) the complement of a referenced nucleotide sequence or portion thereof; (iii) a polynucleotide that is substantially identical to a referenced polynucleotide or the complement thereof; or (iv) a polynucleotide that hybridizes under stringent conditions to the referenced polynucleotide, complement thereof, or a sequences substantially identical thereto.

[00046] A "variant" can further be defined as a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity. Representative examples of "biological activity" include the ability to be bound by a specific antibody or polypeptide or to promote an immune response. Variant can mean a substantially identical sequence. Variant can mean a functional fragment thereof. Variant can also mean multiple copies of a polypeptide. The multiple copies can be in tandem or separated by a linker. Variant can also mean a polypeptide with an amino acid sequence that is substantially identical to a referenced polypeptide with an amino acid sequence that retains at least one biological activity. A conservative substitution of an amino acid, i.e., replacing an amino acid with a different amino acid of similar properties (e.g., hydrophilicity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes can be identified, in part, by considering the hydropathic index of amino acids. See Kyte et al., J. Mol. Biol. 1982, 157, 105-132. The hydropathic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indexes can be substituted and still retain protein function. In one aspect, amino acids having hydropathic indices of ±2 are substituted. The hydrophobicity of amino acids can also be used to reveal substitutions that would result in polypeptides retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a polypeptide permits calculation of the greatest local average hydrophilicity of that polypeptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity, as discussed in U.S. Patent No. 4,554,101 , which is fully incorporated herein by reference. Substitution of amino acids having similar hydrophilicity values can result in polypeptides retaining biological activity, for example immunogenicity, as is understood in the art. Substitutions can be performed with amino acids having hydrophilicity values within ±2 of each other. Both the hydrophobicity index and the hydrophilicity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophilicity, charge, size, and other properties. A variant can be a polynucleotide sequence that is substantially identical over the full length of the full gene sequence or a fragment thereof. The polynucleotide sequence can be 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the gene sequence or a fragment thereof. A variant can be an amino acid sequence that is substantially identical over the full length of the amino acid sequence or fragment thereof. The amino acid sequence can be 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the amino acid sequence or a fragment thereof. In some embodiments, variants include homologues. Homologues may be

polynucleotides or polypeptides or genes inherited in two species by a common ancestor.

2. Central Nervous System (CNS) Autoimmune Disease

[00047] Provided herein are methods for treating and diagnosing a central nervous system (CNS) autoimmune disease. CNS disorders affect the structure or function of the spinal cord, the brain, or both, which form the central nervous system. The brain is the main organ of the CNS and is protected by the skull. The spinal cord transmits sensory reception from the peripheral nervous system to the brain, and it also conducts motor information to the body's skeletal muscles, cardiac muscles, smooth muscles, and glands. The spinal cord includes multiple pairs of spinal nerves. These nerves each contain both sensory and motor axons. The spinal cord is protected by vertebrae and connects the peripheral nervous system to the brain. The peripheral nervous system includes the nerves and ganglia beyond the brain and spinal cord. Autoimmune disorders are disorders caused by an abnormal immune response, wherein the immune system attacks the body's own tissues and cells as if they were foreign. CNS autoimmune disorders are those in which the immune system attacks the body's own CNS as if it were foreign.

[00048] CNS autoimmune diseases include, but are not limited to, multiple sclerosis, myasthenia gravis, Guillain-Barre syndrome, transverse myelitis, and chronic inflammatory demyelinating polyneuropathy. a. Multiple Sclerosis

[00049] Multiple Sclerosis (MS) is a chronic inflammatory autoimmune disorder of the CNS in which the myelin sheaths in the spinal cord and/or brain that coat nerves and assist in nerve impulses are destroyed and/or damaged. Demyelination is the destruction of the myelin sheaths. Symptoms of MS include autonomic, visual, motor, and/or sensory problems; difficulty or loss of balance or coordination; numbness; difficulty walking; muscle weakness; bowel and bladder symptoms; eye symptoms including double vision, vision loss, and blindness; muscle spasms; problems with speech; problems with swallowing; acute or chronic pain; depression, mood swings, and memory loss. MS symptoms may be progressive (progressive MS), or they may relapse with symptoms partially or fully improving in between episodes (relapsing-remitting MS, or RRMS).

[00050] Conventional treatments for MS include, for example, interferon-β (ΙΡΝβ), natalizumab, and glatiramer acetate. ΙΡΝβ is a conventional first-line treatment for MS, but it is not effective for a significant proportion of MS patients.

[00051] An experimental autoimmune encephalomyelitis (EAE) model was used to examine

MS. The NLRP3 inflammasome plays a role in EAE development. Nlrp3 " ^ " mice are resistant to EAE and have fewer Th1 and Th17 cells in the peripheral lymphoid tissues and in the CNS. The lack of the NLRP3 inflammasome in antigen presenting cells (APCs) prevents T helper cells and APCs from migrating to the CNS due to reduced chemokine and chemokine receptor upregulation.

[00052] ΙΡΝβ suppresses NLRP3 inflammasome activity; thus, the NLRP3 inflammasome is a target of ΙΡΝβ treatment in EAE. Although the NLRP3 inflammasome plays a role in EAE development, EAE can be induced in its absence. As detailed in the Examples, EAE induction methods using high dosages of Mtb (heat-killed Mycobacteria as an adjuvant) is sufficient to induce EAE without the NLRP3 inflammasome, and such NLRP3-independent EAE is not ameliorated by \ FU$ treatment. Thus, \ FU$ is effective when EAE is developed in an NLRP3 inflammasome-dependent fashion. I FIS^-resistant EAE can be induced by altering the intensity of innate immune activation.

[00053] As detailed in the Examples, it was found using the EAE model that the addition of extra adjuvant in immunization or acute infection induced an I FIS^-resistant EAE subtype. Pathogenesis of the I FIS^-resistant EAE subtype, which involved membrane-bound lymphotoxin and CXCR2 and is characterized by minimal remission, was successfully ameliorated by antagonists of LTfiR or CXCR2. Evaluation of CXCR2 and LTfiR relative mRNA levels identified both I FIS^-resistant EAE and I FIS^-nonresponder relapsing-remitting MS patients. Functionally, mice with IFIS^-nonresponder relapsing-remitting EAE showed reduced a-motor neuron and shortened neurites mediated by semaphorin 6B on the surface CD4+ T cells. This demonstrated molecular and cellular mechanisms by which the disease heterogeneity is induced.

[00054] MS may be classified as Type A MS or Type B MS. i) Type A

[00055] Type A MS refers to MS that is responsive to Ι ΡΝβ treatment. Type A MS may also be referred to as NLRP3 inflammasome-dependent MS. Type A MS may include reversible neuronal damage and demyelination. Type A MS may be characterized by an increased amount of leukocytes, more demyelination, or a combination thereof, in the spinal cord compared to a control. In some embodiments, the control is a healthy control. In some embodiments, the control comprises Type B MS. ii) Type B

[00056] Type B MS refers to MS that is non-responsive to I FN β treatment. Type B MS may also be referred to as N LRP3 inflammasome-independent MS. Subjects with Type-B MS may not display disease remission due to irreversible neuronal damage and demyelination. Type B MS may be characterized by an increased amount of leukocytes, more demyelination, or a combination thereof, in the brain and/or optic nerve compared to a control. The neuronal damage in Type-B EAE may be caused by a neuronal guidance molecule semaphorin 6B (Sema6B; a class 6 transmembrane semaphorin) expressed on the T cells and upregulated through LT&R signaling. Type B MS may be induced by LT&R signaling and its downstream effectors CXCR2 and Sema6B. Type B MS may also be induced by aggressive immunization. Aggressive immunization may include, for example, administering an antigen such as Mtb in an amount sufficient to induce an acute immune response. As detailed in the Examples, high doses of Mtb alters the methylation status of the lymphotoxin-a (LTa) promoter and induces expression of the LTa gene in dendritic cells (DCs). Together with Ι_Τβ, LTa forms a

heterotrimeric (ίΤα1 β2) membrane-bound lymphotoxin (mLT) on DCs in Type B MS. Type B MS may also induce increased expression of CXCR2 in neutrophils and CD4+ T cells compared to a control.

[00057] In some embodiments, Type B MS is characterized by at least one of irreversible neuronal damage, demyelination, or a combination thereof; irresponsiveness to treatment with ΙΡΝβ; lack of activation of the NLRP3 inflammasome; increased expression of CXCR2, CXCR1 , LTβR, or Sema6B; increased levels of B cells in the DLNs; or a combination thereof, relative to a control. In some embodiments, the control is a healthy control. In some embodiments, the expression of CXCR2 is increased in neutrophils, CD4+ cells, or a combination thereof. In some embodiments, the control is a healthy control. In some embodiments, the control comprises Type A MS.

[00058] Type B MS may be treated with inhibitors targeting biomarkers that distinguish Type A MS and Type B MS. Type B MS may be treated with inhibitors of LTβR (mLT receptor), inhibitors of CXCR1 , inhibitors of CXCR2, inhibitors of Sema6, or combinations thereof.

3. Biomarkers

[00059] In some embodiments, Type B MS biomarkers include LTβR (mLT receptor), CXCR1 , CXCR2, and Sema6. a. LTpR

[00060] Lymphotoxin beta receptor (LTβR), also known as tumor necrosis factor receptor superfamily member 3 (TNFRSF3), is a cell surface receptor for lymphotoxin. LTβR specifically binds the lymphotoxin membrane form (mLT), which is a complex of lymphotoxin-alpha (LTa) and lymphtoxin-beta (ΙΤβ). Together with ίΤβ, LTa forms the heterotrimeric (ίΤα1 β2) membrane-bound lymphotoxin (mLT). LTβR and mLT are involved in apoptosis, cytokine release, and the development and organization of lymphoid tissue and transformed cells. [00061] An example of a LT R polypeptide is one according to Accession No. NP_034866. In some embodiments, a LT R polypeptide comprises an amino acid sequence of SEQ ID NO: 41 , or a variant thereof. In some embodiments, a polynucleotide encodes a polypeptide of SEQ ID NO: 41 , or a variant thereof.

