SHARPE NEAL (US)
GODDEERIS MATTHEW (US)
LANDSKRONER SHIRA (US)
| WO2018081377A1 | 2018-05-03 |
| US20130237489A1 | 2013-09-12 |
| CLAIMS What is claimed is: 1. A method of inhibiting nonsense mediated messenger RNA (mRNA) decay of a cystic fibrosis transmembrane regulator ( CFTR ) transcript comprising one or more nonsense mutations in a subject, the method comprising administering to the subject one or more aminoglycosides and/or derivatives thereof. 2. A method of treating cystic fibrosis in a subject in need thereof, the method comprising administering to the subject one or more aminoglycosides and/or derivatives thereof in amount effective to inhibit nonsense mediated messenger RNA (mRNA) decay of a cystic fibrosis transmembrane regulator (CFTR) gene comprising one or more nonsense mutations. 3. A method of treating cystic fibrosis by inhibiting nonsense mediated messenger RNA (mRNA) decay of a cystic fibrosis transmembrane regulator (CFTR) gene comprising one or more nonsense mutations in a subject in need thereof, the method comprising administer to the subject one or more aminoglycosides and/or derivatives thereof. 4. The method of any one of claims 1-3, wherein the one or more aminoglycosides and/or derivatives thereof is selected from the group consisting of a Category I compounds, Category II compounds, Category III compounds, Category IV compounds, and Category VI compounds. 5. The method of any one of claims 1-3, wherein the one or more aminoglycosides and/or derivatives thereof is NB 124. 6. The method of any one of claims 1-5, wherein the subject has a G524X nonsense allele of the CFTR transcript. 7. The method of claim 6, wherein the subject is homozygous for a G524X nonsense allele of the CFTR transcript. Attorney Ref. 128570.8010.WO00 8. The method of claim 6, wherein the subject is heterozygous for a G524X nonsense allele of the CFTR transcript. 9. The method of claim 8, wherein the subject has a G524X/W1282X genotype of the CFTR transcript. 10. The method of any one of claims 1-3, wherein administration of said one or more aminoglycosides and/or derivatives thereof results in an increase in CFTR transcript mRNA levels. 11. The method of any one of claims 1-3, wherein the subject is administered about 0.3 mg/kg to about 2.5 mg/kg of the one or more aminoglycosides and/or derivatives thereof. 12. A kit comprising one or more aminoglycosides or derivatives thereof for use in inhibiting nonsense mediated messenger RNA (mRNA) decay of a cystic fibrosis transmembrane regulator ( CFTR ) transcript comprising one or more nonsense mutations. 13. The kit of claim 12, further comprising instructions of use. 14. The kit of claim 12 or 13, wherein the one or more aminoglycosides and/or derivatives thereof is selected from the group consisting of a Category I compounds, Category II compounds, Category III compounds, Category IV compounds, and Category VI compounds. 15. The kit of any one of claims 12-14, wherein the one or more aminoglycosides and/or derivatives thereof is NB 124. 87 144594891.3 |
BACKGROUND
[0001] Premature stop codon (PSC) diseases such as cystic fibrosis (CF) are caused by nonsense mutations, i.e., mutations that introduce premature stop codons into a protein coding sequence, resulting in truncated or absent proteins (Linde & Kerem 2008; Bordeira-Carriqo 2012. The disease phenotype in CF caused by nonsense mutations in the cystic fibrosis transmembrane regulator ( CFTR ) gene is frequently more severe than those caused by missense mutations due to premature stop mutations often resulting in a complete loss of protein function (Frischmeyer 1999). More specifically, the W1282X CFTR nonsense mutation is a“Class I” mutation resulting in no functional protein and CFTR messenger RNA (mRNA) instability. CFTR mRNA destabilization results from nonsense-medicated decay (NMD), a cellular mechanism that selectively degrades mRNA containing nonsense mutations such as the W1282X CFTR. While NMD reduces and/or prevents the production of defective proteins, it is also a significant contributor to genetic disorders such as CF. It is estimated that nonsense mutations account for 11% of disease-causing mutations (Linde & Kerem 2008). Disease management is based primarily on management of complications and palliative care.
[0002] Aminoglycosides can induce PSC readthrough by binding at the decoding center of the eukaryotic ribosome. Aminoglycosides are chemically diverse, broad spectrum antibiotics which bind to a specific site in ribosomes and affect translation elongation and termination (Borovinskaya 2007). Consequently, aminoglycosides increase the frequency of pairing near cognate aminoacyl-tRNAs to the PSC and enables formation of full-length protein (Francois 2005; De Loubresse 2014). In 1997, the aminoglycoside gentamicin was found to induce CFTR protein expression from the CFTR gene harboring nonsense mutations in bronchial epithelial cells from patients with CF (Bedwell 1997). However, gentamicin potency as a readthrough agent is low, and its recognized nephrotoxicity and ototoxicity effects at high doses discouraged its further development. Improved methods are therefore needed for treating these disorders, including methods that not only induce PSC readthrough, but also inhibit NMD.
SUMMARY
[0003] Provided herein in some embodiments are methods of treating CF in a subject in need thereof comprising administering to the subject one or more aminoglycosides and/or derivatives thereof as disclosed herein. [0004] In some aspects, the present disclosure provides methods of inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations in a subject. In some embodiments, the methods comprise administering to the subject one or more aminoglycosides and/or derivatives thereof.
[0005] In another aspect, the present disclosure provides for the use of one or more aminoglycosides and/or derivatives thereof in the preparation of a medicament for inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations in a subject. In yet another aspect, the present disclosure provides for the use of one or more aminoglycosides and/or derivatives thereof for inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations in a subject.
[0006] In some aspects, the present disclosure provides methods of treating CF in a subject in need thereof, the methods comprising administering to the subject one or more aminoglycosides and/or derivatives thereof in amount effective to inhibit nonsense mediated mRNA decay of a CFTR transcript.
[0007] In another aspect, the present disclosure provides for the use of one or more aminoglycosides and/or derivatives thereof in the preparation of a medicament for treating CF in a subject, wherein the medicament inhibits nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations. In yet another aspect, the present disclosure provides for the use of one or more aminoglycosides and/or derivatives for treating CF in a subject in need thereof, wherein the one or more aminoglycosides inhibits nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations in the subject.
[0008] In yet another aspect, the present disclosure provides methods of treating cystic fibrosis by inhibiting nonsense mediated mRNA decay of a CFTR transcription comprising one or more nonsense mutations in a subject in need thereof, the method comprising administering to the subject one or more aminoglycosides and/or derivatives thereof.
[0009] In another aspect, the present disclosure provides for the use of one or more aminoglycosides and/or derivatives thereof in the preparation of a medicament for treating CF in a subject, wherein the one or more aminoglycosides and/or derivatives thereof are present in an amount effective for inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations. In yet another aspect, the present disclosure provides for the use of one or more aminoglycosides and/or derivatives for treating CF in a subject in need thereof, wherein the one or more aminoglycosides is administered to the subject in an amount effective for inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations in the subject.
[0010] In yet another aspect, the present disclosure provides kits comprising one or more aminoglycosides and/or derivatives thereof for use in inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations. In some embodiments, the kit further comprises instructions of use.
[0011] In one embodiment, the one or more aminoglycosides and/or derivatives thereof is selected from the group consisting of Category I compounds, Category II compounds, Category III compounds, Category IV compounds, and Category VI compounds. In some embodiments, the one or more aminoglycosides and/or derivatives thereof is NB124. In another embodiment, the subject is administered about 0.3 mg/kg to about 2.5 mg/kg of the one or more aminoglycosides and/or derivatives thereof.
[0012] In another embodiment, the subject has a G524X nonsense allele of the CFTR transcript. In yet another embodiment, the subject is homozygous for a G524X nonsense allele of the CFTR transcript. In some embodiments, the subject is heterozygous for a G524X nonsense allele of the CFTR transcript. In some embodiments, the subject has a G524XW1282X genotype of the CFTR transcript.
[0013] In some embodiments, the subject exhibits an increase in CFTR transcript mRNA levels.
[0014] In some embodiments of the methods, uses, pharmaceutical formulations, medicaments, and kits provided herein, the one or more aminoglycosides and/or derivatives thereof as disclosed herein include NB 124.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIGs. 1A and 1B show that ELX-02 induces readthrough of multiple nonsense mutations in CFTR. FIG. 1 A shows that normalized mRNA expression levels quantified by RT- qPCR for CFTR with various mutations (F508del/G542X, G542X/G542X, G542X/W1282X, W1282X/W1282X) increased significantly after treatment with ELX-02, while mRNA expression levels for CFTR with several mutations (F508del/508del, and F508del/Nl282X) showed an improvement comparable to that for wild type CFTR (wt). FIG. 1B shows unnormalized increase of mRNA expression levels for CFTR with various mutations (F 508 del/G542X, G542X/G542X, G542X/W1282X, W1282X/W1282X, F508del/508del,
F508del/Nl282X) after treatment with ELX-02.
[0016] FIG. 2 shows a mutation-specific correlation between functional CFTR activity and mRNA levels after treatment with ELX-02.
[0017] FIG. 3 shows that ELX-02 induces readthrough of multiple nonsense mutations in CFTR. Nonsense mutations in human CFTR gene were cloned between Renilla and Firefly luciferase in a biluciferase plasmid. The location of the different mutations in CFTR is indicated in the second column, and the prevalence of each mutation in the CF patient population is indicated in the third column. Nucleotides of nonsense mutations are indicated as "0" position and are denoted with U (uridine, "U"), (guanidine, "G") or ESI (adenine, "A").
Nucleotides highlighted in indicate consensus sequence known to show high natural translation readthrough.
[0018] FIG. 4 shows a dose dependent increase in readthrough of two prevalent CFTR nonsense mutations (G542X and W1282X) following administration of ELX-02.
[0019] FIGs. 5A-5C shows that ELX-02 rescues function of CFTR having a G542X nonsense mutation in rectal organoids as measured by forskolin induced swelling (FIS). FIG. 5A shows quantification of the surface area relative to t = 0 (normalized area) of F508del/G542X mutant rectal organoids treated for 24, 48 or 72 hours with ELX-02 (0, 100 pg/ml) or VX770/VX809 (3 mM) and different forskolin concentrations (0.128, 0.8 and 5 pM). FIG. 5B shows FIS of rectal organoid F508del/G542X treated with various ELX-02 concentrations for 48 hours, then with forskolin (5mM). FIG. 5C shows FIS of F508del/G542X rectal organoid incubated with various ELX-02 concentrations for 48 hours and with increasing Forskolin concentrations. Data is expressed as the absolute area under the curve (AUC) calculated from tracings comparable to (B) (baseline, 100%; t = 120 min).
[0020] FIG. 6 shows that organoids swell in response to forskolin following administration of ELX-02. Representative organoid images were taken 120 minutes following administration of forskolin. Images were taken at 40X magnification.
[0021] FIG. 7 shows that organoid swelling is significantly increased following administration of ELX-02. FIS assay results were compiled from three independent experiments, each with biological replicates (n=6 points per condition). The vehicle is water. 0.8 mM forskolin was used to induce swelling and imaging was performed with the Perkin Elmer imaging system. 3mM VX770 was used as the potentiator and 3mM VX661 was used as the corrector. Data were assessed by ordinary one-way ANOVA with Dunnett’s multiple comparison testing versus vehicle subgroup post transformation, Y=Log(Y+500). *** = p<0.00l, **** = p<0.000l. All potentiator and corrector conditions were non-significant. Error bars represent SD.
[0022] FIGs. 8A-8F show that ELX-02 rescues function of homozygote and heterozygote nonsense mutations in CFTR in rectal organoids measured by FIS. Organoids were incubated with the indicated concentrations of ELX-02 and VX809 for 48 hours, VX-770 (3 mM) and Forskolin (5 mM). FIGs. 8A and 8D shows a homozygote G542X organoid treated with ELX-02 (A) or ELX-02 with VX-770/VX809 (D). FIGs. 8B and 8E shows patient-derived homozygote W1282X organoids (organoid A on the left and B on the right) treated with ELX-02 (B) or ELX- 02 in combination with VX-770/VX-809 (E). FIGs. 8C and 8F shows a heterozygote G542X/W1282X organoid treated with the indicated concentrations of ELX-02 (C) or in combination with VX-770/VX-809.
[0023] FIG. 9 shows that ELX-02’ s effect on organoid swelling is increased when combined with potentiator (VX 770) and corrector (VX661) small molecules. FIS assay results (n=3 biological replicates point per condition). 0.8 mM forskolin was used to induce swelling and imaging was performed with the Perkin Elmer imaging system. 3mM VX770 was used as the potentiator and 3mM VX661 was used as the corrector. Data were assessed by ordinary one-way ANOVA with Dunnett’s multiple comparison testing versus indicated ELX-02 subgroup. *=p<0.05, **=p<0.0l, *** = p<0.00l, **** = p<0.000l, ns =non-significant versus vehicle treated organoids. Error bars represent SD.
[0024] FIGs. 10A and 10B show that ELX-02 rescues function of composite heterozygote mutations in CFTR in rectal organoids measured by FIS. FIG. 10A shows two different heterozygote G542X/R1066C organoids (organoid A and B, left and right panels) treated with ELX-02 concentrations as indicated in the inset in the right panel. FIG. 10B shows two different patient-derived heterozygote DF508/R1162X organoids (organoid A on the left and B on the right) treated with ELX-02 as indicated in the inset in panel A.
[0025] FIG. 11 shows that ELX-02 rescues functional activity of different nonsense mutation of CFTR. [0026] FIG. 12 shows that organoid swelling induced by ELX-02 is dependent on CFTR chloride channel conductance. FIS assay results representing one experiment conducted in biological triplicate (n=3 points per condition). Vehicle treatment of DMSO was used to accommodate CFTR inhibitor cocktail solution. 0.8 mM forskolin was used to induce swelling and imaging was performed with the Perkin Elmer imaging system. Data were assessed by ordinary one-way ANOVA with Dunnett’s multiple comparison testing versus vehicle subgroup. ****=p<0.000l, ns= non-significant. Error bars represent SD.
[0027] FIG. 13 shows changes in CFTR mRNA transcripts with ELX-02 administration in subject organoids. CFTR change compared to vehicle was performed across three experiments for a total of three biological samples per group (n=3). Data were assessed by unpaired t test. p=0.0008. Error bars represent SD.
[0028] FIGs. 14A-C shows FIS assay results with 5mM forskolin and various concentrations of ELX-02.
[0029] FIGs. 15A-C show results of a forskolin and ELX-02 titration study for a duration of 120 minutes. Vehicle, 50 and 100 mg/mL ELX-02 were induced with 5 mM (A) and 0.8 mM Forskolin (B) after 48 hours of incubation. Results from A, B are converted to AETC values and compared with 0, 0.128 and 2 5 mM Forskolin in (C).
