AND SIGNAL TRANSDUCERS

CROSS REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Application No. 61/919,352, filed December 20, 2013, which is incorporated herein by reference in its entirety.

ACKNOWLEDGEMENTS

This work was supported in part by the NIH under Grant Nos. 5RO1AI092839-01 and 5RO1AI092839-03. The United States Government therefore has certain rights to the inventions disclosed herein.

BACKGROUND

Molecular self-assembly, a fundamental process underlying the replication and regulation of biological systems, has emerged as an important engineering paradigm for nanotechnology. For example, molecular nanotechnology uses positionally-controlled mechanosynthesis guided by molecular systems. Molecular nanotechnology involves combining physical principles demonstrated by the molecular machinery of life, chemistry, and other nanotechnologies with the systems engineering principles found in modern macroscale factories.

In biological systems, self-assembling and disassembling complexes of proteins and nucleic acids bound to a variety of ligands perform intricate and diverse dynamic functions. Attempts to rationally encode structure and function into synthetic amino and nucleic acid sequences have largely focused on engineering molecules that self-assemble into prescribed target structures without explicit concern for transient system dynamics. See, Butterfoss, G. L. & Kuhlman, Annu. Rev. Bioph. Biom. 35, 49-65 (2006); Seeman, N. C, Nature 421, 427- 431(2003).

SUMMARY

Disclosed herein is a system comprising at least three different nucleic acid sequences, wherein the first and second nucleic acid sequences are complementary to each other over at least a portion of their sequence, but are unable to substantially hybridize to each other unless they are in the presence of a third nucleic acid, and wherein once the first and second nucleic acids hybridize with each other, the third nucleic acid is no longer able to substantially hybridize with either the first or the second nucleic acid, and further wherein the first and second nucleic acid sequences are enzymatically-produced RNA. Either the first or second nucleic acid sequences, or both, can be kinetically trapped. This means that at least one of the sequences are not available for interaction, such as hybridization, with another nucleic acid sequence.

Also disclosed herein is a method of detecting a nucleic acid interaction, the method comprising: a) providing a first and second nucleic acid sequence which are complementary to each other over at least a portion of their sequence, wherein the first and second nucleic acid sequence are kinetically trapped and therefore unable to substantially hybridize with each other; b) providing a third nucleic acid sequence which is substantially complementary to either the first nucleic acid sequence, the second nucleic acid sequence, or both, over at least a portion of its sequence; c) allowing the third nucleic acid sequence to interact with either the first nucleic acid sequence, the second nucleic acid sequence, or both, wherein said interaction leads to strand displacement of either the first nucleic acid sequence, the second nucleic acid sequence, or both, therefore kinetically freeing the first, second, or both nucleic acids; d) allowing the first and second nucleic acid sequences to substantially interact with each other, wherein once they interact with each other, they are no longer able to substantially interact with the third nucleic acid; and e) detecting the interaction between the first and second nucleic acid sequences, further wherein the first and second nucleic acid sequences are enzymatically produced RNA.

Disclosed herein is a method of detecting nucleic acid interaction, comprising: a) designing a first and second nucleic acid sequence which are complementary to each other over at least a portion of their sequence, wherein either the first nucleic acid sequence, the second nucleic acid sequence, or both, comprise one or more mismatches in the portion in which the first and second nucleic acid sequences are complementary to each other, and further wherein the first and second nucleic acid sequence are kinetically trapped and therefore unable to substantially hybridize with each other; b) providing a third nucleic acid sequence which is substantially complementary to either the first nucleic acid sequence, the second nucleic acid sequence, or both, over at least a portion of its sequence; c) allowing the third nucleic acid sequence to interact with either the first nucleic acid sequence, the second nucleic acid sequence, or both, wherein said interaction leads to strand displacement of either the first nucleic acid sequence, the second nucleic acid sequence, or both, therefore kinetically freeing the first, second, or both nucleic acids; d) allowing the first and second nucleic acid sequences to substantially interact with each other, wherein once they interact with each other, they are no longer able to substantially interact with the third nucleic acid; and e) detecting the interaction between the first and second nucleic acid sequences. BRIEF DESCRIPTION OF THE DRAWINGS

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments and together with the description illustrate the disclosed compositions and methods.

Figure 1. Design of non-enzymatic catalyzed RNA hairpin assembly circuit, (a) Schematic of catalyzed nucleic acid hairpin assembly circuit. The circuit composed of hairpins HI and H2 is turned on in the presence of the input sequence (CI). CI catalyzes the assembly of HI and H2 into an H1 :H2 duplex and is itself recycled. Circuit output (H1 :H2 duplex) is quantitated as increasing fluorescence intensity of a labeled oligonucleotide probe (RepF) upon displacement of its complementary quencher oligonucleotide (RepQ) by the H1 :H2 duplex, (b) Design of T7 RNA polymerase-driven transcription templates for enzymatic synthesis of RNA CHA circuit components with precise 5'- and 3 '-ends. Transcription template for each component, HI, H2 and CI, is flanked on both the left (L) and the right (R) sides by

hammerhead ribozymes (HRz). The size (in nucleotides) of each component and its ribozyme flanks is indicated under each schematic. Secondary structures of the resulting chimeric RNA at 42 °C prior to ribozyme processing are depicted. The RNA structures were generated using NUPACK.

Figure 2. Synthesis and execution of RNA CHA circuit, (a) LHRz and RHRz-mediated co-transcriptional RNA cleavage releases the internal circuit components HI, H2 and CI . 50 ng of PCR-generated transcription templates for HI, H2 and CI were transcribed in 50 μΐ reactions by T7 RNA polymerase for 2 h at 42 °C. Two microliters of the resulting transcripts were analyzed by electrophoresis on a 10% denaturing polyacrylamide gel. Single-stranded DNA oligonucleotides were used as size markers, (b) RNA hairpins undergo catalyzed assembly into RNA duplexes. Gel purified RNA catalyst CI and the hairpins HI and H2 were combined as indicated and incubated in IX TNaK buffer containing 20 units of RNaseOUT for 150 min at 42 °C (lanes 1-4), 52 °C (lanes 5-8) or 62 °C (lanes 9-12). The reactions were then analyzed on a 10% native polyacrylamide gel. 15 ng of CI RNA was included in lane 13 as a control. Single- stranded DNA oligonucleotides were used as size markers.

Figure 3. Kinetics and sensitivity of purified RNA CHA circuit, (a) Fold amplification and sensitivity of gel purified RNA CHA circuit. The RNA CHA circuit can detect pure CI to picomolar concentration with approximately 87-fold amplification of 0.1 nM CI within 315 min at 52 °C. Circuit output measured as concentration of RepF released from RepF:RepQ duplex was extrapolated from a standard curve of free RepF. (b) Initial rate of CI -catalyzed H1 :H2 hybridization was measured by incubating varying concentrations of gel purified HI and H2 with 2.5 nM pure CI RNA diluted in 1 μΜ oligo dTn. Circuits were executed in IX TNaK buffer containing 20 units of RNaseOUT, 0.5 μΜ ROX reference dye and 400 nM RepF annealed with 5X excess (2 μΜ) RepQ at 52 °C for 315 min. Initial rates were calculated from circuit output measurements made during the initial 3-20 min of circuit operation. Average data from three separate experiments is represented. HI concentration has a greater impact on the initial rate suggesting that the first step of the circuit (CI -triggered unfolding of HI) is a rate limiting step, (c) Effect of HI and H2 concentrations on the kinetics of RNA CHA circuit. Average raw fluorescence data from triplicate experiments is plotted. Circuit output is maximal when operated with near equal concentrations of HI and H2. Increasing H2 concentration above that of HI generally decreased the initial reaction rate and resulted in reduced circuit output.

Figure 4. Co-transcriptional RNA CHA and circuit design optimization for co- transcription, (a) Co-transcribed RNA circuit components undergo catalyzed hairpin assembly without requiring gel purification of individual reactants. Fifty nanograms each of HI and H2 transcription templates along with titrating amounts of CI transcription template were co- transcribed for 1 h at 42 °C using T7 RNA polymerase followed by passage through Illustra MicroSpin Sephadex G25 columns. Transcription templates were amplified from cloned inserts using primers pCR2.1.F and pCR2.1.R specific to plasmid sequences flanking the inserts. Two microliter aliquots of the co-transcribed RNA mixtures were then incubated in 15 μΐ volume with 400 nM RepF annealed with 5X excess (2 μΜ) RepQ fluorescent DNA reporter duplex in IX TNaK buffer containing 20 units of RNaseOUT and 0.5 μΜ ROX reference dye to quantitate formation of H1 :H2 RNA duplexes at 52 °C. Average data from triplicate experiments is represented, (b and c) Schematic depicting sequences of RNA hairpins HI and H2 with one- or two-base engineered mismatches. Mismatched HI (mHl) presents a 2 base mismatch between its domain 4* and domain 4 of H2. The hairpins mAHl and mGHl each contain a single mismatched base between their domains 4* and the domain 4 of H2. The mutated H2 hairpin m2H2 presents two mismatched bases between its domain 2* and the HI domain 2.

Figure 5. Operation of co-transcriptionally-generated RNA CHA circuits without any downstream purification and design optimization for detection of DNA target, (a) Fifty nanograms each of the indicated pairs of hairpin 1 and 2 transcription templates were co- transcribed with or without 10 ng of CI transcription template for 1 h at 42 °C using T7 RNA polymerase. Following transcription 2 μΐ of the reaction mix was directly incubated in 1 X TNaK buffer containing 20 units of RNaseOUT and 0.5 μΜ ROX reference dye along with 400 nM RepF (annealed with 5X excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time at 52 °C. (b) Schematic depicting strand displacement amplification (SDA) of DNA. The single-stranded template DNA (black arrow) consists of a sequence (C*) complementary to the RNA CHA catalyst followed by the nicking enzyme recognition sequence (NE) that is present on the non-cleaved DNA strand and a primer binding site (PBS). Following primer binding (step 1) the DNA polymerase synthesizes the complementary strand that now completes the duplex NE site and contains the RNA CHA catalyst sequence (C). Nicking enzyme then binds the duplex NE site (step 2) and cleaves the newly synthesized strand at the NE site. The new 3 '-OH group generated at the nick site is then extended by the DNA polymerase (step 3) while displacing the previously synthesized strand. The displaced ssDNA amplicon can then catalyze RNA CHA. (c) Schematic of DNA target sequence design for catalysis of RNA CHA. Single toehold (domain 1*) DNA target CI (generated by SDA from the template TLTRSDA) with the same domain architecture as the RNA CI is an inefficient catalyst of RNA CHA. Extended DNA target CI 234 (generated by SDA from the template

1234LTRSDA) presenting two toeholds for RNA HI successfully catalyzes RNA CHA.

Figure 6. Co-transcriptionally generated RNA CHA as signal transducer for nucleic acid diagnostics, (a) End-point sequence-specific detection of SDA-generated ssDNA targets by RNA CHA. Samples with or without 10 nM template 1234LTRSDA were amplified by SDA for 90 min at 37 °C in 25 μΐ reaction volumes. Reactions were then incubated at 95 °C for 5 min and stored at room temperature prior to assay by RNA CHA. Five microliters of these SDA products were then probed with 2 μΐ of Sephadex G25 column-purified co-transcribed mHl :H2 RNA CHA circuit. RNA CHA co-transcriptions were performed with T7 RNA polymerase using 50 ng each of the mHl and H2 transcription templates for 1 h at 42 °C. End-point RNA CHA detection reactions were assembled in IX TNaK buffer containing 20 units of RNaseOUT, 0.5 μΜ ROX reference dye and 100 nM RepF (annealed with 5X excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time at 52 °C. Negative control reactions lacking RNA CHA components or containing 2 μΐ of either only mHl or H2 were also tested, (b) Real-time signal transduction of ssDNA-generating SDA by co-transcribed mHl :H2 RNA CHA. High temperature (55 °C) SDA reactions were set up with or without 10 nM

1234HTRSDA template in 20 μΐ volume containing 0.5 μΜ ROX reference dye and 75 nM RepF (annealed with 5X excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time. Real-time sequence-specific signal transduction was achieved by adding 2 μΐ of unpurified mHl :H2 RNA CHA circuits co-transcribed from 50 ng of each transcription template to the SDA reactions. Control SDA reactions containing no RNA CHA components or 2 μΐ of either only mHl or H2 were also tested. Figure 7. Re-engineering of the chromophore-dependent fluorescent RNA aptamer Spinach into sequence-triggered aptamer beacons (Spinach.ST). The chromophore DFHBI bound to Spinach.STl is indicated as a red stellate. Spinach.ST is embedded within a tRNA scaffold and is therefore not subjected to RNA end processing by hammerhead ribozymes.

Figure 8. An entirely RNA-based CHA circuit operation and fluorimetric detection, (a)

CHA circuit components (hairpins H1B and H2 and catalyst CI) and the RNA reporter

Spinach.STl were separately transcribed by T7 RNA polymerase from 500 ng of PCR-generated duplex DNA transcription templates. H1B, H2 and CI transcription templates were amplified using primers complementary to the exact ends of the cloned inserts (HlB.amp.F:HlB.amp.R, H2.amp.F:H2.amp.R and Cl.amp.F:Cl.amp.R, respectively) rather than the flanking plasmid. Spinach.ST transcription templates were amplified using primers specific to the flanking plasmid sequence at the 5 '-end (pCR2.1.F) and the primer sphT.U.R specific to the 3 '-end sequence of Spinach.ST. Transcription reactions were filtered through Sephadex G25 columns prior to circuit assembly. Three microliters of H1B, H2, CI and Spinach.STl transcripts were mixed in indicated combinations and incubated in IX TNaK buffer containing 70 μΜ DFHBI and 20 units of RNaseOUT. Circuit output was measured as increasing fluorescence intensity over time at 37 °C. (b, c and d) Performance of DNA reporter duplex H1BF:H1BQ (b) versus Spinach.STl (c) in measuring RNA CHA circuit output. Indicated concentrations of gel purified RNA hairpins H1B and H2 were incubated with equal concentration of H1BF:H1BQ or gel purified Spinach.STl (+ 70 μΜ DFHBI) in the presence of titrating concentrations of pure CI RNA. All circuits were operated in IX TNaK buffer containing 20 units of RNaseOUT at 37 °C and average data from triplicate experiments is represented. Signal-to-noise ratio of

H1BF:H1BQ versus Spinach.STl over the time course of RNA CHA detection is plotted in (d).

Figure 9. Application of RNA CHA circuit as an OR logic processor, (a) Schematic of RNA CHA circuit operation in response to either catalyst CI OR C2. The RNA hairpin H1B serves as the OR gate and circuit output is measured fluorimetrically using Spinach.STl RNA aptamer beacon, (b) Circuit components (H1B and H2 RNA hairpins), reporter RNA

(Spinach.STl) and the inputs CI and C2 were transcribed from 500 ng of duplex DNA transcription templates using T7 RNA polymerase. Transcription templates were prepared using the same procedure as Figure 1 1. Following filtration through Sephadex G25, 3 μΐ per transcript (or 1.5 μΐ each of CI and C2 when added together in a reaction) were mixed in the indicated combinations in IX TNaK buffer containing 70 μΜ DFHBI and 20 units of RNaseOUT. Circuits were operated at 37 °C and outputs were measured fluorimetrically. Figure 10. Co-transcribed RNA CHA circuits are activated only by specific catalyst sequences. HI or mutant HI (mHl) was co-transcribed with H2 and specific catalyst CI or the non-specific catalyst GQ-C1 for 1 h at 42 °C using T7 RNA polymerase. Following passage through Sephadex G25 columns aliquots of the co-transcribed RNA mixtures were incubated with fluorescent DNA reporter duplex RepF:RepQ in IX TNaK buffer to quantitate formation of H1 :H2 RNA duplexes at 52 °C (A and B). Similar amounts of RNA were transcribed in all reactions as determined by analyzing 2 μΐ of each transcription on a 10% denaturing

polyacrylamide gel followed by staining with SYBR-Gold (C). Co-transcription reactions lacking T7 RNA polymerase (C1-T7RNAP) failed to synthesize the circuit and hence did not activate the reporter.

Figure 11. Schematic depicting engineered mismatches between RNA CHA hairpins 1 and 2 designed to reduce uncatalyzed duplex assembly nucleated by breathing hairpin stems.