[00062] Inhibitors of LT R may include antibodies that bind LT&R, siRNA directed to a polynucleotide encoding LT&R, peptides, or small molecule inhibitors specific for LT&R. b. CXCR1

[00063] C-X-C motif chemokine receptor 1 (CXCR1 ; also referred to as Interleukin 8 receptor alpha) is a chemokine receptor. CXCR1 binds to Interleukin 8 (IL8) with high affinity and transduces the signal through a G-protein-activated second messenger system. Stimulation of CXCR1 in neutrophils by IL8 leads to neutrophil chemotaxis and activation.

[00064] An example of a CXCR1 polypeptide is one according to Accession No. NP_839972. In some embodiments, a CXCR1 polypeptide comprises an amino acid sequence of SEQ ID NO: 42, or a variant thereof. In some embodiments, a polynucleotide encodes a polypeptide of SEQ ID NO: 42, or a variant thereof.

[00065] Inhibitors of CXCR1 may include antibodies that bind CXCR1 , siRNA directed to a polynucleotide encoding CXCR1 , peptides, or small molecule inhibitors specific for CXCR1. c. CXCR2

[00066] C-X-C motif chemokine receptor 2 (CXCR2; also referred to as Interleukin 8 receptor beta) is a chemokine receptor. CXCR2 binds to Interleukin 8 (IL8) with high affinity and transduces the signal through a G-protein-activated second messenger system. CXCR2 also binds CXCL1 , CXCL2, CXCL3, and CXCL5.

[00067] An example of a CXCR2 polypeptide is one according to Accession No. NP_034039. In some embodiments, a CXCR2 polypeptide comprises an amino acid sequence of SEQ ID NO: 43, or a variant thereof. In some embodiments, a polynucleotide encodes a polypeptide of SEQ ID NO: 43, or a variant thereof.

[00068] Inhibitors of CXCR2 may include antibodies that bind CXCR2, siRNA directed to a polynucleotide encoding CXCR2, peptides, or small molecule inhibitors specific for CXCR2. In some embodiments, the CXCR2 inhibitor comprises SB225002 (N-(2-Bromophenyl)-N'-(2- hydroxy-4-nitrophenyl)urea, which may be purchased from Tocris (Bristol, UK), catalog no. 2725). d. Sema6

[00069] Semaphorin 6B (Sema6B) is a class 6 transmembrane semaphorin. Semaphorins are a class of secreted and membrane proteins that were originally identified as axonal growth cone guidance molecules. Semaphorins may signal through multimeric receptor complexes and may act as short-range inhibitory signals. Semaphorins may act as cues to deflect axons from inappropriate regions, as in, for example, neural system development.

[00070] An example of a Sema6B polypeptide is one according to Accession No.

NP_001 123928. In some embodiments, a Sema6B polypeptide comprises an amino acid sequence of SEQ ID NO: 44, or a variant thereof. In some embodiments, a polynucleotide encodes a polypeptide of SEQ ID NO: 44, or a variant thereof.

[00071] Inhibitors of Sema6 may include antibodies that bind Sema6, siRNA directed to a polynucleotide encoding Sema6, peptides, or small molecule inhibitors specific for Sema6.

4. Detection of Biomarkers

[00072] As used herein, the term "detect" or "determine the presence of" refers to the qualitative measurement of undetectable, low, normal, or high concentrations of one or more biomarkers. Detection may include in vitro, ex vivo, or in vivo detection. Detection may include detecting the presence of one or more biomarkers versus the absence of the one or more biomarkers. Detection may also include quantification of the level of one or more biomarkers. The term "quantify" or "quantification" may be used interchangeably, and may refer to a process of determining the quantity or abundance of a substance (e.g., biomarker), whether relative or absolute.

[00073] Biomarkers or expression thereof as described herein may be detected and/or measured at the polynucleotide level, the polypeptide level, or a combination thereof.

Expression may be detected and/or measured by any means known by one of skill in the art such as, for example, immunohistochemistry, antibody binding, hybridization of a probe, arrays, microarrays, PCR, real time RT-PCR, RNA in situ hybridization, RNAse protection assay, Northern analysis, magnetic particles (e.g., microparticles or nanoparticles), Southern analysis, Western analysis, ELISA, expression reporter plasmids, DNA-chip analysis with primers, HPLC, mass spectrometry, protein microarray analysis, PAGE analysis, isoelectric focusing, 2-D gel electrophoresis, enzymatic assays, and any method or system involving flow cytometry.

Binding with antibodies may include, for example, antibodies tethered to or associated with a reporter or an imaging agent, ELISA, and arrays. The ELISA may be a sandwich ELISA. In some embodiments, the biomarker itself as a polypeptide is detected by antibody binding or any suitable immunohistochemistry method. In some embodiments, a polynucleotide encoding the biomarker may be detected by hybridization with a probe. In some embodiments, expression of a polynucleotide encoding the biomarker may be detected using microarray analysis. In some embodiments, an antibody or probe may be labeled with a reported for detection. In some embodiments, the amount or level of polypeptide or gene expression may be quantified. In some embodiments, expression may be measured by determining at least one of mRNA levels, protein levels, or protein activity levels of the biomarker.

[00074] In some embodiments, a biomarker or expression thereof is detected at the polynucleotide level. In some embodiments, at least one nucleic acid probe specifically binds or hybridizes to a polynucleotide encoding the biomarker polypeptide to form a complex, and the complex is detected. In some embodiments, RT-PCR is used to amplify a polynucleotide encoding the biomarker polypeptide with specific primers. In some embodiments, quantitative RT-PCR is used to amplify a polynucleotide encoding the biomarker polypeptide with specific primers. In some embodiments, rolling circle amplification is used to amplify a polynucleotide encoding the biomarker polypeptide. In some embodiments, strand displacement amplification is used to amplify a polynucleotide encoding the biomarker polypeptide.

[00075] In some embodiments, a biomarker or expression thereof is detected at the polypeptide level. In some embodiments, a biomarker or expression thereof is detected by using molecules which bind to the biomarker polypeptide. Suitable molecules/agents which bind either directly or indirectly to the biomarker polypeptide in order to detect its presence include naturally occurring molecules such as peptides and proteins, for example antibodies, or they may be synthetic molecules. In some embodiments, a sample is contacted with an antibody capable of binding the biomarker polypeptide and monitoring the sample for the presence of the polypeptide. The antibody may be a monoclonal antibody or polyclonal antibody. The complex formed between the antibody and the biomarker polypeptide may be monitored by any method known in the art, such as, for example, fluorescence resonance energy transfer (FRET), and surface plasmon resonance (SPR). In some embodiments, the biomarker polypeptide is detected by an immunoassay. Immunoassays may include, for example, competitive and noncompetitive assay systems, Western analysis, radioimmunoassays, ELISA, sandwich immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein A immunoassays. Specific immunological binding of the antibody to the biomarker polypeptide can be detected via direct labels, attached to the antibody or via indirect labels, such as alkaline phosphatase or horseradish peroxidase. The use of immobilized antibodies may be incorporated into the immunoassay. The antibodies may be immobilized onto a variety of supports, such as magnetic or chromatographic matrix particles, the surface of an assay plate (such as microtiter wells), pieces of a solid substrate material, and the like. An assay strip can be prepared by coating the antibody or plurality of antibodies in an array on a solid support. This strip can then be dipped into the test biological sample and then processed quickly through washes and detection steps to generate a measurable signal, such as a colored spot.

5. Administration

[00076] A composition may comprise the inhibitor. The inhibitors of biomarkers as detailed above can be formulated into a composition in accordance with standard techniques well known to those skilled in the pharmaceutical art. The composition may be prepared for administration to a subject. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular subject, and the route of administration.

[00077] The inhibitor can be administered prophylactically or therapeutically. In prophylactic administration, the inhibitor can be administered in an amount sufficient to induce a response. In therapeutic applications, the inhibitors are administered to a subject in need thereof in an amount sufficient to elicit a therapeutic effect. An amount adequate to accomplish this is defined as "therapeutically effective dose." Amounts effective for this use will depend on, e.g., the particular composition of the inhibitor regimen administered, the manner of administration, the stage and severity of the disease, the general state of health of the patient, and the judgment of the prescribing physician.

[00078] The inhibitor can be administered by methods well known in the art as described in Donnelly et al. (Ann. Rev. Immunol. 1997, 15, 617-648); Feigner et al. (U.S. Patent No. 5,580,859, issued Dec. 3, 1996); Feigner (U.S. Patent No. 5,703,055, issued Dec. 30, 1997); and Carson et al. (U.S. Patent No. 5,679,647, issued Oct. 21 , 1997), the contents of all of which are incorporated herein by reference in their entirety. The inhibitor can be complexed to particles or beads that can be administered to an individual, for example, using a vaccine gun. One skilled in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration.

[00079] The inhibitor can be delivered via a variety of routes. Typical delivery routes include parenteral administration, e.g., intradermal, intramuscular or subcutaneous delivery. Other routes include oral administration, intranasal, intravaginal, transdermal, intravenous,

intraarterial, intratumoral, intraperitoneal, and epidermal routes. In some embodiments, the inhibitor is administered intravenously, intraarterially, or intraperitoneally to the subject.