[0030] FIG. 16 shows the responsiveness (e.g., swelling) of organoids treated with ELX-02.
[0031] FIG. 17 shows the dose-dependent readthrough activity for the production of functional CFTR protein. Data were assessed by ordinary one-way ANOVA with Tukey’s multiple comparison testing was used; ns, non-significant, ***p<0.00l versus vehicle control, **** p<0.000l versus vehicle control, #### p<0.000l versus next lower concentration.
[0032] FIGS. 18A and 18B show that treatment with ELX-02 increases CFTR mRNA to healthy control levels as measured by qPCR primers and nanostring probes to the 3’ region of CFTR mRNA, respectively (unpaired t-test, *p<0.05).
[0033] FIG. 19 shows CFTR instability by comparison of probes that bind to different regions of the mRNA (data represent two independent experiments.
[0034] FIG. 20 shows that 3’ CFTR probe binding is reduced relative to 5’ probes. Data were assessed by ordinary one-way ANOVA with Tukey’s multiple comparison testing was used; ns, non-significant, *p<0.05 versus vehicle control, **** p<0.000l versus vehicle control, ### p<0.00l versus next lower concentration [0035] FIG. 21 is a pictorial representation of ribosomal protection mRNA from nonsense mediated decay triggered endonuclease activity.
[0036] FIG. 22 shows organoid swelling in organoids with one or two nonsense alleles. Data were assessed by ordinary one-way ANOVA with Tukey’s multiple comparison testing was used; ns, non-significant, ***p<0.00l versus vehicle control, **** p<0.000l versus vehicle control.
DETAILED DESCRIPTION
[0037] The following description of the invention is merely intended to illustrate various embodiments of the invention. As such, the specific modifications discussed are not to be construed as limitations on the scope of the invention. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of the invention, and it is understood that such equivalent embodiments are to be included herein.
[0038] Provided herein are methods, compositions, and kits for inhibiting NMD of mRNA transcribed from a gene comprising one or more nonsense mutations that result in a premature stop codon, and for treating genetic disorders associated with the presence of nonsense mutations that result in a premature stop codon, including CF. These methods, compositions, and kits utilize one or more aminoglycosides that both induce readthrough of nonsense mutations and inhibit NMD of mRNA.
Definitions
[0039] The terms "treat," "treating," and "treatment" as used herein with regard to a genetic disorder associated with one or more nonsense mutations that result in a premature stop codon (e.g., CF) may refer to eliminating the disorder; preventing, delaying, or reducing the likelihood of development or progression of the disorder or of one or more symptoms associated with the disorder; reducing or eliminating one or more symptoms associated with the disorder; reducing the severity or occurrence of one or more symptoms associated with the disorder; or some combination thereof. Additionally, where the genetic disorder is cancer, "treat," "treating," and "treatment" may refer to partial or total inhibition of tumor growth; reduction of tumor size; complete or partial tumor eradication; complete or partial regression or remission; reduction or prevention of malignant growth; prevention, slowing, or reduction of cancer remission; partial or total eradication of cancer cells; or some combination thereof.
[0040] The phrases "increasing the efficacy of a readthrough inducing agent" or "increasing the efficacy of a nonsense mediated decay (NMD) agent" as used herein may refer to increasing readthrough percentage or increasing inhibiting of NMD percentage, reducing the required dosage of the readthrough inducing agent or NMD agent, and/or reducing the required administration frequency of the readthrough inducing agent or NMD agent.
[0041] A "subject in need thereof as used herein refers to a mammalian subject, preferably a human, who has been diagnosed with, is suspected of having, is at risk of developing, or is exhibiting or has exhibited one or more symptoms associated with a genetic disorder associated with one or more nonsense mutations that result in a premature stop codon. In certain embodiments, the subject may have previously received one or more therapeutic interventions for the treatment of the genetic disorder or for one or more symptoms associated with the disorder.
[0042] A "readthrough inducing agent" is any compound that induces ribosomal readthrough of premature stop codons during translation so that they are interpreted as sense codons. In certain cases, readthrough inducing agents introduce a conformational change in mRNA which allows the ribosome to insert an amino acid at a UGA, UAG, or UAA premature stop codon site during translation. This results in production of full-length functional protein, or a protein close to a full-length functional protein, and restoration of protein/enzyme function.
[0043] A“nonsense mediated decay (NMD) agent” is any compound that decreases the activity of NMD and/or degradation of mRNA containing a nonsense mutation. Similar to readthrough inducing agents, NMD agents can increase production of full-length functional protein, or a protein close to a full-length functional protein, and restoration of protein/enzyme function. However, NMD agents also increase the production of mRNA transcriptions and/or mRNA expression.
[0044] The term "monosaccharide" as used herein and as well known in the art, refers to a simple form of a sugar that consists of a single saccharide molecule which cannot be further decomposed by hydrolysis. Most common examples of monosaccharides include glucose (dextrose), fructose, galactose, and ribose. Monosaccharides can be classified according to the number of carbon atoms of the carbohydrate, i.e., triose, having 3 carbon atoms such as glyceraldehyde and dihydroxyacetone; tetrose, having 4 carbon atoms such as erythrose, threose and erythrulose; pentose, having 5 carbon atoms such as arabinose, lyxose, ribose, xylose, ribulose and xylulose; hexose, having 6 carbon atoms such as allose, altrose, galactose, glucose, gulose, idose, mannose, talose, fructose, psicose, sorbose and tagatose; heptose, having 7 carbon atoms such as mannoheptulose, sedoheptulose; octose, having 8 carbon atoms such as 2-keto-3- deoxy-manno-octonate; nonose, having 9 carbon atoms such as sialose; and decose, having 10 carbon atoms. Monosaccharides are the building blocks of oligosaccharides like sucrose (common sugar) and other polysaccharides (such as cellulose and starch).
[0045] The term "oligosaccharide" as used herein refers to a compound that comprises two or more monosaccharide units, as these are defined herein, linked to one another via a glycosyl bond (-0-). Preferably, the oligosaccharide comprises 2-6 monosaccharides, more preferably the oligosaccharide comprises 2-4 monosaccharides and most preferably the oligosaccharide is a disaccharide moiety, having two monosaccharide units.
[0046] The phrases "effective in treating medical conditions associated with associated with CFTR ," "effective in treating medical conditions such as CF," "effective in treating CF," "effective in treating a subject diagnosed with a medical conditions associated with CFTR ," "effective in treating a subject diagnosed with a medical conditions such as CF," "effective in treating a subject diagnosed with CF," and/or "for use in the treatment of a medical condition associated with CFTR in a subject," as used herein interchangeably, refer to characteristics of a substance, such as the compounds according to some embodiments of the present invention, that effecting a reduction in one or more symptoms of CF and/or medical conditions associated with CFTR , effecting a reduction in CF and/or medical conditions associated with CFTR , or prevention of CF and/or medical conditions associated with CFTR.
[0047] The phrase "pharmaceutically acceptable carrier" as used herein refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound or molecule of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body. A pharmaceutically acceptable carrier may comprise a variety of components, including but not limited to a liquid or solid filler, diluent, excipient, solvent, buffer, encapsulating material, surfactant, stabilizing agent, binder, or pigment, or some combination thereof. Each component of the carrier must be "pharmaceutically acceptable" in that it must be compatible with the other ingredients of the composition and must be suitable for contact with any tissue, organ, or portion of the body that it may encounter, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
[0048] The terms“compound” or“compounds” refer to conventional chemical compounds (e.g., small organic). As used herein, the phrase“small molecule” is used interchangeably with the term“compound.”
[0049] The phrase“nonsense mediated decay (NMD)” or“nonsense mediated mRNA decay” as used herein refers to a cellular mechanism that selectively degrades mRNA containing a nonsense mutation.
[0050] The phrase“inhibition of nonsense mediated decay (NMD)” as used herein refers to a decrease in the activity of NMD and/or the degradation of mRNA containing a nonsense mutation.
[0051] The term "about" as used herein means within 10% of a stated value or range of values.
[0052] The phrase "therapeutically effective amount" as used herein is an amount of the agent that produces a desired therapeutic effect in a subject.
[0053] The term "alkyl" as used herein refers to an aliphatic hydrocarbon including straight chain and branched chain groups. The alkyl may have 1 to 20 carbon atoms, or 1-10 carbon atoms, and may be branched or unbranched. According to some embodiments of the present invention, the alkyl is a low (or lower) alkyl, having 1-4 carbon atoms (namely, methyl, ethyl, propyl and butyl).
[0054] The terms substituted “alkyl,” “cycloalkyl,” “aryl,” “alkylaryl,” “heteroaryl,” “heteroalicyclic,” “acyl,” include but are not limited to hydroxy, alkoxy, thiohydroxy, thioalkoxy, aryloxy, thioaryloxy, alkaryl, alkenyl, alkynyl, sulfonate, sulfoxide, thiosulfate, sulfate, sulfite, thiosulfite, phosphonate, cyano, nitro, azo, sulfonamide, carbonyl, thiocarbonyl, C-carboxylate, O-carboxylate, N-thiocarbamate, O-thiocarbamate, oxo, thiooxo, oxime, acyl, acyl halide, azo, azide, urea, thiourea, N-carbamate, O-carbamate, C-amide, N-amide, guanyl, guanidyl, hydrazine and hydrazide.
[0055] The term "solvate" as used herein refers to a complex of variable stoichiometry (e.g., di-, tri-, terra-, penta-, hexa-, and so on), which is formed by a solute (the compound of the present invention) and a solvent, whereby the solvent does not interfere with the biological activity of the solute. Suitable solvents include, for example, ethanol, acetic acid and the like. [0056] The terms "hydroxyl" or "hydroxy" as used herein refer to an -OH group.
[0057] The term "amine" as used herein refers to a -NR'R" group where each of R' and R" is independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heteroalicyclic, aryl, heteroaryl, alkaryl, alkheteroaryl, or acyl, as these terms are defined herein. Alternatively, one or both of R' and R" can be, for example, hydroxy, alkoxy, hydroxyalkyl, trihaloalkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, heteroalicyclic, amine, halide, sulfonate, sulfoxide, phosphonate, hydroxy, alkoxy, aryloxy, thiohydroxy, thioalkoxy, thioaryloxy, cyano, nitro, azo, sulfonamide, carbonyl, C- carboxylate, O-carboxylate, N-thiocarbamate, O-thiocarbamate, urea, thiourea, N- carbamate, O-carbamate, C-amide, N-amide, guanyl, guanidine and hydrazine.
[0058] A numerical range; e.g., "1-10", as used herein, implies that the group, for example, an alkyl group, may contain 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to and including 40 carbon atoms or more.
[0059] The phrases“substituted alkyl” or“substituent alkyl” as used herein refer to one or more of an alkyl (e.g., forming a branched alkyl), an alkenyl, an alkynyl, a cycloalkyl, an aryl, a heteroaryl, a heteroalicyclic, a halo, a trihaloalkyl, a hydroxy, an alkoxy and a hydroxyalkyl as these terms are defined hereinbelow. An alkyl substituted by aryl is also referred to herein as "alkaryl", an example of which is benzyl.
[0060] The term "alkenyl" as used herein refers to an unsaturated alkyl for example, having at least two carbon atoms and at least one carbon-carbon double bond, e.g., allyl, vinyl, 3- butenyl, 2-butenyl, 2-hexenyl and i-propenyl. The alkenyl may be substituted or unsubstituted by one or more substituents.
[0061] The term "alkynyl" as used herein refers to an unsaturated alkyl having for example, at least two carbon atoms and at least one carbon-carbon triple bond. The alkynyl may be substituted or unsubstituted by one or more substituents.
[0062] The term "cycloalkyl" as used herein refers to an all-carbon monocyclic or fused ring (i.e., rings which share an adjacent pair of carbon atoms), branched or unbranched group containing 3 or more carbon atoms where one or more of the rings does not have a completely conjugated pi-electron system, and may further be substituted or unsubstituted. Exemplary cycloalkyl groups include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, or cyclododecyl. The cycloalkyl can be substituted or unsubstituted. When substituted, the substituent can be, for example, one or more of an alkyl, an alkenyl, an alkynyl, a cycloalkyl, an aryl, a heteroaryl, a heteroalicyclic, a halo, a trihaloalkyl, a hydroxy, an alkoxy and a hydroxy alkyl.
[0063] The term "aryl" as used herein refers to an all-carbon monocyclic or fused-ring polycyclic (i.e., rings which share adjacent pairs of carbon atoms) groups having a completely conjugated pi-electron system. The aryl group may be unsubstituted or substituted by one or more substituents. When substituted, the substituent can be, for example, one or more of an alkyl, an alkenyl, an alkynyl, a cycloalkyl, an aryl, a heteroaryl, a heteroalicyclic, a halo, a trihaloalkyl, a hydroxy, an alkoxy and a hydroxyalkyl.
[0064] The term "heteroaryl" as used herein refers to a monocyclic or fused ring (i.e., rings which share an adjacent pair of atoms) group having in the ring(s) one or more atoms, such as, for example, nitrogen, oxygen and sulfur and, in addition, having a completely conjugated pi- electron system.
[0065] The term "heteroalicyclic" as used refers to a monocyclic or fused ring group having in the ring(s) one or more atoms such as nitrogen, oxygen and sulfur. The rings may also have one or more double bonds. However, the rings do not have a completely conjugated pi-electron system.
[0066] The term "oxo" as used herein, describes a (=0) group, wherein an oxygen atom is linked by a double bond to the atom (e.g., carbon atom) at the indicated position.
[0067] The term "hydroxyalkyl" as used herein refers to an alkyl group, as defined herein, substituted with one or more hydroxy group(s), e.g., hydroxymethyl, 2- hydroxyethyl and 4- hydroxypentyl.
Aminoglycosides
[0068] In certain embodiments of the methods, compositions, and kits provided herein, the one or more readthrough inducing agents and/or NMD agents are aminoglycosides. In certain of these embodiments, the aminoglycosides are pseudo-oligosaccharide aminoglycosides (e.g., pseudo-tri saccharide aminoglycosides). In certain embodiments, the pseudo-trisaccharide aminoglycosides comprising a ribose derivative (e.g., an amino-ribose) conjugated with a pseudo-disaccharide derivative. In certain embodiments, the pseudo-disaccharide derivative comprises a glucose derivative (e.g., an amino-glucose). The aminoglycosides and derivatives thereof disclosed herein can be used as small molecule drugs to facilitate read-through of premature stop codons, for example, by binding to eukaryotic ribosomes, and restore full-length functional proteins. In certain embodiments, the aminoglycosides and derivatives thereof disclosed herein have improved affinity to eukaryotic ribosome and enhanced readthrough activity in comparison to classical aminoglycosides such as gentamicin. In certain embodiments, the aminoglycosides and derivatives thereof disclosed herein have reduced affinity to prokaryotic ribosomes and preferentially bind to eukaryotic ribosomes.