Figure 12. H1 :H2 base mismatches between domains 4 and 4* improve signal to noise ratio of RNA CHA. (a) Indicated pairs of gel purified RNA hairpins reactants were mixed in equimolar concentration (200 nM each) with or without 5 nM CI RNA in IX TNaK buffer containing 20 units of RNaseOUT and 0.5 μΜ ROX reference dye. Formation of H1 :H2 duplexes at 52 °C was quantitated by including 200 nM RepF annealed with 5X excess (1 μΜ) RepQ fluorescent DNA reporter duplex in a final volume of 15 μΐ. Average data from triplicate experiments is represented, (b) Only the background CHA reactions performed in the absence of catalyst from (a) are depicted for clarity, (c) Initial (first 10 min) and average (over entire reaction duration) reaction rates of the catalyzed RNA CHA are depicted. Catalyzed reaction rates observed with the mutated hairpins mHl, mAHl and mGHl were not statistically different from those obtained with the original hairpin HI . Data was analyzed using single-factor ANOVA followed by Tukey's post-hoc analysis for determining statistical significance, (d) Average reaction rates of uncatalyzed CHA are depicted. Compared to HI the single mismatch hairpins mAHl and mGHl demonstrate statistically significant reduction in non-catalyzed assembly with H2. The double mismatch hairpin mHl demonstrates the lowest background with statistically significant difference in its reaction rate compared to those of HI, mAHl and mGHl. Data was analyzed using single-factor ANOVA followed by Tukey's post-hoc analysis for determining statistical significance.

Figure 13. H1 :H2 base mismatches between domains 2 and 2* improve signal to noise ratio of RNA CHA. (a) Indicated pairs of gel purified RNA hairpins reactants were mixed in equimolar concentration (200 nM each) with or without 5 nM CI RNA in IX TNaK buffer containing 20 units of RNaseOUT and 0.5 μΜ ROX reference dye. Formation of H1 :H2 duplexes at 52 °C was quantitated by including 200 nM RepF annealed with 5X excess (1 μΜ) RepQ fluorescent DNA reporter duplex in a final volume of 15 μΐ. Average data from triplicate experiments is represented, (b) Average (over entire reaction duration) reaction rates of the catalyzed and uncatalyzed R A CHA are depicted. Catalyzed reaction rate observed with the mutated hairpin m2H2 was comparable to that obtained with the original hairpin H2. However, the uncatalyzed background assembly of m2H2 with HI was significantly lower than that of H2. Data was analyzed by Student's Mest as well as by using single- factor ANOVA followed by Tukey's post-hoc analysis for determining statistical significance.

Figure 14. Introduction of H1 :H2 base mismatches for optimal co-transcriptional RNA CHA. Co-transcribed RNA circuit components undergo catalyzed hairpin assembly without requiring gel purification of individual reactants. (a) Co-transcriptional RNA CHA. Fifty nanograms each of the indicated pairs of hairpin 1 and 2 transcription templates with or without 10 ng of CI transcription template were co-transcribed at 42 °C using T7 RNA polymerase followed by passage through Sephadex G25 columns. Two microliter aliquots of the co- transcribed RNA mixtures were then incubated with 200 nM RepF (annealed with 5X excess RepQ) fluorescent DNA reporter duplex in IX TNaK buffer containing 20 units of RNaseOUT and 0.5 μΜ ROX reference dye to quantitate formation of H1 :H2 RNA duplexes at 52 °C. Average data from triplicate experiments is represented, (b and c) Initial (first 10 min) reaction rates of uncatalyzed (b) and catalyzed RNA CHA (c) are depicted. A two base mismatch between HI and H2 does not compromise CHA kinetics. Catalyzed reaction rates observed with the mutated hairpins mHl and m2H2 were not statistically different from those obtained with the original hairpins HI or H2. In contrast, the uncatalyzed background assembly of the double mismatch hairpin mHl with H2 is significantly reduced compared to background duplex formation between H1 :H2 and Hl :m2H2. Data was analyzed using single-factor ANOVA followed by Tukey's post-hoc analysis for determining statistical significance.

Figure 15. Use of H1 :H2 base mismatch for optimal co-transcriptional RNA CHA. Co- transcribed RNA circuit components undergo catalyzed hairpin assembly without requiring gel purification of individual reactants. (a) Schematic depicting sequences of RNA hairpins H2, HI and mismatched HI (mHl) with a 2 base mismatch between domains 4* and 4 of mHl and H2, respectively, (b) Co-transcriptional RNA CHA. Fifty nanograms each of HI and H2 transcription templates along with titrating amounts of C 1 transcription template were co- transcribed at 42 °C using T7 RNA polymerase followed by passage through sephadex G25 columns. Aliquots of the co-transcribed RNA mixtures were then incubated with fluorescent DNA reporter duplex in IX TNaK buffer to quantitate formation of HI :H2 RNA duplexes at 52 °C. Average data from triplicate experiments is represented, (c and d) A two base mismatch between mHl and H2 does not compromise CHA kinetics (c) compared to fully base-matched circuit. However, this mismatch reduces the CHA background (d) in the absence of CI RNA. Indicated concentrations of gel purified RNA components were mixed in IX TNaK buffer in the presence of fluorescent reporter DNA duplex. Formation of H1 :H2 RNA duplex was measured as increasing fluorescence accumulation over time at 52 °C. Average data from triplicate experiments is represented.

Figure 16. Target sequence-specific end-point signal transduction of SDA by co- transcribed RNA CHA. Reactions containing no template or 10 nM of the templates TLTRSDA (produces the inactive DNA catalyst CI) or 1234LTRSDA (produces the active DNA catalyst C1234) were amplified by SDA at 37 °C for 90 min followed by 5 min incubation at 95 °C prior to storage at room temperature. Five microliter aliquots of these SDA reactions were then probed in 15 μΐ reaction volumes with 2 μΐ of co-transcribed mHl :H2 RNA CHA circuits. Co- transcriptions were performed for 1 h at 42 °C with T7 RNA polymerase using 50 ng of each hairpin transcription template. The co-transcribed circuits were either filtered through Sephadex G25 prior to use (a) or used without any purification for probing SDA reactions (b). RNA CHA- mediated SDA signal transduction reactions were assembled in 1 X TNaK buffer containing 0.5 μΜ ROX reference dye, 20 units of RNaseOUT and 100 nM RepF (annealed with 5X excess RepQ) fluorescent DNA reporter duplex. The RNA CHA output was measured in real-time at 52 °C.

Figure 17. RNA CHA-mediated real-time signal transduction of ssDNA-generating high temperature SDA. High temperature (55 °C) SDA reactions were set up with or without titrating concentrations of 1234HTRSDA template in 20 μΐ volume containing 0.5 μΜ ROX reference dye and 75 nM RepF (annealed with 5X excess RepQ) fluorescent DNA reporter duplex for quantitating RNA CHA in real-time. Real-time sequence-specific signal transduction was achieved by adding 2 μΐ of mHl :H2 RNA CHA circuits co-transcribed from 50 ng of each transcription template to the SDA reactions. Co-transcribed RNA CHA circuits were not purified prior to use as real-time SDA signal transducers.

Figure 18. Initial catalytic rates of the RNA CHA OR processor. Initial catalytic reaction rates between the first 26 to 65 min of circuit operation were measured using the data depicted in Figure 9b. The statistical significance was calculated using single-factor ANOVA followed by Tukey's post-hoc analysis. The initial catalytic rates in the presence of CI or C2 or both CI and C2 were significantly higher than uncatalyzed reaction rate. The initial catalytic rate of CI was significantly lower than those observed with C2 alone or in C2 in combination with CI. Figure 19. Catalytic hairpin assembly reaction with fluorescence read-out. Briefly, one short linear oligonucleotide, 'catalyst', will react with HI via toehold binding and then initiate a branch migration reaction. The partially-opened HI can interact with a toehold on H2 and similarly initiate a branch migration reaction. At the conclusion of the second branch migration the catalyst will be completely displaced from HI and will be available for additional reaction cycles. Numbers in the figure stand for different sequence domains; each domain includes 8 bases.

Figure 20. Possible pathways for leakage and positions of potential active breathing sites relative to the introduced mismatches: A) When the left-end of the stem of HI 'breathes', the 3'- end of domain 2 will be transiently exposed, revealing a partial toehold that is complementary to domain 2 of H2. This transient toehold exposure permits HI and H2 to react in the absence of catalyst; B) The four mismatch positions correspond to the revealed interactions that initiate strand displacement reactions between HI and H2. For example, mismatches at the 3 ' end of domain 2 of H2 disrupt binding and / or strand exchange with domain 2* of HI ; similarly, mismatches at the 5 ' end of domain 1 of H 1 disrupt binding and / or strand exchange with domain 1 * of H2.

Figure 21. Signal generation with four different mismatches. A) Wild-type circuit and CircA-H2D2M2 circuit; B) Wild-type circuit and CircA-H2D3M2 circuit; C) Wild-type circuit and CircA-HlD4M2 circuit; D) Wild-type circuit and CircA-HlDlM2 circuit. The wild-type data are the same for each comparison; they are simply broken out for ease of viewing.

Figure 22. Signal-to-background ratios for four different mismatches. C denotes 'with 2.5 nM catalyst'; B denotes 'background' or 'without catalyst'. Signaknoise ratios were calculated from the linear portion of each fluorescence curve (such as those seen in Figure 21); each set of CHA reactions has been repeated at least three times. The numbers at the tops of columns represent the ratio of the catalyzed rate to background leakage.

Figure 23. Signal generation in Circuit A with nine different domain 2 mismatches. Calculated signal-to-background ratios for A) single mismatches in CircA-H2; and B) double mismatches and triple mismatches. Each CHA reaction was carried out with 50 nM of H2 (either wild-type or mismatched), 50 nM CircA-Hl, and 50 nM CircA-reporter.

Figure 24. Signal generation in Circuit A with a single mismatch in domain 4.

Comparison of wild-type Circuit A to the CircA-HlD4Ml circuit, with and without catalyst. Each CHA reaction was carried out with 50 nM HI (either wild-type or mismatch), 50 nM CircA-H2, and 50 nM CircA-reporter. Figure 25. Signal generation in Circuit A with various H2 mismatches. A) Single mismatched H2; B) Double and triple mismatched H2.

Figure 26. Native polyacrylamide gel electrophoresis of CHA reactions, a) CircA-Hl; b) CircA-H2; c) CircA-H2D2M2; d) CircA-Hl+CircA-H2+5nM Catalyst; e) CircA-Hl+CircA- H2D2M2+5nM catalyst; f) CircA-Hl+CircA-H2; g) CircA-Hl+CircA-H2D2M2. The gel was photographed by Storm Scanner 840. The inset Table shows the relative fluorescence intensity (R-FI; derived from ImageQuant 5.2 software ) of the bands corresponding to the assembled hairpins for lanes d to g.

Figure 27. Signal generation with four different mismatches. A) Wild-type circuit and CircB-H2D2M2 circuit; B) Wild-type circuit and CircB-H2D3M2 circuit; C) Wild-type circuit and CircB-HlD4M2 circuit; D) Wild-type circuit and CircB-HlDlM2 circuit. The wild-type data are the same for each comparison; they are simply broken out for ease of viewing. All wild-type and mismatch sequences are based on Circuit B.

Figure 28. Signal generation in Circuit B with a single mismatch in domain 4.

Comparison of wild-type Circuit B to the CircB-HlD4Ml circuit, with and without catalyst. Each CHA reaction was carried out with 50 nM HI (either wild-type or mismatch), 50 nM CircB-H2, and 50 nM CircB-reporter.

Figure 29. Signal generation in Circuit B with domain 2 mismatches. A) Wild-type circuit and CircB-H2D2Ml circuit; B) Wild-type circuit and CircB-H2D2M2 circuit; C) Calculated signakbackground ratios from A) and B). Each CHA reaction was carried out with 50 nM of H2 (either wild-type or mismatch), 50 nM CircB-Hl, and 50 nM CircB-Reporter.

DETAILED DESCRIPTION

Before the present compounds, compositions, articles, devices, and/or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

Definitions

As used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like. Ranges can be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that when a value is disclosed that "less than or equal to" the value, "greater than or equal to the value" and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value "10" is disclosed the "less than or equal to 10"as well as "greater than or equal to 10" is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point "10" and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings:

"Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

A "self-assembly pathway" is a series of reactions autonomously executed by nucleic acid sequences in the execution of hybridized, detectable nucleic acid sequences. The self- assembly pathway comprises assembly, or hybridization, of nucleic acid sequences. In some embodiments, the self-assembly pathway can also comprise one or more disassembly reactions.

The term "nucleic acid" refers to natural nucleic acids, artificial nucleic acids, analogs thereof, or combinations thereof. Nucleic acids may also include analogs of DNA or RNA having modifications to either the bases or the backbone. For example, nucleic acid, as used herein, includes the use of peptide nucleic acids (PNA). The term "nucleic acids" also includes chimeric molecules. The term "hairpin" as used herein refers to a structure formed by intramolecular base pairing in a single-stranded polynucleotide ending in an unpaired loop (the "hairpin loop"). In various embodiments, hairpins comprise a hairpin loop protected by stems. For example, a hairpin can comprise a first stem region, a hairpin loop region, and a second stem region. The first and second stem regions can hybridize to each other and together form a duplex region. Thus, a stem region of a hairpin nucleic acid is a region that hybridizes to a complementary portion of the same nucleic acid to form the duplex stem of a hairpin.

the term "hairpin loop" refers to a single stranded region that loops back on itself and is closed by a single base pair.

"Interior loop" and "internal loop," are used interchangeably and refer to a loop closed by two base pairs. The closing base pairs are separate by single stranded regions of zero or more bases. A "bulge loop" is an interior loop where one of the separated single-stranded regions is zero bases in length and the other is greater than zero bases in length.

An "initiator" is a molecule that is able to initiate the hybridization of two other nucleic acid sequences. The initiator is also referred to herein as the third nucleic acid sequence, while it facilitates the hybridization of what is referred to herein as the first and second nucleic acid sequences.

"Monomers" as used herein refers to individual nucleic acid sequences. For example, monomers are referred to herein as a first nucleic acid sequence, a second nucleic acid sequence, or a third nucleic acid sequence, etc.

By "nucleic acid sequence" is meant a nucleic acid which comprises an individual sequence. When a first, second, or third nucleic acid sequence is referred to, this is meant that the individual nucleotides of each of the first, second, third, etc., nucleic acid sequence are unique and differ from each other. In other words, the first nucleic acid sequence will differ in nucleotide sequences from the second and third, etc. There can be multiple nucleic acid sequences with the same sequence. For instance, when a "first nucleic acid sequence" is referred to, this can include multiple copies of the same sequence, all of which are referred to as a "first nucleic acid sequence."

Typically, at least two different nucleic acid sequences are used in self-assembly pathways, although three, four, five, six or more may be used. Typically each nucleic acid sequence comprises at least one domain that is complementary to at least a portion of one other sequence being used for the self-assembly pathway. Individual nucleic acid sequences are discussed in more detail below. The term "domain" refers to a portion of a nucleic acid sequence. An "input domain" of a nuclei acid sequence refers to a domain that is configured to receive a signal which initiates a physical and/or chemical change, such as, a for example, a conformational change, of the nucleic acid sequence. In some embodiments, an input domain can be an initiator binding domain, an assembly complement domain, or a disassembly complement domain. An "output domain" of a nucleic acid sequence refers to a domain that is configured to confer a signal. For example, the signal can bind a complementary sequence to an input domain. In some embodiments, an output domain is configured to confer a signal to an input domain of another nucleic acid sequence. In some embodiments, an output domain can be, for example, an assembly domain, or a disassembly domain. In some embodiments, an output domain can be present in an initiator.

The term "nucleate" as used herein means to begin a process of, for example, a physical and/or chemical change at a discrete point in a system. The term "nucleation" refers to the beginning of physical and/or chemical changes at discrete points in a system.

The term "toehold" refers to nucleation site of a domain comprising a nucleic acid sequence designed to initiate hybridization of the domain with a complementary nucleic acid sequence. The secondary structure of a nucleic acid sequence may be such that the toehold is exposed or sequestered. For example, in some embodiments, the secondary structure of the toehold is such that the toehold is available to hybridize to a complementary nucleic acid (the toehold is "exposed," or "accessible"), and in other embodiments, the secondary structure of the toehold is such that the toehold is not available to hybridize to a complementary nucleic acid (the toehold is "sequestered," or "inaccessible"). If the toehold is sequestered or otherwise unavailable, the toehold can be made available by some event such as, for example, the opening of the hairpin of which it is a part of. When exposed, a toehold is configured such that a complementary nucleic acid sequence can nucleate at the toehold.

A "propagation region" as used herein refers to a portion of a domain of a first nucleic acid sequence that is configured to hybridize to a complementary second nucleic acid sequence once the toehold of the domain nucleates at an exposed toehold of the second nucleic acid sequence. The propagation region is configured such that an available secondary nucleic acid sequence does not nucleate at the propagation region; rather, the propagation region hybridizes to the second nucleic acid sequence only after nucleation at the toehold of the same domain.