[00080] The inhibitor can be a liquid preparation such as a suspension, syrup, or elixir. The inhibitor can be incorporated into liposomes, microspheres, or other polymer matrices (such as by a method described in Feigner et al., U.S. Patent No. 5,703,055; Gregoriadis, Liposome Technology, Vols. I to III (2nd ed. 1993), the contents of which are incorporated herein by reference in their entirety). Liposomes can consist of phospholipids or other lipids, and can be nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer.

[00081] The inhibitor may be used as a vaccine. The vaccine can be administered via electroporation, such as by a method described in U.S. Patent No. 7,664,545, the contents of which are incorporated herein by reference. The electroporation can be by a method and/or apparatus described in U.S. Patent Nos. 6,302,874; 5,676,646; 6,241 ,701 ; 6,233,482;

6,216,034; 6,208,893; 6,192,270; 6, 181 ,964; 6, 150, 148; 6, 120,493; 6,096,020; 6,068,650; and 5,702,359, the contents of which are incorporated herein by reference in their entirety. The electroporation can be carried out via a minimally invasive device.

[00082] In some embodiments, the inhibitor is administered in a controlled release formulation. The inhibitor may be released into the circulation, for example. In some

embodiments, the inhibitor may be released over a period of at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 1 week, at least about 1.5 weeks, at least about 2 weeks, at least about 2.5 weeks, at least about 3.5 weeks, at least about 4 weeks, or at least about 1 month.

6. Methods a. Method of Treating a CNS Autoimmune Disease

[00083] Provided herein are methods of treating a central nervous system (CNS)

autoimmune disease in a subject. The method may include administering to the subject at least one of an LTβR inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof. b. Method of Diagnosing Type B Multiple Sclerosis

[00084] Provided herein are methods of diagnosing Type B MS in a subject. In some embodiments, the methods may include determining the expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in a sample from the subject, wherein an increase of the expression relative to a control indicates a diagnosis that the subject is afflicted with Type B MS. In some embodiments, the methods further include diagnosing the patient as having Type B MS when the expression is increased relative to the control. In some embodiments, the control is a healthy control. In some embodiments, the control comprises Type A MS. In some

embodiments, the methods further include administering treatment with one or more

pharmaceutical compositions, to the subject diagnosed as having Type B MS.

[00085] In some embodiments, the methods may include (a) contacting a sample from the subject with an agent for specifically detecting expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; (b) determining a level of expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; and (c) comparing the level of expression in the sample with a control level of expression to diagnose Type B MS. In some embodiments, the methods further include diagnosing the patient as having Type B MS when the level of expression is increased relative to the control. In some embodiments, the control is a healthy control. In some embodiments, the control comprises Type A MS. In some embodiments, the methods further include administering treatment with one or more pharmaceutical compositions, to the subject diagnosed as having Type B MS. c. Method of Predicting Responsiveness of a Subject with Multiple Sclerosis to Treatment with IFNp

[00086] Provided herein are methods of predicting responsiveness of a subject with MS to treatment with ΙΡΝβ. The methods may include (a) contacting a sample from the subject with an agent for specifically detecting expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; (b) determining a level of expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; (c) comparing the level of expression in the sample with a control level of expression; and (d) determining that the subject is not responsive to treatment with ΙΡΝβ when the level of expression is increased relative to the control, and that the subject is responsive to treatment with ΙΡΝβ when the level of expression is the same or decreased relative to the control. In some embodiments, the methods further include administering treatment with ΙΡΝβ, to the subject determined to be responsive to treatment with ΙΡΝβ. In some embodiments, the methods further include administering treatment to the subject determined to be not responsive to treatment with ΙΡΝβ, wherein the treatment includes at least one of an LT R inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof. In some embodiments, the sample is obtained before treatment. In some embodiments, the sample is obtained during treatment. In some embodiments, the sample is obtained after treatment. In some embodiments, the sample is obtained before, during, and/or after treatment. In some embodiments, the control is a healthy control. In some embodiments, the control comprises Type A MS. In some embodiments, the control is a sample from the subject obtained prior to treatment. In some embodiments, the control is a sample from the subject obtained during treatment. In some embodiments, the control is a sample from the subject obtained after treatment.

7. Examples

Example 1

Materials and Methods

[00087] Animals. Healthy male mice of the C57BU6 background of 6-8 weeks old were randomly selected and used in this study. The Asc "A and Nlrp3 "A mice were gifts from

Genentech under material transfer agreement, and were rederived in our facility. Cxcr2 fl fl mice were a gift from Dr. Richard M. Ransohoff (Cleveland Clinic)(Liu et al. Genesis 2013, 51 , 587- 595). Lck-Cre transgenic mice were purchased from Jackson Laboratories. C57BU6 mice were purchased from Jackson Laboratories. All the mice were kept in a specific pathogen free facility. This study was approved by the Duke University Institutional Animal Care and Use Committee.

[00088] Induction of active EAE. Type-A EAE was induced as previously described

(Shinohara et al. Immunity 2008, 29, 68-78). EAE was induced by 6 different methods as indicated in FIG. 8. In general, MOG 3 5.55 peptide was emulsified with CFA (including Mtb, heat- killed Mycobacteria) and subcutaneously injected in the flanks of mice on day 0 for one-time immunization, or day 0 and 7 for two-time immunization. Amounts of MOG peptide and Mtb are described in FIG. 8. In addition to whether immunization was performed once or twice,

Pertussis toxin (PTx; 200 ng/mouse) was administered on day 0 and 2, if the MOG

immunization was performed once on day 0. If the immunization was performed twice on day 0 and 7,200 ng/mouse PTx was administered on day 0, 2, and 7. EAE scores were assessed daily for clinical signs of EAE in a blinded fashion as previously described (Inoue et al. Sci. Signal 2012, 5, ra38).

[00089] Reagents, antibodies, and recombinant proteins, SB225002, a specific CXCR2 inhibitor, was purchased from Tocris. Ι_ΤβΡ-Ρο (PR0154527) was a gift from Genentech.

Antibodies against LT (ab100844), CXCR2 (129101), and CXCL1 (LS-B2513) were purchased from Abeam, Biolegend, and Life Span Bioscience, respectively. The ΓίΡΝβ used in EAE treatment was human r!FNp- 1 b (Betaseron, Bayer). rLT (ΓίΤα2β1 ; 1008-LY-010/CF) was purchased from R & D systems. Mouse rCXCLI (573702), rlL-17 (576002), and rIFNv (575306) were purchased from Biolegend. MOG 35-55 peptide was synthesized by United Peptides. Enzyme-linked immunosorbent assay (EUSA) kits for the detection of ί L- f β and CXCL1 were purchased from BD PharMingen, and Promocel!, respectively.

[00090] Induction of passive EAE. To polarize Th17 cells, total splenocytes were obtained from naive MOG-specific 2D2 CD4÷ TCR Tg mice, and cultured with MOG 35-55 peptide (3 g/mL), IL-6 (20 ng/mL), ΤΟΡβ (4 ng/mL), and IL-23 (50 ng/mL) for 6 days. Ceils (3x10 7 ceils) were transferred i.v. into subiethally irradiated (450 rad) B6 and Asc-1 mice.

[00091] EAE induction by Type-A EAE with MHV68 infection. MHV68 was purchased from ATCC Ceil lines (VR-1465). MHV68 strains were amplified in BALB/3 TI2-3 ceils (ATCC, CCL-164™), and virus-infected cells were treated with three freeze-thaw cycles, and then supernatant was isolated. Titers of purified virus were determined using the median tissue culture infective dose (TCID50) method, and convert TCID50 to plaque forming units (PFU). MHV68 (10 5 pfu/mouse) was inoculated through i.v.at the time of Type-A EAE immunization.

[00092] Pharmaceutical treatment of mice with EAE, ΙΡΝβ (3x10 4 unit/mouse) were i.p. injected every other day from day 0 to 8 as previously performed (Inoue et al. Sci. Signal 2012, 5, ra38). rLT (ΓίΤ32β1)(1008-ίΥ-0 0/ΌΡ, R&D; 10 Mg/kg mouse) was i.p. administered every day from day 0 to 9. CXCR2 inhibitor (SB225002, Tocris: 0.1 pg/kg mouse) was i.p. injected every day from day 0 to day 20. I ^R-Fc (PR0154527, Genentech)(150 ng/mouse) was i.p. injected every other day from day 0.

[00093] Confocal microscopy of brain sections. Transverse sections (30 μνη) of brain sectioned with a Cryostat were stained with CXCL1 Ab. Briefly, sections were blocked with 2% BSA in TBS (25 m : Tris-CL pH-7.5, 150 m NaCI) for 1 h, and stained with antibodies against CXCL1 (Life Span Bioscience). Stained cells were mounted with the Prolong Gold antifade reagent including DAPi (invitrogen), and analyzed with Zeiss LS 750 laser scanning confocal microscope through the Plan-Apochromat 63x71.40 oil DIG 27 (n=4). Images were captured with AxioCam (Zeiss) and analyzed by ZEN software (Zeiss).

[00094] Cell isolation, CD4+ T cells were isolated with CD4 microbead (Myltenyi) from the spleen of naive mice. DCs were isolated with CD1 1c microbead (Myltenyi) from DLNs of naive mice in all the experiments. In some experiments, DCs were stimulated with riL-17 (10 ng/mL) or r!FNy (10 ng/mL) for 3h. Total RNA isolation, cDNA synthesis and qPCR were performed as described below.