[0069] In certain embodiments of the methods, compositions, and kits provided herein, the one or more readthrough inducing agents and/or NMD agents are selected from the group consisting of Category I compounds, Category II compounds, Category III compounds, Category IV compounds, and Category VI compounds as described below. In certain embodiments, the aminoglycosides or derivatives thereof are selected from the group consisting of NB84, NB122, NB124, and NB127. In other embodiments, the aminoglycosides or derivatives thereof are gentamicin X2.
[0070] All references (e.g., patents and applications) referred to herein are incorporated by reference in their entireties.
Category Compounds
[0071] Category I compounds include all aminoglycosides disclosed or claimed in any application or patent claiming priority to U.S. Provisional Appl. No. 60/788,070, filed Apr. 3, 2006, and/or PCT Appl. No. PCT/IL2007/000463, filed Apr. 10, 2007 (PCT Publ. No. WO07/113841). These include, but are not limited to, U.S. Patent Nos. 9,073,958 and 9,821,001; CA Patent No. 2,646,407; and EP Patent Nos. 2007783 and 2390255.
[0072] Examples of Category I compounds include, without limitation, compounds of Formula I:
Formula I,
or stereoisomers or pharmaceutically acceptable salts thereof, wherein:
each of Ri, R2, and R3 is independently a monosaccharide moiety, halide, hydroxyl, amine, or oligosaccharide moiety; X is oxygen or sulfur;
R.4 is hydrogen or (S)-4-amino-2-hydroxybutyryl (AHB);
R 5 is hydroxyl;
Y is hydrogen or alkyl; and
the dashed line indicates an R configuration or an S configuration,
with the proviso that the compound is not selected from the group consisting of
Compoun
HO OH OH OH
amikacin, apramycin, arbekacin, butirosin, dibekacin, fortimycin, G-418, gentamicin, hygromycin, habekacin, dibekacin, netlmicin, istamycin, isepamycin, kanamycin, lividomycin, neamine, neomycin, paromomycin, ribostamycin, sisomycin, spectinomycin, streptomycin, and tobramycin.
[0073] In certain embodiments, a Category I compound having Formula I is selected from the group consisting of:
Compound 3 (also referred to as NB30),
Compound 7,
Compound 37 (also referred to as NB54),
Compound 22 (also referred to as NB83),
Compound NB88,
Compound 43,
or a stereoisomer or pharmaceutically acceptable salt thereof.
[0074] In certain embodiments wherein one or more of Ri, R2, and R3 is a monosaccharide moiety, the monosaccharide moiety has the structure set forth in Formula II:
Formula II,
wherein:
the dashed line indicates an R configuration or an S configuration; and
each of R6, R7, and Rx is independently selected from the group consisting of hydroxyl and amine.
[0075] In some embodiments, the amine is a substituted or unsubstituted amine. In some embodiments, the amine is an alkyl substituted amine (e.g., N(ϋ¾)2, NFhCiiFFs), NH(C6Hi 3 ), or NH(CH 2 CH 3 )).
[0076] Additional examples of Category I compounds include, without limitation, compounds of Formula la*:
Formula la*
or stereoisomers or pharmaceutically acceptable salts thereof, wherein:
the dashed line indicates an R configuration or an S configuration;
each of R*i, R*2, and R* 3 is independently a halide, hydroxyl, amine, or is linked to the compound having Formula I, wherein at least one of R*i, R*2 and R* 3 is linked to the compound having Formula I;
X* is oxygen or sulfur;
R*4 is hydrogen or an AHB moiety;
R*5 is hydroxyl or amine; and
Y* is hydrogen, alkyl or aryl. [0077] In certain embodiments, a Category I compound is a dimer comprising two units of Formula la* attached via their corresponding Ri, R*i, R 2 , R*2, R3, or R* 3 positions in any combination thereof, for example, an RI-R*2 or R2-R* 1 linked dimer, an RI-R* 3 or R 3 -R*I linked dimer, an R 3 -R*2 or R 2 -R* 3 linked dimer, an Ri-R*i linked dimer, an R 2 -R*2 linked dimer, or an R 3 -R*3 linked dimer. In some embodiments, the dimer is an Ri-R*i linked dimer.
[0078] In certain embodiments, the two units of the Formula la* dimer are attached (i.e., linked) via a linker, or a linking moiety. The term "linker" as used herein refers to a chemical moiety which is attached to at least two other chemical moieties and thereby connects ("links") those moieties. In certain embodiments the linker is preferably a low alkyl having 1-6 carbon atoms, and more preferably a methylene.
[0079] In certain embodiments, a Category I compound of Formula la* is:
Compound 9 (also referred to as NB33), or
Compound NB 136,
or a stereoisomer or pharmaceutically acceptable salt thereof.
Category Compounds
[0080] Category II compounds include all aminoglycosides disclosed or claimed in any application or patent claiming priority to U.S. Provisional Appl. No. 61/414,956, filed Nov. 18, 2010, and/or PCT Appl. No. PCT/IL2011/000889 (PCT Publ. No. W012/66546), filed Nov. 17,
2011. These include, but are not limited to, U.S. Patent Nos. 8,895,519, 9,175,029, 9,616,079, and 9,943,533; and EP Patent No. 2640734.
[0081] Examples of Category II compounds include, without limitation, compounds of Formula III:
Formula III
or stereoisomers or pharmaceutically acceptable salts thereof, wherein:
Ri is selected from the group consisting of alkyl, cycloalkyl, and aryl, and is preferably alkyl;
R2 is hydrogen or AHB;
R3 is selected from the group consisting of hydrogen, alkyl, cycloalkyl, and aryl, and is preferably hydrogen or alkyl; and
a stereo-configuration of each of position 6' and position 5" is independently an R configuration or an S configuration.
[0082] In some embodiments, cycloalkyl groups include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, or cyclododecyl.
[0083] In certain embodiments, a Category II compound having Formula III is selected from the group consisting of:
Compound NB 123,
Compound NB 128,
or a stereoisomer or pharmaceutically acceptable salt thereof.
Category III Compounds
[0084] Category III compounds include all aminoglycosides disclosed or claimed in any application or patent claiming priority to one or more of US Provisional Appl. Nos. 62/213,143, filed Sept. 2, 2015; 62/213,187, filed Sept. 2, 2015; and 62/274,915, filed Jan. 5, 2016; PCT
Appl. Nos. PCT/IL16/50965 (PCT Publ. No. W017/37717), filed Sept. 2, 2016; PCT/IL/l 6/50966 (PCT Publ. No. W017/37718), filed Sept. 2, 2016; PCT/IL/l 6/50968, filed Sept. 2, 2016 (published as WO2017/037719); and PCT/IL/l 6/50969 (PCT Publ. No. WO 17/118698), filed Sept. 2, 2016.
[0085] Examples of Category III compounds include, without limitation, compounds of Formula IV:
Formula IV
or stereoisomers or pharmaceutically acceptable salts thereof, wherein: the dashed lines indicates a stereo-configuration of position 6' being an R configuration or an S configuration;
Ri is alkyl, cycloalkyl, alkyaryl, or aryl;
R2 is selected from the group consisting of substituted or unsubstituted alkyl, OR', and NR'R", wherein each of R and R" is independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl;
R 4 is selected from the group consisting of hydrogen, acyl, amino-substituted alpha- hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and a cell-permealizable group; and
R3 is hydrogen, acyl, or a monosaccharide moiety represented by Formula V:
Formula V,
wherein:
the curved line denotes a position of attachment; and
R5 and R6 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, substituted or unsubstituted heteroaryl, acyl, and a cell-permealizable group or, alternatively, Rs and R6 together form a heterocyclic ring;
wherein when R2 is hydroxy, R 4 is not hydrogen, AHB, or (i?AS)-3 -amino-2 - hydroxypropionate (AHP), and/or at least one of Rs and/or R 6 , if present, is not hydrogen.
[0086] As used herein, "cell-permealizable group" refers to a group which can increase cell permeability of a compound. In some embodiments, a cell-permealizable group can include, without limitation, one or more groups selected from the group consisting of guanine, guanidyl, guanidine, hydrazinyl, hidrazide, thiohydrazide, urea, and thiourea. [0087] In certain embodiments, a Category III compound having Formula IV is selected from the group consisting of:
Compound NB 146,
Compound NB 152,
or a stereoisomer or pharmaceutically acceptable salt thereof.
[0088] In certain embodiments, the compound of Formula IV has a monosaccharide moiety at R.3, and is represented by Formula IVa:
Formula IVa,
or a stereoisomer or pharmaceutically acceptable salt thereof
wherein:
the dashed lines indicates a stereo-configuration of position 6' being an R configuration or an S configuration;
Ri is alkyl, cycloalkyl, alkyaryl, or aryl;
R2 is selected from the group consisting of substituted or unsubstituted alkyl, OR', and NR'R", wherein each of R and R" is independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl;
R 4 is selected from the group consisting of hydrogen, acyl, amino-substituted alpha- hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and a cell-permealizable group;
the curved line denotes a position of attachment; and
R 5 and R6 are each independently selected from the group consisting ofhydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, substituted or unsubstituted heteroaryl, acyl, and a cell-permealizable group or, alternatively, Rs and R6 together form a heterocyclic ring;
wherein when R 2 is a hydroxyl, R 4 is not hydrogen, AHB, or (i?AS)-3-amino-2- hydroxypropionate (AHP), and/or at least one of Rs and/or R 6 , if present, is not hydrogen.
[0089] In certain embodiments wherein, the compound of Formula IV has a monosaccharide moiety at R3, and is represented by Formula IVb:
Formula IVb
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
the dashed lines indicate a stereo-configuration of position 6' and/or 5" being an R configuration or an S configuration;
Ri is selected from the group consisting of hydrogen, alkyl, cycloalkyl, or aryl;
R2 is selected from substituted or unsubstituted alkyl, OR', and NR'R", wherein each of R and R" is independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl;
R 4 is selected from the group consisting of hydrogen, acyl, amino-substituted alpha- hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and a cell-permealizable group;
R 5 and R6 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, substituted or unsubstituted heteroaryl, acyl, and a cell-permealizable group, or, alternatively, Rs and R6 together form a heterocyclic ring; and
R7 is alkyl, cycloalkyl, or aryl, provided that:
when R 2 is hydroxy, R 4 is not hydrogen, AHB, or AHP, and/or at least one of Rs and/or R6, if present, is not hydrogen. [0090] In certain embodiments, a Category III compound having Formula IVb is selected from the group consisting of:
Compound Bl, Compound B2,
Compound Cl, Compound C2,
Compound El, and Compound E2,
or stereoisomers or pharmaceutically acceptable salts thereof.
[0091] Additional examples of Category III compounds include, without limitation, compounds having Formula Via:
Formula Via,
or stereoisomer or pharmaceutically acceptable salts thereof, wherein:
the dashed line indicates a stereo-configuration of position 6' being an R configuration or an S configuration;
Xi is O or S; the dashed bond between C4' and C5' in Ring I represents a single bond or a double bond; the dashed bond between C4' and C3' in Ring I represents a single bond or a double bond;
Rx, Ryi and Rz are each independently hydrogen, alkyl, cycloalkyl, or absent, wherein at least Rz is absent when the dashed bond between C4' and C5' is a double bond, and wherein at least Ryi is absent when the dashed bond between C4' and C3' is a double bond;
R7-R9 are each independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, carboxylate, sulfonyl (including alkyl sulfonyl and aryl sulfonyl), and a cell-permealizable group.
Ry2-Ry9 and RWI-RW3 are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, and cycloalkyl, each being substituted or unsubstituted; or, alternatively, each can be hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, carboxylate, sulfonyl (including alkyl sulfonyl and aryl sulfonyl), or a cell-permealizable group;;
Ri is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, substituted or unsubstituted amine, substituted or unsubstituted amide, acyl, carboxylate, substituted or unsubstituted saturated hydroxyl alkyl (e.g., -CH2-OH), and substituted or unsubstituted unsaturated hydroxy alkyl (e.g., -CH2-OH);
R2 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl;
R3 and R 4 are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heteroalicycle aryl, heteroaryl, amine, and OR16, wherein Ri 6 is independently selected from the group consisting of hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl, or is absent, wherein R 3 is optionally absent when the dashed bond between C4' and C5' is a double bond, and R 4 is optionally absent when the dashed bond between C4' and C3' is a double bond; and
R 5 and R6 are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heteroalicycle, aryl, heteroaryl, amine, and ORi 6 , wherein Ri 6 is independently selected from the group consisting of hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl.
[0092] In certain embodiments, a compound of Formula Via comprises a monosaccharide moiety, the monosaccharide moiety comprises the structure set forth in Formula VII:
Formula VII
wherein:
the curved line denotes a position of attachment;
the dashed line indicates a stereo-configuration of position 5" being an R configuration or an S configuration;
X2 is OR13 or NRi 4 Ri 5 ;
each of Rio, R11 and R13 is independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl;
R12 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, substituted or unsubstituted amine, substituted or unsubstituted amide, acyl, carboxylate, and saturated or unsaturated substituted hydroxyalkyl, or saturated or unsaturated unsubstituted hydroxyalkyl;
Ri4 and Ris are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, acyl, or a cell-permealizable group, or, alternatively, Ri4 and Ris, when present, together form a heterocyclic ring.
[0093] Substituents not shown in Formula VII at positions such as 6', 1", 2", 3", 4", and 5" are independently hydrogen or substituents, such as, but not limited, as defined for Ry 2 -Ry9.
[0094] In certain embodiments, a Category III compound having Formula IVa is selected from the group consisting of:
NB74-NlBz:
NB74-NlAc,
or stereoisomers or pharmaceutically acceptable salts thereof.
[0095] In certain embodiments, a compound of Formula Via comprising a monosaccharide moiety of Formula VII has the structure set forth in Formula VIb:
[0096] Additional examples of Category III compounds include, without limitation, compounds of Formula Vic:
Formula Vic
or stereoisomers or pharmaceutically acceptable salts thereof, wherein:
the dashed line indicates a stereo-configuration of position 6' being an R configuration or an S configuration;
Xi is O or S;
Rx, Ryi, and Rz are each independently hydrogen, alkyl, or cycloalkyl;
R7-R9 are each independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, carboxylate, sulfonyl (including alkyl sulfonyl and aryl sulfonyl), and a cell-permealizable group;
Ry2-Ry9 and RWI-RW3 are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, and cycloalkyl, each being substituted or unsubstituted, or, alternatively, each can be independently hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, carboxylate, sulfonyl (including alkyl sulfonyl and aryl sulfonyl), or a cell-permealizable group;
Ri is a substituted or unsubstituted hydroxy alkyl (e.g., -CH2-OH);
R2 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl; and
R.3 and R.4 are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heteroalicycle, aryl, heteroaryl, amine, and ORi6, wherein Ri6 is independently selected from the group consisting of hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl, as described herein for any of the respective embodiments of Formula Via.
