METHODS AND COMPOSITIONS FOR MODULATING SOCS3

FIELD

The invention relates to methods of manipulation of cellular mechanisms for controlling the level of activity of signal transduction pathways. In particular, the invention relates to manipulation of expression of suppressor of cytokine signalling-3 (SOCS3) an important modulator of several cytokine signal transduction pathways.

BACKGROUND

Regulatory T cells (T _reg cells) are a specialized subpopulation of T cells that are able to suppress immune aggression in an antigen-specific manner, qualified by the T cell receptor (TCR). T _reg cells serve to maintain homeostasis in the immune system and, crucially, tolerance to the organism's own tissues. Evidence from experimental mouse models demonstrates that the immunoregulatory potential of T _reg cells can be harnessed therapeutically to treat autoimmune diseases and facilitate transplantation tolerance.

Foxp3 is a transcriptional regulator that plays an essential role in regulatory immune tolerance, being required for lymphocyte development along the T _reg lineage. Foxp3 belongs to the forkhead (Fox) family of transcriptional regulators, where the Foxp subgroup is characterised by a divergent DNA-binding winged helix domain. Foxp3 (mouse Foxp3, human FOXP3) further diverges from other Foxp family members, having a truncated N-terminal domain and requiring homo-dimerisation of the Foxp3 protein for DNA binding activity. In T lymphocytes Foxp3 is known to function as a transcriptional repressor of target genes including that encoding interleukin 2 (IL2). To date, the full mechanism by which Foxp3 controls the gene expression programme for T _reg function is not fully understood. Using global gene arrays, Foxp3 has been found to have the ability to act as both a transcriptional repressor and transcriptional activator and has many potential target genes (approximately 700), including genes responsible for regulating transcription and establishing epigenetic modifications (Zheng Y et al., 2007).

When homo-dimerised, Foxp3 protein is competent to bind DNA and repress interleukin-2 {IL-2) gene transcription by binding to the IL2 promoter, resulting in immunosuppression due to down regulation of IL2 activity. Foxp3 actively represses

transcription in vivo including through its association with transcription corepressors histone acetyltransferase TIP60 and class Il histone deacetylase C7.ln the cytoplasm, hetero-dimeric interactions between Foxp3 and the latent primary transcription factors NFAT (nuclear factor of activated T cells) and NFKB (nuclear factor-kappa B) further add to the immuno-suppressive capacity of Foxp3 by sequestering these key mediators of signal transduction in T lymphocytes.

It has recently been shown that deletion of glutamic acid (δE250 human; δE251 mouse) in the leucine zipper domain of Foxp3 impairs both dimerisation and the suppressive function of Foxp3 in T cells. The same mutation has been found in human carriers of the X-chromosome-linked severe auto-immune and allergic disorder known as IPEX (immune polyendocrinopathy enteropathy X-linked). In light of these and other results Foxp3 has been broadly indicated as a potential target for regulating the immune system and as a marker of immune status (see WO-A-2006/012641 , and WO- A-2002/090600).

In addition to Foxp3, MARCH-7 (a stem cell-associated gene previously known as "axotrophin") and leukaemia inhibitory factor (LIF) are also positively associated with regulatory immune tolerance. LlF is an important factor in promoting embryonic stem cell (ES) self renewal and in inhibiting differentiation of ES cells in culture (Smith et al. (1988) Nature 336:688-690; & Williams et al. (1988) Nature 336: 684-687). Hence, there is great interest in identifying the processes that control and moderate LIF signalling activity both in regulatory immune tolerance and in pluripotent stem cells.

By advancing understanding of the mechanisms that control the immune response and in particular immune tolerance as mediated by T lymphocytes, new approaches to exploit these mechanisms are sought. There is also a broader need to identify means by which control of the T _reg lineage can be extended to other cellular processes, such as in stem cell differentiation and self renewal of both T lymphocytes and other cell types.

SUMMARY

According to the present invention, a requirement for Foxp3 homodimer activity in the control of SOCS3 (suppressor of cytokine signalling 3) gene expression has been identified. SOCS proteins, which are inhibitors of cytokine signalling pathways, have

been shown to be key regulators of both innate and adaptive immunity and are central to T-cell development and differentiation. Since SOCS3 is a potent regulator of LIF signalling activity the present invention has major implications in therapeutic approaches to regulation not only of the immune response but also in the control of pluripotency in stem cells and precursor cells.

In a first aspect, the invention provides a method for controlling the expression of SOCS3 in a mammalian cell comprising modulating the expression and/or activity of Foxp3 in the cell.

In a second aspect, the invention provides a method for identifying a modulator of SOCS3 expression in a cell comprising isolating a Foxp3 monomer; screening one or more candidate molecules to determine whether the one or more of the candidate molecules binds to the Foxp3 monomer, thereby identifying the candidate molecule as a Foxp3 monomer binding molecule; determining whether homodimerisation of the Foxp3 monomer is inhibited by the Foxp3 monomer binding molecule; and identifying a Foxp3 binding molecule that inhibits Foxp3 homodimerisation as a modulator of SOCS3 expression.

In a third aspect, the invention provides a method for identifying a modulator of SOCS3 expression in a cell comprising isolating a Foxp3 homodimer; screening one or more candidate molecules to determine whether the one or more of the candidate molecules binds to the Foxp3 homodimer, thereby identifying the candidate molecule as a Foxp3 binding molecule; and determining whether activity of the Foxp3 homodimer is inhibited by the Foxp3 binding molecule; wherein activity of the Foxp3 homodimer is determined by assessing the ability of the Foxp3 homodimer to inhibit expression of a coding sequence that is placed under the control of a SOCS3 promoter region in the presence of the Foxp3 binding molecule.

In a fourth aspect, the invention provides for use of an inhibitor of Foxp3 activity to modulate expression of SOCS3 in a mammalian cell.

In a fifth aspect, the invention provides a method of modulating an immune response to an antigen in an individual, the method including providing the individual with a modulator of Foxp3 homodimer activity and/or expression that is able to control the expression of SOCS3 in a cell.

In a sixth aspect, the invention provides a method of modulating an immune response to an antigen in an individual, the method including providing the individual with exogenous Foxp3 homodimer activity and/or expression that is able to reduce the expression of SOCS3 in a cell.

In a seventh aspect, the invention provides for use of a modulator of a Foxp3 homodimer, that is capable of controlling the expression of SOCS3 in a cell, so as to induce or to regulate directly or indirectly the immune response to an antigen in an animal.