[00095] RNA and cDNA preparation and qPCR and PCR array analyses, For qPCR and PGR array analysis, CD3÷ CD4÷ ceils (as splenic CD4+T cells) and CD11 c+MHCIi÷ ceils (as DCs from DLNs) were isolated by FACS-sorting on 9-dpi. Total RNA was extracted from cells with RNeasy Kit (Qiagen). cDNA synthesis was performed with qScript cDNA SuperMix (Quanta). Real-time, quantitative polymerase chain reaction (qPCR) analysis was performed with KAPA-SYBR-FAST (KAPA Bio Systems) with an initial denaturing step at 95°C for 3 min, followed by 35 cycles of a denaturation step at 94°C for 3 s and an annealing and extension step at 60°C for 30 s. The relative amounts of qPCR products were determined with the AACt method to compare the relative expression of target genes and housekeeping genes. The expression of the gene encoding β-actin was used as an internal control (Shinohara et al.

immunity 2008, 29, 68-78). Primer sequences were indicated in TABLE 3. PCR array was performed by using Chemokines & Receptors PGR Array (PA M-022Z, Qiagen) and Cytokines & Chemokines PGR Array (PA M-150Z, Qiagen) with CD4÷ T cells isolated from spleen and DCs isolated from DLNs at 9-dpi, respectively.

TABLE 3. Primer sequences (shown from the 5'-end to the 3'-end),

[00096] RNA-seq analysis. For RNA-seq analysis, CD3÷ CD4+ cells (as CD4+ T cells) were purified by FACS-sorting from spleens of two mice at 9-dpi. Total RNA was extracted from cells with RNeasy Kit (Qiagen). Stranded mRNA libraries were made with the !!iumina TruSeq Stranded mRNA kit (catalog number RS-122-2101). Before library preparation, the RNA quality was evaluated using a TapeStation instrument (Agilent technologies) and using a Qubit (Life Technologies). The quality of RNA libraries was checked by running them on a 2100

Bioanalyzer instrument (Agilent), pooled and sequenced on 2 lanes of lliumina HiSeq 50bp SR. RNA-seq data was processed using the TrimGa!ore toolkit

(http://www.bioinformatics.babraham.ac.uk/projectsltrim__gal ore), which employs Cutadapt (Lopez-Alvarez et ai. Journal of Veterinary Cardiology 201 1 , 13, 211-218) to trim low quality bases and lliumina sequencing adapters front the 3' end of the reads. Only pairs where both reads were 20-nt or longer were kept for further analysis. Reads were mapped to the

NCBI .38r73 version of the mouse genome and transcriptome (Kersey et al. Nucleic Acids Research 2012, 40, D91-97) using the STAR RNA-seq alignment tool (Dobin et al.

Bioinformatics 2013, 29, 15-21). Reads were kept for subsequent analysis if they mapped to a single genomic location. Gene counts were compiled using the HTSeq tool (http://www- huber.en1 bl.de/users/ande. rslHTSeql). Only genes that had at least 10 reads in any given library were used in subsequent analysis. Normalization and differential expression was carried out using the EdgeR (Robinson et ai. Bioinformatics 2010, 26, 139-140) and Bioconductor (Gentleman et ai. Genome Biology 2004, 5, R80) package with the R statistical programming environment (www.r-p.roject.org). The exact test method (Robinson and Smyth, Biostatistics 2008, 9, 321-332) was used to identify differentially expressed genes between the different conditions. Enriched pathways were determined by GSEA (Mootha et al. Nature Genetics 2003, 34, 267-273). Genes and samples have been clustered using correlation distance with complete linkage. A gene was listed on the heatmap if it had a p- value <= 0.05 and a log2FC >l or <-1.

[00097] RRMS patient's information and qPCR analysis of PBMC samples from RRMS patients were obtained from the MURDOCH study cohorts (www.murdock-study.com). Each participant self-reported their drug history, which included the drug, start and end dates, and comments. Comments on discontinued drugs typically included the reason for discontinuation, and we selected group 2 individuals (non-responders) as those that self-reported stopping an interferon drug due to it not working. Relapses and more lesions via RI were often cited, and some referred to positive neutralizing antibody results, but sometimes they just reported that it was not working without further description. Group 1 individuals (responders) were currently taking an interferon drug with no reports of disease progression, and we weighted selection to those that explicitly reported that the drug was working for them and that they had not had relapses or developed more lesions while on it.

[00098] RNA from samples responder and non-responder groups were quantified via

Ribogreen, normalized and converted to cDNA using the Superscript® VI LO™ cDNA Synthesis Kit. A cDNA input gradient of 2 ng, 5 ng, 8 ng, and 10 ng was used to find ideal PGR conditions for amplification across the seven target probes and endogenous control, with long performing best. Both the input gradient and gene expression assays utilized the Taq an® Gene

Expression protocol to generate 10 μΙ_ reactions across 6 384-weli plates and run on the ViiA™ 7 Real-Time PGR System.

[00099] DNA methylation assay. DCs were FACS-sorted as CD11 c+CD1 1 b- from DLNs of naive and Type-A and Type-B EAE mice at 9-dpi. Genomic DNA was obtained with the

GenElute™ Mammalian Genomic DNA Miniprep kit (Sigma), Bisulfite conversion was performed with the Methyl Detector kit (Active Motif), and the Lta promoter (between -363- nt and ÷65-nt from the transcription start site) was cloned into the pCR4-TOPO-TA vector (Life Technologies) and transformed into £. co!i, Methylation status was evaluated by sequencing 17- 22 clones per group. Percentages of unmethylated CpG in all the tested CpG sites were calculated

[000100] Analyzing demyelination. For Luxol fast blue (LFB) staining, transverse sections (5 pm) of spinal cord and the brain from mice at 17-dpi were stained. MR! analysis was performed with mice with either Type-A or Type-B EAE at 18-dpi. As a procedure for MR!, a catheter was inserted into the left ventricle of the heart, and the mice were perfused with a peristaltic pump with 20 cc of warm (37°C) 0.9% saline followed by 20 cc of 10% buffered formalin. After perfusion fixation, the beads of the mice were stored in 20% buffered formalin overnight before imaging experiments in the following day. The perfused mouse brains were kept within the cranium to prevent any potential damage to the brain caused by surgical removal. Ail images were acquired using a 9.4 T (400 Hz) 89-mm vertical bore Oxford magnet with shielded coil providing gradients of 2200 mT/m. The system was controlled by the Agilent imaging console. The specimen was positioned tightly inside a cylindrical polyethylene tube which was filled with Fombiin (perfiuoropolyether; Ausimont, Inc., Morristown, NJ) that did not emit proton MR signal thus providing dark background in the image. The tube was sealed with care to avoid air bubbles entering the tube. Specimens were imaged in a solenoid radiofrequency coil constructed from a single sheet of microwave substrate. The diameter of the solenoid coil was closely matched to the specimen container thus providing high signal sensitivity. The specimens were scanned using a 2D fluid attenuated inversion recovery (FLAIR) sequence with the following parameters: FOV = 22 x 11 mm 2 matrix = 256 x 128, 0.5-mm slice thickness with zero gap, TR/TI/TE = 5000/925/30.8 ms, echo train length (ETL) = 8, bandwidth = 100 kHz and 12 averages.

[000101] Neuronal staining and motor neuron analysis by stereoiogy. Neuronal staining was performed by Goigi's silver staining with the FD Rapid Goigi staining kit according manufacture's protocol (FD Neurotechonologies, inc.). For stereological analysis, EAE mice at 70 dpi were euthanized by C02 and transcardially perfused with PBS followed by cold 4% paraformaldehyde in 0.1 M phosphate buffer. Fixed spinal cords were removed and

cryoprotected in 30% sucrose for 2 days. Caudal to rostral cryosections were cut at 30 μρη thickness and collected as free floating tissue. Spinal sections were then mounted in order on slides for thionin staining. Tissue sections were analyzed by stereoiogy using Stereo

Investigator v11 (MicroBrightfleld, Williston, VT) using a Zeiss Axiolmager M2 microscope. Contours were drawn around the ventral horn with a 5x objective and neuronal counting was completed using a 63x/1.40 oil objective (Zeiss). Beginning at L6 and moving caudaliy, we sampled 10 lumbar spinal sections at a section interval of 5. Using the resample oversampie tool in Stereo Investigator, we first determined that at a section interval of 5, a systematic random sampling (SRS) grid size of 164x90 would allow precise ceil estimates in the ventral horn of the lumbar region. The mounted thickness was 22 μνη after tissue shrinkage and we used 2 μητι guard zones. The dissector height was 18 m and the counting frame size was 75 x 75 μητ Stereoiogy parameters were indicated in TABLE 4. The total numbers of bilateral Nissl- stained ventral horn neurons were counted stereoiogicaily with Stereo Investigator software by using an optical fractionator. a-motor neurons were defined by having a maximal diameter greater than 30 m. Total neuron numbers included a-motor neurons and Nissl-stained neurons having a diameter less than 30 μνη to ensure that a change in motor neuron number did not reflect changes in cell size. The average number of a-motor neurons (>30 μητι) was 162. The average number of total Nissl-stained neurons counted per animal was 337. Our analysis produced a CE (Gunderson, m=) of 0.078. TABLE 4. Stereo!ogy parameters.