[0097] Compounds represented by Formula Vic are also referred to herein as "diol-containing" compounds. In certain embodiments, diol-containing compounds are selected from the group consisting of:
Compound NB 157,
or stereoisomers or pharmaceutically acceptable salts thereof.
[0098] Additional examples of Category III compounds include, without limitation, compounds of Formula VId:
Formula VId,
or stereoisomers or pharmaceutically acceptable salts thereof, wherein: the dashed line indicates a stereo-configuration of position 6' being an R configuration or an S configuration;
Xi is O or S;
R7-R9 are each independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, carboxylate, sulfonyl (including alkyl sulfonyl and aryl sulfonyl), and a cell-permealizable group;
Rx, Ryi-Ry9 and RWI-RW3 are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, and cycloalkyl, each being substituted or unsubstituted, or, alternatively, each can be as defined herein for R7-R9;
Ri is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, substituted or unsubstituted amine, substituted or unsubstituted amide, acyl, carboxylate, substituted or unsubstituted saturated hydroxy alkyl (e.g., -CH2-OH-), or substituted or unsubstituted unsaturated and/or substituted hydroxy alkyl, as described herein in any of the respective embodiments of Formula Via or VIb;
R2 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl, as described herein in any of the respective embodiments of Formula Via or VIb;
R4-R 6 are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heteroalicycle, aryl, heteroaryl, amine, and OR1 6 , wherein Ri 6 is independently selected from hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl, as described herein in any of the respective embodiments of Formula Via or VIb; and [0099] Compounds represented by Formula VId are also referred to herein as "unsaturated glucosamine (Ring I)-containing" compounds. In certain embodiments, unsaturated glucosamine (Ring I)-containing compounds are selected from the group consisting of:
Compound NB 158 (R=H), and Compound NB 159 (R=CH 3 ), or stereoisomers or pharmaceutically acceptable salts thereof.
[00100] Additional examples of Category III compounds include, without limitation, compounds of Formula Vie:
or stereoisomers or pharmaceutically acceptable salts thereof, wherein:
the dashed line indicates a stereo-configuration of position 6' being an R configuration or an S configuration;
Xi is O or S;
Rx, Ryi and Rz are each independently hydrogen, alkyl, or cycloalkyl;
R7-R9 are each independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, carboxylate, sulfonyl (including alkyl sulfonyl and aryl sulfonyl), and a cell-permealizable group, as described herein for any of the respective embodiments of Formula Via or VIb,
Ry2-Ry9 and RWI-RW3 are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, and cycloalkyl, each being substituted or unsubstituted, or, alternatively, each can be as defined herein for R7-R9;
Ri is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, substituted or unsubstituted amine, substituted or unsubstituted amide, acyl, carboxylate, substituted or unsubstituted saturated hydroxyl alkyl (e.g., CH2-OH), or substituted or unsubstituted unsaturated hydroxy alkyl, as described herein in any of the respective embodiments of Formula Via or VIb;
R2 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl, as described herein for Formula Via;
R3 and R 4 are each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heteroalicycle, aryl, heteroaryl, amine, and OR1 6 , wherein Ri6 is independently selected from hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, or acyl, as described herein for any of the respective embodiments of Formula Via;
wherein at least one of R3-R6 is OR16, at least two of substituents R2 and R3-R6 are OR16, and OR16 is an acyl.
[00101] Additional examples of Category III compounds include, without limitation, compounds of Formula VIII:
Formula VIII,
or stereoisomers a pharmaceutically acceptable salt thereof, wherein:
the dashed line indicates a stereo-configuration of position 6' being an R configuration or an S configuration;
Ri is selected from the group consisting of a hydroxy- substituted alkyl, a hydroxy- substituted alkenyl, a hydroxy-substituted cycloalkyl and a hydroxy-substituted aryl;
R2 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and OR', wherein R is selected from the group consisting of hydrogen, substituted or
unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl;
R3-R6 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and OR', wherein R is selected from the group consisting of hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl; and
R7-R9 are each independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and a cell-permealizable group. [00102] In certain embodiments, a compound of Formula VIII is selected from the group consisting ofNBl53 and NB 155.
[00103] In certain embodiments, a compound of Formula VIII comprises a monosaccharide moiety, the monosaccharide moiety has the structure set forth in Formula IX:
Formula IX,
wherein:
the curved line denotes a position of attachment;
the dashed line indicates a stereo-configuration of position 5" being an R configuration or an S configuration;
Rio and Rn are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and acyl;
R12 is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted aryl;
each of Ri4 and Ris is independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and a cell-permealizable group, or, alternatively, Ri4 and Ris together form a heterocyclic ring.
[00104] In certain embodiments, a compound of Formula VIII comprising a monosaccharide moiety of Formula IX has the structure set forth in Formula Villa:
Formula Villa,
wherein:
the variables are as described herein for Formula VIII and Formula IX, including any combination thereof.
[00105] In certain embodiments, a compound of Formula VIII is selected from the group consisting ofNBl56 and NB 157.
[00106] Additional examples of Category III compounds include, without limitation, compounds of Formula X:
Formula X
or stereoisomers or pharmaceutically acceptable salts thereof, wherein:
the dashed line indicates an optional stereo-configuration of position 6' being R configuration or an S configuration;
Ri is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, and substituted or unsubstituted aryl;
R2 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and OR', wherein R is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl;
R4-R.6 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and OR', wherein R is selected from the group consisting of hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl; and
R7-R9 are each independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and a cell-permealizable group.
[00107] Compounds represented by Formula X are also referred to herein as "unsaturated glucosamine (Ring I)-containing" compounds.
[00108] In certain embodiments wherein, a compound of Formula X comprises a monosaccharide moiety, the monosaccharide moiety is a monosaccharide moiety of Formula IX as defined above. In certain of these embodiments, the compound of Formula X has the structure set forth in Formula Xa:
Formula Xa,
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
each of the variables is independently as defined herein in any of the respective embodiments and any combination thereof.
[00109] In some embodiments, R14 and/or R15 are alkyl substituted with a carbonyl or oxo (i.e., C=0) group (e.g., -CO(CisH3i)). In some embodiments, R14 and R15 form together a nitrogen-containing heterocyclic ring, such as, but not limited to, morpholine, piperidine, and piperazine. In some embodiments, Ris and/or Ri 4 are a guanidine group (guanidinyl; guanidyl). In some embodiments, R15 and/or Ri 4 is independently an alkyl, a cell-permealizable group, as described herein, or an acyl, such as, for example, an alpha-hydroxy acyl or an amino-substituted alpha-hydroxy acyl, as described herein. Ri4 and R15, if present, include, but are not limited to, hydrogen, (R/S)-4-amino-2-hydroxybutyryl (AHB), (R/S)-3-amino-2-hydroxypropionyl (AHP), 5-aminopentanoyl, 5-hydroxypentanoyl, formyl, -C(=0)-0-methyl, -C(=0)-0-ethyl, -C(=0)-0- benzyl, -b-amino-a-hydroxypropionyl, -d-amino-a-hydroxyvaleryl, -b-benzyloxycarbonylamino- a-hydroxypropionyl, -d-benzyloxycarbonylamino- a-hydroxyvaleryl, methylsulfonyl, phenylsulfonyl, benzoyl, propyl, isopropyl, -(CHz^NHz, -(CH) 3 NH2, -CH2CH(NH2)CH3, - (CH4NH2, -(CH 2 ) 5 NH2, -(CH 2 )2NH-ethyl, -(CH2)2NH(CH 2 )2NH2, -(CH2)3NH(CH 2 )3NH2,-
(CH2)3NH(CH2)4NH(CH 2 )3NH2, -CH(-NH 2 )CH 2 (OH), -CH(-OH)CH 2 (NH 2 ), -CH(-OH)-
(CH 2 )2(NH 2 ), -CH(-NH 2 )-(CH 2 )2(OH), -CH(-CH 2 NH2)-(CH 2 OH), -(CH 2 )4NH(CH2)3NH 2 , - (CH2)2NH(CH2)2NH(CH 2 )2NH2, -(CH2)2N(CH 2 CH2NH2)2, -CH 2 -C(=0)NH 2 , -CH(CH 3 )-
C(=0)NH 2 , -CHz-phenyl, -CH(i-propyl)-C(=0)NH 2 , -CH(benzyl)-C(=0)NH 2 , -(CH 2 )20H, - (CH 2 )30H and -CH(CH 2 OH) 2 .
[00110] In some embodiments, R? is selected from the group consisting of hydrogen, (R/S)~4~ amino-2-hydroxybutyiyl (AHB), (R/ S)-3 -amino-2-hy droxy propionate (AHP), and (R/S)-3- amino-2-hydroxypropionyl, 5- aminopentanoyf, 5-hydroxypentanoyl, formyl, -C( ::: 0)-0-methyl, -C(=0)-0-ethyl, -C(=0)-0-benzyl, -b-amino-a-hydroxypropionyl, -5-amino-a-hydroxyvaleryL - b-b enzy 1 oxy carb ony i am i n o-a-hy droxy propi ony 1. ~5~b en zy i oxycarb on y 1 ami no- a-hy droxy v al eryl, methylsulfonyl, phenylsulfonyl, benzoyl, propyl, isopropyl, -((Ί =3 ).· 1 i ·. -{(Ί 1 } XI i ·. -
C(=0)NH 2 , -CH(CH3)-C(= : 0)NH2 S -CHz-phenyl, -CH(i-propyi)-C(= : 0)NH2 s -CH(benzyl)- P ί ) > X 1 1 . ·K Ί l.d'Ol i. -<i l l·) ()i I and -Cl IK Ί bOi 1 } 2 In some embodiments, R? is alkyl, cycioalkyl or aryl. In some embodiments, R? is an alkyl selected from the group consisting of ethyl, propyl, isopropyl, isobutyl, tert-butyl, and benzyl. In some embodiments, R? is hydrogen, acyl or amino-substituted a-hydroxy-acyl. In some embodiments, R is a substituted and/or un substituted methyl or ethyl . In some of these embodiments, the methyl or ethyl is substituted by, for example, a cycloaikyl or aryl In some embodiments, R? is cyeloalkyl, and the cycloaikyl can be, for example, cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl. In some embodiments, R 7 is aryl, and the a d can be, for example, a substituted or unsubstituted phenyl. Non-limiting examples include unsubstituted phenyl and toluene. In some embodiments, R/ is an aryl acyl (e.g., -C(=0)-R wherein R is an aryl, e.g., a benzene).
Category IV Compounds
[00111] Category IV compounds include all aminoglycosides disclosed in the applications and patents claiming priority to US Provisional Appl. No. 62/515,021, filed June 5, 2017, and/or PCT Appl. No. PCT/IL18/50612, filed June 5, 2018.
[00112] Examples of Category IV compounds include, without limitation, compounds of Formula XI:
Formula XI
or stereoisomers or pharmaceutically acceptable salts thereof, wherein:
the dashed line indicates a stereo-configuration of position 6' being an R configuration or an S configuration;
Ri is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, and substituted or unsubstituted aryl;
R. 2 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and ORx, wherein Rx is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or un substituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, or an acyl, or alternatively IU is ORx and together with R 3 forms a dioxane, R 3 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and ORy, wherein Ry is selected from the group consisting of hydrogen, substituted or
unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl, or, alternatively, Rs is ORy and together with R2 forms a dioxane;
R 4 -R 0 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and ORz, wherein Rz is selected from the group consisting of hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or un substituted heteroaryl, substituted or un substituted alkaryl, and acyl; and
R7-R 9 are each independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and su!fonyl,
provided that at least one of R7-R9 is a su!fonyi
[00113] In certain embodiments, a compound of Formula XI in which R7 is sulfonyl has the structure of Formula XIa:
Formula XIa,
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R.6, R-8, and R9 are as defined for Formula XI; and
R 1 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted alkaryl, and substituted or unsubstituted aryl.
[00114] In certain embodiments, a compound of Formula XI is a compound of Formula XI*:
Formula XI*
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
the dashed line indicates a stereo-configuration of position 6' being an R configuration or an S configuration;
Ri is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, and substituted or unsubstituted aryl;
R2 is ORx, wherein Rx is selected from the group consisting of substituted or
unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted alkaryl;
R3 is ORy, wherein Ry is selected from the group consisting of substituted or
unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted alkaryl;
R4-R6 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and ORz, wherein Rz is selected from the group consisting of hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl; and
R7-R9 are each independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and sulfonyl, and wherein ORx and ORy are linked to one another such that R2 and R3 together form a dioxane.
[00115] In certain embodiments, a compound of Formula XI is a compound of Formula XI*a:
Formula XI*a
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
Ri, R4-R6 and R7-R9 are as defined for Formula XI*; and
Rw is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted alkaryl, and substituted or unsubstituted aryl.
[00116] In certain embodiments, a compound of Formula XI is a compound of Formula XI*b:
Formula XI*b
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
Rw, Ri, R4-R6, R8, and R9 are as defined for Formula XI*; and
R is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted alkaryl, and substituted or unsubstituted aryl.
[00117] In certain embodiments wherein, the compound of Formula XI comprises a monosaccharide moiety, the monosaccharide moiety has the structure set forth in Formula IX. In certain of these embodiments, the compound has the structure of Formula XII:
Formula XII
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R1-R4 and R6-R9 are each as defined for Formula X or Formula Xa; and
Rio, R11, R12, R14, and R15 are each as defined for Formula IX.
[00118] In certain embodiments of the compound of Formula XII wherein R7 is sulfonyl, the compound has the structure of Formula Xlla:
Formula Xlla
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R1-R4, R0, Rs, and Rg are as defined for Formula X or Formula Xa;
Rio, R11, R12, R14, and R15 are as defined for Formula IX; and
R is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted alkaryl, and substituted or unsubstituted aryl.
[00119] In certain embodiments, a compound of Formula Xlla is selected from the group consisting of:
Compound NBl24-MeS, and Compound NB !24-PhS,
and stereoisomer or pharmaceutically acceptable salts thereof.
[00120] In certain embodiments of the compound of Formula XII wherein Rs is ORz and Rz is the monosaccharide moiety represented by Formula IX, the compound has the structure of
Formula XII*:
Formula XII*
or is a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R1-R4 and R6-R9 are each as defined for Formula X* or X*a or X*b; and
Rio, R11, R12, R14, and R15 are each as defined for Formula XI.