In some embodiments, nucleic acid sequences can be "metastable." That is, in the absence of an initiator they are kinetically disfavored from associating with other nucleic acid sequences comprising complementary regions. As used herein, the terms "polymerization" and "assembly" are used interchangeably and refer to the association of two or more nucleic acid sequence, or one or more nucleic acid sequences and an initiator, to form a polymer. The "polymer" may comprise covalent bonds, non-covalent bonds or both. For example, in some embodiments a first, second, and third nucleic acid sequence can hybridize sequentially to form a polymer comprising a three-arm branched junction.

As used herein term "disassembly" refers to the disassociation of an initiator or at least one nucleic acid sequence.

As used herein "reaction graph" refers to a representation of assembly (and, optionally, disassembly) pathways that can be translated into molecular executables.

As used herein the terms "flip" and "switch" are used interchangeably and refer to a change from one state (e.g., accessible) to another state (e.g., inaccessible).

"Kinetically trapped" means that the nucleic acid sequences are inaccessible. In other words, a nucleic acid sequence which is "kinetically trapped" is not available for hybridization. For example, a nucleic acid sequence which has formed a hairpin is considered to be kinetically trapped.

As used herein, an "aptamer" is an oligonucleotide that is able to specifically bind an analyte of interest other than by base pair hybridization. Aptamers typically comprise DNA or RNA or a mixture of DNA and RNA. Aptamers may be naturally occurring or made by synthetic or recombinant means. The aptamers are typically single stranded, but may also be double stranded or triple stranded. They may comprise naturally occurring nucleotides, nucleotides that have been modified in some way, such as by chemical modification, and unnatural bases, for example 2-aminopurine. See, for example, U.S. Pat. No. 5,840,867. The aptamers may be chemically modified, for example, by the addition of a label, such as a fluorophore, or a by the addition of a molecule that allows the aptamer to be crosslinked to a molecule to which it is bound. Aptamers are of the same "type" if they have the same sequence or are capable of specific binding to the same molecule. The length of the aptamer will vary, but is typically less than about 100 nucleotides.

The term "oligonucleotides," or "oligos" as used herein refers to oligomers of natural (RNA or DNA) or modified nucleic acid sequences or linkages, including deoxyribonucleotides, ribonucleotides, anomeric forms thereof, peptide nucleic acid monomers (PNAs), locked nucleotide acids monomers (LNA), and the like and/or combinations thereof, capable of specifically binding to a single-stranded polynucleotide by way of a regular pattern of sequence- to-sequence interactions, such as Watson-Crick type of base pairing, base stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or the like. Usually nucleic acid sequences are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few base units, e.g., 8-12, to several tens of base units, e.g., 100-200. Suitable oligonucleotides may be prepared by the phosphoramidite method described by Beaucage and Carruthers (Tetrahedron Lett., 22, 1859-1862, 1981), or by the triester method according to Matteucci, et al. (J. Am. Chem. Soc, 103, 3185, 1981), both incorporated herein by reference, or by other chemical methods such as using a commercial automated oligonucleotide synthesizer. Typically, oligonucleotides are single-stranded, but double-stranded or partially double-stranded oligos may also be used in certain embodiments of the invention. An "oligo pair" is a pair of oligos that specifically bind to one another (i.e., are complementary (e.g., perfectly complementary) to one another).

The terms "complementary" and "complementarity" refer to oligonucleotides related by base-pairing rules. Complementary nucleotides are, generally, A and T (or A and U), or C and G. For example, for the sequence "5'-AGT-3'," the perfectly complementary sequence is "3'- TCA-5'." Methods for calculating the level of complementarity between two nucleic acids are widely known to those of ordinary skill in the art. For example, complementarity may be computed using online resources, such as, e.g., the NCBI BLAST website

(ncbi.nlm.nih.gov/blast/producttable.shtml) and the Oligonucleotides Properties Calculator on the Northwestern University website (basic.northwestem.edu/biotools/oligocalc.html). Two single-stranded RNA or DNA molecules may be considered substantially complementary when the nucleotides of one strand, optimally aligned and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98 to 100%. Two single-stranded oligonucleotides are considered perfectly complementary when the nucleotides of one strand, optimally aligned and with appropriate nucleotide insertions or deletions, pair with 100% of the nucleotides of the other strand. Alternatively, substantial complementarity exists when a first oligonucleotide will hybridize under selective hybridization conditions to a second

oligonucleotide. Selective hybridization conditions include, but are not limited to, stringent hybridization conditions. Selective hybridization, or substantially complementary hybridization, occurs when at least about 65% of the nucleic acid sequences within a first oligonucleotide over a stretch of at least 14 to 25 sequences pair with a perfectly complementary sequences within a second oligonucleotide, preferably at least about 75%, more preferably at least about 90%. Preferably, the two nucleic acid sequences have at least 95%, 96%, 97%, 98%, 99% or 100% of sequence identity. See, M. Kanehisa, Nucleic Acids Res. 12, 203 (1984), incorporated herein by reference. For shorter nucleotide sequences selective hybridization occurs when at least about 65% of the nucleic acid sequences within a first oligonucleotide over a stretch of at least 8 to 12 nucleotides pair with a perfectly complementary nucleic acid sequence within a second oligonucleotide, preferably at least about 75%, more preferably at least about 90%. Stringent hybridization conditions will typically include salt concentrations of less than about 1 M, more usually less than about 500 mM and preferably less than about 200 mM. Hybridization temperatures can be as low as 5° C, and are preferably lower than about 30° C. However, longer fragments may require higher hybridization temperatures for specific hybridization.

Hybridization temperatures are generally at least about 2° C. to 6° C. lower than melting temperatures (T _m ), which are defined below.

As used herein, "two perfectly matched nucleotide sequences" refers to a nucleic acid duplex wherein the two nucleotide strands match according to the Watson-Crick basepair principle, i.e., A-T and C-G pairs in DNA:DNA duplex and A-U and C-G pairs in DNA:RNA or RNA:RNA duplex, and there is no deletion or addition in each of the two strands.

The term, "mismatch" refers to a nucleic acid duplex wherein at least one of the nucleotide base pairs do not form a match according to the Watson-Crick basepair principle. For example, A-C or U-G "pairs" are lined up, which are not capable of forming a basepair. The mismatch can be in a single set of bases, or in two, three, four, five, or more basepairs of the nucleic acid duplex.

As used herein, "complementary to each other over at least a portion of their sequence" means that at least two or more consecutive nucleotide base pairs are complementary to each other. For example, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more consecutive nucleotide base pairs can be complementary to each other over the length of the nucleic acid sequence. .

As used herein, "substantially hybridized" refers to the conditions under which a stable duplex is formed between two nucleic acid sequences, and can be detected. This is discussed in more detail below.

As used herein, "melting temperature" ("Tm") refers to the midpoint of the temperature range over which nucleic acid duplex, i.e., DNA:DNA, DNA:RNA and RNA:RNA, is denatured.

As used herein: "stringency of hybridization" in determining percentage mismatch is as follows:

1) high stringency: 0.1 X SSPE, 0.1% SDS, 65°C; 2) medium stringency: 0.2 X SSPE, 0.1% SDS, 50°C (also referred to as moderate stringency); and

3) low stringency: 1.0 X SSPE, 0.1% SDS, 50°C

It is understood that equivalent stringencies may be achieved using alternative buffers, salts and temperatures (See generally, Ausubel (Ed.) Current Protocols in Molecular Biology, 2.9A. Southern Blotting, 2.9B. Dot and Slot Blotting of DNA and 2.10. Hybridization Analysis of DNA Blots, John Wiley & Sons, Inc. (2000)).

As used herein, a "significant reduction in background hybridization" means that nonspecific hybridization, or hybridization between unintended nucleic acid sequences, is reduced by at least 80%, more preferably by at least 90%, even more preferably by at least 95%, still more preferably by at least 99%.

By "preferentially binds" it is meant that a specific binding event between a first and second molecule occurs at least 20 times or more, preferably 50 times or more, more preferably 100 times or more, and even 1000 times or more often than a nonspecific binding event between the first molecule and a molecule that is not the second molecule. For example, a capture moiety can be designed to preferentially bind to a given target agent at least 20 times or more, preferably 50 times or more, more preferably 100 times or more, and even 1000 times or more often than to other molecules in a biological solution. Also, an immobilized binding partner, in certain embodiments, will preferentially bind to a target agent, capture moiety, or capture moiety/target agent complex. While not wishing to be limited by applicants present

understanding of the invention, it is believed binding will be recognized as existing when the K _a is at 10 ⁷ 1/mole or greater, preferably 10 ⁸ 1/mole or greater. In the embodiment where the capture moiety is comprised of antibody, the binding affinity of 10 ⁷ 1/mole or more may be due to (1) a single monoclonal antibody (e.g., large numbers of one kind of antibody) or (2) a plurality of different monoclonal antibodies (e.g., large numbers of each of several different monoclonal antibodies) or (3) large numbers of polyclonal antibodies. It is also possible to use combinations of (l)-(3). The differential in binding affinity may be accomplished by using several different antibodies as per (l)-(3) above and as such some of the antibodies in a mixture could have less than a four-fold difference. For purposes of most embodiments of the invention an indication that no binding occurs means that the equilibrium or affinity constant Ka is 10 ⁶ 1/mole or less. Antibodies may be designed to maximize binding to the intended antigen by designing peptides to specific epitopes that are more accessible to binding, as can be predicted by one skilled in the art. The term "sample" in the present specification and claims is used in its broadest sense and can be, by non-limiting example, any sample that is suspected of containing a target agent(s) to be detected. It is meant to include specimens or cultures (e.g., microbiological cultures), and biological and environmental specimens as well as non-biological specimens. Biological samples may comprise animal-derived materials, including fluid (e.g., blood, saliva, urine, lymph, etc.), solid (e.g., stool) or tissue (e.g., buccal, organ-specific, skin, etc.), as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may be obtained from, e.g., humans, any domestic or wild animals, plants, bacteria or other microorganisms, etc. Environmental samples can include environmental material such as surface matter, soil, water (e.g., contaminated water), air and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention. Those of skill in the art would appreciate and understand the particular type of sample required for the detection of particular target agents (Pawliszyn, J., Sampling and Sample Preparation for Field and Laboratory, (2002); Venkatesh Iyengar, G., et al, Element Analysis of Biological Samples: Principles and Practices (1998); Drielak, S., Hot Zone For ensics: Chemical, Biological, and Radiological Evidence Collection (2004); and Nielsen, D. M., Practical Handbook of

Environmental Site Characterization and Ground-Water Monitoring (2005)).

A substance is commonly said to be present in "excess" or "molar excess" relative to another component if that component is present at a higher molar concentration than the other component. Often, when present in excess, the component will be present in at least a 10-fold molar excess and commonly at 100-1,000,000 fold molar excess. Those of skill in the art would appreciate and understand the particular degree or amount of excess preferred for any particular reaction or reaction conditions. Such excess is often empirically determined and/or optimized for a particular reaction or reaction conditions.

As used herein, "a promoter, a promoter region or promoter element" refers to a segment of DNA or RNA that controls transcription of the DNA or RNA to which it is operatively linked. The promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. This portion of the promoter region is referred to as the promoter. In addition, the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences may be cis acting or may be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, may be constitutive or regulated. As used herein, "operatively linked or operationally associated" refers to the functional relationship of nucleic acids with regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences. For example, operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA. In order to optimize expression and/or in vitro transcription, it may be necessary to remove, add or alter 5' untranslated portions of the clones to eliminate extra, potential inappropriate alternative translation initiation (i.e., start) codons or other sequences that may interfere with or reduce expression, either at the level of transcription or translation.

Alternatively, consensus ribosome binding sites (see, e.g., Kozak, J. Biol. Chem., 266: 19867- 19870 (1991)) can be inserted immediately 5' of the start codon and may enhance expression. The desirability of (or need for) such modification may be empirically determined.

As used herein, "RNA polymerase" refers to an enzyme that synthesizes RNA using a DNA or RNA as the template. It is intended to encompass any RNA polymerase with conservative amino acid substitutions that do not substantially alter its activity.

As used herein, "reverse transcriptase" refers to an enzyme that synthesizes DNA using a RNA as the template. It is intended to encompass any reverse transcriptase with conservative amino acid substitutions that do not substantially alter its activity.

"Enzymatically produced" refers to the production or secondary or tertiary folding of a nucleic acid by an enzyme rather than by chemical synthesis. Enzymatically produced nucleic acids can be made in vitro or in vivo. For example, ribozyme-containing transcription template scaffolds can be engineered to enable enzymatic co-transcriptional synthesis of RNA circuits that can operate without any post-synthetic separation and re-folding of individual circuit components.

Systems and Methods

Disclosed herein are systems and methods, as well as the components to be used to prepare the disclosed systems and methods. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular nucleic acid sequence is disclosed and discussed and a number of modifications that can be made to a number of molecules including the nucleic acid sequence are discussed, specifically contemplated is each and every combination and permutation of the nucleic acid sequence and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.

RNA Circuits

Nucleic acid circuits are finding increasing real-life applications in diagnostics and synthetic biology. While DNA has been the main operator in most nucleic acid circuits, transcriptionally produced RNA circuits can provide powerful alternatives for reagent production and their use in cells. The results demonstrated herein are that the design principles developed for DNA circuits are readily translatable to engineering RNA circuits that operate with similar kinetics and sensitivities of detection. Not only can purified RNA hairpins perform amplification reactions, but RNA hairpins transcribed in vitro also mediated amplification, even without purification. Moreover, the results of the non-enzymatic amplification reactions were readable using a fluorescent RNA aptamer (Spinach) that was engineered to undergo sequence- specific conformational changes (Example 1). These advances were applied to the end-point and real-time detection of the isothermal strand displacement amplification reaction that produces single-stranded DNAs as part of its amplification cycle. Gate structures with RNA similar to those that have previously formed the basis of DNA circuit computations were also engineered. These results validate an entirely new chemistry for the implementation of nucleic acid circuits.

Nucleic acids are versatile molecules that store and process information in living systems. In addition, though, the relatively simple rules for base-pairing interactions have led to the extraordinary blossoming of nucleic acids as molecules that are suitable for nanoscale computation and engineering (Chen 2010). In the past decade an increasingly complex array of nucleic acid circuits and devices has been engineered both in vitro and in vivo based on programmed strand displacement (Chen (2010), Li (2011), Qian (201 1), Zhang (2011), Qian (201 1), Seelig (2006), Choi (2010), Lucks (2011),. Isaacs (2004)). Short complementary single- stranded domains termed 'toeholds' provide a means of initiating more extensive branch migration reactions. Ultimately, the toehold-mediated, non-enzymatic interactions between substrates are driven by the free energy of strand displacement, either via the formation of more net base pairs (enthalpy gain) or via the release of strands from complexes (entropy gain) (Zhang 2011).

One example is a programmable DNA circuit known as catalytic hairpin assembly

(CHA) (Yin 2008). In CHA two partially complementary DNA hairpins are prevented from reacting with one another by ensconcing the complementary sequences within hairpin structures, effectively leading to kinetic trapping of the reaction (Li (201 1). A short, single-stranded oligonucleotide 'catalyst' that can interact with a toehold on one of the hairpins leads to strand displacement and the revelation of sequences that can interact with the other hairpin, the formation of a double-stranded product, and the recycling of the catalyst. Such CHA circuits have recently been developed into sequence-specific signal transduction tools for detection and quantitation of isothermal nucleic acid amplification reactions (Li (2012), Jiang (2013)).

Since RNA molecules have predictable base-pairing properties similar to DNA, and are also capable of hybridization and strand displacement, nucleic acid circuits were developed based on RNA as well as DNA. Nucleic acid circuits were rationally designed that completely relied on programmed interactions between RNA in vitro, rather than on DNA. A RNA CHA circuit was designed based on a well-studied DNA CHA circuit. The production of this RNA circuit further required considerable modification for in vitro transcription, processing, and signal transduction, including engineering the recently described fluorescent RNA aptamer

Spinach into a sequence-dependent aptamer beacon that can transduce the circuit output (HI :H2 duplexes) into readable fluorescent signals (Example 1). However, in operation the RNA circuits can be directly transcribed from DNA without the need for purification, separation, or refolding of the hairpin reactants. Even so, the RNA circuit could detect picomolar concentrations of a catalyst sequence with a median amplification of 87-fold. Turnover rates (v/[Cl]) of the RNA CHA circuit were between 0.2 to 1/min were, similar to the DNA circuit (Li (201 1)). Such circuits can be especially useful for the in situ generation of substrates for real-time signal transduction of enzymatic isothermal nucleic acid amplification reactions. These results clearly demonstrate that the base-pairing properties and conformational malleability of RNA can be readily harnessed for executing in vitro nucleic acid circuits and also demonstrate the feasibility of RNA 170 computational modules. RNA circuits can be engineered and operated using the same design principles as DNA, but because of the ease of construction of DNA templates rather than DNA substrates may now render large-scale, high-fidelity enzymatic circuit synthesis that is both time and cost effective. Ultimately, co-transcriptional RNA circuit synthesis in vitro may provide a basis for in vivo nucleic acid computation and new regulatory paradigms in synthetic biology.