Probe Optical Fractionator

Countour objective 5x

Counting objective 63x/1.40 oil

Counting frame dimensions 75x75 mm

Dissector height 18 mm

Average mounted thickness 22 mm

Guard Zones 2 mm

Average cells counted/animal 162 (a), 337 (total Nissl)

Coefficient of error (CE), Gunerson m+1 0.078

[000102] CD4÷ T cell-neuron co-culture, and neurite length measurement. Primary neurons were obtained from the hippocampus of P2 mice, as described previously (Banker and Goslin Nature 1988, 336, 185-186). After papain treatment to hippocampus tissue, 1x10 s cells were plated on poly-L lysine-coated 8 mm diameter glass slides and were cultured for 8 days. CD4+ T cells were isolated with CD4+ microbead ( yltenyi) from the spleen of naive mice and EAE at 9-dpi, and cultured with primary cultured neuron for 24 h. Neuron and nuclear staining were performed with MAP2 and DAPL respectively. Neurite lengths and numbers of total axons, dendrites and branches were analyzed with the Neurolucida software (MBF bioscience) using at least 18 neurons per condition. Results on neurite lengths and numbers of total axon, dendrite and branches are expressed as the mean ± the standard error of the mean (SEM) by three independent experiments.

[000103] Hot-plate test. To evaluate thermal sensitivity, hot plate test (Eddy and Leimbach The Journal of Pharmacology and Experimental Therapeutics 1953, 107, 385-393) was used for mice at 9-dpi. The mice were yet to show any EAE symptoms and motor dysfunction. The latency to nociceptive responses, such as licking of paw or flicks hind paw, were measured, when they are placed on a warmed metal plate at constant temperature (52°C). A cut-off time of40 sec was used to avoid pain and tissue injury as much as possible. [000104] Chemotaxis assay. Splenic CD4÷ T cells were obtained from naive mice or mice with either Type-A EAE or Type-B EAE at 9-dpi, and submitted for chemotaxis assays as previously described (Inoue et ai. PNAS 2012109, 10480-10485). Briefly, CD4÷ T cells (1x10 6 cells/well) were resuspended in the RPMI 1640 medium containing 5% FBS, and plated in upper chambers of Transweil (5 pm pore, Coming Costar). rCXCL.1 was added to lower chambers, and cells were incubated for 3 hr at 37°C. Numbers of migrated cell were counted, and the data are displayed after subtracting ceil numbers in lower chambers in untreated group (as control),

[000105] Statistical analysis. Statistical analysis in all results, except for human sample analysis and for motor neuron stereology analysis, was evaluated with Student's t tests. The criterion of significance was set as P < 0.05. Data is shown as the mean ± the standard error of the mean (SEM). Statistical analysis for human samples were carried out with the Mann- Whitney U test. Differences among means in motor neuron stereology analysis were analyzed by one- way ANOVA followed by Bonferroni post hoc testing for pairwise comparison unless otherwise stated. We did not include or exclude certain animals for analyses, and animals were randomly used for experiments under the criteria aforementioned in the section of "Animals." All data from samples and mice were used for making figures and statistical analysis. For making figures and statistical analysis, results from a single experiment were used. As suggested by the IACUC guideline, we tried to use minimum numbers of mice when statistical significance was achieved. Ail behavior experiments were performed in a blinded fashion.

Example 2

Intensive stimulation of innate immune cells elicits NLRP3 inflammasome-independent and IFNp-Resistant EAE

[000106] Freund's adjuvant (CFA)(Method 1 , FIG. 8AB), as previously reported (Inoue et al. PNAS 2012, 109, 10480-10485). However, either repeated immunization or a double dosage of Mtb (400 μg) was sufficient to induce EAE in Nlrp3-1 mice (Method 2, 3; FIG. 8AB). When immunization with 400 μg Mtb was repeated twice, severe EAE was observed in Nlrp3-1 mice (Method 5; FIG. 8AB). Immunization with 1.25-fold more MOG peptide did not increase EAE severity (Method 3 vs. 4 and 5 vs. 6; FIG. 8AB), suggesting that dosage of adjuvant, but not MOG peptide, impacts EAE development in the absence of the NLRP3 inflammasome. The data suggested that the initial stimulation of innate immunity shapes the nature of disease pathology. In particular, EAE induced by intensive stimulation of innate immunity develops without NLRP3 inflammasome activation.

[000107] Next we compared EAE severity between WT, Nlrpr3-1 and Asc-1 groups by using Method 6 (the most aggressive EAE induction method) in FIG. 8AB. Asc-1 and Nlrpr3-1 mice showed comparable disease severity to WT mice (FIG. 1A, left panel), showing a significant contrast to the nearly complete resistance of Asc-1 and Nlrpr3-1 mice, subjected to Type-A EAE induction (Method 1 in FIG. 8AB)( FIG. 1A, right panel). Asc-1 and Nlrpr3-1 mice immunized with Type-B EAE displayed similar numbers of total leukocytes, CD4+ T cells, and Th17 cells as WT mice in spinal cords and brains (FIG. 1 B, FIG. 1 C, FIG. 1). WT mice with Type-B EAE showed basal levels of serum I L-1 β (FIG. 1 D), suggesting that the NLRP3 inflammasome was not activated in Type-B EAE. In contrast, high levels of serum ΙΡΝβ were observed in Type-B EAE mice (FIG. 1 E). As ΙΡΝβ suppresses NLRP3 inflammasome activity (Inoue et al., Sci. Signal 2012, 5, ra38), endogenous ΙΡΝβ may contribute to inhibit NLRP3 inflammasome activation in Type-B EAE mice.

[000108] Here, ΙΡΝβ did not ameliorate Type-B EAE both in WT and Nlrp3-1 mice (FIG. 1 F; FIG. 8D), while Type-A EAE responded well to ΙΡΝβ treatment (FIG. 1 F, right panel). Severity of Type-B EAE was similar to Type-A EAE, whereas ΙΡΝβ treatment readily distinguished these two types of disease.

[000109] Because Type-B EAE is induced with high Mtb dosages, i.e., high levels of microbial adjuvant, used in EAE immunization (FIG. 8), we sought to identify if acute infection also induced Type-B EAE. We used murine gamma herpesvirus-68 (MHV-68), equivalent to Epstein- Barr virus (EBV) in humans, because EBV infection is one of the risk factors for MS. Type-A EAE induction accompanied with a high inoculum of MHV-68 made mice develop NLRP3 inflammasome-independent and ΙΡΝβ-resistant EAE (FIG. 1 G).

[000110] Taken together, it is possible to induce Type-B EAE by strong stimulation of innate immunity with high dosages of adjuvant or acute infection, which itself plays the role of a strong adjuvant. Example 3

Distinct phenotypes between Type-A and Type-B EAE

[000111] Type-B EAE mice showed significantly higher numbers of various leukocytes in brains than Type-A EAE mice on 17-dpi (peak time of disease)(FIG. 1 H, FIG. 8E). In contrast, Type-A EAE mice showed higher numbers of these cells in spinal cords than Type-B EAE mice (FIG. 1 H, FIG. 8E). The data strongly suggest that Type-B EAE tends to attract immune cells to the brain.

[000112] Type-A EAE mice suffered severe demyelination in the spinal cord, whereas this demyelination was milder in Type-B EAE mice (FIG. 11). Alternatively, Type-B EAE mice, but not Type-A EAE mice, suffered severe demyelination in the brain (proximal to choroid plexus, an entry zone of immune cells into the brain) and in the optic nerve (FIG. 11). MRI T2 FLAIR images also showed hyperintensity in the external capsule and adjacent cortical regions in the brains of Type-B EAE mice at 18-dpi and to a lesser extent in the spinal cord (FIG. 1 J, FIG. 8F). The results indicate possible loss of myelin in the brain cortical region and milder loss in the spinal cord in Type-B EAE mice.

[000113] Heterogeneity of MS manifests as a pain syndrome in some MS patients but not in others. Interestingly, Type-B EAE mice showed thermal hyperalgesia at 9-dpi (no EAE symptoms and motor dysfunction at this time point), but mice with Type-A EAE did not (FIG. 8G). Taken together, Type-A and Type-B EAE have distinct pathophysiological phenotypes.

Example 4

Membrane-bound lymphotorin on DCs plays a critical Role in Type-B EAE development

[000114] Because Type-B EAE does not require the NLRP3 inflammasome for the disease development (FIG. 1), we hypothesized that an as-yet-unknown molecular pathway is involved. To identify molecules involved in Type-B EAE, we compared gene expression between Type-A EAE and Type-B EAE mice. PCR array analyses indicated high expression of Lta mRNAs in DCs isolated from draining lymph nodes (DLNs) of Type-B EAE mice compared to Type-A EAE mice (TABLE 1). Lta encodes lymphotoxin a (LTa, also termed ΤΝΡβ), which forms secreted homotrimer or membrane-bound hetero-trimer with ΙΤβ (mLT as membrane LT). LT is known to be critical in the development of MS and EAE. For example, LT was observed in demyelinated regions in the brain of some MS patient. Serum LT levels were reported to be elevated in a subgroup of MS patients with high numbers of lesions and disease burden. Blockade of LTfiR, an mLT receptor ameliorates EAE induced by repetitive immunizations, a condition that approximates Type-B EAE induction. Here, we found significantly high levels of Lta mRNA and mLT expression in DCs from Type-B EAE mice, but not from naive and Type-A EAE mice (FIG. 2A, FIG. 2B; FIG. 9A), suggesting involvement of mLT in Type-B EAE development.

TABLE 1. Genes highly expressed in DCs of DLNs from Type-B EAE mice compared to Type-A EAE mice.