[00121] In certain embodiments of the compound of Formula XII wherein the compound comprises a dioxane and the dioxane is a substituted or unsubstituted l,3-dioxane, the compound has the structure of Formula XII* a:
Formula XII* a
or is a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
Ri, R4, R 6 , and R7-R9 are as defined for Formula X* or X*a or X*b;
Rio, R11, R12, R14, and R15 are as defined for Formula XI; and Rw is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted alkaryl, and substituted or unsubstituted aryl.
[00122] In other embodiments wherein, the compound of Formula XII comprises a dioxane and the dioxane is a substituted or unsubstituted l,3-dioxane, the compound has the structure of Formula XII*b:
Formula XII*b
or is a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
Rw, Ri, R 4 , R 6 , R8, and R9 are as defined for Formula X*b;
Rio, R11, R12, R14, and R15 are as defined for Formula IX; and
R is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted alkaryl, and substituted or unsubstituted aryl.
[00123] Additional examples of Category IV compounds include, without limitation, compounds of Formula XIII:
Formula XIII
or stereoisomers or pharmaceutically acceptable salts thereof, wherein:
Y is oxygen or sulfur; Ri 6 is selected from the group consisting of hydrogen, amine, and ORq;
Rq is selected from the group consisting of hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted alkaryl;
R3-R6 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted aryl, unsubstituted alkyl, and ORz, wherein Rz is selected from hydrogen, a monosaccharide moiety, an oligosaccharide moiety, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkaryl, and acyl; and
R7-R9 are each independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and sulfonyl.
[00124] In certain embodiments, a compound of Formula XIII is selected from the group consisting of:
Compound NB 161,
or stereoisomers or pharmaceutically acceptable salts thereof.
[00125] In certain embodiments of the compound of Formula XIII, wherein Rs is ORz, and Rz is the monosaccharide moiety represented by Formula XI, the compound has the structure of Formula Xllla:
Formula Xllla
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
the dashed line indicates a stereo-configuration of position 5" being each independently an R configuration or an S configuration;
Y, R.3, R.4, and R.6-R9 are each as defined for Formula XIII;
Rio and R11 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, and acyl;
R12 is selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, and substituted or unsubstituted aryl; and
each of R14 and R15 is independently selected from the group consisting of hydrogen, acyl, amino-substituted alpha-hydroxy acyl, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkaryl, sulfonyl, and a cell-permealizable group, or, alternatively, R14 and R15 together form a heterocyclic ring.
[00126] In certain embodiments, a compound of Formula Xllla is selected from the group consisting of:
Compound NB 163 (Ri2=H), and
Compound NB 165 (RI 2 =CH 3 ),
or stereoisomers or pharmaceutically acceptable salts thereof.
Methods
[00127] Aspects of the present disclosure are directed towards inhibiting nonsense mediated decay of CFTR mRNA in a subject by administering one or more aminoglycosides and/or derivatives thereof.
[00128] In some aspects, the present disclosure provides methods of inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations in a subject by administering to the subject one or more aminoglycosides and/or derivatives thereof. As used herein,“inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations” refers to inhibiting nonsense mediated decay of an mRNA transcribed from a CFTR gene containing one or more nonsense mutations, and these two phrases may be used interchangeably. In some embodiments, the methods further comprise inducing readthrough activity.
[00129] In another aspect, the present disclosure provides methods of treating cystic fibrosis in a subject in need thereof. In some embodiments, the method comprises administering to the subject one or more aminoglycosides and/or derivatives thereof in an amount effective to inhibit nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations. In some embodiments, the methods further comprise inducing readthrough activity.
[00130] In another aspect, the present disclosure provides methods of treating cystic fibrosis by inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations in a subject in need thereof. In some embodiments, the methods comprise administering to the subject one or more aminoglycosides and/or derivatives thereof. [00131] In yet another aspect, the present disclosure provides methods of inhibiting the nonsense mediated mRNA decay pathway to stabilize CFTR mRNA transcripts comprising one or more nonsense mutations, which normally would cause an increase in the CFTR mRNA transcript decay rate. In some embodiments, stabilization of a CFTR mRNA transcript can result in production of a full-length and/or fragment CFTR protein. In some embodiments, the methods further comprise inducing readthrough activity.
[00132] In some embodiments, the methods of treating cystic fibrosis in a subject having a CFTR mRNA transcripts comprising one or more nonsense mutations comprise administering one or more aminoglycosides and/or derivatives thereof, wherein the one or more aminoglycosides and/or derivatives thereof induce readthrough activity and inhibit nonsense mediated decay. In some embodiments, the methods further comprising treating CF.
[00133] In some aspects, the present disclosure provides a kit comprising one or more aminoglycosides and/or derivatives thereof for use in inhibiting nonsense mediated mRNA decay of a CFTR transcript comprising one or more nonsense mutations. In some embodiments, the kit further comprises instructions of use. In certain embodiments, the kit is for use in treating CF.
[00134] In some embodiments, after administration of one or more aminoglycosides and/or derivatives thereof, the subject exhibits an increase in organoid swelling as compared to baseline and/or control. An increase in organoid swelling is correlated to increase of the CFTR protein function. In some embodiments, the subject exhibits an increase in organoid swelling of at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, or at least about 200% as compared to baseline and/or control.
[00135] In some embodiments, after administration of one or more aminoglycosides and/or derivatives thereof, the subject exhibits an increase in CFTR transcript mRNA levels as compared to baseline and/or control. In some embodiments, the subject exhibits an increase in CFTR transcript mRNA levels of at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, or at least about 200% as compared to baseline and/or control.
[00136] In some embodiments, after administration of one or more aminoglycosides and/or derivatives thereof, the subject exhibits an increase in CFTR protein levels as compared to baseline and/or control. In some embodiments, the subject exhibits an increase in CFTR protein levels of at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, or at least about 200% as compared to baseline and/or control.
[00137] In some embodiments, the subject is identified as having one nonsense mutation allele of the CFTR transcript. In yet another embodiment, the subject is identified as having two nonsense mutation alleles of the CFTR transcript. In some embodiments, the subject having two nonsense mutation alleles of the CFTR transcript exhibits greater CFTR mRNA stability after administration of one or more aminoglycosides and/or derivatives thereof as compared to a subject having one nonsense mutation allele of the CFTR transcript.
[00138] In some embodiments, the subject has a G524X allele of the CFTR transcript. In some embodiments, the subject is homozygous for a G524X allele of the CFTR transcript. In yet another embodiment, the subject is heterozygous for a G524X allele of the CFTR transcript. In one embodiment, subject has a G524X/W1282X genotype of the CFTR transcript.
[00139] In some embodiments, the subject is administered a therapeutically effective dose of administration of one or more aminoglycosides and/or derivatives thereof. In some embodiments, the therapeutically effective dose of the one or more aminoglycosides and/or derivatives thereof decreases symptoms of cystic fibrosis by inhibiting NMD.
[00140] In certain embodiments of the methods provided herein, the one or more readthrough inducing agents and/or nonsense mediated decay (NMD) agents may be administered daily, two or more times per week, weekly, bi-weekly (i.e., every other week), every third week, or monthly. In certain preferred embodiments, the one or more readthrough inducing agents and/or NMD agents are administered twice per week, weekly, or bi-weekly.
[00141] In certain embodiments, the one or more readthrough inducing agents and/or NMD agents may be administered more frequently at or near the start of the treatment period. For example, the one or more readthrough inducing agents and/or NMD agents may be administered twice per week at the start of treatment, then once per week for the remainder of the treatment period. In certain of these embodiments, the initial higher frequency dosing may continue for a period of time determined in advance. For example, a readthrough inducing agent and/or NMD agent may be administered at a certain frequency for a specific number of weeks or months, at which point administration frequency is reduced. Alternatively, the initial higher frequency dosing may continue until a specific benchmark is achieved. In certain embodiments, this benchmark is the achievement of a steady-state blood concentration. In these embodiments, the initial higher frequency dosing constitutes a loading phase designed to achieve steady-state, and the ensuing lower frequency dosing constitutes a maintenance phase designed to sustain steady- state. In other embodiments, the benchmark may be the achievement of a specific therapeutic outcome, for example a reduction or cessation in one or more symptoms.
[00142] In certain embodiments, the one or more readthrough inducing agents and/or NMD agents may be administered at a higher dosage at or near the start of the treatment period, and a lower dosage later in the treatment period. In certain of these embodiments, the initial higher dosage may continue for a period of time determined in advance. For example, a readthrough inducing agent and/or NMD agent may be administered at an initial higher dosage for a specific number of weeks or months, at which point dosage is reduced. Alternatively, the initial higher dosage may continue until a specific benchmark is achieved. In certain embodiments, this benchmark is the achievement of a steady-state blood concentration. In these embodiments, the initial higher dosage constitutes a loading phase designed to achieve steady-state, and the ensuing lower dosage constitutes a maintenance phase designed to sustain steady-state. In other embodiments, the benchmark may be the achievement of a specific therapeutic outcome, for example a reduction or cessation in one or more symptoms.
[00143] In certain embodiments, both the administration frequency and the dosage of a readthrough inducing agent and/or NMD agent may be adjusted over the course of treatment.
[00144] In certain embodiments of the methods provided herein, the one or more readthrough inducing agents and/or NMD agents may be administered for a specific time course determined in advance. For example, the one or more readthrough inducing agents and/or NMD agents may be administered for a time course of 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, 16 weeks, 20 weeks, 24 weeks, 36 weeks, 48 weeks, 1 year, 18 months, 2 years, or more than 2 years. In other embodiments, the one or more readthrough inducing agents and/or NMD agents may be administered indefinitely, or until a specific therapeutic benchmark is reached. For example, the one or more readthrough inducing agents and/or NMD agents may be administered until one or more symptoms of a genetic disorder have been eliminated or reduced to a desired level.
[00145] In certain embodiments of the methods, compositions, and kits provided herein, the one or more readthrough inducing agents and/or NMD agents may specifically target nonsense mutations that are associated with the CFTR gene and/or CF. In some embodiments, the NMD agents may specifically target mutations that are associated with nonsense mediated decay.
[00146] In certain embodiments of the methods provided herein, the nonsense mutation targeted for readthrough may be one for which a particular readthrough inducing agent induces a relatively low level of readthrough as compared to other nonsense mutations. In certain embodiments, the methods provided herein target conditions associated with such mutations, and co-administration of the one or more readthrough inducing agents results in a higher degree of readthrough than can be achieved with the one or more readthrough inducing agents alone.
[00147] In certain embodiments of the methods provided herein, the nonsense mutation targeted for NMD may be one for which a particular NMD agent induces a relatively low level of NMD inhibition as compared to other nonsense mutations. In certain embodiments, the methods provided herein target conditions associated with such mutations, and co-administration of the one or more NMD agents results in a higher degree of NMD inhibition than can be achieved with the one or more NMD agents alone.
[00148] In certain embodiments of the methods provided herein, the nonsense mutation targeted for readthrough and NMD may be one for which a particular readthrough and NMD agent induces a relatively low level of readthrough and NMD inhibition as compared to other nonsense mutations. In certain embodiments, the methods provided herein target conditions associated with such mutations, and co-administration of the one or more readthrough and NMD agents results in a higher degree of readthrough and NMD inhibition than can be achieved with the one or more readthrough and NMD agents alone.
[00149] In certain embodiments of the methods provided herein, the genetic disorder being treated is CF, and the nonsense mutation is selected from the group consisting of, but not limited to, E92X, S1255X, W1089X, Y1092X (C-A), R1158X, W1282X, Y1092X (C-G), S1455X, R553X, C225X, G542X, and S466X in the CFTR gene In certain preferred embodiments, the mutation may be selected from the group consisting of E92X, S1255X, W1089X, Y1092X (C- A), R1158X, W1282X, and Y1092X (C-G).
[00150] In some embodiments, the subject is identified as having one or more nonsense alleles of the CFTR transcript selected from the group consisting of E92X, S1255X, W1089X, Y1092X (C-A), R1158X, W1282X, Y1092X (C-G), S1455X, R553X, C225X, G542X, and S466X. In some embodiment, the subject has one or two nonsense alleles of the CFTR transcript.
[00151] In certain embodiments of the methods provided herein, one or more additional therapeutic agents may be administered in addition to the one or more readthrough inducing agents and/or NMD agents. A readthrough inducing agent and/or NMD agent may be delivered to a subject by any administration pathway known in the art, including but not limited to parenteral, oral, aerosol, enteral, nasal, ophthalmic, parenteral, or transdermal (e.g., topical cream or ointment, patch). "Parenteral" refers to a route of administration that is generally associated with injection, including intravenous, intraperitoneal, subcutaneous, infraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intrapulmonary, intraspinal, intratarsal, intrathecal, intrauterine, subarachnoid, subcapsular, transmucosal, or transtracheal.
[00152] In certain embodiments, the therapeutically effective amount is an amount that yields maximum therapeutic effect. In other embodiments, the therapeutically effective amount yields a therapeutic effect that is less than the maximum therapeutic effect. For example, a therapeutically effective amount may be an amount that produces a therapeutic effect while avoiding one or more side effects associated with a dosage that yields maximum therapeutic effect. The precise therapeutically effective amount for a particular agent will vary based on a variety of factors, including but not limited to the characteristics of the agent (e.g., activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (e.g., age, body weight, sex, disease type and stage, medical history, general physical condition, responsiveness to a given dosage, and other present medications), the nature of any pharmaceutically acceptable carriers present in the agent composition, and the route of administration. One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, namely by monitoring a subject's response to administration of the agent and adjusting the dosage accordingly. For additional guidance, see, e.g., Remington: The Science and Practice of Pharmacy, 22 nd Edition, Pharmaceutical Press, London, 2012, and Goodman & Gilman's The Pharmacological Basis of Therapeutics, 12 th Edition, McGraw-Hill, New York, NY, 2011, the entire disclosures of which are incorporated by reference herein.
[00153] In certain embodiments of the methods provided herein wherein the subject is human, the one or more aminoglycosides and/or derivatives thereof may be administered at a dosage of 0.1 mg/kg to 10 mg/kg, 0.1 to 7.5 mg/kg, 0.1 to 5 mg/kg, 0.1 to 4 mg/kg, 0.1 to 3 mg/kg, 0.1 to 2.5 mg/kg, 0.2 to 10 mg/kg, 0.2 to 7.5 mg/kg, 0.2 to 5 mg/kg, 0.2 to 4 mg/kg, 0.2 to 3 mg/kg, 0.2 to 2.5 mg/kg, 0.3 to 10 mg/kg, 0.3 to 7.5 mg/kg, 0.3 to 5 mg/kg, 0.3 to 4 mg/kg, 0.3 to 3 mg/kg, or 0.3 to 2.5 mg/kg. In certain embodiments, wherein the aminoglycoside being administered is NB124, the compound may be administered at a dosage of about 0.3 to about 2.5 mg/kg, for example at a dosage of about 0.3, about 0.5, about 1.0, about 1.5, about 2.0, or about 2.5 mg/kg.