In an eighth aspect, the invention provides for use of a modulator of a Foxp3 homodimer, that is capable of controlling the expression of SOCS3 in a mammalian cell, for the purpose of regulating expression of LIF in the cell.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows SOCS3 transcription is dysregulated in δE250-Foxp3-transfected Jurkat T cells. Kinetics of Foxp3, MARCH-7, and SOCS3 transcript induction following activation of wt-Foxp3, or δE250-Foxp3, in Jurkat T cells. Graphs A, C, E and G show wt-Foxp3 and graphs B, D, F and H show δE250-Foxp3. Graphs A, B, E, and F are plotted against log transcript value to reveal the relative behaviours of each target gene. Graphs C, D, G, and H are linear and reveal the massive increase of SOCS3 transcripts limited to δE250-Foxp3 cells. The experiment was repeated either with serum (A, B, C and D, 10 % FCS), or without serum (E, F, G and H). Transcript levels in the serum-free cultures (E ₁ F ₁ G and H) were more sensitive to the inductive effect of 0.5 μg/ml doxycyline, but the overall pattern of the inductive response of each gene was almost identical (compare A and B, versus E and F). The basal transcript levels of each individual gene was consistent between the two experimental series, and SOCS3 showed the lowest basal level prior to induction. The absence of serum over the 36h period resulted in cell death in the δE250-Foxp3 cultures. The abscissa of all graphs is the fold change in the target gene / β-actin transcripts for each sample.

Figure 2 shows a model of inter-active relationships between Foxp3, MARCH-7, LIF and SOCS3. The shaded boxes in A.2 show a reduction in March-7 / LIF pathways. B shows interlinked March-7 / LIF / Foxp3. There is evidence that Foxp3, MARCH-7, LIF and SOCS3 are each reciprocally interactive, and we propose a model of a regulatory "cassette" where, in the absence of Foxp3, the MARCH-7/LIF axis of the cassette is

reduced due to SOCS3 activity. In the presence of Foxp3, SOCS3 is transcriptionally repressed and the MARCH-7/LIF axis is maintained. Since both MARCH-7 and LIF are stem cell-associated, with LIF contributing to maintenance of the undifferentiated state, the MARCH-7/LIF axis is in accord with the model of "sternness" in regulatory immune tolerance. Evidence for the inter-relationships between MARCH-7 and LIF (a) and (b) are: (a) in the MARCH-7 null mouse, where T cell-derived LIF is dysregulated: and (b) that exogenous LIF added to an ex vivo allo-immune response enhances MARCH-7 transcription. SOCS3 is known to be a target gene of LIF/STAT3 signalling (c), providing feedback inhibition of LIF (d). There is evidence for MARCH-7 being required for normal Foxp3 expression (e) in the thymus of the MARCH-7 null mouse [Muthukumarana et al; 2007]. Although the mechanism of this MARCH-7/Foxp3 relationship has yet to be established, the expression of Foxp3 must be linked to epigenetic development of the T _reg cell: this is likely to be qualified by the MARCH- 7/LIF developmental axis, as discussed later. The data presented here (f) provide a mechanism by which Foxp3 plays a role in the regulatory cassette, with concordant activities maintaining the MARCH-7/LIF/Foxp3 cassette and perpetuating the T _reg phenotype.

Figure 3 is a histogram showing relative transcript levels of SOCS3 and Foxp3 by comparing LIF null (shaded) and LIF wild-type (black-fill) spleen cells. Transcript levels were calculated relative to actin in each sample then normalised to 1 for the LIF null, allowing direct comparison with expression levels in the LIF wild-type. Lack of LIF is associated with decreased Foxp3 transcripts and with increased levels of SOCS3 transcripts, in accordance with loss of Foxp3-mediated repression of SOCS3 gene expression.

DETAILED DESCRIPTION

Prior to setting forth the invention, a number of definitions are provided that will assist in the understanding of the invention. All references cited herein are incorporated by reference in their entirety. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The term "promoter" as used herein denotes a region within a gene to which transcription factors and/or RNA polymerase can bind so as to control expression of an associated coding sequence. Promoters are commonly, but not always, located in

the 5' non-coding regions of genes, upstream of the translation initiation codon. The promoter region of a gene may comprise one or more consensus sequences that act as recognisable binding sites for sequence specific DNA binding domains of DNA binding proteins. Nevertheless, such binding sites may also be located in regions outside of the promoter, for example in enhancer regions located in introns or downstream of the coding sequence.

The term "homologue" of Foxp3 as used herein refers to polynucleotides (e.g. mRNA) and/or polypeptides that have substantially similar sequence identity to that of Foxp3. Homologues are considered to include orthologues of the sequences from other species, and mutants that nonetheless exhibit a high level of functional equivalence. By substantially similar sequence identity, it is meant that the level of sequence identity is from about 50%, 60%, 70%, 80%, 90% or 95% to about 99% identical to the respective Foxp3. Percent sequence identity can be determined using conventional methods (e.g. Henikoff & Henikoff, 1992, Proc. Natl. Acad. ScL USA, 89: 10915; and Altschul et al., 1997, Nucleic Acids Res., 25: 3389-3402).

The term "antigen" denotes a molecule that triggers an immune response. An antigen may be in the form of a full length polypeptide or protein. Alternatively, the antigen can be in the form of peptide fragments that bear the specific epitopes that allow antibodies raised against such fragments to also bind to the full length polypeptide. Antigen also refers to any substance which comprises a plurality of antigens and epitopes, for example a cell or tissue, organ, implant, indeed any substance to which an immune response can be mounted by the immune system.

The term "allo-antigen" as used herein denotes an antigen, such as a histocompatibility or red blood cell antigen, that is present in only some members of a species and therefore able to stimulate allo-antibody production in other members of the same species who lack it.

An "antibody" denotes a protein that is produced in response to an antigen that is able to combine with and bind to the antigen, preferably at a specific site on the antigen, known as an epitope. The term as used herein includes antibodies of polyclonal and monoclonal origin, unless stated otherwise. Polyclonal antibodies are a group of antibodies produced by different B lymphocytes in response to the same antigen; different antibodies in the group typically recognize different parts (epitopes) on the antigen. A monoclonal antibody recognizes only one type of antigen and is produced

by the daughter cells of a single antibody-producing lymphocyte, typically a hybridoma. Also included within the term 'antibody' are antigen binding fragments of naturally or non-naturally occurring antibodies, for example, the "Fab fragment", "Fab' fragment" (a Fab with a heavy chain hinge region) and "F(ab')2 fragment" (a dimer of Fab' fragments joined by a heavy chain hinge region). Recombinant methods have been used to generate small antigen-binding fragments, such as "single chain Fv" (variable fragment) or "scFv," consisting of a variable region light chain and variable region heavy chain joined by a synthetic peptide linker. Unlike antibodies derived from other mammals, camelid species express fully functional, highly specific antibodies that are devoid of light chain sequences. Camelid heavy chain antibodies are of particular use, as they are found as homodimers of a single heavy chain, dimerised via their constant regions. The variable domains of camelid heavy chain antibodies are referred to as VHH domains and retain the ability, when isolated as small fragments of the VH chain, to bind antigen with high specificity (Hamers-Casterman et al., 1993, Nature 363: 446- 448; Gahroudi et al., 1997, FEBS Lett. 414: 521-526). Further included within the term 'antibody' are so called camelized mutants of human VH domains that retain antigen binding activity but exhibit some of the advantages of camelid VHH domains (Riechmann, 1994, FEBS Lett. 339: 285-290).