Disclosed herein is a system comprising at least three different nucleic acid sequences, wherein the first and second nucleic acid sequences are complementary to each other over at least a portion of their sequence, but are unable to substantially hybridize to each other unless they are in the presence of a third nucleic acid, and wherein once the first and second nucleic acids hybridize with each other, the third nucleic acid is no longer able to substantially hybridize with either the first or the second nucleic acid, and further wherein the first and second nucleic acid sequences are enzymatically-produced RNA. Either the first or second nucleic acid sequences, or both, can be kinetically trapped. This means that at least one of the sequences are not available for interaction, such as hybridization, with another nucleic acid sequence.

Also disclosed herein is a method of detecting a nucleic acid interaction, the method comprising: a) providing a first and second nucleic acid sequence which are complementary to each other over at least a portion of their sequence, wherein the first and second nucleic acid sequence are kinetically trapped and therefore unable to substantially hybridize with each other; b) providing a third nucleic acid sequence which is substantially complementary to either the first nucleic acid sequence, the second nucleic acid sequence, or both, over at least a portion of its sequence; c) allowing the third nucleic acid sequence to interact with either the first nucleic acid sequence, the second nucleic acid sequence, or both, wherein said interaction leads to strand displacement of either the first nucleic acid sequence, the second nucleic acid sequence, or both, therefore kinetically freeing the first, second, or both nucleic acids; d) allowing the first and second nucleic acid sequences to substantially interact with each other, wherein once they interact with each other, they are no longer able to substantially interact with the third nucleic acid; and e) detecting the interaction between the first and second nucleic acid sequences, further wherein the first and second nucleic acid sequences are enzymatically produced RNA.

For example, in Figure 1, there is a first nucleic acid sequence (HI) and a second nucleic acid sequence (H2) which are kinetically trapped. They are kinetically trapped because they are in a hairpin formation, which means that at least a portion of the nucleic acid sequence is not available for hybridization. It is noted that Figure 1 is illustrative only, as there are many other examples of different circuits which can comprise the systems disclosed herein.

At least a portion of either the first or second nucleic acid sequences, or both, are complementary to the third nucleic acid sequence. By complementary is meant that the nucleic acid sequences are able to hybridize with one another over at least a portion of their sequence.

By a "portion" is meant 2, 3, 4 ,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides are capable of hybridization with each other. An example of the third nucleic acid sequence is portrayed as CI in Figure 1, which is capable of hybridizing to a portion of HI and/or H2 at a toehold region. Once CI interacts with HI and/or H2, HI and/or H2 are

"switched" sot that they become accessible for hybridization in the region which was previously kinetically trapped. Once this occurs, the first and second nucleic acid sequence (such as HI and H2 in Figure 1) become free to interact (hybridize) with one another. Once the first and second nucleic acid sequences hybridize with one another, they are no longer available to hybridize with the third nucleic acid sequence (CI in Figure 1).

Any of the first, second, and third nucleic acid sequences disclosed herein can be RNA. Preferably, all three of the nucleic acid sequences are RNA. The nucleic acids can also be enzymatically produced. For example, ribozyme-containing transcription template scaffolds can be engineered to enable enzymatic co-transcriptional synthesis of RNA circuits that can operate without any post-synthetic separation or re-folding of individual circuit components. In one example, the RNA is not chemically synthesized, meaning that it is enzymatically produced. The nucleic acid sequences can therefore be co-transcribed, meaning they are transcribed without the need for chemical synthesis.

The system disclosed herein can operate in a continuous circuit without intervention, for example. By "without intervention" is meant that at least two or more of the steps disclosed herein can be carried out without the need for human interaction with the system. For example, the co-transcription component and the system itself can operate without input from the outside. In other words, it can be self-contained and self-sustaining. Alternatively, the system can function with minor intervention, such as with the simple addition of aliquots, buffer, or reporter, for example. In one example, the system can be carried out without strand purification.

There are multiple examples of circuits which are useful with the present systems and methods. Some examples include, but are not limited to, catalytic hairpin assembly (referred to herein as CHA), hybridization chain reaction, various duplex RNA components, such as see-saw gates, hammerhead ribozymes, or tripartite riboswitches.

The third nucleic acid sequence is also referred to herein as the initiator. The initiator can be, for example, a nucleic acid that is to be detected in a sample or a portion of a nucleic acid that is to be detected. In this case, the sequence of the third nucleic acid is taken into consideration in designing the first and second nucleic acid sequences. For example, the complementary region of either the first or second nucleic acid sequences, or both, are designed to be complementary to a portion of the third nucleic acid sequence, which can be the target. In other embodiments, the third nucleic acid sequence comprises at least a portion of a nucleic acid that is part of a "initiation trigger" such that the third nucleic acid sequence, or initiator, is made available when a predetermined physical event occurs. For example, that predetermined event can be the presence of an analyte of interest. However, in other

embodiments the predetermined event may be any physical process that exposes the initiator. For example, and without limitation, the initiator may be exposed as a result of a change in temperature, pH, the magnetic field, or conductivity. In each of these embodiments the initiator is preferably associated with a molecule that is responsive to the physical process. Thus, the initiator and the associated molecule together form the initiation trigger. For example, the initiator may be associated with a molecule that undergoes a conformational change in response to the physical process. The conformational change would expose the initiator and thereby stimulate hybridization of the first and second nucleic acid sequences, which would have previously been kinetically trapped. In other embodiments, however, the initiation trigger comprises a single nucleic acid. The initiator region of the nucleic acid is made available in response to a physical change. For example, the conformation of the initiation trigger may change in response to pH to expose the initiator region.

The structure of the trigger is preferably such that when the analyte of interest is not present (or the other physical event has not occurred), the initiator is not available to hybridize with either the first or second nucleic acid sequence, or both. Analyte frees the initiator such that it can interact with the first or second, or both, nucleic acid sequences, as described above. In some embodiments analyte causes a conformational change in the trigger that allows the initiator to interact with the first or second nucleic acid sequences, or both.

The initiator may be part of a trigger comprising a nucleic acid that is linked to or associated with a recognition molecule, such as an aptamer, that is capable of interacting with an analyte of interest. The trigger is designed such that when the analyte of interest interacts with the recognition molecule, the initiator is able to stimulate interaction between the first and second nucleic acid sequences. Preferably, the recognition molecule is one that is capable of binding the analyte of interest.

Recognition molecules include, without limitation, polypeptides, such as antibodies and antibody fragments, nucleic acids, such as aptamers, and small molecules. The use of an initiator bound to an aptamer is described in more detail below. The recognition molecule can be a single-stranded DNA amplicon.

In some particular embodiments, amplification of diverse recognition events is achieved by coupling the system disclosed herein to nucleic acid aptamer triggers. An aptamer is identified that is able to specifically bind an analyte of interest. The analyte is not limited to a nucleic acid but may be, for example, a polypeptide or small molecule. The aptamer is linked to a nucleic acid comprising a third nucleic acid in such a way that the third nucleic acid sequence (the initiator) is unavailable to interact with the first or second nucleic acid sequence in the absence of analyte binding to the aptamer.

Preferably, conformational changes in the aptamer secondary structure expose the initiator segment of the third nucleic acid sequence. In one example, such an aptamer trigger is a hairpin nucleic acid that comprises an initiator segment that is complementary to the initiator complement region or sticky end of the first or second nucleic acid sequence. The aptamer trigger also comprises a complementary region that is complementary to a region of the first or second nucleic acid sequence, or both, adjacent to the sticky end, a loop region and an aptamer sequence. The hairpin aptamer trigger may also comprise a region that enhances the stability of the hairpin in the absence of aptamer binding to the analyte, such as a nucleic acid region in one arm of the hairpin that is complementary to a region of the other arm.

Hybridization between the first and second nucleic acid sequence is readily detectable by methods known to one of skill in the art for the detection of nucleic acids, including, for example, agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary

electrophoresis, and gel-filled capillary electrophoresis. As the polymers comprise nucleic acids, they can be visualized by standard techniques, such as staining with ethidium bromide. Other methods also may be suitable including light scattering spectroscopy, such as dynamic light scattering (DLS), viscosity measurement, colorimetric systems and fluroscence spectropscopy.

The system disclosed herein can be used to transduce signals into a sequence-specific reporter. For example, the signal can trigger hybridization between the first and second nucleic acid sequence, which can be detectable by a sequence-specific reporter. For example, hybridization between the first and second nucleic acid can be monitored by fluorescence resonance energy transfer (FRET). Certain sequences are labeled with fluorescent dyes so that conformational changes resulting from hybridization between the appropriate strands can be monitored by detecting changes in fluorescence. RNA aptamers are known that bind fluorophores resembling the fluorophore in GFP. These RNA-fluorophore complexes create a palette that spans the visible spectrum. An RNA-fluorophore complex, termed Spinach, resembles enhanced GFP and emits a green fluorescence comparable in brightness with fluorescent proteins. Spinach is markedly resistant to photobleaching, and Spinach fusion RNAs can be imaged in living cells. Because the number of hybridized products is inversely related to the amount of the target analyte in a sample, analyte concentration can be determined using the methods disclosed herein. The average molecular weight of the hybridization product of the first and second nucleic acid sequence, when hybridized together, is obtained by standard measurements.

The system disclosed herein can take place in solution, on solid platforms such as paperfluidics, or in vivo. The hybridization reaction can be detectable in real time, for example. The ability to co-transcriptionally generate nucleic acid circuits allows for long-term circuit storage in the form of double-stranded transcription templates from which circuits can be synthesized in real-time or as needed during diagnostic application. By "long period" is meant days, weeks, months, or years in storage. One of skill in the art can readily determine how to store such a system for long-term use. The methods and systems disclosed herein allow for long term storage while still retaining functionality. By "functionality" is meant that the system retains its ability to function when used.

Nucleic acid computing (or I/O computing) is a form of computing which uses nucleic acids, biochemistry and molecular biology, instead of the traditional silicon-based computer technologies. Nucleic acid computing, or, more generally, biomolecular computing, is a fast developing interdisciplinary area. Research and development in this area concerns theory, experiments, and applications of nucleic acid computing. The systems and methods disclosed herein can be used in I/O computation.

Also disclosed herein are kits for the detection of an analyte in a sample, the kit comprising: at least three different nucleic acid sequences, wherein the first and second nucleic acid sequences are complementary to each other over at least a portion of their sequence, but are unable to substantially hybridize to each other unless they are in the presence of a third nucleic acid, and wherein once the first and second nucleic acids hybridize with each other, the third nucleic acid is no longer able to substantially hybridize with either the first or the second nucleic acid, and further wherein the first and second nucleic acid sequences are enzymatically- produced RNA. In one example, either the first nucleic acid sequence, the second nucleic acid sequence, or both, comprise one or more mismatches in an area in which the first and second nucleic acid sequences are complementary to each other.

Mismatch Technology

Nucleic acid circuits have been shown to execute non-specifically, even in the absence of particular inputs. Specifically, unintended duplexes occur because DNA naturally "breathes" and when the double-stranded end of one hairpin "breathes," it results in a temporarily single- stranded hairpin end that can react with the single-stranded loop of another hairpin. The introduction of a mismatch into the hairpin sequence does not deter breathing but does forestall hairpin duplex assembly. This background leakage is characterized by an initial burst of signal followed by a steady-state, non-catalyzed rate of circuit execution. It was previously found that the rate constant of the steady-state leakage of a typical CHA circuit was about 200 M-ls-1 while the corresponding catalytic rate with 5 nM catalyst was 4000 M-ls-1. While the 20-fold enhancement observed in the catalytic rate allowed for robust signal detection, any

accompanying background leakage can potentially make quantitation of lower concentrations of inputs more difficult. For example, it was found that while CHA circuits can be designed for a variety of sequence targets and applications, the signal-to-noise ratio for these circuits (that is, the catalyzed reaction relative to the uncatalyzed reaction) seldom exceeds 100-fold.

The background leakage can be attributed to a number of factors, including the purity of DNA samples and the mis-folding of nucleic acids into alternative conformers. Underlying many of these mechanisms, though, is the uncatalyzed binding of an otherwise occluded toehold to its hybridization partner, the subsequent initiation of strand exchange, and the continued propagation of the hairpin assembly reaction. For example, when the kinetically trapped hairpin substrates in CHA 'breathe' they inadvertently reveal binding sites that can then initiate CHA even in the absence of a catalyst strand.

In order to reduce the prevalence of uncatalyzed strand exchange, it was determined that it is possible to 'block' either the revealed, inadvertent binding reaction and / or its continuation as a strand exchange reaction. In turn, the simplest way to introduce a block was to introduce mismatched nucleotides into the regions thought to breathe and / or adjacent positions that might be involved in strand exchange. Since the ends of helices are more likely to 'breathe' than internal base-pairs, mismatches were introduced into these portions of the hairpin substrates (Example 2).

Disclosed herein is a method of detecting nucleic acid interaction, comprising: a) designing a first and second nucleic acid sequence which are complementary to each other over at least a portion of their sequence, wherein either the first nucleic acid sequence, the second nucleic acid sequence, or both, comprise one or more mismatches in the portion in which the first and second nucleic acid sequences are complementary to each other, and further wherein the first and second nucleic acid sequence are kinetically trapped and therefore unable to substantially hybridize with each other; b) providing a third nucleic acid sequence which is substantially complementary to either the first nucleic acid sequence, the second nucleic acid sequence, or both, over at least a portion of its sequence; c) allowing the third nucleic acid sequence to interact with either the first nucleic acid sequence, the second nucleic acid sequence, or both, wherein said interaction leads to strand displacement of either the first nucleic acid sequence, the second nucleic acid sequence, or both, therefore kinetically freeing the first, second, or both nucleic acids; d) allowing the first and second nucleic acid sequences to substantially interact with each other, wherein once they interact with each other, they are no longer able to substantially interact with the third nucleic acid; and e) detecting the interaction between the first and second nucleic acid sequences.

The first and second nucleic acid sequences can be any nucleic acid. In one example, they are enzymatically-produced RNA. The method can be carried out in a nucleic acid circuit, such as CHA, or one of the other nucleic acid circuits disclosed herein, such as hybridization chain reaction (HCR). In one embodiment, the third nucleic acid sequence is able to hybridize with the first nucleic acid sequence, second nucleic acid sequence, or both, when an analyte is present in the sample. Examples of analytes, aptamers, and initiators and initiator triggers are discussed herein.

Either the first nucleic acid sequence, the second nucleic acid sequence, or both, can comprise two or more mismatches. For example, the first, second, or both nucleic acid sequence can comprise 2, 3, 4, 5 ,6 ,7, 8, 9, or 10 or more mismatches. The mismatch(es) can reduce hybridization between the first and second nucleic acid when they are not in the presence of the third nucleic acid. For example, the mismatch(es) can reduce hybridization between the first and second nucleic acid by at least 10 fold. In one example, the two or more of the mismatches can be consecutive. Alternatively, they can be spaced so that they are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more nucleobases away from each other. Alternatively, the mismatch can comprise an addition or deletion to one or more of the first or second nucleic acid sequences.

In one example, the mismatches are intentionally engineered into the nucleic acid sequence. One of skill in the art can appreciate how such a mismatch can be engineered. For example, in the design of the first and second nucleic acid sequences, one can design such sequences so that they are perfectly matched, or complementary over 100% of their sequence. One can then intentionally design a mismatch in said sequences, in which one or more of the nucleotide bases are no longer perfectly matched, but a mismatch is created.

Hybridization/selective hybridization

The term hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene. Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide. The hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.

Parameters for selective hybridization between two nucleic acid molecules are well known to those of skill in the art. For example, in some embodiments selective hybridization conditions can be defined as stringent hybridization conditions. For example, stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps. For example, the conditions of hybridization to achieve selective hybridization may involve hybridization in high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 12-25°C below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5°C to 20°C below the Tm. The temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations. The conditions can be used as described above to achieve stringency, or as is known in the art. (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989;

Kunkel et al. Methods Enzymol. 1987: 154:367, 1987 which is herein incorporated by reference for material at least related to hybridization of nucleic acids). A preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 68°C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68°C. Stringency of hybridization and washing, if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for. Likewise, stringency of hybridization and washing, if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.