[00154] In certain embodiments of the methods provided herein, a therapeutically effective amount of a readthrough inducing agent and/or NMD agent may be a dosage at which the agent is capable of generating a desired response as a monotherapy (e.g., a target level of readthrough induction, etc.), i.e., when administered alone. In certain of these embodiments, the therapeutically effective amount may be a dosage that has previously been determined to be optimal or near optimal for generating the desired response. In other embodiments, a therapeutically effective amount of a readthrough inducing agent and/or NMD agent may be lower than the dosage at which the agent would normally be administered for use as a monotherapy, i.e., a suboptimal dose. In certain of embodiments, the dosage of readthrough inducing agent may change over the course of the treatment regimen. For example, the readthrough inducing agent and/or NMD agent may be administered at higher dosage at the start of treatment (e.g., a loading phase), followed by a lower dosage later in treatment. In certain embodiments, this loading phase may also utilize more frequent administration than later phases of the treatment period.
Compositions
[00155] Examples of pharmaceutically acceptable carriers that may be used in conjunction with the compositions provided herein include, but are not limited to, (1) sugars, such as lactose, glucose, sucrose, or mannitol; (2) starches, such as com starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols such as propylene glycol; (11) polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) disintegrating agents such as agar or calcium carbonate; (14) buffering or pH adjusting agents such as magnesium hydroxide, aluminum hydroxide, sodium chloride, sodium lactate, calcium chloride, and phosphate buffer solutions; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) alcohols such as ethyl alcohol and propane alcohol; (20) paraffin; (21) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, or sodium lauryl sulfate; (22) coloring agents or pigments;
(23) glidants such as colloidal silicon dioxide, talc, and starch or tri-basic calcium phosphate;
(24) other non-toxic compatible substances employed in pharmaceutical compositions such as acetone; and (25) combinations thereof.
[00156] One of ordinary skill in the art will recognize that the various embodiments described herein can be combined. For example, steps from the various methods of treatment disclosed herein may be combined in order to achieve a satisfactory or improved level of treatment.
EXAMPLES
[00157] The foregoing and the following working examples are merely intended to illustrate various embodiments of the present invention. The specific modifications discussed above are not to be construed as limitations on the scope of the invention. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of the invention, and it is understood that such equivalent embodiments are to be included herein. All references cited herein are incorporated by reference as if fully set forth herein.
Example 1 : ELX-02 Increases CFTR mRNA Levels and Activity in a Mutation-Specific Manner
[00158] ELX-02 was evaluated for an ability to inhibit nonsense mediated decay and readthrough of nonsense mutations associated with cystic fibrosis. Specifically, the effects of ELX-02 were evaluated on organoids with the G542X CFTR mutation. Overall, these experiments showed that ELX-02 both inhibits nonsense mediated decay resulting in increased CFTR mRNA stability and induces read-through of nonsense mutations associated with cystic fibrosis. Materials and Methods
[00159] The effect of ELX-02 treatment on accumulative swelling in organoids with the G542X CFTR mutation was evaluated using an Forskolin-induced swelling (FIS) assay. Measurement of organoid swelling provides an assessment of the activity of the CFTR protein. Increased expression of CFTR mRNA can contribute to increased abundance of the CFTR protein. The FIS assay was performed as described previously (Dekkers 2013). Organoids were seeded on an assay plate at 25-50 per well. ELX-02 (0, 12.5, 25, 50 or 100 pg/mL) or Vertex controls (VX770 and VX809; 3 mM) were added at the time of seeding, and the plate was incubated for 48 hours.
[00160] After 48 hours, organoids were incubated for 30 minutes with 10 pM calcein green. After calcein treatment, forskolin (5pM) was added. Organoid size was directly measured by fluorescence microscopy using a Cell Voyager 7000S (Yokogawa) microscope over up to 2 hours, with images taken every 10 minutes.
[00161] Images were automatically analyzed using Fiji (Fiji Life-Line version, 2014 November 25), an open source image processing package based on ImageJ. HUB has generated a script which detect the organoids and quantifies change in size over time. Fiji identified objects (organoids) and measures the area of each object at each time point. Subsequently, the change in size over time (relative to t=0) was calculated for each object. If the macro failed to identify an object in one or more time points, this object was excluded from all time points. From the remaining objects, the median change of size for each time point was calculated. The relative organoid size was averaged between replicates. The area under the curve (AUC) was calculated by using the software GraphPad Prism (version GraphPad Prism 7). AUC levels were found to differ in a mutation-specific manner.
Results
[00162] After the FIS assay was complete, organoid pellets were collected and processed for RT-PCR. CFTR mRNA levels were measured. These results are summarized in FIG. 1 A, which shows mRNA levels normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and FIG. 1B, which shows unnormalized mRNA levels. In FIGs. 1A and 1B, grey bars represent organoids treated with ELX-02 and white bars represent untreated organoids. As shown in FIG. 1 A, normalized CFTR mRNA expression levels increased in organoids with nonsense mutations treated with ELX-02 as compared untreated organoids. In contrast, regardless of treatment with ELX-02, no significant changes in CFTR mRNA expression levels were observed in organoids without the nonsense mutations (i.e., wt and F508del). FIG. 1B shows the non-normalized CFTR mRNA expression levels. Significantly, mRNA expression levels are typically normalized as shown in FIG. 1A as changes in expression levels can appear negligible when non-normalized. However, as shown in FIG. 1B, the increase in mRNA expression levels were so significant that normalization was not necessary. The increase in the CFTR mRNA levels indicates that ELX-02 not only induces readthrough activity, but also, inhibits nonsense mediated decay pathways. In particular, if ELX-02 operated only by inducing readthrough of nonsense mutations and did not inhibit nonsense mediated decay, there would be no change in CFTR mRNA expression levels. This is because readthrough activity effects only the resulting CFTR protein and/or CFTR activity levels and is irrespective of changes mRNA expression levels.
[00163] The AETC data was used to evaluate the correlation between the elevation in mRNA levels and changes in CFTR function after ELX-02 treatment in three G542X organoids: homozygous G542X/G542X and heterozygous G542X/F508del and G542X/W1282X. These results are summarized in FIG. 2. Accumulative swelling levels were found to be tightly correlated to CFTR mRNA levels. G542X/G542X, which exhibited the largest normalized increase in mRNA levels of the three G542X organoids tested, also exhibited the largest AUC. These results suggest that increased functional CFTR activity following treatment with ELX-02 is associated with increased mRNA levels. Surprisingly, FIG. 2 shows that organoids with nonsense mutations that showed a greater relative increase in CFTR mRNA levels (i.e., nonsense mutations more susceptible to NMD) after treatment with ELX-02 also exhibited greater CFTR protein activity. This is surprising as it is generally expected that organoids with nonsense mutations less impacted by NMD would have greater mRNA abundance levels, would therefore, exhibit higher CFTR protein increases through read-through. Importantly, this suggests that ELX-02 has the potential to be more effective at treating cystic fibrosis than therapeutic agents that only induce readthrough activity without inhibiting nonsense mediated decay.
Conclusion
[00164] Taken together, these data indicate the efficacy of ELX-02 in treating cystic fibrosis by targeting nonsense mutations associated with nonsense mediated decay. This contrasts conventional therapies that have focused on targeting stable nonsense mutations that are less susceptible to nonsense mediated decay. It is contemplated that ELX-02 has the potential to treat patients with cystic fibrosis that have a wide range of nonsense mutations of the CFTR gene, to include mutations associated with NMD.
Example 2: ELX-02 Induces Readthrough Translation in Nonsense Mutations Resulting in a Functional CFTR as Assessed in Human-Derived Intestinal Organoids
[00165] This study assessed the ability of ELX-02 to suppress several CFTR gene nonsense mutations, including the most frequent nonsense mutations G542X and W1282X accounting for 37% and 17% of reported nonsense mutations in this gene. More specifically, rectal biopsy- derived organoid system was used to evaluate CFTR function via a forskolin-induced swelling assay. As shown below, the CFTR W1282X/W1282X organoids demonstrate no swelling upon forskolin induction indicating a lack of functional CFTR. This is consistent with other Class 1 mutations (Dekkers 2016). In addition, the organoids were unresponsive to potentiator and corrector compounds approved for use in other cystic fibrosis patient classes. However, when incubated with 25, 50 or 100 pg/mL ELX-02 for 48 hours, swelling was observed in the CFTR w1282X/w1282X subject organoid and increased in a dose-dependent fashion. The response increased further by concomitant presence of CFTR potentiator/corrector. Organoid swelling is CFTR activity dependent as co-administration of CFTR inhibitor compounds abolishes ELX-02 induced swelling. The degree of CFTR activity increase observed with 50 and 100 pg/mL ELX- 02 is consistent with the change reported in organoids derived from patient that have demonstrated clinically meaningful responses with potentiator and corrector compounds (Dekkers 2016; Berkers 2019). 100 pg/mL ELX-02 increased CFTR mRNA in the subject organoid by 3.6-fold over vehicle consistent with increased mRNA stability.
Materials and Methods
[00166] In initial assays, multiple nonsense mutation stop codons and the surrounding nucleotide context were inserted into a dual luciferase reporter vector for quantification of stop codon readthrough efficiency. Intestinal organoid derived from 11 individuals carrying 8 different CFTR genotypes were also used to monitor the restoration of CFTR function in the most physiologically relevant setting possible in cultured cells.
[00167] Compound Formulation: ELX-02 was diluted in Type 1 Milli-Q water to a stock concentration of 20 mg/mL. Potentiator and corrector compounds were sourced from SelleckChem and stock solutions were prepared in Type 1 Milli-Q water to a stock concentration of 10 mM. CFTR inhibitor 172 and CFTR inhibitor-II were sourced from Sanbio and stock solutions were prepared in dimethyl sulfoxide (DMSO).
[00168] Plasmids. DNA fragments derived from human CFTR , tested nonsense mutation, or the corresponding wild-type codon and six upstream and downstream flanking nucleotides as shown in FIG. 3 were synthesized and inserted into the polylinker of the dual luciferase, p2luc plasmid. In p2Luc, firefly luciferase cDNA is located downstream to the Renilla cDNA. To keep the open reading frame (ORF) between the inserted sequences and firefly luciferase, an additional adenosine nucleotide was inserted upstream to the CFTR insert.
[00169] Dual Luciferase Readthrough Assays : For in vitro readthrough assays, the plasmids obtained in the presence of ELX-02 (0-16 mM) were transcribed and translated using TNT reticulocyte lysate quick-coupled transcription/translation system (TNT® Quick Master, Promega). Luciferase activity was determined 90 minutes post incubation at 30°C using the dual luciferase reporter assay system according to manufacturer protocol (Promega). Luminescence was measured immediately after the addition of assay buffer for 30 seconds on a Synergy HTX luminometer (Biotek, USA), relative light unit (RLU) counts, normalized for the background were used to calculate the Firefly to Renilla luciferase ratio for each sample. The Firefly to Renilla luciferase ratio was used to determine the percent stop codon readthrough of the construct carrying the nonsense mutation by dividing it by the Firefly to Renilla luciferase ratio of the same construct carrying the wild-type sequence.
[00170] For cell based readthrough assays, plasmids were transfected into Hela cells (American Type Culture Collection) maintained in Dulbecco’s Modified Eagle Medium (Invitrogen) supplemented with 4 mM L-glutamine, 1.5 g/L sodium bicarbonate, 4.5 g/L glucose and adjusted to contain 10% fetal calf serum (Gibco) at 37°C and 5% C02. Cells were maintained according to standard techniques. Cells were grown to 70-80% confluence, seeded into 96-well plates at a density of 10,000 cells per well and allowed to grow to a confluence of 50-60% (~24 h) before transfection. Typically, 100 ng of pGL2-Luc plasmid DNA was mixed with 0.4 pL TurboFectTM Transfection Reagent (ThermoFisher Scientific) was used per well. Transfected cells were incubated at 37°C and 5% C02 for 24 hours, medium was replaced, and ELX-02 was added (0.125, .25, 0.5, 1, and 1.5 mM). Cells were washed once with 50 pL 1 c PBS and then lysed by addition of 25 pL of 1 x Passive Lysis Buffer (Promega). After 25 minutes of incubation, 10 mL of the cell lysate were removed, and luciferase activity was measured as described above for the in vitro translation assay. Percent readthrough was also calculated as described above.
[00171] Tissue Processing·. Crypts isolated from the biopsies were plated according to LM004 in a multi-well plate. After crypt isolation, leftover biopsy material was placed in a microfuge tube (labelled with the M-number, the HUB-code and a 2D barcode) and frozen at -80°C for future DNA isolation and SNP fingerprinting.
[00172] DNA Isolation and SNP Fingerprinting: DNA was isolated using an automated equipment (Qiasymphony) and subsequently analyzed using TaqMan OpenArray technology in combination with the QuantStudio 12K Flex Real-Time PCR System. Both the OpenArray Barcode Panel 32 and OpenArray Barcode Panel 60, including 29 and 57 autosomal and 3 Y- chromosomal SNPs, respectively, were used.
[00173] Crypt Isolation from Intestinal Biopsies and Organoid Culture Establishment. Stem cell isolation and organoid differentiation was originally described in Sato 2011. Briefly, rectal biopsies were imaged for integrity and visible crypts then washed with cold phosphate buffered saline (PBS) until the supernatant was clear. Samples were diced using a scalpel into pieces no larger than 2 mm. Next, the tissue fragments were incubated in 2 mmol/L EDTA in PBS for 90- 120 minutes at 4°C. After removal of the EDTA buffer, tissue fragments were vigorously resuspended in cold chelation buffer using a l0-mL pipette to isolate intestinal crypts. The tissue fragments were allowed to settle down under normal gravity for 1 minute, and the supernatant was removed for inspection by inverted microscopy. The resuspension/sedimentation procedure was repeated six to eight times, and the supernatants not containing crypts were discarded. The supernatants containing crypts were collected in tubes coated with bovine serum albumin. Isolated crypts were pelleted, washed with cold chelation buffer, and centrifuged at 150-200 xg for 3 minutes to separate crypts from single cells.