The term "T lymphocyte" or "T cell" as used herein denotes a principal type of white blood cell that completes maturation in the thymus and that has various roles in the immune system, including the identification of specific foreign antigens in the body and the activation and repression of other immune cells.

The term "stem cells" as used herein denotes unspecialised cells that are able to both extensively self-renew and differentiate into progenitors. The amount of these different cell types that a given stem cell can act as a progenitor for is typically referred to as the 'potency' of that stem cell. Hence, pluripotent stem cells can act as progenitors for very many different differentiated cell types. If a cell can differentiate into all cells in the body, it is totipotent. If it can differentiate into most cell types, it is pluripotent. Embryonic stem cells are usually referred to as pluripotent as they can generate most cell types in mammals with the exception of extra-embryonic tissues (i.e. trophectoderm). Multipotent stem cells are less potent than totipotent and pluripotent cells and can only produce cells of a closely related family, i.e. they can act as progenitors for several cell types, but those types are limited in number. An example of a multipotent stem cell is a hematopoietic cell, which is a blood stem cell that can

develop into several types of blood cells, but cannot develop into brain cells or other types of cells. Multipotent stem cells can also be referred to as 'precursor' cells.

The present invention provides means for controlling and moderating LIF signalling activity in a cell via control of SOCS3 expression. This control mechanism has been demonstrated by identifying the requirement for Foxp3 in the regulation of SOCS3 expression, thereby identifying SOCS3 as a Foxp3 target gene. This finding was unexpected. Based upon the information available in the art, a conventional view would have been that Foxp3 would influence MARCH-7 (which it does) and/or LIF, supporting a three-way model of reciprocity between Foxp3, MARCH-7, and LIF. The present demonstration that Foxp3 is required to control SOCS3 transcription adds a further pivotal dimension to this model. According to the present invention the mechanism linking Foxp3 to control of LIF activity is via SOCS3, indirectly regulating LIF by influencing the strength of the intracellular LIF/STAT3 signalling pathway.

The observed divergence in behaviour between SOCS3 and MARCH-7 may relate to the action of SOCS3 protein, inhibiting LIF/STAT3 signalling. It has been previously shown that MARCH-7 and LIF are inter-dependent, and that LIF is inductive for MARCH-7. Thus, reduced LIF activity due to high SOCS3 in the absence of wt-Foxp3 would bias the inter-actions towards decreased MARCH-7, as found experimentally. Foxp3 could therefore play a major integrative role in the MARCH-7/LIF axis, acting to contain SOCS3 transcription within the permissive range for MARCH-7 expression and function, as illustrated in Figure 2. Evidence in support of this model comes from ex vivo experiments comparing the allo-tolerant versus allo-aggressive response to allo- antigen: tolerance is specifically associated with increased Foxp3, MARCH-7, and LIF, and low SOCS3. The novel findings described herein argue for an additional or alternative mechanism, involving Foxp3 in a compound inter-dependency with LIF and MARCH-7 via SOCS3 (Figure 2).

The present model also explains why MARCH-7 has specific regulatory effects on T lymphocytes, controlling proliferation and LIF release in vitro and down-regulating the allo-immune response in vivo [unpublished observations]. Despite MARCH-7 being expressed in most cell types, functional inter-dependence with Foxp3 would endow specificity for cells that express Foxp3, i.e. T lymphocytes and stromal cells of the thymus. According to the present invention tissue-specific Foxp3 contributes to a regulatory molecular cassette of Foxp3/MARCH-7/LIF in T lymphocytes. It is likely that similar regulatory cassettes operate in a tissue-specific manner in other cell types,

possibly with Fox-family proteins endowing the tissue-specific component, for example, in stem cells, precursor cells, and other target cell types where LIF/STAT3 signalling is critically regulated by SOCS3. These concepts are compatible with novel approaches to therapy. It is known that both MARCH-7 and LIF/SOCS3 signalling are linked to neural development and it has been proposed that modulation of SOCS3 might facilitate the endogenous repair of central nervous system injury: the present invention provides access to a regulatory cassette involving SOCS3 that would enable such modulation, exploiting natural mechanisms.

The present invention focuses on the properties of Foxp3, and homologues or agonists thereof, as a transcriptional repressor and provides evidence that SOCS3 is a target gene of Foxp3. This infers that SOCS3, either at the gene promoter, or at a more distant regulatory site for the SOCS3 gene, is subject to regulation by Foxp3 homodimers. The known sites within the SOCS3 promoter for transcriptional regulation include a STAT-responsive element. This functions in feedback of STAT3 and STAT1 signalling pathways induced by LIF-family members, including LIF, IL6, IL11 , oncostatin M, ciliary neurotrophic factor and cardiotrophin. A second regulatory site is a 5'-upstream GC-rich element, that lies downstream of the STAT-responsive element: this GC-rich element binds Sp3 (specificity protein 3). Sp3 acts as an enhancer of both basal and induced SOCS3 expression, requiring Sp3 lysine-483, a potential target for acetylation. The present invention data indicates that one or more Foxp3-responsive SOCS3 regulatory sites also exist.

According to the invention mutant variants, analogues, inhibitors and/or agonists of Foxp3 are utilised to moderate expression of SOCS3. It is of particular advantage that small molecule inhibitors of Foxp3 homodimerisation and/or DNA binding can cause a significant increase in the level of SOCS3 expression in the cell. Likewise, analogues of the Foxp3 homodimer that are capable of binding to and repressing expression of SOCS3, cause a significant decrease in the level of SOCS3 expression in the cell. As such, those regions of Foxp3 that contribute to its ability to bind and repress SOCS3 expression as well as the Foxp3 DNA binding sequence represent excellent targets for drug discovery.

A wide variety of molecules may be assayed for their ability to modulate the immune system, in particular SOCS3 expression via Foxp3. Examples include organic molecules, proteins or peptides and nucleic acid molecules. Therapeutic agents may be formulated for delivery in any suitable method known to the person skilled in the art.

/

Particular small nucleic acid molecules that are of use in the invention as inhibitors of Foxp3, and thereby increasing the level of expression of SOCS3, are short stretches of double stranded RNA that are known as short interfering RNAs (siRNAs). RNA interference (RNAi) techniques allow for the selective inactivation of gene function in vivo and in vitro. In the present invention, RNAi can be used to knock-down Foxp3 expression in cells. In this process, double stranded mRNAs are recognized and cleaved by the dicer RNase resulting in 21-23 nucleotide long stretches of RNAi. These RNAis are incorporated into and unwound by the RNA-inducing silencing complex (RISC). The single antisense strand then guides the RISC to mRNA containing the complementary sequence resulting in endonucleolytic cleavage of the mRNA (Elbashir et al. (2001 ) Nature 411 ; 494-498) by argonaute, the catalytic component of the RISC complex. Hence, this technique provides a means for the targeting and degradation of Foxp3 mRNA , thereby increasing the level of expression of SOCS3.