[000115] We next asked what induces Lta expression in DCs and found that the CpG island of the Lta promoter were largely unmethylated in DCs from Type-B EAE mice, compared to naive and Type-A EAE mice (FIG. 2C; FIG. 9B), suggesting that the Lta gene promoter in DCs from Type-B EAE mice is under epigenetic control. These results suggested that epigenetic changes in the Lta promoter increase expression of mLT in DC of Type-B EAE. To examine the involvement of mLT in the development of Type-B EAE we blocked LT R with ίΤβΡ-Ρα ίΤβΡ-Ρο treatment ameliorated Type-B EAE but was not effective at all for Type-A EAE (FIG. 2D), suggesting that LT R signaling is essential for development of Type-B EAE, but not Type- A EAE. [000116] We next hypothesized that recombinant LT (rl_T; Ι_Τα2β1), a soluble LTβR agonist, could convert the EAE phenotype from Type-A to the Type-B. Despite Type-A EAE induction, Nlrp3-1 mice developed severe EAE with i.p. rl_T treatment (FIG. 2E) and WT mice lost responsiveness to ΙΡΝβ treatment (FIG. 2F). Moreover, rl_T treatment increased the immune cell migration into the brain (FIG. 2G) as observed in Type-B EAE mice (FIG. 1 H). Taken together, these findings strongly suggest ml_T and LTβR are key factors for Type- B EAE development.

[000117] Of note, ex vivo rl_T treatment also had an impact on DC mRNA and/or protein expression of Urn (encoding IL-1 R antagonist, IL-RA), Cxc110, Cc119, Cxcr5, and Ltbr (FIG. 9C, FIG. 9D). On the other hand, LTβR -Fc decreased Urn mRNA expression in DCs from Type-B EAE mice (FIG. 9E). In particular, induced expression of 111 rn mRNA with rLT treatment suggested that LT-mediated EAE further weakened the impact the NLRP3 inflammasome, by antagonizing I L-1 β through IL-IRA. Taken together, these findings strongly suggest mLT and LTβR are key factors for Type-B EAE development.

Example 5

Connection between Type-B EAE and Th17 cell-mediated passive EAE

[000118] It was previously reported that ΙΡΝβ treatment did not ameliorate EAE induced by Th17 cell adoptive transfer. Therefore, we sought a connection between Th17-mediated passive EAE and Type-B EAE. We first found that rlL-17 but not rIFNy, upregulated Lta expression in DCs (FIG. 2H). Thus, Th17 cells may induce Type-B EAE disease. Indeed, LTβR-Fc strongly ameliorated Th17-mediated passive EAE (FIG. 2I). Moreover, Th17 cell transfer made Asc "A recipients develop severe EAE (FIG. 2I), although MOG-stimulated unpolarized T cells were not potent enough to drive EAE in recipients lacking the NLRP3 inflammasome (Inoue et al. Sci. Signal 2012, 5, ra38). These results suggest that the LT-LTβR axis is dominant in Th17- mediated EAE, as well as Type-B EAE.

Example 6

Distinct gene expression profile in CD4+ T cells between Type-A and Type-B EAE

[000119] We next examined phenotypes of CD4+ T cells in Type-B EAE. PCR array analyses indicated high expression of Cxcr2 and Cxcrl mRNAs in CD4+ T cells isolated from splenocytes of Type-B EAE mice compared to Type-A EAE mice (TABLE 2). To further address the broad changes of gene expression profile in CD4+ T cells between Type-A EAE and Type-B EAE, we performed high-throughput RNA-Seq analysis (FIG. 3 and FIG. 10), and obtained gene expression profiles of splenic CD4+ T cells, which were quite distinct between Type-A EAE and Type-B EAE (FIG. 3). Our analysis revealed that 668 genes were upregulated more than 2-fold (P< 0.05) in CD4+ T cells from Type-B EAE mice compared to those from Type-A EAE mice, while 600 genes were down regulated more than 2-fold in CD4+ T cells from Type-B EAE mice, Several genes detected by PCR array, such as Cxcr2 and Cxcrl (TABLE 2), were consistently detected by RNA-Seq as high expression genes in Type-B EAE. Alternatively, CD4+ T cells from Type-A EAE mice highly expressed Cxcr6, as we have reported to be mediated by the NLRP3 inflammasome (FIG. 3C). High expression of Urn (encoding an IL-1 R antagonist), and low expression of 111 Sri (IL-18 receptor) and 1118rap (encoding IL-18 receptor accessory protein) seems to be further weakened the impact of the NLRP3 inflammasome, which processes generation of mature I L-1 β and IL-18, in Type-B EAE.

TABLE 2. Genes highly expressed highly expressed in splenic CD4+ T cells of Type-B EAE mice compared to Type-A EAE mice.

[000120] Interestingly, several pattern-recognition receptors and neuronal damage-related molecules are upregulated in Type-B EAE (FIG. 3C), suggesting enhanced inflammation and neuronal damages in Type-B EAE. The results strongly suggested Type-A and Type-B EAE have quite distinct gene expression profiles in splenic CD4+ T cells.

Example 7

Distinct phenotypes between Type-A and Type-B EAE at the cellular and protein levels

[000121] Having established gene expression variation between Type-A and Type-B EAE induction, we next sought to identify differences in secondary lymphoid organs between the two EAE subtypes at the cellular and protein levels. At the cellular level, we found statistically significant levels of increase in total cell numbers and B cells in DLNs and spleens on 9-dpi (just before onset of disease)(FIG. 4A) and 17-dpi (peak time of disease)(FIG. 11 A). Of note, we did not find significant differences in the numbers of total CD4+ T, Th1 , Th17, and Treg cells at the both time points (FIG. 4A, FIG. 11A). Proportions of GM-CSF-producing Th1 and Th17 cells, which are encephalitogenic cells for EAE, were also similar between the two EAE subsets (FIG. 11 B, FIG. 11 C). Taken together, except for increased B cells in Type-B EAE, two EAE subsets cannot be distinguished at the cellular level in the secondary lymphoid organs.

[000122] Then, we focused on protein expression of cell surface molecule on leukocytes in secondary lymphoid organs. On CD4+ T cells, we first confirmed the results from qPCR array and RNA-Seq (FIG. 3; Gene Expression Omnibus Accession No. GSE85946) by qPCR that Type-B EAE mice express high levels of Cxcr2 and Cxcrl mRNA in spleens (FIG. 4B). LT&R expression levels were also significantly higher on CD4+ T cells in spleens of Type-B EAE mice (FIG. 4B). Expression of Cxcr2 and Cxcrl , as well as LT&R, in CD4+ T cells was induced by ex- vivo rl_T treatment (FIG. 4C), suggesting the involvement of the LTBR signaling in the phenotype.

[000123] Because of the high induction levels of gene expression, expression of CXCR2 protein was examined next. CXCR2 is generally known as a receptor on neutrophils, but more than 10% of CD4+ T cells from Type-B EAE mice expressed CXCR2 on their cell surface (FIG. 40, FIG. 11 D). Here, a majority of neutrophils expressed CXCR2, but mean fluorescent intensity (MFI) levels were increased in Type-B EAE (FIG. 11 E). CXCR2+ macrophages were also more frequent and expressed higher levels of CXCR2 in Type-B EAE, although the CXCR2+ macrophage population was small (FIG. 11 E). Thus, the data suggested that mRNA expression levels of Cxcr2, Cxcrl , and Ltbr may be used to distinguish an IFIS^-resistant subtype.

[000124] We next compared gene expression of Cxcr2, Cxcrl , and LT&R between ΙΡΝβ- responder and ΙΡΝβ-nonresponder RRMS patients by using peripheral blood mononuclear cells (PBMCs), which are mixtures of T cells, B cells, monocytes, and other cells. Given the heterogeneity of cell types in PBMCs we did not see significant differences in expression of Cxcr2, Cxcrl, and LT&R when using a housekeeping gene, RplpO, to normalize expression levels. However, when using Vcaml as the endogenous control, because it is expressed in monocytes (Expression Atlas by EMBL-EBI) and is not differentially expressed between ΙΡΝ - responder and nonresponder RRMS patients (Bustamante et al, 2013), our analysis showed that relative mRNA expression of Cxcr2, Cxcrl , and LT&R were significantly higher in ΙΡΝβ- responder than nonresponder (FIG. 4E). Coefficient of determination (R2) between two genes in two combinations from Cxcrl , Cxcr2, and LT&R was higher in non-responder than responder (FIG. 11 F), suggesting that expression of the genes is in better correlation in non-responders than responders. Taken together, the data suggested that expression of Cxcr2, Cxcrl , and LT&R might be used to distinguish IFIS^-resistant diseases.

Example 8

CXCR2 in T cell plays a critical role in Type-B EAE

[000125] Because CXCR1 and CXCR2 expression is upregulated in CD4+ T in Type-B EAE, we next carried out a functional assay by evaluating CD4+ T cell chemotaxis towards CXCL1 , a main ligand for CXCR1/2 receptors, by a transwell assay. As expected, significantly increased chemotaxis toward rCXCL.1 were observed in CD4+ T cells from Type-B EAE mice, but not from Type-A EAE (FIG. 5A), reflecting enhanced expression of CXCR1/2 in CD4+ T cells from Type- B EAE. In mice with Type-B EAE, significantly high levels of CXCL1 were observed in serum, choroid plexus, and the spinal cord (FIG. 5B, FIG. 5C; FIG. 12). Blocking LTfiR in Type-B EAE mice reduced CXCL1 levels both in serum and choroid plexus (FIG. 5D). Therefore, enhancement of the CXCL1 -CXCR2 interaction is a key effector response downstream of LT in the development of Type-B EAE. Indeed, blockade of CXCR2 ameliorated Type-B EAE, but not Type-A EAE (FIG. 5E). We confined the involvement of CXCR2 in a T cell-specific manner in vivo by using Cxcr2c fl fl LckCre+ mice, which are conditional knockout of CXCR2 (CXCR2 cKO). Type-A EAE was developed similarly between WT and CXCR2 cKO mice, but CXCR2 cKO mice were significantly protected from the induction of Type-B EAE in an early phase (FIG. 5F). CXCR2 cKO mice eventually catch up with WT mice in EAE severity later and this suggest the involvement of CXCR2 on other cells, such as neutrophil and macrophages in Type-B EAE. Taken together, we demonstrated the critical role of CXCR1/2 on T cells and enhanced expression of CXCL1 in an LT mediated fashion in Type-B EAE.