[00174] Crypts were resuspended in Matrigel (Corning 356231) and plated in a multi-well tissue culture plate. When the Matrigel was polymerized, culture media was added, and the plate placed in a tissue culture incubator. Media for CF organoids contains the following components: Wnt-conditioned media, Noggin, R-spondin, B27, n-Acetyl Cysteine, Nicotinamide, hEGF, A83- 01, SB202190 and Gastrin. When organoids were formed and reached a threshold size, organoids were passaged by breaking the organoids into smaller pieces by mechanical shearing and plating the fragments in fresh Matrigel. [00175] Organoid Swelling Assay The organoid FIS assay was performed as described in Boj 2017. Briefly, the FIS assay was performed by adding ELX-02 alone or with VX-809 at the time of organoid seeding (25-50 organoids per 96-well) in an assay plate and incubated for 48 hours at 37°C. For ELX-02 and/or corrector treated samples, compounds were added at the time of organoid seeding for a total treatment time of 48 hours. After 48 hours, organoids were incubated for 30 minutes with 1 OmM calcein green. After calcein treatment, Forskolin and VX- 770 (added to a final concentration of 3mM at the time of forskolin induction) were added and organoid cross-sectional area was directly measured by confocal fluorescence microscopy for up to 2 hours with images taken every 10 minutes. In experiments in which CFTR inhibitors were included, a combination of CFTR inhibitor 172 and CFTR inhibitor-II were added at a final concentration of 50 mM three hours before the addition of forskolin. Forskolin was used at 5mM, or as indicated, and VX-770 and VX-809 at 3mM each. Organoid size was directly measured by fluorescence microscopy up to 2 hours, images taken every 10 minutes. Two different live-cell microcopy systems were used: Cell Voyager 7000S (Yokogawa) and an Operetta CLS (Perkin Elmer). Direct comparison across the two systems revealed no significant differences in FIS results. Images were automatically analyzed using Fiji (Fiji Life-Line version, 2014 November 25), an open source image processing package based on ImageJ. Lising Fiji, each organoid was detected, and its cross-sectional area was measured at each time point. Organoids were detected, tracked and measured for area over time. Subsequently, the change in cross sectional area over time (relative to t=0) and median change of size for each time point was calculated for each object. The relative organoid size was averaged between replicates. Where indicated, the area under the curve (AUC) was calculated by using Graphpad Prism (version GraphPad Prism 7).
All experiments were performed with biological duplicate or triplicates, representing 2 or 3 independent wells per condition. Experimental replicates were also performed, these are described for each experiment.
[00176] RNA Isolation, cDNA Preparation, and qPCR Analysis: For CFTR mRNA analysis, organoids embedded in Matrigel were seeded in a 24-well plate format. After seeding, ELX-02 was added to culture media of appropriate wells and organoids were incubated for 48 hours at 37°C. RNA was isolated using the RNeasy protocol from Qiagen and the concentration was measured using the Qubit HS RNA assay. cDNA was synthesized using Superscript II with random primers (hexamers) on 200 ng total RNA. cDNA was diluted 5-fold and 1 mΐ was used to run the qPCR in a total reaction volume of 10 mΐ. For every experiment a standard curve using 1 :5 dilutions of reference cDNA were loaded and used for quantification. The following primer pairs were used for the quantitation of CFTR and GAPDH mRNA {CFTR- l-F,
C ATTGC AGT GGGCTGT AA ACTC; CFTR- l-R, CTTCTGTTGGCATGTCAATGAACTT; hGAPDH fw2, GCATCTTCTTTTGCGTCG; MH hGAPDH rv2,
TGTAAACCATGTAGTTGAGGT). The qPCR reaction was performed in a Quantstudio Real- Time PCR Instrument (Thermofisher). In every qPCR assay plate, a standard curve was included which was used to calculate the abundance of CFTR and GAPDH in each sample. To determine the relative abundance in each sample, the value of CFTR was normalized to GAPDH.
[00177] Statistical Analysis: Graphpad Prism 7 software (Version 7.0d) was used for statistical analysis. All data were included for purposes of statistical analysis. FIS assay data were tested by ordinary one-way ANOVA with post-hoc Dunnett’s multiple comparison testing versus Vehicle subgroups. Testing was performed on transformed data due to unequal variances across groups. qPCR data were evaluated by unpaired t-test.
Results
[00178] ELX-02 Efficiently Suppresses Nonsense Mutations in Human CFTR : The stop codon of G542X, W1282X, and additional tested nonsense mutations and the surrounding nucleotide context, shown in FIG. 3, were inserted into a dual luciferase reporter vector for quantification of stop codon readthrough efficiency. ELX-02 induced readthrough in a dose-dependent manner as shown in FIG. 3 and FIG. 4.
[00179] FIG. 3 depicts the nonsense mutations found in human CFTR gene that were cloned between Renilla and Firefly luciferase in a biluciferase plasmid. As a control, the wild-type sequence was additionally cloned. The location of the different mutations in CFTR is indicated in the second column (i.e., titled Mutation), and the prevalence of each mutation in the cystic fibrosis patient population is indicated in the third column (i.e., titled % prevalence in the nonsense population #). The nonsense mutation and the nucleotides flanking the nonsense mutations which were cloned into the bi-luciferase plasmid are indicated to the right of the percent prevalence. Nucleotide of nonsense mutations are indicated as "0" position and are indicated with (uridine, "U"), (guanidine, "G") or E¾3 (adenine, "A"). Nucleotides highlighted in ίϋI indicate consensus sequence known to show high natural translation readthrough. Percent readthrough (% readthrough relative to wild type) was calculated as detailed above under materials and methods and reflected ELX-02 induced readthrough in an in vitro translation assay. Percent readthrough in cell-based assay was measured in Hela cells transfected with bi-luciferase plasmid and treated with ELX-02, as detailed in material and methods. Percent readthrough in Hela cells is shown in FIG. 4 for ELX-02 concentration of 1.5 mM. FIG. 4 shows ELX-02 dose dependently increase readthrough of two prevalent CFTR nonsense mutations, G542X (dark grey bars shown on the right) and W1282X (light grey bars shown in the left), as assessed on bi-luciferase plasmids. ELX-02 concentrations are denoted below the X-axis. Data are mean of three triplicates and standard deviation.
[00180] The expected hierarchy in the intrinsic fidelity of the stop codons (EiAA>EiAG»EiGA) was observed with the nucleotides at the +4 and -4 positions showing an enhancing effect in the context of all stop codons (FIG. 3, highest readthrough for S466X for ETGA, Q522X for EGAA). The maximum level of readthrough achieved with ELX-02 was 32% and 8% for S466X mutation, in vitro and ex-vivo , respectively (FIG. 3). ELX-02 was about 6 times more effective than gentamicin in increasing basal readthrough rates both in vitro and in cell based readthrough assays. The identity of a PSC and its surrounding mRNA sequence context have already shown to have considerable influence on the ability of drugs to suppress PSCs. Therefore, it was important to determine readthrough efficiency for various stop codons. A set of 17 PSCs found in the human CFTR gene of patients were selected (FIG. 3). These mutations have different prevalence in the patient population (FIG. 3). For all the stop codons tested, ELX-02 clearly promoted PSC readthrough inducing 0.1-33% readthrough in vitro and 0.5-10% readthrough in cell-based assay, depending on the stop codon considered (FIG. 3). PSC readthrough levels can be quantified very efficiently with the dual reporter system, but it was also important to determine the effect of the drug on endogenously expressed proteins. Thus, the effect of ELX-02 on the production of the endogenous CFTR protein by testing CFTR channel activity in human derived intestinal organoids was analyzed next.
ELX-02 -Induced Readthroush of PSCs in Human CFTR Results in Functional Activity:
[00181] ELX-02 was tested in human derived bronchial epithelial cells (HBEs) carrying a compound heterozygous mutation in CFTR , DeltaF508/G542X. ELX-02 (250 pg/ml) showed a 2.5-fold induction in forskolin (20 mM)- stimulated short-circuit current (Isc) in HBEs. These findings were next extended to additional CFTR nonsense mutations using human intestinal organoid cultures derived from the rectal epithelium of 11 individuals carrying 8 different CFTR genotypes as shown in Table 2.
Table 1. Additional CFTR Nonsense Mutations
[00182] Intestinal organoid cultures are three-dimensional (3D) adult stem cell-based cultures that self-organize into tissue-recapitulating "mini-guts" in vitro that enable the long-term expansion and biobanking of primary patient tissue using defined growth conditions. In this study, the recently developed and validated forskolin-induced swelling (FIS) assay was used, which measures the forskolin-induced, C ZR-dependent, swelling of 3D-intestinal organoids. The FIS assay was able to discriminate between different classes of CFTR mutations and respond to CFTR therapeutics
[00183] First, the optimal forskolin concentration and time of drug exposure on patient derived G542X/DeltaF508 organoids was assessed. To determine the swelling effect induced by ELX- 02 (100 pg/ml) on G542X/DeltaF508 organoids derived from patients were used with three different forskolin concentrations (0.128, 0.8, and 5 mM) to identify the minimal forskolin concentration required to induce swelling in combination with compounds as shown in FIGs. 5A-5C. FIG. 5A shows the quantification of the surface area relative to t = 0 (normalized area) of F508del/G542X mutant rectal organoids treated for 24, 48 or 72 hours with ELX-02 (0, 100 pg/ml) or VX770/VX809 (3 mM) and different forskolin concentrations (0.128, 0.8 and 5 mM) averaged from three independent wells. Organoid swelling was measured every 10 minutes for a total of 60 minutes. FIG. 5B shows the FIS of rectal organoid F508del/G542X treated with various ELX-02 concentrations (indicated in the graph inset) for 48 hours. Organoids were then treated with Forskolin (5mM) and swelling measured every 10 minutes for a total of 120 minutes. Lastly, FIG. 5C shows the FIS of F508del/G542X rectal organoid incubated with the indicated ELX-02 concentrations for 48 hours and with increasing Forskolin concentrations (indicated below the graph). The data is expressed as the absolute area under the curve (ALTC) calculated from tracings comparable to (B) (baseline, 100%; t = 120 min), the data was collected in triplicates, and represent the mean ±SD.
[00184] The results as shown in FIG. 5A demonstrate that a forskolin dose-dependent increase in swelling was greatly varied among organoids with different CFTR mutations consistent with previous reports. Indeed, forskolin in combination with either ELX-02 or VX-770/VX-809 showed a dose-dependent induction of swelling in G542X/deltaF508 organoids (FIG. 5A, compare left with middle and right panels).
[00185] Swelling was induced in a time-dependent manner for ELX-02 with maximal response detected with 5 mM forskolin and 48 hours incubation for ELX-02 (ALTC 60 min, 747±185). Similarly, forskolin dose-response analyses was done for all other organoids used in this study. The optimal forskolin concentration for each genotype is shown in Table 2.
Table 2 Optimal Forskolin Concentration of Each Genotype
[00186] A plateau in swelling was not reached after 60 minutes in ELX-02 treated organoids (FIG. 5A, dotted circles). Thus, a dose-response study with ELX-02 following organoid swelling for 120 minutes was performed as depicted in FIG. 5B. ELX-02 showed a dose- dependent increased swelling in G542X/deltaF508 intestinal organoids, reaching a maximal response at 100 pg/ml (AUC 120 min, 3523 ± 693). Indeed, organoid swelling continued for 120 minutes at all doses (FIG. 5B). For all subsequent studies, organoid swelling was measured for 120 minutes. In HBE cells derived from CF-patients carrying the compound mutation, DeltaF508/G542X, ELX-02 (250 pg/ml) induced a 2.5-fold induction in forskolin-induced current; this is in line with the effect detected in this study using FIS-assay in intestinal organoids, 1.6-fold from untreated organoids at ELX-02 concentration of 100 pg/mL.
[00187] CFTR W1282X/W1282X subject organoids were evaluated for CFTR chloride channel activity in six separate experiments (FIG. 6). As shown in FIG. 6, ELX-02 administered organoids demonstrate a significant increase in CFTR activity as evidenced by organoid swelling. Three initial experiments were performed using 5 pM forskolin induction, each of which demonstrated increased organoid swelling at 50 and 100 pg/mL ELX-02.
[00188] As shown in Table 3 and FIG. 10, a forskolin titration experiment was performed using the subject’s organoids evaluating 0, 50 and 100 pg/mL ELX-02 activity with 0, 0.128, 0.8, 2, and 5 pM forskolin induction levels. These data demonstrate no significant differences in ELX- 02 organoid swelling using 0.8, 2, and 5 pM forskolin. Therefore, subsequent studies used 0.8 pM forskolin induction.
Table 3 ELX-02 Increases Organoid Swelling
*Values represent cumulative swelling (AETC) over 120 minutes poste forskolin induction.
[00189] The effect of ELX-02 alone or in combination with VX-770/VX-809 on additional organoids expressing other nonsense mutations, homozygote nonsense mutations (FIG. 8, G542X, W1282X), heterozygote nonsense mutations (FIG. 8, G542X/W1282X), and compound heterozygote (FIG. 10, G542X/R1066C, DeltaF508/Rl 162X). FIGs. 8A-68 show that ELX-02 exhibited a dose-dependent increase in swelling for all homozygote nonsense mutations tested.
[00190] Organoids were incubated with the indicated concentrations of ELX-02 and VX809 for 48 hours, VX-770 (3 mM) and Forskolin (5 mM) were added at time 0. Swelling was followed every 10 minutes for a total of 120 minutes. FIGs. 8A and 8D show the effect of treating a homozygote G542X organoid with ELX-02 (FIG. 8A) or ELX-02 with VX-770/VX809 (FIG. 8D) as indicated in the inset of FIGs. 8C and 8F, respectively. FIGs. 8B and 8E show two different patient-derived homozygote W1282X organoids (organoid A on the left and B on the right) treated with ELX-02 (FIG. 8B) or ELX-02 in combination with VX-770/VX-809 (FIG. 8E). FIGs. 8C and 8F, show the heterozygote G542X/W1282X organoid treated with the indicated concentrations of ELX-02 or in combination with VX-770/VX-809. Again, all experiments were done in triplicates and data are represented as means ± SD.
[00191] The data indicate that the highest activity was detected in G542X homozygous organoids with a maximal value seen at 100 pg/ml (AETC 120 min, 4443 ± 690); a lower response was observed in W1282X homozygous organoids (maximal response at 100 pg/ml, AUC 120 min, 1771 ± 512) and a lower response in the heterozygote, G542X/W1282X (maximal response at 100 pg/ml, AUC 120 min, 2010 ± 290). The difference in response cannot be attributed to the type of the mutation as similar differences in response, 120% versus 140% response, were observed in W1282X derived from two different patients. In dual luciferase cell- based assay (FIG. 3), a similar readthrough effect was observed for G542X and W1282X mutations, 1.56 and 1.73%, respectively, indicating that there is a similar readthrough potential between the two mutations. Thus, there may be another factor contributing to the change in response between patient-derived organoids, for example factors regulating nonsense mediating decay of CFTR mRNA (NMD).