Suitable double-stranded siRNA molecules can be formed from two substantially complementary oligonucleotide strands, a sense (non-targeting) strand and an antisense (targeting) strand, which anneal to form a double-stranded region of any suitable length. Suitably the double stranded region is between 17 and 29 nucleotides, more suitably between 18 and 25 nucleotides, still more suitably between 19 and 23 nucleotides, and most suitably between 19 and 21 nucleotides. Alternatively, an siRNA molecule can be generated from a short hairpin (or fold-back stem-loop structure) in a single RNA molecule (i.e. an shRNA molecule), which can give rise to siRNA after intracellular processing. Such a approach can be preferable for RNAi therapy because it requires the synthesis of a single RNA molecule only, and may allow a less complex / time-consuming annealing process.

Typically, an siRNA molecule for use in accordance with the invention is targeted to a unique sequence of the Foxp3 mRNA strand. Optionally, the antisense strand of the siRNA molecule, or the antisense portion of the shRNA molecule is substantially complementary to the Foxp3 target nucleotide sequence. By "substantially complementary" it is meant that the sequences are sufficiently complementary that the antisense strand of the resultant siRNA molecule can anneal to the target sequence sufficiently effectively to cause degradation of the target mRNA in vivo. It is within the ability of the person of skill in the art, using known sequence databases to determine a suitable sequence of Foxp3 for targeting by siRNA. In a particularly suitable

embodiment the target sequence is unique in an animal genome, and most suitably is unique in the human genome. Alternatively, the target sequence can be in a non- human mammalian system, for example in mouse, pig, goat, sheep or cattle.

It is possible to obtain siRNA or shRNA molecules that target Foxp3 mRNA. Commercially available shRNA molecules .(SIGMA, Mission ^® RNAi) that target the human Foxp3 mRNA coding sequence include:

Mission ^® RNAi catalogue shRNA Sequence (5' to 3') no./SEQ ID NO

TRCN0000018959 CCGGCCTCCACAACATGGACTACTTCTCGAGAAGTAGTCCATGTTGTGGAGGTTTTT SEQ ID NO: 1

TRCN0000018960 CCGGCACACGCATGTTTGCCTTCTTCTCGAGAAGAAGGCAAACATGCGTGTGTTTTT SEQ ID NO: 2

TRCN0000018961 CCGGGCTGGCAAATGGTGTCTGCAACTCGAGTTGCAGACACCATTTGCCAGCTTTTT SEQ ID NO: 3

TRCN0000018962 CCGGCTGAGTCTGCACAAGTGCTTTCTCGAGAAAGCACTTGTGCAGACTCAGTTTTT SEQ ID NO: 4

TRCN0000018963 CCGGGCCCGGATGTGAGAAGGTCTTCTCGAGAAGACCTTCTCACATCCGGGCTTTTT SEQ ID NO: 5

Hence, shRNA sequences such as those described above are suitable for knockdown of Foxp3 expression in target cells, thereby modulating expression of SOCS3 in those cells. Conventional techniques for determining protein-protein interactions and protein- DNA interactions, such as the yeast two-hybrid screen, can be used to identify potential agonists and antagonists of Foxp3 and/or SOCS3. It is also within the remit of the invention to identify small molecules that inhibit the association of homodimers of Foxp3, for example, by masking or disrupting interaction with those domains of Foxp3 that are known to directly interact with other proteins. Foxp3 and/or SOCS3 protein-protein interactions or protein-small molecule interactions can be investigated using technologies such as a BIAcore ^® which detects molecular interactions using surface plasmon resonance (BIAcore, Inc., Piscataway, NJ; see also www.biacore.com).

Foxp3 and/or SOCS3 proteins (polypeptides or fragments thereof) can be recombinantly expressed to create transgenic cell lines and purified proteins for use in

drug screening. Cell lines over-expressing Foxp3 and/or SOCS3 or fragments thereof can be used, for example, in high-throughput screening methodologies against libraries of low molecular weight organic compounds (e.g. "small molecules"), antibodies or other biological agents. These screening assays may suitably be either cell-based assays, in which defined phenotypic changes are identified or can serve as the source of high levels of purified proteins for use in affinity-based screens such as radioligand binding and fluorescence polarisation.

It is within the remit of the invention to regulate the expression of SOCS3 by inducing expression of Foxp3 in cells that do not express endogenous Foxp3, for example the Jurkat human T-cell line. For instance, expression of exogenous Foxp3 homodimer can be achieved by introducing an expression vector including the coding sequence for Foxp3 into the cells. The term "expression vector" as used herein denotes a DNA molecule that is either linear or circular, into which another DNA sequence fragment of appropriate size can be integrated. Such DNA fragment(s) can include additional segments that provide for transcription of a gene encoded by the DNA sequence fragment. The additional segments can include and are not limited to: promoters, transcription terminators, enhancers, internal ribosome entry sites, untranslated regions, polyadenylation signals, selectable markers, origins of replication and such like. Expression vectors are often derived from plasmids, cosmids, viral vectors and yeast artificial chromosomes; vectors are often recombinant molecules containing DNA sequences from several sources. Usually, the coding sequence is operably linked to either a constitutively active or an inducible promoter.

The term "operably linked", when applied to DNA sequences, for example in an expression vector, indicates that the sequences are arranged so that they function cooperatively in order to achieve their intended purposes, i.e. a promoter sequence allows for initiation of transcription that proceeds through a linked coding sequence as far as the termination sequence.

Manipulation of the expression (decrease or increase) of Foxp3 in cellular systems can be used to identify any dependent genes that may be suitable downstream as drug discovery targets, thereby effecting the level of expression of SOCS3. Elucidation of the signal transduction pathways that interact with, control, or are controlled by Foxp3 will enable the adoption of a more "systems-biology" based approach to drug discovery.

Another method that can be used to identify small-molecule modulators of SOCS3 activity via Foxp3 involves a cellular assay in which a suitable cell line is transfected with a nucleic acid construct comprising a reporter gene that is expressed under the control of a SOCS3 promoter. The assay for a modulator of SOCS3 activity via Foxp3 may be carried out using methods that will be understood by the skilled person in the art. A suitable reporter gene can be any gene that is conveniently expressed in eukaryotic cells and can be readily detected, such as CAT, LacZ, luciferase, or GFP. Endogenous Foxp3 homodimers present in cell will repress SOCS3 expression, which in turn will repress reporter gene expression from the nucleic acid construct. By carrying out (automated) high-throughput screening of candidate small molecules, for example, from small molecule libraries, molecules that bind to the Foxp3 homodimers and/or prevent them from binding to SOCS3 and therefore allowing the reporter gene to be expressed may be identified. These molecules are candidate drug targets for modulating SOCS3 expression via the Foxp3 control axis. This method can also be carried out in cells that do not express Foxp3 endogenously. For example, a nucleic acid expression vector comprising a Foxp3 coding sequence can be transfected into cells of the Jurkat human T-cell line, which do not express Foxp3 endogenously, thereby causing high levels of expression of exogenous Foxp3 in the cells. The Foxp3 homodimers present in the cells will repress SOCS3 expression, and correspondingly will also repress reporter gene expression. Candidate drug small molecules that modulate the formation or activity of the Foxp3 homodimers and/or prevent them from binding to the SOCS3 promoter result in a detectable increase in the expression of the reporter gene.