Another way to define selective hybridization is by looking at the amount (percentage) of one of the nucleic acids bound to the other nucleic acid. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75,

76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is bound to the non-limiting nucleic acid. Typically, the non- limiting primer is in for example, 10 or 100 or 1000 fold excess. This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10 fold or 100 fold or 1000 fold below their kd, or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their

Another way to define selective hybridization is by looking at the percentage of primer that gets enzymatically manipulated under conditions where hybridization is required to promote the desired enzymatic manipulation. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer is enzymatically manipulated under conditions which promote the enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then selective hybridization conditions would be when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer molecules are extended. Preferred conditions also include those suggested by the manufacturer or indicated in the art as being appropriate for the enzyme performing the manipulation.

Just as with homology, it is understood that there are a variety of methods herein disclosed for determining the level of hybridization between two nucleic acid molecules. It is understood that these methods and conditions may provide different percentages of hybridization between two nucleic acid molecules, but unless otherwise indicated meeting the parameters of any of the methods would be sufficient. For example if 80% hybridization was required and as long as hybridization occurs within the required parameters in any one of these methods it is considered disclosed herein.

It is understood that those of skill in the art understand that if a composition or method meets any one of these criteria for determining hybridization either collectively or singly it is a composition or method that is disclosed herein.

Examples

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary and are not intended to limit the disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric.

Example 1: Design and Application of Co-Transcriptional, Non-Enzymatic RNA Circuits and Signal Transducers

MATERIALS AND METHODS

Reagents, oligonucleotides and transcription templates unless otherwise indicated, all molecular-biology-grade chemical reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA). Acrylamide was purchased from Bio-Rad (Hercules, CA, USA).

All oligonucleotides were obtained from Integrated DNA Technologies (IDT, Coralville, IA, USA). Oligonucleotides were re-suspended at 100 GM concentration in TE (10:0.1) buffer (10 mM Tris-HCl, pH 7.5, 0.1 mM EDTA, pH 8.0) and stored at -20 °C. The concentrations of the DNA and RNA suspensions were measured by UV spectrophotometry using the NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). All transcription templates were built using DNA oligonucleotides obtained from IDT. Short transcription templates (< 60 bp) were initially prepared by annealing two completely complementary oligonucleotides that were mixed in equimolar concentration in TE (10:0.1) buffer containing 50 mM NaCl. The oligonucleotides further underwent denaturation for 5 min at 95 °C before being annealed via slow cooling (0.1 °C/s) to 25 °C; this last step was performed in order to ensure higher yield and greater structural uniformity. Annealed oligonucleotides were quantitated and used directly for in vitro transcription reactions and excess was stored at -20 °C. Longer transcription templates were sequentially assembled from sets of shorter overlapping oligonucleotides by

oligonucleotide annealing, primer extensions, and PCR reactions. Site-directed mutagenesis was performed by overlap PCR using mutagenic primers. All DNA enzymatic amplification reactions were performed using highfidelity Phusion DNA polymerase (New England Biolabs (NEB), Ipswich, MA, USA) or Taq DNA polymerase (NEB), according to the manufacturer's protocols. In some cases, fully assembled transcription templates were subjected to A-tailing by Taq DNA polymerase (NEB). All DNA fragments were either purified using Wizard SV gel and PCR clean-up columns (Promega, Madison, WI, USA) or subjected to agarose gel purification prior to TOPO-TA cloning into a pCR2.1TOPO plasmid, according to the manufacturer's instructions (Life Technologies, Carlsbad, CA, USA). Cloned plasmids were selected and maintained in an E. coli Top 10 strain. All transcription templates were verified by sequencing at the Institute of Cellular and Molecular Biology Core DNA Sequencing Facility.

For performing in vitro run-off transcription, transcription templates cloned in a pCR2.1- TOPO vector were amplified from sequenced plasmids by PCR using Phusion DNA polymerase. Primers pCR2.1.F and pCR2.1.R specific to the plasmid sequences flanking the insert were used for the amplification of ribozyme-containing transcription templates to ensure uniformity of transcription. For some experiments, RNA CHA circuit components H1B, H2, and CI were amplified using primers complementary to the exact ends of the cloned inserts

(HlB.amp.F:HlB.amp.R, H2.amp.F:H2.amp.R, and Cl.amp.F:Cl .amp.R, respectively) rather than the flanking plasmid. Spinach. ST 1 transcription templates were amplified using a primer (pCR2. IF) specific to the flanking plasmid sequence at the 5 '-end to maintain uniformity of transcription and a primer (sphT.U.R) specific to the sequence right at the 3 '-end of Spinach. ST 1 to prevent the incorporation of additional nucleotides. PCR products were analyzed by agarose gel electrophoresis and then purified using the Wizard SV gel and PCR Clean-up system, according to the manufacturer's instructions (Promega, Madison, WI, USA).

Circuit design

All RNA structures, circuit designs, and interactions were analyzed using NUPACK (Zadeh (2011), Dirks (2007), Dirks (2003), Dirks. (2004)). RNA was analyzed at different temperatures using the Serra and Turner, 1995 RNA energy parameters with some Dangle treatment. Free energy comparisons of RNA and DNA sequences were performed with the same parameters; considering that the NUPACK default for RNA sequences is 1 M Na+ concentration (and zero Mg2+ concentration), DNA tests were run with the same concentration.

In vitro transcription

100 pg to 1000 ng of double-stranded DNA transcription templates were transcribed using 100 units of T7 RNA polymerase (NEB) in 50 Gl reactions containing 40 mM Tris-HCl, pH 7.9, 30 mM MgC12, 10 mM DTT,2 mM spermidine, 4 mM ribonucleotide (rNTP) mix, and 20 units of the recombinant ribonuclease inhibitor RNaseOUT (Life Technologies).

Transcription reactions were incubated at 42 °C for 1 to 2 h. After this, transcripts of the circuit components were either (i) used directly for assembly or (ii) subjected to purification prior to assembly. Transcripts intended for purification were either filtered through Sephadex G25 using the Illustra MicroSpin G-25 columns, according to the manufacturer's instructions (GE

Healthcare, Piscataway, NJ, USA), or run through RNA gel purification. Specifically, these latter transcripts were treated with 2 units of DNase I (Epicentre Biotechnologies, Madison, WI, USA) at 37 °C for 30 min to degrade the template DNA prior to RNA gel purification. Any RNA not used directly for circuit assembly was stored for short durations at -20 °C while long term storage was done at -80 °C.

Denaturing poly aery lamide gel electrophoresis and RNA gel purification 10% polyacrylamide gels containing 7 M urea were prepared using 40% acrylamide and bis -aery lamide solution, 19: 1 (Bio-Rad) in IX TBE buffer (89 mM Tris Base, 89 mM Boric acid, 2 mM EDTA, pH 8.0) containing 0.04% ammonium persulphate and 0.1% TEMED. An equal volume of 2X denaturing dye (7 M urea, IX TBE, 0.1% bromophenol blue) was added to the RNA samples. These were incubated at 65 °C for 3 min followed by cooling to room temperature before electrophoresis. A ssDNA ladder prepared by mixing 20 nt-, 42 nt-, 66 nt-, and 99 nt-long oligonucleotides was included as a size marker. The gels were stained for 10 min with SYBR-Gold (Life Technologies) prior to visualization on the Storm Imager (GE

Healthcare). For RNA purification, desired bands were excised from the gel and the RNA was eluted twice into TE (10: 1) buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH 8.0) and incubated at 70 °C and 1000 rpm for 20 min. Acrylamide traces were removed by filtering eluates through Ultrafree-MC centrifugal filter units (EMD Millipore, Billerica, MA, USA) followed by precipitation with 2X volume of 100% ethanol in the presence of both 15 Gg GlycoBlue (Life Technologies) and 0.3 M sodium acetate, pH 5.2. RNA pellets were washed once in 70% ethanol. Dried pellets of purified RNA samples were resuspended in 0.1 mM EDTA and stored at -80 °C.

Native polyacrylamide gel analysis of RNA circuits

200 nM each of gel-purified HI and H2 and 5 nM of gel purified CI were used to set up 15 Gl RNA CHA reactions in 0.2 ml PCR tubes. All RNA components were thawed from -80 °C storage and diluted to the desired stock concentrations in 0.1 mM EDTA without refolding. Reactions were assembled at 4 °C by mixing circuit components in the indicated combinations in IX TNaK buffer (20 mM Tris-HCl, pH 7.5, 140 mM NaCl, 5 mM KCl) containing 20 units of RNaseOUT. HI was added last to the assembled reactions which were then incubated for 2.5 h in thermocyclers maintained at 42 °C, 52 °C or 62 °C. Following incubation, 10 Gl of 50% glycerol was added to each reaction and mixed by pipetting. 15 ng of CI alone was similarly prepared as a loading control. All samples were then electrophoresed at room temperature on a native 10% polyacrylamide gel in IX TBE. A mixture of ssDNA and bromophenol-containing loading dye was used as a size marker. The gels were stained with SYBR-Gold for 10 min prior to visualization on the Storm Imager.

Real-time fluorimetric quantitation of RNA CHA circuits assembled from gel purified RNA

In most experiments, real-time fluorimetric detection of RNA CHA was performed using a RepF:RepQ duplex DNA FRET reporter. This reporter was prepared by annealing the FAM- labeled fluorescent RepF and quencher RepQ oligonucleotides in a 1 :5 molar ratio in IX TNaK buffer. The oligonucleotides were first denatured for 1 min at 95 °C followed by slow cooling at a rate of 0.1 °C/s to 25 °C in order to generate annealed duplexes that were then stored in the dark at -20 °C. Prior to circuit assembly, all gelpurified RNA was thawed from -80 °C and stored on ice. The refolding of RNA hairpins was deemed unnecessary. The HI and H2 RNA were diluted to working concentrations in 0.1 mM EDTA. The specific (CI) and non-specific (GQ-C1) catalyst RNA were diluted to working concentrations in 0.1 mM EDTA containing 1 GM oligo dT17. Circuits were assembled on ice in 15 Gl reactions by mixing the indicated concentrations of H2 and CI in IX TNaK buffer containing 0.5 GM ROX reference dye (Life Technologies), 20 units of RNaseOUT, and 100 to 400 GM RepF (annealed with 5X excess RepQ). The indicated concentration of HI RNA was added last to the assembled reactions, in order to initiate circuit assembly; circuits were assembled with 50 nM to 400 nM concentrations of HI and H2 RNA while CI concentration ranged between 5 pM to 5 nM. Circuit operation was quantitated in 96-well optically-clear plates in an ABI 7300 real-time PCR machine (Life Technologies) that was programmed to cycle the circuits through 3 min incubations at 52 °C followed by 30 s at 51 °C. Fluorescence data was acquired in the FAM and ROX channels.

Experiments were performed at least in triplicate and groups of data were statistically compared by single-factor ANOVA followed by Tukey's post-hoc analysis.

Real-time fluorimetric quantitation of RNA CHA circuits assembled from co- transcribed RNA

Co-transcriptions were performed using 50 ng each of PCR-amplified HI and H2 transcription templates; the transcriptions were performed both with different concentrations of CI and non-specific catalyst GQC1 template as well as in the absence of any catalyst template. Transcriptions were mediated by T7 RNA polymerase in 50 Gl reactions that were incubated for 1 h at 42 °C. For some experiments, the transcribed RNA was filtered through Sephadex G25 prior to circuit assembly. For other experiments, the cotranscribed RNA was used directly for RNA CHA quantitation. In most experiments, 2 Gl of the cotranscribed RNA components were transferred to IX TNaK buffer containing 0.5 GM ROX reference dye, 20 units of RNaseOUT, and 100 to 400 GM RepF (annealed with 5X excess RepQ). Reactions were assembled on ice in 15 Gl final volumes and analyzed in 96-well optically-clear plates using an ABI 7300 real-time PCR machine that was programmed to cycle the circuits through 3 min incubations at 52 °C followed by 30 s at 51 °C. Experiments were performed at least in triplicate and groups of data were statistically compared first by single-factor ANOVA followed by Tukey's post-hoc analysis. RNA CHA-mediated signal transduction of strand displacement amplification

(SDA)

End-point RNA CHA-mediated signal transduction of low-temperature SDA. Various concentrations of the ssDNA templates TLTRSDA and 1234LTRSDA were amplified in 25 Gl reactions containing IX NEB Buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.9), 100 nM primer PSDA, 200 nM dNTP, 10 units of Nb.BbvCI (NEB), and 6.25 units of Klenow Fragment (3'→5' exo-) (NEB). The reactions were assembled on ice and then incubated at 37 °C for 90 min followed by denaturation for 5 min at 95°C. Samples were then kept at room temperature until end-point signal analysis by RNA CHA. The mHl :H2 RNA CHA circuit was co-transcribed using T7 RNA polymerase with 50 ng each of the PCR amplified hairpin transcription templates. Following 1 h of co-transcription at 42 °C, the mHl :H2 RNA CHA circuits were used for end-point SDA signal transduction either directly (i.e. without purification) or after an initial filtration through Sephadex G25. Five-Gl aliquots of the completed SDA reactions were then incubated in 15 Gl of a signal transduction reaction containing IX TNaK, 0.5 GM ROX reference dye, 20 units if RNaseOUT, and 100 nM RepF (annealed with 5X excess of RepQ). Two-Gl aliquots of the cotranscribed mHl :H2 circuits were then added to these reactions for sequence-specific signal transduction of the SDA samples. Control SDA signal transduction reactions included (i) reactions without the SDA templates, (ii) reactions with 2 Gl of only the mHl or H2 RNA, and (iii) reactions without any of the RNA CHA components. The fully assembled SDA end-point RNA CHA signal transduction reactions were then transferred to 96-well optically-clear plates. The FAM and ROX signals were monitored in real-time using an ABI 7300 real-time PCR machine that was programmed to cycle the reactions through 3 min incubations at 52 °C followed by 30 s at 51 °C.

Real-time RNA CHA-mediated signal transduction of high-temperature SDA. Various concentrations of the ssDNA template 1234HTRSDA were amplified in 20 Gl reactions containing IX NEB Buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.9), 100 nM primer PSDA, 200 nM dNTP, 10 units of Nb.BsrDI (NEB), and 8 units of Bst 2.0 (NEB). For fluorescent quantitation, 0.625 GM ROX reference dye and 75 nM RepF (annealed with 5X excess of RepQ) were included in the reactions. The :H2 RNA CHA circuit was co- transcribed using T7 RNA polymerase from 50 ng each of the PCR-amplified hairpin transcription templates. Following 1 h of co-transcription at 42 °C, the mHl :H2 RNA CHA circuits were used for SDA signal transduction either directly (i.e. without purification) or after an initial filtration through Sephadex G25. Two-Gl aliquots of the mHl :H2 circuits were added to the SDA reactions on ice. Control SDA reactions included (i) reactions without the 1234HTRSDA template, (ii) reactions with 2 Gl of only the mHl or H2 RNA, and (iii) reactions without any of the RNA CHA components. The fully assembled SDA reactions with real-time RNA CHA were then transferred to 96-well optically-clear plates. The FAM and ROX signals were monitored in real- time using an ABI 7300 real-time PCR machine programmed to cycle the reactions through 3 min incubations at 55 °C followed by 30 s at 54 °C.

Real-time quantitation of RNA CHA with sequence-dependent fluorescent RNA aptamer beacon

Use of Spinach. ST 1 RNA aptamer beacon as a sequence-specific signal transducer of RNA CHA. H1B, H2, CI, C2, and Spinach. ST 1 RNA were transcribed separately by T7 RNA polymerase using 500 ng of double-stranded transcription templates. Transcription templates for H1B, H2, and CI were amplified using primers complementary to the exact ends of the cloned inserts (HlB.amp.F:HlB.amp.R, H2.amp.F:H2.amp.R, and Cl.amp.F:Cl .amp.R, respectively) rather than the flanking plasmid. Spinach. ST 1 transcription templates were amplified using a primer (pCR2. l.F) specific to the flanking plasmid sequence at the 5'-end and a primer

(sphT.U.R) specific to the sequence right at the 3 '-end of Spinach.STl . Transcriptions were performed for 2 h at 42 °C followed by filtration of the transcripts through Sephadex G25. RNA CHA reactions with Spinach.STl signal transduction were then performed in 15 Gl reactions containing IX TNaK buffer, 20 units of RNaseOUT, and 70 GM DFHBI. Three-Gl transcription aliquots of each RNA circuit component - including the hairpins H1B and H2, catalysts CI and C2, and reporter Spinach.STl - were added to the CHA reactions as indicated. The reactions were transferred to 384-well flat-bottomed black plates and Spinach.STl fluorescence was measured in a TECAN Safire plate reader (TECAN, Switzerland) maintained at 37 °C.