Example 9

Minimum remission with neuronal damage in Type B EAE mice

[000126] To further characterize Type-B EAE, long-term disease severity was evaluated. Type-B EAE mice showed persistent EAE severity with little remission (FIG. 6A). To investigate the long-term disease severity, we focused on the spinal cord rather than the brain, because the spinal cord is responsible for overt motor disability in EAE. Type-B EAE mice displayed severe myelin loss in the spinal cord at 60-dpi as the disease did not remit (FIG. 6B). Nevertheless, spinal cords in Type-B EAE mice at 70-dpi were devoid of cell infiltration in the CNS as well as those in Type-A EAE mice (FIG. 13A). Then, we considered possibility of poor remyelination in Type-B EAE by evaluating insulin-like growth factor (IGF)-I, which plays a key role in

remyelination via promotion of oligodendrocytes development and stimulation of the synthesis of myelin (McMorris et al, 1986; Roth et al., 1995). However, mice with both subtypes of EAE showed similarly increased levels of IGF-1 in the spinal cord on 22-dpi, compared with WT control (FIG. 13B), suggesting that at least IGF-1-mediated remyelination may not be devoid in Type-B EAE.

[000127] Given that a previous study had shown the loss of neurites in some MS patients, we next evaluated morphology of neurons in spinal cord sections from EAE mice. We first performed silver neuron staining with spinal cord sections from EAE mice, and found that Type- B EAE mice showed low-density, transected neurites in the spinal ventral horn containing motor neurons at 22-dpi (FIG. 13C) and 70-dpi (FIG. 6C, FIG. 13D). Stereological analysis confirmed significant reduction of a-motor neuron and interneuron surrounding a-motor neuron in the spinal ventral horn of Type-B EAE mice (FIG. 6D). On the other hand, Type-A EAE mice showed similar neuronal morphology and number of a-motor neurons to naive mice (FIG. 6C, FIG. 6D, FIG. 13C, FIG. 13D). Based on the minimal remission in Type-B EAE, it is possible that axon retraction played a role in making Type-B EAE severity irreversible. Example 10

T cells in Type-B EAE mice induce neuronal retraction by Sema6B

[000128] To further investigate the altered neuronal morphology in Type-B EAE mice, we examined primary hippocampal neurons, co-cultured with CD4+ T cells from EAE mice.

Significant suppression of neurite outgrowth and reduction in the number of axon, dendrites, and branches in cultured primary hippocampal neurons were observed, when neurons were co- cultured with CD4+ T cells from Type-B EAE mice, but not from Type-A EAE mice (FIG. 7A). Quantitative analyses confirmed that CD4+ T cells from Type-B EAE mice decreased lengths of neurites and numbers of axon/dendrite branches, compared to CD4+ T cells from naive or Type-A EAE mice (FIG. 7B, FIG. 7C).

[000129] To identify molecules responsible for transected neurites specific for Type-B EAE, we examined expression levels of axon guidance molecules in the semaphorin and ephrin families. Among several molecules, which potently inhibit neurite outgrowth, semaphorin 6B (Sema6B; a class 6 transmembrane semaphoring) gene expression was particularly high in CD4+ T cells from Type-B EAE mice (FIG. 7D). shRNA knockdown of Sema6b mRNA in CD4+ T cells from Type-B EAE mice almost completely rescued neurite outgrowth (FIG. 7E, FIG. 7F) with 62% of reduction in Sema6b mRNA with shRNA (FIG. 14). Taken together, the results suggested Sema6B on CD4+ T cells appears to be involved in spinal neuron retraction, specific to Type-B EAE mice. Importantly, rl_T also upregulated Sema6b mRNA expression in CD4+ T cells from Type-A EAE mice, and decreased length and numbers of neurites ex vivo (FIG. 7G, FIG. 7H). Taken together, these results strongly suggested that LT R signaling in CD4+ T cells enhanced their pathogenicity by induce expression of Sema6B and induced neurite retraction in Type-B EAE mice. A schematic diagram of the distinct pathology of the two EAE subtypes is shown in FIG. 15.

[000130] The foregoing description of the specific aspects will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art, readily modify and/or adapt for various applications such specific aspects, without undue

experimentation, without departing from the general concept of the present disclosure.

Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed aspects, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance.

[000131] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary aspects, but should be defined only in accordance with the following claims and their equivalents.

[000132] All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and/or other document were individually indicated to be incorporated by reference for all purposes.

[000133] For reasons of completeness, various aspects of the invention are set out in the following numbered clauses:

[000134] Clause 1. A method of treating a central nervous system (CNS) autoimmune disease in a subject, the method comprising administering to the subject at least one of an LT R inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof.

[000135] Clause 2. The method of clause 1 , wherein the inhibitor comprises siRNA, an antibody, or a small molecule.

[000136] Clause 3. The method of clause 1 or 2, wherein the CNS autoimmune disease comprises multiple sclerosis (MS).

[000137] Clause 4. The method of clause 3, wherein the MS is not responsive to treatment with IFNp.

[000138] Clause 5. The method of clause 3, wherein the MS comprises NLRP3-independent MS.

[000139] Clause 6. The method of clause 3, wherein the MS comprises Type B MS.

[000140] Clause 7. The method of clause 3, wherein the subject has irreversible neuronal damage, demyelination, or a combination thereof. [000141] Clause 8. The method of clause 7, wherein the irreversible neuronal damage, demyelination, or a combination thereof, is in the brain or optic nerve.

[000142] Clause 9. The method of clause 6, wherein the Type B MS is characterized by at least one of: irreversible neuronal damage, demyelination, or a combination thereof;

irresponsiveness to treatment with ΙΡΝβ; lack of activation of the NLRP3 inflammasome;

increased expression of Ltbr, CXCR2, CXCR1 , or Sema6B; increased levels of B cells in the DLNs; or a combination thereof, relative to a control.

[000143] Clause 10. The method of clause 9, wherein expression of CXCR2 is increased in neutrophils, CD4+ cells, or a combination thereof.

[000144] Clause 1 1. A method of diagnosing Type B MS in a subject, the method comprising: determining the expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in a sample from the subject, wherein an increase of the expression relative to a control indicates a diagnosis that the subject is afflicted with Type B MS.

[000145] Clause 12. The method of clause 11 , further comprising diagnosing the patient as having Type B MS when the expression is increased relative to the control.

[000146] Clause 13. The method of clause 11 , further comprising administering treatment with one or more pharmaceutical compositions, to the subject diagnosed as having Type B MS.

[000147] Clause 14. The method of clause 13, wherein the treatment comprises at least one of an LTβR inhibitor, a CXCR2 inhibitor, a CXCR1 inhibitor, or a Sema6B inhibitor, or a combination thereof.

[000148] Clause 15. A method of diagnosing Type B MS in a subject, the method comprising: (a) contacting a sample from the subject with an agent for specifically detecting expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; (b) determining a level of expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; and (c) comparing the level of expression in the sample with a control level of expression to diagnose Type B MS.

[000149] Clause 16. The method of clause 15, wherein the agent comprises a polynucleotide probe that hybridizes specifically with RNA transcribed from gene encoding at least one of CXCR2, CXCR1 , Ltbr, and Sema6B present in the subject. [000150] Clause 17. The method of clause 15, wherein the agent comprises an antibody that binds to at least one of CXCR2, CXCR1 , Ltbr, and Sema6B.

[000151] Clause 18. The method of any one of clauses 15-17, further comprising diagnosing the patient as having Type B MS when the level of expression is increased relative to the control.

[000152] Clause 19. The method of any one of clauses 15-18, further comprising

administering treatment with one or more pharmaceutical compositions, to the subject diagnosed as having Type B MS.

[000153] Clause 20. A method of predicting responsiveness of a subject with MS to treatment with ΙΡΝβ, the method comprising: (a) contacting a sample from the subject with an agent for specifically detecting expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; (b) determining a level of expression of at least one of CXCR2, CXCR1 , Ltbr, and Sema6B in the sample; (c) comparing the level of expression in the sample with a control level of expression; and (d) determining that the subject is not responsive to treatment with ΙΡΝβ when the level of expression is increased, and that the subject is responsive to treatment with ΙΡΝβ when the level of expression is the same or decreased.

[000154] Clause 21. The method of any one of clauses 9-20, wherein the expression is measured by determining at least one of mRNA levels, protein levels, or protein activity levels.

[000155] Clause 22. The method of any one of clauses 1 1-21 , wherein the determining step comprises at least one of PCR or antibody binding.

[000156] Clause 23. The method of any one of clauses 11-22, wherein the sample comprises peripheral blood mononuclear cells (PBMCs).