Screening of molecules and proteins for binding to Foxp3 and/or SOCS3 can be performed via automated high-throughput screening procedures. Hence, the invention provides methods for identifying Foxp3 and/or SOCS3 interacting molecules via detection of a positive binding interaction between Foxp3 and/or SOCS3 and a target molecule. Further screening steps may be used to determine whether the identified positive binding interaction is of pharmacological importance, i.e. whether the target molecule is capable of moderating Foxp3 and/or SOCS3 bioactivity or function. If a molecule with a positive Foxp3 and/or SOCS3 moderating effect is identified, the molecule is classified as a 'hit' and can then be assessed as a potential candidate drug. Additional factors may be taken into consideration at this time or before, such as the absorption, distribution, metabolism and excretion (ADME), bio-availability and toxicity profiles of the molecule, for example. If the potential drug molecule satisfies the

pharmacological requirements, suitable compositions can be formulated for testing the activity in-vitro and in-vivo, in accordance with standard procedures known in the art.

It is also possible to use rational drug design to design small molecules that can modulate SOCS3 activity via modulation of Foxp3 activity. A particular example of rational drug design involves the use of three-dimensional information about biomolecules obtained from such techniques as x-ray crystallography and NMR spectroscopy. For example, by identifying the crystal structure of Foxp3 it is possible to study the biological and physical properties of the target and to design small molecules that can inhibit Foxp3 dimerisation (e.g. by binding in the active site between the two monomers) and/or binding of Foxp3 to other co-factors that can inhibit expression of the SOCS3 gene.

The present invention provides for the use of a modulator of a Foxp3 homodimer to control the expression of SOCS3 in a cell to induce or to regulate directly or indirectly the immune response to an antigen, whether a "foreign" antigen (for example allogeneic, xenogeneic, prokaryotic, viral or synthetic) or autologous ("self) antigen.

Any reference to "regulation" of the immune response in relation to the present invention includes regulating phenotypic development and maintenance of cell populations that regulate immunity to a given antigen.

The present invention also provides for the use of a modulator of a Foxp3 homodimer that controls the expression of SOCS3 in a cell in the manufacture of a medicament to induce or to regulate directly or indirectly the immune response of a vertebrate to an antigen, whether a "foreign" antigen (for example allogeneic, xenogeneic, prokaryotic, viral or synthetic) or autologous ("self") antigen. This medicament being suitable for treating an individual to reduce rejection of transplanted tissues, cells or organs.

The present invention further provides for the use of a modulator of a Foxp3 homodimer to control the expression of SOCS3 to regulate expression of LIF in a cell. LIF may induce or regulate directly or indirectly the immune response of a vertebrate to an antigen, whether a "foreign" antigen (for example allogeneic, xenogeneic, prokaryotic, viral or synthetic) or autologous ("self") antigen. Suitably, a modulator of a Foxp3 homodimer to control the expression of SOCS3 to regulate expression of LIF allows cancerous immune cells that are sensitive to LIF to be targeted ex vivo or in vivo.

It is also within the remit of the present invention to provide for the use of a modulator of a Foxp3 homodimer that controls the expression of SOCS3 so as to induce or regulate T cell proliferation in a cell population in an in vivo, ex vivo or in vitro environment. Suitably, the T cells are T lymphocyte cells.

Advantageously, the present invention may be used to guide the immune response of a vertebrate, for example a mammal, to accept a transplanted organ, tissue, cell, gene or gene product, artificial substance, or any other agent utilised within the body, for example for a therapeutic purpose. The invention is especially applicable in supporting the use of stem cells in therapy or otherwise in regenerative medicine.

The immune suppressive activity of a modulator of a Foxp3 homodimer may be used to protect biological materials that have been introduced to the body from immune attack. For example, transplanted cells used to treat diseases such as neurodegenerative diseases, tissues for grafting, bone marrow, skin, cartilage, bone, tendons, muscle, blood vessels, cornea, neural cells, gastrointestinal cells and transplanted organs such as kidney, liver, pancreas, heart and lung. Suitably, expression of a modulator of a Foxp3 homodimer may be modified in host immune cells ex vivo to bias the immune response to accept the introduced biological materials. Furthermore, expression of a modulator of a Foxp3 homodimer within the biological materials may be modulated ex vivo to carry immunomodulatory properties when introduced in vivo.

Modulators of the Foxp3 homodimer that serve to control the expression of SOCS3 in cells may be used in the treatment of immune disorders, including severe combined immunodeficiency (SCID), by regulating T lymphocytes as well as effecting the cytolytic activity of NK cells and other cell populations. These immune disorders may be genetic or be caused by viral (for example, HIV), bacterial or fungal infections, or may result from autoimmune disorders. Suitably, infectious diseases caused by viral, bacterial, fungal or other infections may be treated using modulators of the Foxp3 homodimer. Such infections include HIV, hepatitis viruses, herpes viruses, mycobacteria, Leishmania spp., malaria spp. and various fungal infections such as candidiasis.

Examples of autoimmune disorders which may be treated using a modulator of the Foxp3 homodimer, acting via the SOCS3 axis, include connective tissue disease,

multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation, Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent diabetes mellitus, myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye disease. Additionally, modulators of the present invention may be used in the treatment of allergic reactions and conditions, for example, anaphylaxis, serum sickness, drug reactions, food allergies, insect venom allergies, mastocytosis, allergic rhinitis, hypersensitivity pneumonitis, urticaria, angioedema, eczema, atopic dermatitis, allergic contact dermatitis, erythema multiforme, Stevens-Johnson syndrome, allergic conjunctivitis, atopic keratoconjunctivitis, venereal keratoconjunctivitis, giant papillary conjunctivitis, contact allergies, asthma or other respiratory problems.

The use of a modulator of a Foxp3 homodimer that is able to control the expression of SOCS3 in cells in down-regulating or preventing one or more functions during the immune response, for example in reducing interferon gamma release, may be useful in tissue, skin and organ transplantation and in graft-versus-host disease (GVHD). Up- regulating aggressive immune responses by down modulation of modulators of a Foxp3 homodimer is also useful. Up-regulation of immune responses may be in the form of enhancing an existing immune response or eliciting an initial immune response. For example, enhancing an immune response may be useful in cases of viral infection, including systemic viral diseases such as influenza and the common cold. Regulation of modulators of the Foxp3 homodimer suitably facilitates a T cell- mediated immune response against tumour cells.