Comparison of Spinach.STl and DNA FRET reporter duplex for gel-purified RNA CHA quantitation. Gel purified RNA components were used for direct comparison of the efficiency of the two types of fluorescent nucleic acid reporters. The FAM-labeled fluorescent DNA reporter H1B.F was annealed with the quencher oligonucleotide H1B.Q at a 1 :2 molar ratio in IX TNaK buffer. The oligonucleotides were denatured for 1 min at 95 °C and then annealed by slow cooling at a rate of 0.1 °C/s to 25 °C. The RNA components H1B, H2, CI, and Spinach.STl were transcribed by T7 RNA polymerase from 1 Gg each of PCR-generated transcription templates and purified from denaturing polyacrylamide gels. Stored RNA components were thawed from -80 °C and diluted to the desired working concentrations in 0.1 mM EDTA. RNA CHA circuits were assembled from 1 GM each of H1B and H2 RNA in 15 Gl reactions containing IX TNaK buffer and 20 units of RNaseOUT. One set of reactions was quantitated by adding 1 GM HIB.F (annealed with 2X excess of HIB.Q) while a second set was quantitated by adding 1 GM Spinach. ST 1 RNA along with 70 GM DFHBI. Background hairpin assembly was measured in the absence of CI RNA while the efficiency of catalyzed reactions was quantitated by adding different concentrations (between 10 nM to 100 nM) of CI RNA. Reactions were transferred to 384-well flat-bottomed black plates and multi-label fluorescence was captured using a TECAN Safire plate reader maintained at 37 °C.

RESULTS AND DISCUSSION

Designing a RNA-based catalytic hairpin assembly (CHA) circuit

The energetics of RNA circuits are decidedly different than those of a corresponding DNA circuit, since RNA:RNA interactions are much more stable than DNA:DNA interactions (Lesnick (1995)). In order to determine how to best design RNA circuits, the catalytic hairpin assembly reaction was used (Li (2008), Yin (2011)), in which two short hairpin species form a double-stranded product only in the presence of a single-stranded catalyst that can bind to a toehold and initiate strand-exchange (Figure la).

The chemical synthesis of RNA is more complex, more expensive, and more fraught with error than is the chemical synthesis of DNA. It has been found that the imperfections present in chemically synthesized substrates in nucleic acid circuits are a persistent source of noise during their execution (Lesnick (2005)). Therefore, it was chosen to enzymatically transcribe the substrates for RNA circuits, a procedure that may also provide new options for the design and execution of nucleic acid circuitry in general.

An RNA CHA reaction was initially chosen based on DNA CHA reactions that had previously yielded efficient amplification of a single-stranded sequence signal (Yin (2008)). It was hypothesized that the RNA CHA circuit would operate optimally under conditions in which the RNA hairpin free energies were predicted to be similar to that of their DNA counterparts in the parent DNA CHA circuit. A similar hypothesis led to the design of thermostable DNA circuits that can be used for the real-time detection of isothermal amplification reactions (Jiang (2013)). Thus, instead of redesigning the sequences of the circuit the DNA sequence was converted to a RNA sequence (with minor sequence changes to allow hammerhead ribozyme cleavage at the 3 '-end of circuit components) and predicted a new thermal optimum.

However, in order to generate a RNA circuit that could be enzymatically transcribed several design issues had to first be addressed. First, since T7 RNA polymerase is most efficient with a prescribed initiation sequence (Milligan (1987); Rosa (1979)), either the hairpin substrates had to be designed around a relatively limited set of sequences, or some means of removing the 5 ' termini of a hairpin substrate had to be explored. Similarly, the 3 ' ends of RNA transcripts are frequently heterogeneous, with so-called N+l, non-templated additions of adenosine occurring (Milligan (1987), Krupp (1988)), meaning it was desirable to make the ends flush via some processing mechanism. In order to maximize design possibilities and ensure homogeneity in the RNA termini, each RNA substrate was flanked with hammerhead ribozymes (Figure lb), similar to constructs that are frequently used for the preparation of RNA molecules for crystallography (Price (1995); Ke (2004)). Additionally with this design, short transcripts that would result from the abortive cycling of T7 RNA polymerase (Milligan (1987); Martin (1988)) should only contain ribozyme-derived sequences and not domains from the CHA components that could potentially poison the CHA reaction or increase noise. Nascent transcripts undergo co-transcriptional ribozyme self-cleavage to release circuit components with exact 5'- and 3'-ends. The correct-sized substrates can be separated from the processed ribozyme flanks via denaturing polyacrylamide gel electrophoresis (Figure 2a).

When the gel purified hairpins were mixed together, very little reaction was observed, as determined by native polyacrylamide gel electrophoresis (Figure 2b). However, in the presence of the catalyst (CI) RNA input, a CHA reaction and the formation of a double-stranded RNA product was observed at 42 °C and 62 °C, with maximal duplex formation occurring at 52 °C. The in silico analyses had predicted 52 °C to be the optimal operating temperature for the RNA CHA circuit. At this temperature the free energies of the RNA circuit components should be most closely matched with the functional, parental DNA CHA circuit. At lower temperatures the RNA HI and H2 hairpins were predicted to be too stable and this led to a reduced accumulation of assembled HI :H2 duplexes (Figure 2b). At higher temperatures the hairpins were unstable and background H1 :H2 duplex assembly in the absence of catalyst increased (Figure 2b). These results confirm that the design principles previously developed for optimizing performance with respect to temperature can also be used to optimize performance with respect to chemistry (the difference between DNA and RNA). In short, the free energy of base-pairing is the fundamental parameter for designing functional circuits. A similar set of considerations has led Zhang et al. to rules for optimizing toehold lengths for triggering strand exchange (Zhang (2004)).

Characterization of RNA CHA circuit kinetics

For real-time quantitative analysis of catalyzed H1 :H2 assembly a previously described DNA FRET probe (RepF:RepQ) was used that was prepared by annealing a 5'-FAM-labeled strand (RepF) to an oligonucleotide that had been 3 '-end labeled with the Iowa Black FQ quencher (RepQ) (Figure la, Table 2). Assembly of the H1 :H2 duplex exposes domain 2* that is otherwise sequestered within the stem of free HI. This domain then acts as a toehold to initiate displacement of the RepQ strand from the RepF: RepQ duplex, ultimately resulting in increased RepF fluorescence. Real-time fluorescence quantification during R A CHA circuit operation revealed that 5 nM CI RNA could catalyze rapid accumulation of H1 :H2 RNA duplexes at 52 °C with reactions approaching completion by 2 h (Figure 3a). The RNA circuit consistently detected picomolar concentrations of the catalyst sequence with a median amplification of 87- fold, similar to that previously observed for the DNA CHA counterpart (Li (2011)).

The kinetics of catalyzed and uncatalyzed RNA CHA were measured using varying concentrations of gel-purified substrates HI and H2 in the presence or absence of 2.5 nM gel purified CI (Figures 3b and 3c). Depending on the concentration of the substrates HI and H2, catalyzed CHA proceeded from 20- to 237-fold faster initial rates when compared to uncatalyzed reactions (Table 1). For any given H2 concentration the initial catalyzed reaction rate increased with increasing HI concentration. On the other hand at any given HI concentration the initial rate increased with increasing H2 concentration only until the concentrations of HI and H2 were equivalent. Excess H2 generally resulted in reduced catalytic rates, possibly because uncatalyzed background hybridization between HI and H2 removed HI from the cascade. The strong dependence of the catalytic rate on HI concentration suggests that the H1 :C1 interaction is a rate-limiting step for this circuit. With HI and H2 concentrations ranging from 50 to 300 nM and 100 to 400 nM, respectively, turnover rates (v/[Cl]) of the RNA CHA circuit were measured to be between 0.2 to 1/min (Figure 3b). This implies that the RNA circuit can be operated to produce 12-60 product units (H1 :H2 duplex) per molecule of CI per hour. This range is similar to that previously achieved with a DNA CHA circuit (Li (2011)).

Co-transcriptional synthesis of a RNA CHA circuit

It was hypothesized that the ribozyme end-processed RNA components HI and H2 might fold during transcription to create kinetic traps, without the need for additional purification. This hypothesis was based in part on an understanding of the fact that RNA folds sequentially and locally during transcription (Meyer (2004)). In keeping with this hypothesis, the co- transcriptional self-cleavage of both the flanking hammerhead ribozymes in the HI, H2 and CI RNAs (Figure 2a) suggested that proper ribozyme structures were sequentially formed during in vitro transcription. In order to test this hypothesis, 50 ng of PCR-generated transcription templates of HI and H2 were cotranscribed in 50 Gl reactions in the absence or presence of varying amounts of a CI transcription template. Following 1 h transcription at 42 °C, the reactions and all transcribed species were filtered through Sephadex G25. The FRET probe RepF:RepQ was added to an aliquot of the eluate to monitor circuit output (H1 :H2 duplex). The RNA CHA reaction was then carried out at 52 °C in IX TNaK buffer (Figure 4a). It was observed that co-transcribed HI and H2 showed some reaction in the absence of a catalyst, but could undergo much more robust amplification in the presence of co-transcribed catalyst. As controls, transcription reactions lacking T7 RNA polymerase failed to synthesize the circuit and did not activate the reporter, while co-transcription of non-specific catalyst sequences also failed to catalyze RNA CHA. Uncatalyzed HI :H2 duplex assembly was unacceptably high in co-transcribed circuits, and resulted in end-point signal-to-noise ratios of only between 1 and 1.6. It was believed that separating nucleation of toehold interactions from propagation of these interactions might be a way to disrupt uncatalyzed noise resulting from the random breathing or opening of hairpins. The distal ends of the hairpin stems were predicted to be least stable such that the first few bases in H2 domain 4 and HI domain 2 might be transiently single-stranded due to RNA structural breathing. These bases might therefore function as a weak toehold that led to unintended, non-catalyzed base-pairing with the already single-stranded loop domains of HI (domain 4*) and H2 (domain 2*) and in turn to H1 :H2 assembly. To test this hypothesis mutant HI was generated that had a single-stranded loop domain 4* that contained either a 2 base (mHl) or 1 base (mAHl and mGHl) mismatch with stem domain 4 of H2 (Figure 4b). The mutant hairpins were designed so as to achieve the strongest mismatches while keeping the domain GC content unaltered. Similarly, a mutant H2 hairpin (m2H2) was designed whose single-stranded loop domain 2* contained a 2 base mismatch with the stem domain 2 of HI (Figure 4c).

The activities of mutated hairpins in CHA reactions that employed gel-purified RNA reactants and catalysts (Figures 5 and 6) were compared. The catalytic rates of CHA circuits mHl :H2, mAHl :H2 and mGHl :H2 were not significantly different from that of the wild-type H1 :H2 circuit (Figures 5a and 5c). However, the non-catalyzed background rate of RNA duplex assembly was significantly reduced for mHl, mAHl, and mGHl -containing circuits. The 2 base mismatch-containing mHl showed the most reduction (7-fold) in non-catalyzed hairpin assembly, whereas ca. 3 -fold reduction in background was achieved with both mAHl and mGHl (Figures 5b and 5d). The Hl :m2H2 circuit also demonstrated a significant 7-fold reduction in non-catalyzed assembly of hairpin duplexes (Figure 6). These results generally demonstrate that impairing the formation of transient toeholds at the ends of HI and H2 stems significantly reduces uncatalyzed duplex assembly while still maintaining catalytic hairpin assembly rates similar to those achieved with the original, perfectly paired HI and H2 substrates.

It was also sought to determine how mismatched hairpins impacted signaknoise under co-transcription conditions. Fifty nanograms of the various hairpins 1 and 2 were co-transcribed with or without 10 ng of the CI transcription template. The mHl :H2 and Hl :m2H2 CHA circuits operated with statistically similar initial rates of catalyzed hairpin assembly compared to the HI :H2 circuit, and the initial rate of uncatalyzed hairpin assembly for the HI :m2H2 circuit under co-transcription conditions was also similar to that observed with the H1 :H2 circuit. However, a statistically significant 13 to 15-fold reduction in the initial rate of background hairpin assembly in the mHl :H2 circuit compared to both the HI :H2 and HI :m2H2 circuits

(Figure 7) was observed. Co-transcriptionally generated H1 :H2 and mHl :H2 RNA CHA circuits remained fully functional even without purification through Sephadex G25 with the best signaknoise ratios again being observed with the mHl :H2 circuits (Figure 8a). Based on these initial results, performance of the mHl :H2 circuit was compared in greater detail with the H1 :H2 circuit using varying catalyst concentrations with both gel-purified RNA as well as cotranscribed circuits. Under most conditions tested the mHl :H2 and H1 :H2 circuits showed comparable catalytic rates while the background hairpin assembly remained minimal in the mHl :H2 circuit. With gel-purified H1 :H2 and mHl :H2 circuits initial rates of 0.1/min, 0.02/min, and 0.01/min were observed during the first 10 min of catalysis in the presence of 5 nM, 1 nM, and 0.5 nM pure CI, respectively. The co-transcribed HI :H2 and mHl :H2 circuits that were triggered by cotranscription of 1 ng of CI also demonstrated comparable initial catalytic rates of 0.01/min (background subtracted).

The results demonstrate that strand displacement does not appear to be hindered by having to 'leap' one or two mismatches (see Figures 5-7). The strategic introduction of mismatches has allowed us to co-transcriptionally synthesize RNA CHA circuits that operate with minimal non-catalyzed background duplex assembly while demonstrating highly sequence- specific catalytic response. Designed mismatch placement may prove to be a generalizable means of decreasing noise in nucleic acid circuits.

Transcribing RNA signal transducers for nucleic acid diagnostics

Non-enzymatic nucleic acid amplification circuits have recently been adapted into novel diagnostic tools for sequence-specific detection of amplicons generated by enzymatic amplification (Jiang (2013), Li (201 1)). These nucleic acid devices function not only in solution but also operate on solid surfaces such as paper (Allen (2012)).

The use of co-transcriptionally-generated RNA circuits as similar transducers might further simplify the production of nucleic acid circuits for point-of-care applications; instead of producing, purifying, and storing multiple kinetically trapped nucleic acid substrates, double- stranded transcription templates could generate these substrates on the fly.

However, since RNA:RNA base pairs are typically more stable than DNA:RNA base pairs, the RNA circuitry must be carefully designed to ensure that DNA amplicons can strand invade and trigger the CHA reaction. To determine the feasibility of using RNA circuits for detecting single stranded (ss) DNA amplicons adapting RNA CHA to a well-known isothermal amplification method was attempted for strand displacement amplification (SDA). DNA CHA circuits have been previously used for the real-time, sequence-specific detection of SDA amplicons (Jiang (2013)), and these DNA circuits were used as starting points for the design of their RNA counterparts. A template that could generate multiple ssDNA amplicons

corresponding to the CHA catalyst CI (with a 5'-[3*][2*][l *]-3 ' domain architecture, see Figure 1) was used as the initial analyte for detection.

Isothermal amplification by SDA led to the accumulation of ssDNA copies of CI, which in turn could be used to trigger the co-transcribed RNA CHA circuit. The accumulated SDA products (generated upon 90 min of amplification in the absence or presence of 10 nM template) were denatured for 5 min at 95 °C and then added to either co-transcribed, unpurified HI and H2 hairpins or to hairpins purified via Sephadex G25 size exclusion chromatography. Amplicon detection and circuit performance were monitored at 52°C using 100 nM RepF pre-annealed to an excess of RepQ.

Although the RNA version of CI catalyzed hairpin assembly of co-transcribed mHl :H2 RNA CHA circuit, the SDA-generated ssDNA CI failed to activate the RNA circuit. This result suggested that the DNA catalyst might be inefficient at strand displacement. To overcome this hypothesized barrier the DNA catalyst (CI 234) was extended at its 5 '-end by the addition of a second 8 bp toehold specific for the mHl single-stranded loop (Figure 8b). The increased stability and stacking energy from two toeholds on either flank of the branch migration domains might overcome the energy barrier for displacing a RNA strand. Furthermore, upon binding of the extended DNA catalyst to the first toehold in the mHl loop even partial exchange of the adjacent mHl RNA stem by the DNA catalyst might expose enough domain 3* for productive interactions with H2.

To test this hypothesis unpurified or column-purified, co-transcribed mHl :H2 RNA CHA circuit was incubated with end-point SDA reaction products generated in the presence or absence of 10 nM template 1234LTRSDA whose amplification leads to accumulation of the extended ssDNA catalyst designated C1234. SDA-generated C1234 ssDNA catalyst (with a 5'- [4][3*][2*][1 *]-3' domain architecture) was in fact capable of catalyzing the reaction of the mHl :H2 RNA CHA circuit and led to an increase in fluorescence over time (Figure 9a). As expected, SDA reactions incubated without specific template failed to activate the RNA CHA circuit. Hairpin mHl alone (which contained fluorescent reporter binding domains) yielded some signal when incubated with the SDA-generated CI 234 ssDNA catalyst, but the signal was greatly increased due to catalytic amplification in the presence of co-transcribed H2. Thus, while some catalyst-specific signal was generated just due to mHl -mediated interactions with the reporter, the majority of signal was generated due to C1234-catalyzed initiation of RNA CHA.