[00192] Next, experiments were conducted to determine if there is a synergistic effect between the CFTR corrector, VX-770, CFTR potentiator, and ELX-02 in homozygote nonsense mutation organoids as shown in FIGs. 8D, 8E, and 8F. Correctors and potentiators act to enhance the activity of a translated CFTR protein: potentiators improve the channel gating of CFTR and correctors augment trafficking of CFTR to the plasma membrane. Thus, it was contemplated that the addition of a corrector and potentiator would enhance the activity of CFTR translated due to nonsense mutation readthrough by ELX-02. As expected, the CFTR corrector alone was unable to induce swelling in CFTR nonsense mutations, as no protein is synthesized. Additionally, as expected ELX-02 had no effect on the F508D homozygous organoids. Inhibition of CFTR inhibitor- 172 and -II eliminated the swelling response following ELX-02 administration. However, VX-770/VX-809 was able to increase ELX-02 induced swelling in some of the tested organoids. A marked induction of ELX-02 activity in G542X homozygote organoid was observed as shown in FIG. 8D, and a more modest induction of activity was seen in one of the W1282X homozygote organoids (FIG. 8E, compare left and right panels) and in the double nonsense mutant organoid G542X/W1282 (FIG. 8F, potentiation of ELX-02 (50 pg/ml)).
[00193] CFTR W1282X/W1282X subject organoids were also evaluated for CFTR chloride channel activity in combination with potentiator (VX 770) and/or corrector (VX809). As shown in FIG. 9, neither potentiator nor corrector altered forskolin induced swelling in the absence of ELX-02. However, when ELX-02 was included, the potentiator, corrector and the two in combination had an additive effect up to +87% over ELX-02 alone. Without intending to be bound by any particular theory, these results suggest that the mechanism of action of VX770 and VX809 both require production of full-length CFTR protein to be present in order to elicit an effect. The potentiator VX770 increases the open probability of the CFTR channel, allowing more chloride ions per channel to pass in a given period of time while VX809 acts as a chaperone, improving channel folding and thereby increasing cell surface CFTR. For example, both VX770 and VX809 only increase CFTR function in homozygous nonsense patient cells when combined with a read-through agent. Together, these data indicate that the increased CFTR function observed with ELX-02 can be further improved when combined with potentiator and corrector compounds. Raw data for FIG. 9 are presented in Table 4.
Table 4. CFTR Chloride Channel Activity in CFTR W1282X/W1282X Organoids After Treatment with Potentiator (VX770) and/or Corrector (VX809)
*Values represent cumulative swelling (AUC) over 120 minutes post forskolin induction.
[00194] ELX-02 rescues function of composite heterozygote mutations in CFTR in rectal organoids measured by FIS are shown in FIGs. 10A and 10B. Organoids were incubated with the indicated concentrations of ELX-02 for 48 hours, Forskolin (5 mM) was added at time 0. Swelling was followed every 10 minutes for a total of 120 minutes. FIG. 10A shows two different heterozygote G542X/R1066C organoids (organoid A and B, left and right panels) treated with ELX-02 concentrations as indicated in the inset in the right panel. FIG. 10B shows two different patient-derived heterozygote DF508/R1162X organoids (organoid A on the left and B on the right) treated with ELX-02 as indicated in the inset in panel A. Again, all experiments were done in triplicates and data are represented as means ± SD. Rescue of G542X mutation by ELX-02 in the context of another compound heterozygote mutant, R1066C, also showed a dose- dependent effect, reaching a high response as shown in FIG. 10 A. A variable response to ELX- 02 treatment was observed also for this mutation between two different donors, one showing a very high response and a second showing a very low response (FIG. 10 A, compare left and right panels, respectively). Compound mutations, DeltaF508/Rl 162X, responded in a dose-dependent manner to ELX-02 treatment, showing a robust response by two different donor derived organoids as shown in FIG. 10B (2383 ± 194 and 3115 ± 370).
[00195] To compare the effect of ELX-02 between organoids expressing different nonsense mutations in CFTR , the area under the curve of ELX-02 (100 pg/ml) treatment were represented as shown in FIG. 11. The highest response to ELX-02 was seen for homozygote nonsense mutants, G542X and W1282X; this is expected as the drug is acting on both alleles. As there is no approved treatment to these patients, ELX-02 offers a treatment modality to cystic fibrosis patients carrying nonsense mutations. Compound heterozygote, nonsense mutation in one allele and another class of CFTR mutation in the second allele, tended to show half of the response relative to organoids carrying nonsense mutation in both alleles.
[00196] The swelling response was CFTR activity dependent according to the results of FIG. 12 which shows that swelling occurs in the presence of CFTR channel inhibitors. CFTR inhibitor 172 (Ma 2002) and CFTR inhibitor II (GlyHlOl, (Muanprasat 2004) are selective and reversible inhibitors of CFTR chloride transport. CFTR inhibitor 172 has a Ki of 300 nM while CFTR inhibitor II has a Ki <10 mM. The compounds were used in combination at a final concentration of 50 mM. While relatively potent compared to CFTR inhibitor II, CFTR inhibitor 172 has poor membrane permeability and the CFTR localization in organoids is on the apical (interior) membrane. Inhibitors or DMSO vehicle control was added at the initiation of swelling. Vehicle (DMSO) and CFTR inhibitor administered groups demonstrated no swelling while subject organoids cultured with 100 pg/mL ELX-02 demonstrated a significant (p<0.000l) increases in swelling. Organoid shrinking may have been caused by known dehydrating effects of DMSO (Cheng 2015). ELX-02 swelling was reduced following addition of CFTR inhibitors. This data demonstrates that ELX-02 induced organoid swelling is attributable to a restoration of CFTR activity in subject organoids. Raw data for FIG. 12 are presented in Table 5.
Table 5: Organoid Swelling Following Treatment with Vehicle or CFTR Inhibitor Following Culture With ELX-02
[00197] Subject organoids were administered 100 pg/mL ELX-02 for 48 hours. After 48 hours, total RNA was collected, and qPCR was performed. As shown in FIG. 13, there was a significant 3.6-fold increase in CFTR expression with ELX-02 relative to vehicle-treated control (p=0.0008). These data are consistent with a steady-state elevation of CFTR transcripts due to ELX-02 mediated readthrough activity. Raw data for FIG. 13 are presented in Table 6. Table 6: qPCR of CFTR mRNA Transcript in Organoids Following Culture With ELX-02
[00198] FIGs. 14A-14C show FIS assay results with 5mM forskolin and various concentrations of ELX-02. FIGs. 15A-C show results of a forskolin and ELX-02 titration study for a duration of 120 minutes. Vehicle, 50 and 100 pg/mL ELX-02 were induced with 5 mM (A) and 0.8 mM Forskolin (B) after 48 hours of incubation. Results from A, B are converted to ALTC values and compared with 0, 0.128, 2, and 5mM Forskolin in (C).
Conclusion
[00199] In this study, ELX-02 was rationally designed to show enhanced PSC readthrough activity on human ribosomes with limited toxicity. ELX-02 shows a robust readthrough activity of several nonsense mutations expressed in cystic fibrosis patients, both in in vitro translation assays using reticulocyte ribosomes and in cell-based assay (See FIG. 1). Readthrough activity of ELX-02 adheres to natural readthrough rules, wherein LTGA codon is readthrough better than Li AG and LTAA codons (FIG. 3, 8%, 6% and 2%, respectively, representing the best for each).
[00200] Rectal organoid cultures derived from the rectal epithelium of 11 individuals carrying 8 different CFTR genotypes (see Table 2) to monitor the restoration of CFTR function in the most physiologically relevant setting possible in cultured cells were used. Rectal organoids can reliably recapitulate the severity of disease between different genotypes, with the most severe lack of swelling response to forskolin observed for nonsense mutations. Moreover, rectal organoids show a clinically correlative response to CFTR potentiators and correctors. The correlation of response was dependent on the concentration of forskolin, and thus, the dose of forskolin that induced swelling for each genotype was determined (Table 3). Similarly, to what has been observed for other genotypes, a response to ELX-02 at a low forskolin concentration of 0.128 mM, which was further augmented by 0.8 mM forskolin was observed.
[00201] These data collectively demonstrate the CFTR activity dependent increase in organoid swelling and elevated CFTR mRNA consistent with improved nonsense mutation readthrough in response to ELX-02 using cells derived from the CFTR WI282X/WI282X subject. In addition, this study further showed that ELX-02 demonstrated a concentration related response in nonsense mutation patient derived organoids that lack a response to potentiators and correctors. The degree of CFTR activity increases observed with 50 and 100 pg/mL ELX-02 are consistent with the change reported in organoids derived from patient that have demonstrated clinically meaningful responses with potentiator and corrector compounds (Dekkers 2016; Berkers 2019). An additive response was also noted with combinations of potentiators/correctors with ELX-02. The ELX-02 mediated CFTR activity response was further increased when potentiators and/or correctors were added to ELX-02 incubated subject organoids. In addition, CFTR mRNA significantly increases with incubation of the subject’s organoids with 100 pg/mL ELX-02, consistent with an attenuation of the process of nonsense mutation mediated mRNA decay. These data provide evidence that ELX-02 restores CFTR function in patient derived organoids from nonsense cystic fibrosis patients. Together, these data are consistent with the promotion of nonsense mutation read-through mediated by ELX-02 and provide evidence that ELX-02 may have therapeutic benefit for cystic fibrosis patients with nonsense mutations.
Example 3 : ELX-02 Increases Full-Length CFTR mRNA through Nonsense Mediated Decay Interruption
[00202] ELX-02 was evaluated for an ability to increase the production of full-length CFTR mRNA by inhibiting nonsense mediated decay.
Results
[00203] Organoids were tested for their responsiveness towards treatment with ELX-02 as shown in FIG. 16. FIG. 16 indicates favorable organoid swelling, suggesting that treatment with ELX-02 will translate to clinically meaningful results in organoids with one or two nonsense alleles.
[00204] FIG. 17 shows that a CFZR-dependent organoid swelling is observed across Forskolin induction levels when treated with ELX-02. These data demonstrate that there is a dose- dependent readthrough activity of ELX-02 on the production of functional CFTR protein in an organoid with G542X CFTR alleles.
[00205] FIGS. 18A and 18B demonstrate that treatment with ELX-02 increases CFTR mRNA to healthy control levels as measured by qPCR primers and nanostring probes to the 3’ region of CFTR mRNA. Specifically, FIG. 18A shows the CFTR fold change relative to GAPDH as quantified by CFTR qPCR primers and FIG. 18B shows the change in the normalized counts of CFTR mRNA.
[00206] Unexpectedly, CFTR instability was observed in CFTR nanostring analysis when comparing probes that bind to different regions of the mRNA. While 5’ and 3’ probes bound in a similar manner in healthy wild-type control samples, nonsense allele contained samples demonstrated relatively reduced levels of 3’ probe binding versus 5’ (Figure 19). Further, and consistent with nonsense mediated decay, double nonsense allele organoids had reduced levels CFTR mRNA. Next, ELX-02 is observed to increase probe detection across all probes consistent with an increase in CFTR mRNA abundance. Taken together, these results demonstrate that treatment with ELX-02 significantly increases probe detection across all probes and in most organoids.
[00207] FIG. 20 shows that 3’ CFTR probe binding is reduced relative to 5’ probes. In particular, in healthy (i.e., wild-type) organoids 3’ detection was 93% of the 5’ detection. In contrast, 3’ probe detection was 36% of expected in organoids with two nonsense alleles and 70% in heterozygous nonsense organoids. Importantly, mRNA degeneration may be reflective of the position of the nonsense mutation. For example, ribosomes may temporarily protect the mRNA from nonsense mediated decay triggered endonuclease activity depending on the position of the mutation as depicted pictorial in FIG. 21.
[00208] The results from this study also indicated that ELX-02 mediated organoid swelling is equivalent in organoids with one or two nonsense alleles as shown in FIG. 22. In particular, a significant increase in organoid swelling was observed in both G542X organoids with a second nonsense allele and heterozygous organoids.
Conclusion
[00209] The results from the study indicate that ELX-02 permits dose dependent increases in CFTR mRNA and that nonsense mediated decay activity is detectable through 375’ binding ratios. Treatment with ELX-02 also increased CFTR mRNA stability with a response most pronounced in organoids bearing two nonsense alleles. It is contemplated that this response is a result of the inhibition of nonsense mediated decay pathways. Lastly, ELX-02 treatment increased CFTR function in organoids bearing nonsense alleles representing greater than about 75% of the cystic fibrosis nonsense genotype population. REFERENCES
1. Bedwell et al. Nat Med 3(11): 1280-1284 (Nov. 1997)
2. Berkers et al. Cell Rep 26(7): 1701-1708 (Feb. 12, 2019)
3. Bidou et al. RNA Biol l4(3):378-388 (Mar. 4, 2017)
4. Boj et al. J Vis Exp (120), e55l59 (Feb. 11, 2017)
5. Bordeira-Carriqo et al. Trends Mol Med 18(11):667-678 (Nov. 2012)
6. Borovinskaya et al. ACS Chem Biol 2(8):545-552 (Aug. 17, 2007).
7. Cheng et al. Biophys J l09(2):330-339 (July 21, 2015).
8. Cridge et al. Nucleic Acids Res 46(4): 1927-1944 (Feb. 28, 2018)
9. Dabrowski et al. Mol Med 24(l):25 (May 29, 2018)
10. Dekkers et al. Sci Transl Med 8(344):344ra84 (June 22, 2016)
11. De Loubresse et al. Nature 513(7519):517-522 (Sept. 25, 2014)
12. Floquet et al. PLoS Genet. 8(3):el002608 (2012)
13. Francois et al. Nucleic Acids Res 33(l7):5677-5690 (Oct. 7, 2005)
14. Frischmeyer & Dietz Hum Mol Genet 8(10): 1893-1900 (1999)
15. Kandasamy et al. J Med Chem 55(23): 10630-10643 (Dec. 13, 2012)
16. Kurosaki & Maquat J Cell Sci l29(3):46l-467 (Jan. 19, 2016).
17. Linde & Kerem. Trends Genet 24(11):552-563 (Nov. 2008)
18. Ma et al. J Clin Invest 110(11): 1651-1658 (Dec. 2002).
19. Muanprasat et al. J Gen Physiol 124(2): 125-137 (Aug. 2004).
20. Nudelman et al. J Med Chem 52(9):2836-2845 (May 14, 2009)
21. Rowe et al. WS01.3 Translational read-through of CFTR nonsense mutations and inducement of cystic fibrosis transmembrane conductance regulator (CFTR) function by ELX-02 treatment. J Cyst Fibrosis l7(suppl 3):S2 (June 2018)
22. Sato et al. Biochem Biophys Res Commun 380(3):548-553 (Mar. 13, 2009).
23. Sato & Clevers Science 340(6137): 1190-1194 (June 7, 2013)
24. Shalev & Baasov Medchemcomm 5(8): 1092-1105 (Aug. 1, 2014)
25. Xue et al. Am J Respir Cell Mol Biol 50(4):805-8l6 (Apr. 2014)
26. CFTR2 database: www.CETA2.org
Next Patent: COMBINATION LADDERS, LADDER COMPONENTS AND RELATED METHODS