Modulators of the Foxp3 homodimer that control the expression of SOCS3 may be involved in regulating chemotactic or chemokinetic activity in mammalian cells including, for example, monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells. It is within the remit of the present invention to provide chemotactic or chemokinetic compositions, for example proteins, antibodies, binding partners, or modulators containing modulators of the Foxp3 homodimer to control expression of SOCS3, for use in the treatment of wounds and other trauma to tissues, as well as in treatment of localized infections. For example, attraction of lymphocytes, monocytes or neutrophils to tumours or sites of infection may result in improved immune responses against the tumour or infecting agent.

The present invention may be used to guide the immune system to accept or at least produce a reduced aggressive response to an antigen associated with an autoimmune

disease or disorder, whether eliciting the innate or adaptive immune response during the auto-immune reaction. Furthermore, the present invention may be used to guide the immune response to reject an organ, tissue, cell, pathogen such as a prokaryote, yeast or fungus, parasite or virus, a gene or gene product, an artificial substance, or any other agent that may invade or be taken into the body, or be generated within the body, wherein that agent is unwanted, diseased (for example neoplastic tissue or infected tissue), or otherwise deleterious to the host patient.

The immune response may be guided to tolerance or aggression by signal pathway modulation in vivo. On challenge with an antigen, responsive cells may be guided towards tolerance or aggression in accordance with various aspects of the invention and non-responsive cells will remain unaffected by the regulatory adaptation. The target antigen itself triggers responsive cells or responsive cell populations. Cells capable of responding only to other antigens are not triggered, and are therefore not receptive to guiding towards tolerance or aggression towards the relevant antigen at that time. As an alternative or supplement, immune cells may be guided to regulatory tolerance, or aggression ex vivo. Immune cells, for example of blood and/or spleen, may be removed, treated with antigen and guided to tolerance or aggression, before being returned to the individual.

The present invention may also be used to enhance the degree of immune response against an antigen following vaccination, particularly in cases where current vaccination procedures are of limited success in generating a protective immune rejection response against biological agents, for example those associated with germ warfare.

The antigen may be an antigen of a pathogenic organism associated with human or animal disease. Organisms which cause animal disease include, for example, foot and mouth disease virus, Newcastle disease virus, rabies virus and Salmonella species. Organisms which cause human disease include, for example, bacteria such as Salmonella species, including S. typhimurium and S. typhi, Staphylococcus such as S. aureus, Pertussis, Vibrio cholera, pathogenic E. coli, Mycobacteria species such as M. tuberculosis and M. paratuberculosis. Viral organisms include for example HIV-1 or HIV-2 (which include the viral antigens gpl60/120), HBV (which includes surface or core antigens), HAV, HCV, HPV (for example HPV-16), HSV-1 or-2, Epstein Barr virus (EBV), neurotropic virus, adenovirus, cytomegalovirus, polio myelitis virus and measles virus. Small pox and anthrax are also pathogens of interest and which may

be subject to the present invention. Eukaryotic pathogens include yeast, such as C. albicans, aspergillus, schistosomes, protozoans, amoeba, Plasmodia, including for malaria, toxoplasma, giardia and leishmania.

Furthermore, the antigen may be a tumour associated antigen such as CEA, alpha foetal protein (AFP), neu/HER2, polymorphic endothelia mucin (PEM), N-CAM and Lewis Y. The antigen may be an abnormally expressed antigen, such as p53 or virally- modified antigen.

Antigens such as those mentioned above may be obtained in the form of proteins purified from cultures of the organism or by recombinant production of the desired antigen. Antigens may also be produced by chemical synthesis, for example using an automated peptide synthesiser such as are commercially available.

The present invention provides for a method of modulating an immune response to an antigen in an individual, the method including providing the individual with a modulator of Foxp3 that is able to control the expression of SOCS3 in a cell.

The invention is further illustrated in the following non-limiting examples.

EXAMPLE 1

The SOCS3 gene is subject to suppression by Foxp3

Materials and Methods: Plasmids

The δE250-Foxp3 was prepared by mutagenesis of human FOXP3 cDNA according to the manual (Stratagene) and the primer sequences were as follows: 5' to 3 ¹ Antisense - CAT GGC ACT CAG CTT CTT CTC CAG CAC CAG CT. 5 ¹ to 3' Sense - AGC TGG TGC TGG AGA AGA AGC TGA GTG CCA TG. Both primers were synthesised in the Keck facility at Yale. The construction of doxycyclin inducible-pREV-TRE2-wtFoxp3 and pREV-TRE2-δE250-Foxp3 vectors has been detailed previously (PNAS 2006, vol 103, 9631-9636).

Transfection and Cell culture

The Jurkat human T-cell line grows in suspension and was originally derived from acute lymphoblastic leukaemia cells. Jurkat Tet-On cells (Clontech), stably transfected with a pTet-On and G418-resistance plasmid, were maintained at 37°C, 5%CO ₂ in RPMI-1640 supplemented with 10% FCS (Invitrogen), 2mM glutamine, 100microgram/ml (μg/ml) penicillin, 20microgram/ml streptomycin and 0.5milligram/ml G418. Cells were transfected with either pREV-TRE2-wtFoxp3 or pREV-TRE2-δE250- Foxp3 plasmids using lipofectamine 2000™ (Invitrogen) according to manufacturers' instructions. Cell were selected on day 2 with 0.35milligram/ml hygromycin and 0.5milligram/ml G418. The resultant clones were screened for wt-Foxp3 and δE250- Foxp3 by quantitative real time PCR (QRT-PCR) as previously described [PNAS] and maintained under selection pressure for 10d. As previously reported, there is no significant difference between the kinetics and levels of doxycyclin-mediated Foxp3 protein induction between wt-Foxp3 and δE250-Foxp3.

Wt-Foxp3-Jurkat or δE250-Foxp3-Jurkat clones in early log phase of growth were used experimentally. Two parallel series of cultures, with or without 10% FCS, were seeded at 5x10 ⁷ in 10ml growth medium (RPMM 640, 100μg/ml penicillin, 20μg/ml streptomycin, 2mM glutamine). Each series was of three flasks treated with either 0.2μg/ml ; 0.5μg/ml , or 1.0μg/ml doxycyclin. The flasks were incubated at 37°C in 5% CO ₂ and aliquots of 2ml (i.e. 10 ⁷ cells per aliquot) were harvested from each flask at Oh, 12h, 24h and 36h after doxycyclin addition. Pre-warmed growth medium (2ml) containing the relevant concentration of doxycyclin was added back to each flask immediately after cell harvest at each time point. The harvested cells were pelleted by centrifugation and snap-frozen at -80 ⁰ C for subsequent RNA extraction.