The RNA CHA circuitry could also be used for the real-time detection of SDA. Since the optimal operating temperature of the mHl :H2 RNA CHA circuit was 52 °C the model

1234LTRSDA template described above was further modified to include a nicking site for a thermo endonuclease (Nb.BsrDI). The 1234HTRSDA template was used in SDA reactions along with a previously cotranscribed mHl :H2 RNA CHA circuit added directly to the SDA reactions without purification.

Irrespective of the degree of purification, the RNA CHA circuit could accurately report the real-time accumulation of C1234 SDA amplification products (Figure 9b). As low as 1 nM template DNA could be readily detected in real-time. These results show that RNA CHA is a viable sequence-specific signal transducer that can be adapted for detection the end-point or real-time detection of single-stranded DNA targets and amplicons. The simplicity of generating large quantities of RNA circuits via one pot enzymatic co-transcription without purification or re-folding make RNA circuits an attractive alternative for not only diagnostic applications but also for the construction of more complex computational circuitry. Transcriptional generation of an RNA amplifier circuit and a fluorescent RNA reporter

The results demonstrated that co-transcriptionally generated RNA circuits could execute with minimal background. RNA CHA was adapted to function as a reporter for isothermal amplification reactions. These adaptations of RNA CHA have required that oligonucleotides bearing a fluor and quencher pair be added to the reaction. In order to further simplify the transduction scheme, a 'label free' fluorescent RNA signal transducer was used that could be generated by transcription alone for quantitation of RNA CHA reactions. A RNA aptamer (Spinach) has been reported that binds to the fluorophore DFHBI ((Z)-4-(3,5-difluoro-4- hydroxybenzylidene)-l,2-dimethyl-lH-imidazol-5(4H)-one), leading to a large increase in its fluorescence emission (Paige (2011)). Spinach was therefore engineered into a sequence- dependent fluorescent aptamer beacon (Spinach. ST) that remains conformationally trapped into an inactive state unable to bind DFHBI until it interacts with a specific sequence target (Figure 10).

To enable the application of Spinach.ST aptamer beacons in our CHA, a new CHA fuel HIB was created by replacing the domain 6* of HI with a sequence complementary to domain 6 (the basal stem) of Spinach. ST 1. When present in a duplex with H2, the exposed toehold 2* of HIB will bind to the toehold domain 2 of Spinach. ST 1, initiating branch migration through domains 5 and the duplicate domain 6, regenerating the Spinach basal stem and conformation allowing it to complex with the fluorophore DFHBI (Figure 10).

An entirely R A-based CHA circuit that processes R A input and generates fluorescent R A output was established by separately transcribing templates for the circuit fuels H1B and H2, the catalyst CI, and the reporter Spinach. ST 1. Transcripts were filtered through Sephadex G25 and incubated at 37 °C in IX TNaK buffer containing 70 GM of the fluorophore DFHBI (Figure 1 la). While Spinach. ST 1 by itself demonstrated negligible fluorescence, background duplex formation by CHA fuels H1B and H2 in the absence of CI resulted in ca. 1.25-fold increase in Spinach. ST 1 fluorescence over ~16 h. In contrast, the CI -catalyzed CHA reaction resulted in ca. 2.5-fold overall increase in Spinach.STl fluorescence. To directly compare the efficiency of Spinach.STl with the DNA FRET reporter duplex H1BF:H1BQ the RNA CHA circuit was assembled from gel-purified (rather than size exclusion-purified) RNA components. Some 1 GM of purified H1B and H2 fueled CHA reactions in which the amount of CI was titrated from 0 to 100 nM. Spinach.STl (+ 70 GM DFHBI) or H1BF (annealed with 2X concentration of H1BQ) were included at 1 GM concentrations to monitor CHA execution. The H1BF:H1BQ DNA FRET reporter clearly outperformed the Spinach.STl aptamer beacon and yielded better signal-to-noise ratios at all tested concentrations of the catalyst (Figures 1 lb, 1 1c, and l id). Better relative performance of H1BF:H1BQ might be partly due to the 4-fold greater brightness of FAM compared to DFHBI in Spinach

(http://www.glenresearch.com/Technical/Extinctions.html; (Paige (2011)), or because the displacement rate of H1BQ from the H1BF:H1BQ duplex might be faster than the rate of refolding of the Spinach aptamer. Although Spinach. ST is a less efficient reporter than the DNA FRET reporter duplex previously employed, the fact that it can be transcribed in a manner similar to the other components of the system opens the way to the design and execution of more complex circuits both in vitro and in vivo.

Computations with transcriptionally generated RNA circuits and reporters

The results provide an interesting proof-of-principle demonstration for a fully RNA I/O CHA circuit that can be transcribed to process RNA inputs and generate readable RNA outputs. To further show the potential of such circuitry, a computational task, the determination of an OR Boolean logic function (Figure 12), was attempted. A second RNA catalyst (C2) was designed for the hairpin H1B that could be released from its kinetic trap by either input catalyst RNA CI or C2. While CI uses H1B domain 1 as the toehold to initiate strand displacement through the entire H1B stem, C2 uses a part of the H1B loop domain 4* as a toehold to displace only domain 3* of the H1B stem. The newly opened 3* domain of H1B can then function as a toehold for hybridization with H2, leading to complete displacement of the C2catalyst.

Circuit components (H1B and H2 RNA hairpins), reporter RNA (Spinach. ST 1), and the inputs CI and C2 were separately transcribed in vitro and purified by filtration through

Sephadex G25. These components formed an OR logic processor that operated in IX TNaK buffer containing 70 GM DFHBI. The RNA CHA circuit was found to readily report the presence of either catalyst CI or C2 (Figure 12b), although the initial catalytic rate with C2 was observed to be faster than the initial rate with C 1. This difference may be due to the fact that C2 is completely displaced by the interactions between HI and H2, while CI can still bind over a short region (interactions between domain 1 and 1*). It is also possible that the faster initial rate with C2 could be due to quicker transcription (since it is shorter than CI) and the lack of processing (C2 lacks ribozyme flanks). That said, it was impressive that both catalysts in fact worked in a sequence-specific manner despite these differences in design, size, and processing.

CONCLUSIONS

These results firmly establish RNA as an alternate information processing and signaling molecule for engineering nucleic acid devices and automata. Structural free energy (WG) proved to be a reliable metric for predicting circuit kinetics, and the RNA circuit reported in this paper demonstrated very similar kinetics of operation when compared to the original DNA circuit from which it is derived. This demonstration paves the way to circuits that can be entirely generated by transcription. The conceptual demonstration was underpinned by a number of important technical demonstrations. It was shown that using ribozyme-mediated end-processing of transcripts can easily generate substrates for RNA circuits without requiring further downstream purification and/or re-folding of each individual circuit component. Enzymatic synthesis potentially provides much greater fidelity compared to chemical synthesis, but at a lower cost (Hecker (1998), Tian (2004)). Chemically synthesized oligonucleotides usually demonstrate deletions at a rate of 1 in 100 bases and mismatches and insertions at about 1 in 400 bases, whereas the T7 RNA polymerase is reported to have a nucleotide substitution error rate of <6 x 10-5 and a deletion error rate of 6 x 10-5 (Hecker (1998), Brakmann (2001)). Such differences have proven to be surprisingly important for DNA circuits, where enzymatically synthesized material routinely outperforms chemically synthesized material, in part because it allows more uniform folding of the kinetically trapped substrates (Chen (2013), Price (1995)).

Recently, non-enzymatic nucleic acid amplification circuits have been used as sequence- specific signal transducers of enzymatic isothermal amplification reactions in solution and also on solid platforms such as paperfluidics aimed for point-of-care devices (Allen (2012), Li (2012). Conformational stability and long term storage of nucleic acid circuits is a critical issue for successful translation into diagnostics. The ability to co-transcriptionally generate nucleic acid circuits allows for long-term circuit storage in the form of double-stranded transcription templates from which circuits could be synthesized in real-time or as needed during diagnostic application. Finally, RNA is an especially attractive medium for executing nucleic acid circuits in vivo because it can fold during transcription into engineered conformations amenable to computation and regulation. Thus, the formulation of design principles for RNA circuits translates into a toolbox for synthesis and operation of complex non-enzymatic nucleic acid circuits in vivo (Lucks (2011); Isaacs (2004)).

Table 1 : Initial rates of catalyzed and uncatalyzed RNA CHA.

Average initial rate/mintSD'

[H2] nM [H1] nM 2.5 nM C1 No Ct

100 300 2.15±0.04 0.03±0.02

100 200 1.72*0.05 0.03+0.02

100 100 1.02+0.08 0.01±0.02

100 50 0.6+0.09 -0.004+0.003

200 300 2.61±0.07 0.09±0.01

200 200 2.08+0.08 0.06+0.02

200 100 1.07+0.04 0.02+0.01

200 50 0.62+0.04 0.002±0.002

400 300 2.40±0.08 0.12+0.005

400 200 1.68+0,02 0.07+0.02

400 100 0.88±0.03 0.0410.002

400 50 0.45+0.05 0.007+0.002

^■ RNA CHA circuits were assembled using gel purified RNA

Table 2. Sequences used

Name Forma

Sequence ³

t

<pT7>TAATACGACTCACTATA<LHRz>GGAGATATCCGACATCTCT

Cloned GAAGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC<3>AGATGTCG<4

H2 transcription >GATACACATGG<3*>CGACATCT<2*>AACCTAGC<4*> ;CCATGTGTATC<RH template Rz>GACGGAGTCTAGACTCCGTCCTGAAGAGTCCGTGAGGACGAAATACAC

ATGGGCTATACCAGGTC (SEQ ID NO: 1 )

<pT7>TAATACGACTCACTATA<LHRz>GGAGATAGCTCACACTACT

Cloned GAAGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC<1>TAGTGTGA<2

H1 transcription >GCTAGGTT<3>AGATGTCG<4*>CCATGTGTATC<3*> CGACATCT<2*>AACC template TAGC<5*>CCTTGTCA<6*>TAGAGCTC<RHRz>GACGGAGT CTAGACTCCGT

CCTGAAGAGTCCGTGAGGACGAAAGCTCTATGACTACCAG (SEQ ID NO: 2)

Double <pT7>TAATACGACTCACTATA<LHRz>GGAGATAGCTCACACTACT mismatch H 1 GAAGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC<1>TAGTGTGA<2 mH 1 cloned >GCTAGGTT<3>AGATGTCG<4*>CCATGTGTAG.A<3*> ;CGACATCT<2*>AACC transcription TAGC<5*>CCTTGTCA<6*>TAGAGCTC<RHRz>GACGGAGT CTAGACTCCGT template CCTGAAGAGTCCGTGAGGACGAAAGCTCTATGACTACCAG (SEQ ID NO: 3)

<pT7>TAATACGACTCACTATA<LHRz>GGAGAAGATGTCGCTGAAG

Cloned

AGTCCGTGAGGACGAAACGGTACCCGGTACCGTC<3*>CGACATCT<2*&g t;AA

C1 transcription

CCTAGC<1*>TCACACTA<RHRz>GACGGAGTCTAGACTCCGTCCTGA AGAG template

TCCGTGAGGACGAAAGTGTGAGAAATAAACCAAGGATC (SEQ ID NO: 4) ssDNA /FAM/<6> GAGCTCTA<5>TGACAAGG<2>GCTAGGTT (SEQ ID NO:

Rep.F

oligonucleotide ¹¹ 5)

pCR2.

pCR2.

1TOPO CCGCCAGTGTGATGGATATCTGCAGAATTC (SEQ ID NO: 6) 1.F

Forward primer

pCR2.

pCR2.

1TOPO CTAGTAACGGCCGCCAGTGTGCTGGAATTC (SEQ ID NO: 7) 1.R

Reverse primer

ssDNA

Rep.Q <5*>CCTTGTCA<6*>TAGAGCTC/lowa Black/ (SEQ ID NO: 8) oligonucleotide ¹¹

<pT7>TAATACGACTCACTATA<L.tRNA>GGAAGCGGTGGCTCAAT

Cloned GGTAGAGCTTTCGA<5*>CCTTGTCA<6*>GACGCGACC<>G AAATGGTGAAG

Spina

transcription GACGGGTCCAGTGCTTCGGCACTGTTGAGTAGAGTGTGAGCTCCGTAACT ch.STI

template <6>GGTCGCGTC<6>GGTCGCGTC<5>TGACAAGG<2&g t;GCTAGGTT<R.tRNA

>TCGAAGGGTTGCAGGTTCAATTCCTGTCCGTTTC (SEQ ID NO: 9)

<pT7>TAATACGACTCACTATA<LHRz>GGAGATAGCTCACACTACT

Cloned

GAAGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC<1>TAGTGTGA<2

H1 B transcription

>GCTAGGTT<3>AGATGTCG<4*>CCATGTGTATC<3*> CGACATCT<2*>AACC template

TAGC<5*>CCTTGTCA<6*>GACGCGACCTC<RHRz>GACGG AGTCTAGACTC

a) Domain designation/description precedes the sequence within the '< >' symbols. pT7: T7 RNA polymerase promoter; LHRz: left hammerhead ribozyme; RHRz: right hammerhead ribozyme; *: complementary domain; L.tRNA: left tRNA scaffold; R.tRNA: right tRNA scaffold. Mismatched bases are highlighted in red.

b) Duplex DNA FRET reporter

c) Complementary DNA oligonucleotides were annealed to generate T7 RNA polymerase transcription templates.

d) Duplex DNA FRET reporter

Table 3. Free energy comparison of DNA and RNA hairpins.

Example 2: Mismatches Improve the Performance of Strand-Displacement Nucleic Acid Circuits

Nucleic acid circuits that are based on toehold-mediated strand exchange reactions have yielded interesting approaches to computation, nanotechnology, and diagnostics (Zhang DY, 2009; Ma C, 2012; Yin P, 2008; Zhang DY 2007; Zhang H, 2013; Liu J, 2009). An example of a common amplification reaction, which is known as the catalytic hairpin assembly (CHA), is shown in Figure 19. This circuit has been adapted to a variety of applications, including acting as a monitor of isothermal amplification reactions, both end-point (Li B 2012) and real-time (Jiang Y 2013).

Unfortunately, CHA circuits have also been shown to execute non-specifically, even in the absence of particular inputs (Li B, 2012; Huang J, 2012; Ren J, 201 1). This background leakage is characterized by an initial burst of signal, which is followed by a steady-state, non- catalyzed rate of circuit execution. The rate constant of the steady-state leakage of a typical CHA circuit was approximately 200 M ^' V ¹ , while the corresponding catalytic rate at a catalyst concentration of 5 nM was 4000 M ^' V ¹ (Li B, 2012). Although the 20-fold enhancement of the rate that was observed in the presence of the catalyst allowed for robust signal detection, any accompanying background leakage can potentially make quantitation of lower input concentrations more difficult. For example, although CHA circuits can be designed for a variety of sequence targets and applications, the signal-to-noise ratio for these circuits (that is, the catalyzed reaction relative to the uncatalyzed reaction) seldom exceeds a ratio of greater than 100: 1.

The background leakage can be attributed to a number of factors, including the purity of the DNA samples (Chen X, 2013) and the misfolding of nucleic acids into alternative conformers. Underlying many of these mechanisms, however, is the uncatalyzed binding of an otherwise occluded toehold to its hybridization partner, the subsequent initiation of strand exchange, and the continued propagation of the hairpin assembly reaction. For example, when the kinetically trapped hairpin substrates in CHA "breathe", they inadvertently reveal binding sites that can then initiate CHA even in the absence of a catalyst strand.

To reduce the prevalence of uncatalyzed strand exchange, either the revealed, inadvertent binding reaction and/or its continuation as a strand exchange reaction can be blocked. In turn, the simplest way to introduce a block was to introduce mismatched nucleotides into the regions that are thought to breathe and/or into adjacent positions that might be involved in strand exchange. As the ends of helices are more likely to breathe than internal base pairs (SantaLucia J, 1998; SantaLucia J, 2004), mismatches were introduced into these portions of the hairpin substrates. A CHA circuit (Circuit A) (Li B, 2012) was designed, wherein domains 1 and 1 * were shortened from ten to eight nucleotides, a length that was found to act as an efficient toehold. Furthermore, mismatches were introduced at the 3 '-end of domain 2 in H2 (CircA- H2D2M2, where CircA refers to the overall circuit, H2 refers to the hairpin substrate, D2 refers to the domain, and M2 refers to the type of mutation, that is, single, double, etc.; see also Table 4) to reduce its ability to hybridize to the complementary domain 2* in HI. To probe the potential contribution of different mismatches to background suppression, two consecutive mismatches were introduced at each of four sites (Figure 20 and Table 4).