SEQUENCES

SEQ ID NO: 1

Sema3a Forward Primer

GGGACTTCGCTATCTTCAGAAC

SEQ ID NO: 2

Sema3a Reverse Primer

GTCATCTTCAGGGTTGTCACTC SEQ ID NO: 3

Sema3d Forward Primer

ACATTCCCCATTCCAGACAC

SEQ ID NO: 4

Sema3d Reverse Primer

TTCGTTGCCCACCTACATC

SEQ ID NO: 5

Sema3f Forward Primer

ACGCTATGAGGTGCTTTTCC

SEQ ID NO: 6

Sema3f Reverse Primer

TGGTCATGGTCTTAACAGGTG

SEQ ID NO: 7

Sema4a Forward Primer

GCCGATTCTCCCTCTGTTTC

SEQ ID NO: 8

Sema4a Reverse Primer

GTCTCCTTGTTCAGCTCCTTG

SEQ ID NO: 9

Sema4d Forward Primer

GGGAAAAGTGAAGATGGCAAAG

SEQ ID NO: 10

Sema4d Reverse Primer

CTGTGGGAAGAGTTTCGAGAG

SEQ ID NO: 1 1

Sema6b Forward Primer

TGTGGTTCGTGTTCCTGTTG

SEQ ID NO: 12

Sema6b Reverse Primer

CATCTTGCTCAAACGTGGC

SEQ ID NO: 13

Efnal Forward Primer

CATCTCCAAACCTATCTACCATCAG

SEQ ID NO: 14

Efnal Reverse Primer

TGCAAAACCTGTACTTCCGG

SEQ ID NO: 15

Efna2 Forward Primer

CTTTGAGTTCCGGCCTGG SEQ ID NO: 16

Efna2 Reverse Primer

TGTTACTGGTGAAGATGGGC

SEQ ID NO: 17

Efna5 Forward Primer

GGTGTTCATGATCGTGTTTTCG

SEQ ID NO: 18

Efna5 Reverse Primer

CTGGGTATCCTTGGTGTCTG

SEQ ID NO: 19

Efnbl Forward Primer

AAGTTCCAAGAGTTCAGCCC

SEQ ID NO: 20

Efnbl Reverse Primer

ATCTTCATAGTGCGGGTGC

SEQ ID NO: 21

Efnb2 Forward Primer

AGACAAGAGCCATGAAGATCC

SEQ ID NO: 22

Efnb2 Reverse Primer

ACTTCTCCCATTTGTACCAGC

SEQ ID NO: 23

Efnb3 Forward Primer

CATAATTGCCACATCAGACGG

SEQ ID NO: 24

Efnb3 Reverse Primer

TTCAGACACAGGTTTTCGGG

SEQ ID NO: 25

Lta Forward Primer

TCAGAAGCACTTGACCCATG

SEQ ID NO: 26

Lta Reverse Primer

TCAAAGAGAAGCCATGTCGG

SEQ ID NO: 27

Cxcr2 Forward Primer

GCTGTCCCATGCCACTCAGA SEQ ID NO: 28

Cxcr2 Reverse Primer

GGCAAGGTCAGGGCAAAGAA

SEQ ID NO: 29

Cxcrl Forward Primer

ACCCGATCCGTCATGGATGT

SEQ ID NO: 30

Cxcrl Reverse Primer

GGCCAGGTATCGGTCCACAC

SEQ ID NO: 31

111 rn Forward Primer

TAGCAAATGAGCCACAGACG

SEQ ID NO: 32

111 rn Reverse Primer

ACATGGCAAACAACACAGGA

SEQ ID NO: 33

Ltbr Forward Primer

TCAGAAGCACTTGACCCATG

SEQ ID NO: 34

Ltbr Reverse Primer

TCAAAGAGAAGCCATGTCGG

SEQ ID NO: 35

CxcH O Forward Primer

GCTGCCGTCATTTTCTGC

SEQ ID NO: 36

CxcH O Reverse Primer

TCTCACTGGCCCGTCATC

SEQ ID NO: 37

Cell 9 Forward Primer

GACCTTCCCAGCCCCAACT

SEQ ID NO: 38

Cell 9 Reverse Primer

CGGAAGGCTTTCACGATGTT

SEQ ID NO: 39

Cxcr5 Forward Primer

CTGGACATGGGCTCCATCA

SEQ ID NO: 40

Cxcr5 Reverse Primer

GCTGTAGGCCACAGGCATGA SEQ ID NO: 41

Ltbr from Mus musculus, Accession No. NP_034866, 415 amino acids

1 MRLPRASSPC GLAWGPLLLG LSGLLVASQP QLVPPYRIEN QTCWDQDKEY YEPMHDVCCS

61 RCPPGEFVFA VCSRSQDTVC KTCPHNSYNE HWNHLSTCQL CRPCDIVLGF EEVAPCTSDR

121 KAECRCQPGM SCVYLDNECV HCEEERLVLC QPGTEAEVTD EIMDTDVNCV PCKPGHFQNT

181 SSPRARCQPH TRCEIQGLVE AAPGTSYSDT ICKNPPEPGA MLLLAILLSL VLFLLFTTVL

241 ACAWMRHPSL CRKLGTLLKR HPEGEESPPC PAPRADPHFP DLAEPLLPMS GDLSPSPAGP

301 PTAPSLEEVV LQQQSPLVQA RELEAEPGEH GQVAHGANGI HVTGGSVTVT GNIYIYNGPV

361 LGGTRGPGDP PAPPEPPYPT PEEGAPGPSE LSTPYQEDGK AWHLAETETL GCQDL

SEQ ID NO: 42

Cxcrl from Mus Musculus, Accession No. NP_839972, 351 amino acids

1 MAEAEYFIWT NPEGDFEKEF GNITGMLPTG DYFIPCKRVP ITNRQALVVF YALVSLLSLL

61 GNSLVMLVIL YRRRTRSVMD VYVLNLAIAD LLFSLTLPFL AVSKLKGWIF GTPLCKMVSL

121 LKEFNFFSGI LLLACISVDR YLAIVHATRT LARKRYLVKF VCVGIWGLSL ILSLPFAIFR

181 QAYKPFRSGT VCYEVLGEAT TDFRMTLRGL SHI FGFLLPL LTMLVCYGLT LRMLFKTHMR

241 QKHRAMGVIF AVVLVFLLCC LPYNLVLLSD TLLGAHLIED TCERRNDIDQ ALYITEILGF

301 SHSCLNPIIY AFVGQNFRHE FLKILANHGL VRKEVLTHRR VAFHTSLTAI Y

SEQ ID NO: 43

Cxcr2 from Mus musculus, Accession No. NP_034039, 359 amino acids

1 MGEFKVDKFN IEDFFSGDLD IFNYSSGMPS ILPDAVPCHS ENLEINSYAV VVIYVLVTLL

61 SLVGNSLVML VILYNRSTCS VTDVYLLNLA IADLFFALTL PVWAASKVNG WTFGSTLCKI

121 FSYVKEV FY SSVLLLACIS MDRYLAIVHA TSTLIQKRHL VKFVCIAMWL LSVILALPIL

181 ILRNPVKVNL STLVCYEDVG NNTSRLRVVL RILPQTFGFL VPLLIMLFCY GFTLRTLFKA

241 HMGQKHRAMR VIFAVVLVFL LCWLPYNLVL FTDTLMRTKL IKETCERRDD IDKALNATEI

301 LGFLHSCLNP I IYAFIGQKF RHGLLKIMAT YGLVSKEFLA KEGRPSFVSS SSANTSTTL

SEQ ID NO: 44

Sema6B from Mus musculus, Accession No. NP_001123928, 886 amino acids

1 MWTPRVPPPR PALSFFLLLL LGVTYGLFPE EPPPLSVAPR DYLSHYPVFV GSGPGRLTAA

61 EGAEDLNIQR VLRVNRTLFI GDRDNLYQVE LEPSTSTELR YQRKLTWRSN PSDIDVCRMK

121 GKQEGECRNF VKVLLLRDES TLFVCGSNAF NPICANYSMD TLQLLGDSIS GMARCPYDPK

181 HANVALFSDG MLFTATVTDF LAIDAVIYRS LGDRPTLRTV KHDSKWFKEP YFVHAVEWGS

241 HVYFFFREIA MEFNYLEKVV VSRVARVCK DVGGSPRVLE KQWTSFLKAR LNCSVPGDSH

301 FYF VLQAVT GVVSLGGRPV ILAVFSTPSN SIPGSAVCAF DMNQVAAVFE GRFREQKSPE

361 SIWTPVPEDQ VPRPRPGCCA APGMQYNASS ALPDEILNFV KTHPLMDEAV PSLGHSPWIV

421 RTLMRHQLTR VAVDVGAGPW GNQTIVFLGS EAGTVLKFLV KPNASVSGTT GPSIFLEEFE

481 TYRPDRCGRP SSAGEWGQRL LSLELDAASG GLLAAFPRCV VRVPVARCQL YSGCMKNCIG

541 SQDPYCGWAP DGSCI FLRPG TSATFEQDVS GASTSGLGDC TGLLRASLSD DRAGLVSVNL

601 LVTSSVAAFV VGAVVSGFSV GWFVGLRERR ELARRKDKEA ILAHGGSEAV LSVSRLGERR

661 GTGPGGRGGA GGGPGGPPEA LLAPLMQNGW TKAALLHGGP HDLDTGLLPT PEQTPLPQKR

721 LPTPHPHAHA LGSRAWDHSH ALLSASASTS LLLLAPARAS EQPQVPAEPG PESRLCAPRS

781 CRASHPGDFP LTPHASPDRR RVVSAPTGPL DPSVGDGLPG PWSPPATSSL RRPGPHGPPT

841 AALRRTHTFN SGEARPGGHR PRRHPPADST HLLPCGTGER TAPPVP