RNA isolation and cDNA synthesis

Total RNA was isolated using Nucleospin® RNA Il kit (Macherey-Nagel GmbH) with on column DNase treatment. First-strand cDNA was synthesised using oligo(dT) ₁₅ primers (Invitrogen) with BD Sprint PowerScript™ reverse transcriptase (BD Biosciences) according to manufacturers' instructions.

Primer design and Real Time PCR (QRT-PCR)

MARCH-7, Foxp3 and SOCS3 transcript levels were measured in duplicate relative to actin by quantitative reverse-transcription polymerase chain reaction (QRT-PCR).

Primers were designed to span an exon-exon boundary to eliminate possible influence of contaminating genomic DNA. Platinum ^® Taq DNA polymerase and SYBR ^® Green dye (Invitrogen USA) were used for QRT-PCR analysis on a Stratagene MX3000 PCR machine. A melt curve analysis was performed after each PCR cycle by a temperature gradient from 6O ⁰ C to 95°C and QRT-PCR amplified sample products for each primer pair were separated on an agarose gel to confirm product specificity and lack of primer dimers. Primer pairs used for QTR-PCR were:

β-actin: forward: 5'-CCAACCGCGAGAAGATGACC-3 ¹ reverse: 5'CCCCTCGTAGATGGGCACAG-3'

MARCH-7: forward: δ'-AAAAGTGCGCCTTCAAGAGA-S' reverse: δ'-TGCACTTGCATGGCTCTATC-S'

LIF: forward: δ'-CTGTTGGTTCTGCACTGGAA-S' reverse: δ'-CCCCTGGGCTGTGTAATAGA-S'

Foxp3: forward: δ'-GCAAATGGTGTCTGCAAGTG-S' reverse: 5'-CAC AGA TGA AGC CTT GGT CA 3'

SOCS3: forward: 5'-TGCGCAAGCTGCAGGAGAGC 3' reverse: 5'-GCGTGCTTCGGGGGTCACTC 3'

Data Handling

All QRT-PCR measurements were made in duplicate: the duplicate pairs differed by less than 0.5 cycles. The 2 ^"δλCT method was used to determine the relative expression of target transcript levels at each time point. The transcript expression of each target gene was measured relative to that of actin, the endogenous control in the same sample. The changes in this relative expression at different time points were determined in comparison to Oh, the calibrator control. These values were then plotted against time.

Results

Treatment with 0.5μg/ml doxycyclin resulted in a significant increase in both wt-Foxp3 and δE250-Foxp3 transcripts without compromising cell viability and this data is

presented in Figure 1. Because there was some 50-fold difference in SOCS-3 between wt-Foxp3 versus δE250-Foxp3 cultures, each data set is expressed both linearly and logarithmically. The parallel duplicate experiments with and without FCS showed very similar profiles of transcript expression, indicating that serum-derived factors (e.g. LIF, bone morphogenic protein, transforming growth factor β, fibronectin) did not play a significant role in the effect of Foxp3 induction.

1. δE250-Foxp3 is associated with a massive increase in SOCS-3 transcription SOCS3 is an inducible LIF-response gene, required for feedback inhibition of the LIF- STAT3 signalling pathway. In the Jurkat cells transfected with wt-Foxp3, induction of Foxp3 was associated with a parallel increase in SOCS3 transcripts (Figure 1A and 1E). In marked contrast, cells transfected with δE250-Foxp3 showed a much greater rate of SOCS-3 transcription, reaching 50-fold compared to the wt-Foxp3 cells (compare Figures 1 C and1 G with 1 D and 1 H). Table 1 shows that the ratio between Foxp3 and SOCS3 transcript induction was also markedly changed, increasing rapidly in the δE250-Foxp3 cells. The uncoupling of SOCS3 from Foxp3 is notable at 24h, where wt-Foxp3 and δE250-Foxp3 transcripts were similar, yet SOCS3 was 5 fold greater in the δE250-Foxp3 cells (Table 1 ). Further, the dose-response to doxycyclin at 12h showed early high sensitivity of the SOCS3 transcription response, this being increased 100-fold at all doses of doxycyclin in the δE250-Foxp3 cells, relative to the wt-Foxp3 cells (Table 2).

2. δE250-Foxp3 is associated with reduced MARCH-7 transcription

MARCH-7 is expressed constitutively at a steady state level, but doubles in transcription in both activated T cells and in regulatory responses to allo-antigen. In these experiments, where SOCS-3 showed a 50-fold increase in the δE250-Foxp3 cells, MARCH-7 transcription became decreased with time (Figure 1 B and 1 F, and Table 1 ). This decrease was specific for the mutant Foxp3, since in the wt-Foxp3 Jurkat clone, MARCH-7 transcripts increased then plateaued (Figure 1A and 1 E). There was no constant relationship in the ratio of MARCH-7 to Foxp3 (Table 1) whilst the dose response at 12h revealed that the induction of MARCH-7 was more sensitive to wt-Foxp3. Reduced MARCH-7 transcription was a relatively late event and limited to the δE250-Foxp3 clone. In summary, the transcription of both SOCS3 and MARCH-7 was dramatically changed, and in opposing directions, when the ability of Foxp3 to dimerise was prevented due to the δE250 mutation. This indicates that by controlling

homodimerisation of the Foxp3 in cells the level of SOCS3 expression/activity can also be controlled.

able 1 : Relationship between Foxp3, MARCH-7 and SOCS3 transcripts in wt- and iE250-Foxp3 Jurkat T cells following induction with 0.5 μg/ml doxycyclin.

time Foxp3 MARCH-7 SOCS3 wt-Foxp3 δE250-Foxp3 wt-Foxp3 δE250-Foxp3 wt-Foxp3 δE250-Foxp3

Oh 1.00* 1.00 1.00 **(1.0) 1.00 (1.0) 1.00 (1.0) 1.00 (1.0)

12h 1.58 7.46 4.59 (2.9) 2.46 (0.3) 2.44 (1.5) 145.00 (19.4)

24h 9.44 9.25 5.85 (0.6) 0.50 (0.05) 64.00 (6.8) 345.00 (37.3)

^* transcript number relative to β-actin transcripts is assigned a value of "1 " at Oh (see methods).

^* * numbers in brackets show ratio of target gene to Foxp3 in each sample.

Table 2: Dose-related induction of transcripts after 12 hour doxycyclin treatment of Jurkat T cells transfected with either wt-Foxp3, or δE250-Foxp3

12h Dose Foxp3 MARCH-7 SOCS3 doxycyclin wt-Foxp3 δE250-Foxp3 wt-Foxp3 δE250-Foxp3 wt-Foxp3 δE250-Foxp3

0.2μg/ml 2.55 7.36 3.40 0.90 4.60 410.00

0.5 μg/ml 1.31 13.25 10.00 3.20 2.60 362.00

1.0μg/ml 5.30 10.48 5.00 4.00 5.20 685.00

Although particular embodiments of the invention have been disclosed herein in detail, this has been done by way of example and for the purposes of illustration only. The aforementioned embodiments are not intended to be limiting with respect to the scope of the appended claims, which follow. It is contemplated by the inventors that various substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims.

EXAMPLE 2

Comparison of relative transcript levels of SOCS3 and Foxp3 comparing LIF-null and LIF-wild-type mice by real time Q-PCR revealed altered expression of SOCS3 and Foxp3 associated with lack of LIF, as illustrated in Figure 3.

The LIF-null mice had been derived by Professor Austin Smith using the MF-1 mouse strain. These mice were kindly provided by Dr Sue Kimber, University of Manchester. Spleens from wild-type and null litter-mates were used for preparation of total RNA. Total RNA was isolated with Trizol (Invitrogen) or RNeasy Mini kit (Qiagen), treated with DNasel (Qiagen), and reverse-transcribed using Superscript Il reverse transcriptase and oligo(dT)12-18 primer (Invitrogen) in a final volume of 2OuL. Quantitative real-time PCR was done in an I-Cycler (BioRad) with lQ™ SYBR ^® green supermix (BioRad). Normalisation was done by using amounts of mRNA for β-actin as an internal control for each sample. Melting curve analysis and agarose gel electrophoresis was done to test the purity of the amplified bands. The primer pairs for mouse Foxp3, SOCS3 and β-actin were as follows:

FoxP3: forward: δ'-GCAAATGGTGTCTGCAAGTG-S'; reverse: δ'-CACAGATGAAGCCTTGGTCA-S';

SOCS3. forward: δ'-TGCGCAAGCTGCAGGAGAGC-S'; reverse: 5' -GCGTGCTTCGGGGGTCACTC-3';

βactin: forward: δ'-TGGAATCCTGTGGCATCCATGAAAC-S'; reverse: 5'-TAAAACGCAGCTCAGTAACAGTCCG-S'.

The results were expressed for each mRNA product relative to actin. The LIF-null transcript levels were normalised to a value of 1 for direct comparison to the LIF-wild- type transcript levels each for SOCS3, and for Foxp3. Foxp3 expression was reduced in the absence of LIF ₁ in accordance with the results indicating that LIF positively regulates Foxp3 transcription. Conversely, SOCS3 was increased in the absence of LIF which may be interpreted as a result of reduced Foxp3 allowing increased expression of the SOCS3 gene due to lack of normal repressive control by Foxp3.

REFERENCES

Gossen M, and Bujard H 1992. Tight Control of Gene Expression in Mammalian Cells by Tetracycline-Responsive Promoters. PNAS 15; 89 (12):5547-5551.

Rozen S and Skaletsky HJ(2000) Primer3 on the www for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp365-386 (souse code available at http:// Fokker.wi.mit.edu/primer3/).

Fontenot JD, Rasmussen JP, Williams LM, Dooley JL, Farr AG, Rudensky AY Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity. 2005 Mar;22(3):329-41.

Carson BD, Lopes JE, Soper DM, Ziegler SF Insights into transcriptional regulation by FOXP3. Front Biosci. 2006 May 1 ;11 :1607-19.

Wang B, Lin D, Li C, Tucker P. Multiple domains define the expression and regulatory properties of Foxpi forkhead transcriptional repressors. J Biol Chem. 2003; 278(27):24259-68.

Bettelli E, Dastrange M, Oukka M. Foxp3 interacts with nuclear factor of activated T cells and NF-kappa B to repress cytokine gene expression and effector functions of T helper cells. 2005; Proc Natl Acad Sci USA 2005; 102(14):5138-43.

Chang X, Gao JX, Jiang Q, Wen J, Seifers N, Su L, et al. The Scurfy mutation of FoxP3 in the thymus stroma leads to defective thymopoiesis. JEM 2005; 202 (8): 1141-1151.

Metcalfe SM, Muthukumarana PA. Transplantation tolerance: gene expression profiles comparing allotolerance vs. allorejection. lnt Immunopharmacol. 2005; 5(1 ):33-9.

Metcalfe SM, Muthukumarana PA, Thompson HL, Haendel MA, Lyons GE. Leukaemia inhibitory factor (LIF) is functionally linked to axotrophin and both LIF

and axotrophin are linked to regulatory immune tolerance. FEBS Lett. 2005; 579(3):609-14.

Metcalfe SM, Watson TJ, Shurey S, Adams E, Green CJ. Leukemia inhibitory factor is linked to regulatory transplantation tolerance. Transplantation. 2005; 79(6):726-30.

Muthukumarana, GE Lyons, Y Miura, L Thompson, T Watson, CJ Green, S Shurey.AD Hess, BR. Rosengard, Su M. Metcalfe. Evidence for functional interrelationships between FOXP3, leukaemia inhibitory factor, and axotrophin/MARCH-7 in transplantation tolerance. International lmmunopharmacology 6 (2006) 1993-2001.

Metcalfe SM. Axotrophin and leukaemia inhibitory factor (LIF) in transplantation tolerance. Philos Trans R Soc Lond B Biol Sci. 2005; 360(1461 ):1687-94

Ehlting C, Haussinger D, Bode JG. Sp3 is involved in the regulation of SOCS3 gene expression. Biochem J. 2005 May 1 ;387(Pt 3):737-45.

Emery B, Gate HS, Marriott M, Merson T, Binder MD, Snell C, Soo PY, Murray S, Croker B, Zhang JG, Alexander WS, Cooper H, Butzkueven H, Kilpatrick TJ Suppressor of cytokine signaling 3 limits protection of leukemia inhibitory factor receptor signaling against central demyelination. Proc Natl Acad Sci U S A. 2006 May 16;103(20):7859-64.

Gavin MA, Torgerson TR, Houston E, DeRoos P, Ho WY, Stray-Pedersen A ₁ Ocheltree EL, Greenberg PD, Ochs HD, Rudensky AY Single-cell analysis of normal and FOXP3-mutant human T cells: FOXP3 expression without regulatory T cell development. Proc Natl Acad Sci U S A. 2006 Apr 25;103(17):6659-64.

Chae WJ, Henegariu O, Lee SK, Bothwell AL The mutant leucine-zipper domain impairs both dimerization and suppressive function of Foxp3 in T cells. Proc Natl Acad Sci U S A. 2006 Jun 20;103(25):9631-6.

Li S, Weidenfeld J, Morrisey EE Transcriptional and DNA binding activity of the Foxp1/2/4 family is modulated by heterotypic and homotypic protein interactions. MoI Cell Biol. 2004 Jan;24(2):809-22.

Li B, Samanta A, Song X, lacono KT, Bembas K, Tao R, Basu S, Riley JL, Hancock WW, Shen Y, Saouaf SJ, Greene Ml FOXP3 interactions with histone acetyltransferases and class Il histone deacetylases are required for repression. PNAS. 2007 Mar 7;104;4571-4576.

Zheng Y, Josefowicz SZ, Kas A, Chu TT, Gavin MA, Rudensky AY Genome- wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 2007 Feb 22; 445;936-940.