The resultant "MismatCHA" circuits were assayed by monitoring the release of a fluorescent oligonucleotide from a quencher ("Reporter" in Figure 19; for the sequence, see Table 10). For example, CircA-H2D2M2 was paired with HI, and the development of a fluorescent signal was monitored as a function of time (Figure 3). When compared with the perfectly paired wild-type Circuit A (CircA-Hl paired with CircA-H2), the introduction of a double mismatch into domain 2 (CircA-H2D2M2; Table 4 and Figure 21 A) led to a significant diminution of background signal development in the absence of catalyst. In contrast, when mismatches were introduced into domains 3 and 1 (CircA-H2D3 M2, CircA-HlDl M2; Table 4), there was little effect on the performance of the circuit (Figure 2 IB and 2 ID), and the double mismatch in domain 4 (CircA-HlD4M2; Table 4) severely compromised the rate of the catalytic reaction (Figure 21C). With a single mismatch on domain 4, both the catalytic rate and the background leakage were reduced to one fifth of the values that were obtained for the wild-type constructs (Figure 24, Table 5).

Whereas the rate of the reaction with CircA-H2D2M2 was slightly compromised (Figure 4), it nonetheless had a roughly 23 -fold improved signal-to-noise ratio relative to the wild-type reaction. Although these initial results represent only a single set of designs, they can be rationalized by making two assumptions: First, breathing is more significant at the termini of the helices than at positions adjacent to loops. This implies that there was more opportunity for the suppression of the background signal for constructs CircA-H2D2M2 and CircA-HlD4M2 than for CircA-H2D3M2 and CircA-HlDlM2, as for CircA-H2D2M2 and CircA-HlD4M2, the intensity of the background signal should decrease because of breathing at the terminus of the HI helix, whereas CircA-H2D3M2 and CircA-HlDlM2 should reduce background interactions owing to breathing adjacent to the loop in HI . Second, in the case of CircA-HlD4M2, the double mismatch may effectively prevent not only the uncatalyzed reaction because of breathing, but also the initiation of the second strand exchange reaction that occurs following the opening of HI (Figure 19). In contrast, the double mismatch in domain 2 would not interfere with the initiation, but only with the propagation of the second strand exchange reaction.

Building on the observation that mismatches in the H2 domain 2 (adjacent to the loop) can lead to better signal-to-noise characteristics, a series of Circuit A variants was generated by changing the number, position, and identity of the introduced mismatches (Figure 23; see also Table 6). A variety of single mismatches between HI and H2 were tested (Figure 23 A and Figure 24A). The mismatches (C:A, C:C, and C:T) were positioned at either the 3'-end of domain 2 or at the penultimate residue adjacent to the 3'-end of domain 2 (A:A). All mismatches improved the signal-to-background ratio, and the C:C mismatch gave a signal-to-background ratio of greater than 100: 1. The performance of the C:C mismatch may be due to the fact that it is one of the strongest mismatches (Kwok S, 1994; Kowk S, 1990), or may be due to the increase in the length of the H2 stem, which arises from a fortuitous pairing with an opposing guanosine in the loop. In Figure 23B and Figure 25B, various multiple mismatches were compared between HI and H2. Four different double mismatches were assayed, either adjacent to one another (AC:CA, AC:AA) or separated by potentially paired residues (ATC:CAA,

TTTC:CAAT; paired residues underlined). The double mismatches generally displayed higher signal-to-background ratios than the single mismatches, and three of the four ratios were greater than 100: 1. Three mismatches (AAC:CAA) also yielded a high signal-to-background ratio. Both the double and triple mismatches decreased the catalytic rate of the CHA circuit, while generally improving the signal-to-background ratio.

To ensure that the circuits with mismatches were executing similarly to better known CHA circuits without mismatches, the strand exchange reactions were also examined by native gel electrophoresis of the reaction between CircA-H2 and CircA-H2D2M2 (Figure 25). Hairpins were prepared at a concentration of 50nM and incubated with or without 5nM catalyst at 37°C for 3 h prior to loading the reactions (20μΚ) onto a 10% native polyacrylamide gel. The gel contained 10% acrylamide, 5% glycerol, 0.02M Tris-Boric acid (pH= 8.4), and was poured and polymerized (with 200μΙ. 10% Ammonium Persulfate and 20μΙ. Tetramethylethylenediamine). Electrophoresis was carried out at 250v for 1.5h. The fluorescent bands were photographed using a Storm Scanner 840 (Amersham Bioscience, UK) with Excitation 450nM, Emission 520LP, normal sensitivity and PMT Voltage of 800. Fluorescence values were obtained using ImageQuant 5.2 software and the relative fluorescence intensity ( -FI) was determined by subtracting the background (BG) fluorescence and then normalizing to the 'g' band as 1.

Products were observed to be of the same sizes, irrespective of the presence or absence of mismatches. Consistent with the fluorescence assays, there is more background product from the perfectly paired CircA-H2 relative to the double mismatched CircA-H2D2M2 (roughly twice as much at end point).

To demonstrate that mismatches on domain 2 can generally improve signal-to-noise ratios, NUPACK (Zadeh J , 2011 ; Dirks RM, 2007; Dirks NA, 2003; Dirks RM, 2004), a DNA design software package, was used to generate a second circuit (Circuit B) with the same domain organization as in Figure 19, but with completely different sequences for the hairpin substrates. Again, circuit variants that contained mismatches at four positions (Table 7) were assayed. Once more it was found that only CircB-H2D2M2 (Figures 27 and 28) improved the signal-to- background ratio to over 100: 1. To demonstrate the generality of these results, we also introduced different mismatches into Circuit B. Whereas wild-type Circuit B had a signal-to- background ratio of 4.5: 1 (Figure 29C), a single mismatched H2 (CircB-H2D2Ml, A:A; Figures 29A and 29C, Table 9) increased the signal-to-background ratio to 12.6: 1, and a double mismatch (CircB-H2D2M2, CA:AC; Figure 29B and 29C, Table 9) increased the signal-to- background ratio to over 100: 1.

Overall, MismatCHA designs substantially decreased the amounts of uncatalyzed background reactions in CHA amplification reactions. For a typical CHA circuit, introducing mismatches at the 3 '-end of domain 2 generally gave higher signal-to-background ratios, with multiple mismatches almost always yielding much larger signal-to-background ratios while only modestly decreasing rates. As MismatCHA circuits can increase the signal-to-background ratio from single digits to over 100: 1, they should prove useful for the sequence-specific signal transduction with amplicons that arise from isothermal amplification reactions (Compton J, Walker GT, 1992; Notomi T, 2000). In essence, CHA can now be used with isothermal amplification reactions in the same way a TaqMan probe is used for the polymerase chain reaction (PCR). The rules developed herein should now greatly extend the utility of CHA probes for many different amplicon sequences and for different types of isothermal amplification reactions.

Furthermore, these results continue to highlight the utility of non-canonical pairings in DNA nanotechnology. Defects in DNA nanostructures can potentially be detected using DNA circuits that are sensitive to mismatches (Li B, 2012) (although in this instance, the presence of a mismatch in the structure led to a lower rate of reaction, rather than to a higher signal-to- background ratio as observed here with MismatCHA). Mismatches have also been shown to be specifically incorporated into DNA nanostructures, with regular DNA crystals being formed in part from non- Watson— Crick pairings (Paukstelis PJ, 2004) and even into larger structures, such as oligonucleotides hybridized to the surfaces of gold nanoparticles (Hill HD, 2009). As the rules for the use of mismatches are further elucidated, the wealth of rationally designed DNA circuits and structures will continue to expand. Table 4. Wild-type sequence and mismatched sequences. ^[a]

Name Sequence

CircA AGAGGCAT CAATGGGA ATGGGATC ATGCCTCT AACCTAGC

-HI GATCCCAT TCCCATTG (SEQ ID NO: 29)

CircA ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCATTG ATGCCTCT

-H2 AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 30)

CircA ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCATac ATGCCTCT

-H2D2M2 AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 31)

CircA ATGGGATC GCTAGGTT AGAGGCAT atTCCCAT TCCCATTG ATGCCTCT

-H2D3 ^A M2 AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 32)

CircA AGAGGCAT CAATGGGA ATGGGATC ATGCCTCT AACCTAcg GATCCCAT

-H1D4M2 TCCCATTG (SEQ ID NO: 33)

CircA AGAGGCAT CAATGGGA ATGGGATC taGCCTCT AACCTAGC GATCCCAT

-H1D1M2 TCCCATTG (SEQ ID NO: 34)

[a] Mismatches in lowercase letters.

Table 5. Single mismatch sequence for Circuit A: CircA-HlD4Ml * Na Sequence

me

Cir AGAGGCAT CAATGGGA ATGGGATC

cA- ATGCCTCT AACCTAGg GATCCCAT TCCCATTG (SEQ

H1D4M1 ID NO: 35)

*Mismatches in lowercase

Table 6. Different domain 2 mismatches for Circuit A.*

Nam Sequence

Circ ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCATTa

A- ATGCCTCT AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 36)

H2D2Mla

Circ ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCATTc

A- ATGCCTCT AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 37)

H2D2Mlc

Circ ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCATTt

A- ATGCCTCT AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 38)

H2D2Mld

Circ ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCATaG

A- ATGCCTCT AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 39)

H2D2Mlb

Circ ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCATac A-H2D2M2 ATGCCTCT AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 40)

Circ ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCATaa

A- ATGCCTCT AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 41)

H2D2M2b

Circ ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCAaac A-H2D2M3 ATGCCTCT AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 42)

Circ ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCAaTc

A- ATGCCTCT AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 43)

H2D2M2a

Circ ATGGGATC GCTAGGTT AGAGGCAT GATCCCAT TCCCtTTc

A- ATGCCTCT AACCTAGC CCTTGTCA TAGAGCAC (SEQ ID NO: 44)

H2D2M2b

*Mismatches in lowercase

Table 7. Wild-type circuit and mismatched sequences*

Name Sequence

CircB- CAATATCC GAAACGTC CTCCTAAG GGATATTG GGTTTGAG

HI CTTAGGAG GACGTTTC (SEQ ID NO: 45)

CircB- CTCCTAAG CTCAAACC CAATATCC CTTAGGAG GACGTTTC H2 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 46)

CircB- CTCCTAAG CTCAAACC CAATATCC CTTAGGAG GACGTca H2D2M2 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 47)

CircB- CTCCTAAG CTCAAACC CAATATCC aaTAGGAG GACGTTTC H2D3M2 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 48)

CircB- CAATATCC GAAACGTC CTCCTAAG GGATATTG GGTTTGtc H1D4M2 CTTAGGAG GACGTTTC (SEQ ID NO: 49)

CAATATCC GAAACGTC CTCCTAAG tcATATTG GGTTTGAG

H1D1M2 CTTAGGAG GACGTTTC (SEQ ID NO: 50)

*Mismatches in lowercase

Table 8. Single mismatch sequence for Circuit B: CircB-HlD4Ml*

Name Sequence

CircB- CAATATCC GAAACGTC CTCCTAAG GGATATTG GGTTTGTa

H 1 D4M 1 CTTAGGAG GACGTTTC (SEQ ID NO : 51 )

*Mismatches in lowercase

Table 9. Different domain 2 mismatches for Circuit B.*

Name Sequence

CircB CTCCTAAG CTCAAACC CAATATCC CTTAGGAG GACGTTTa H2D2M1 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 52)

CircB- CTCCTAAG CTCAAACC CAATATCC CTTAGGAG GACGTTca

H2D2M2 GGATATTG GGTTTGAG AGAGTTTC GAGTTCTG (SEQ ID NO: 53)

*Mismatches in lowercase

Table 10. Reporter sequences

Name Sequence

CircA- /56-FAM/CGA GTGCTCTA TGACAAGG GCTAGGT

ReporterF

CircA- C CCTTGTC ATAGAGCAC TCG/3IABkFQ/ (SEQ ID NO: 54) ReporterQ

CircB- /56-FAM/-CAC AGAACTC GAAACTCT CTCAAACC

ReporterF

CircB- G AGAGTTTC GAGTTCT GTG-/3IABkFQ/ (SEQ ID NO: 55) ReporterQ

CircA-Reporter was a mixture of CircA-ReporterF and CircA-ReporterQ with a ratio of 1:2. For example, 50 nM CircA-Reporter contains 50 nM CircA-ReporterF and 100 nM CircA- ReporterQ. Similarly, CircB-Reporter was a mixture of CircB-ReporterF and CircB-ReporterQ with a ratio of 1 :2 where 50 nM CircB-Reporter contains 50 nM CircB-ReporterF and 100 nM CircB-ReporterQ.

MATERIALS AND METHODS

All the chemicals used in our experiments were of analytical grade and were purchased from Sigma-Aldrich (MO, USA) unless otherwise indicated. All the oligonucleotides were ordered from Integrated DNA Technology (IDT, Coralville, IA, USA). All the hairpins were purified by 12% polyacrylamide gel electrophoresis (PAGE). All hairpins and duplexes were annealed at 95 oC for 5 min and cooled down to 25 °C by 0.1 °C/s before use. The buffer used in the annealing step and the CHA reaction was Tris-HCl buffer with 20 mM Tris-HCl (pH 7.5, 25 °C), 140 mM NaCl, 5 mM KC1. A 20 μΐ. CHA reaction sample contained 50 nM HI (either wild-type or mismatch), 50 nM H2 (either wild-type or mismatch), 50 nM Reporter (which consisted of ReporterF: ReporterQ in a 1 :2 ratio), and either 2.5 nM catalyst or no catalyst at all. All the kinetic readings were carried out with a 384-well plate from Thermo Fisher Scientific (Rochester, NY) in a TEC AN Safire plate reader; each kinetic reading proceeded for 3 h.

References

Chen, X. and Ellington, A.D. (2010) Shaping up nucleic acid computation. Current opinion in biotechnology, 21, 392-400.

Li, B., Ellington, A.D. and Chen, X. (201 1) Rational, modular adaptation of enzyme-free DNA circuits to multiple detection methods. Nucleic acids research, 39, el 10.

Qian, L., Winfree, E. and Bruck, J. (201 1) Neural network computation with DNA strand displacement cascades. Nature, 475, 368-372.

Zhang, D.Y. and Seelig, G. (2011) Dynamic DNA nanotechnology using

stranddisplacement reactions. Nature chemistry, 3, 103-1 13.

Qian, L. and Winfree, E. (201 1) Scaling up digital circuit computation with DNA strand displacement cascades. Science, 332, 1 196-1201.

Seelig, G., Soloveichik, D., Zhang, D.Y. and Winfree, E. (2006) Enzyme-free nucleic acid logic circuits. Science, 314, 1585-1588.

Choi, H.M., Chang, J.Y., Trinh le, A., Padilla, J.E., Fraser, S.E. and Pierce, N.A. (2010) Programmable in situ amplification for multiplexed imaging of mRNA expression. Nature biotechnology, 28, 1208-1212.

Lucks, J.B., Qi, L., Mutalik, V.K., Wang, D. and Arkin, A.P. (201 1) Versatile RNA- sensing transcriptional regulators for engineering genetic networks. Proceedings of the National

Academy of Sciences of the United States of America, 108, 8617-8622. Isaacs, F.J., Dwyer, D.J., Ding, CM., Pervouchine, D.D., Cantor, C.R. and Collins, J.J. (2004) Engineered riboregulators enable post-transcriptional control of gene expression. Nature biotechnology, 22, 841-847.

Yin, P., Choi, H.M., Calvert, C.R. and Pierce, N.A. (2008) Programming biomolecular self-assembly pathways. Nature, 451, 318-322.

Li, B., Chen, X. and Ellington, A.D. (2012) Adapting enzyme-free DNA circuits to the detection of loop-mediated isothermal amplification reactions. Analytical chemistry, 84

8371-8377.

Jiang, Y.S., Li, B., Milligan, J.N., Bhadra, S. and Ellington, A.D. (2013) Real-time detection of isothermal amplification reactions with thermostable catalytic hairpin assembly. Journal of the American Chemical Society, 135, 7430-7433.

Kim, J. and Winfree, E. (2011) Synthetic in vitro transcriptional oscillators. Mol Syst

Biol, 7.

Franco, E., Friedrichs, E., Kim, J., Jungmann, R., Murray, R., Winfree, E. and Simmel, F.C. (2011) Timing molecular motion and production with a synthetic transcriptional clock. Proceedings of the National Academy of Sciences of the United States of America, 108, E784- E793.

Simpson, Z.B., Tsai, T.L., Nguyen, N., Chen, X. and Ellington, A.D. (2009) Modelling amorphous computations with transcription networks. J R Soc Interface, 6. Page 17 of 36 Nucleic Acids Research

Kim, J., White, K.S. and Winfree, E. (2006) Construction of an in vitro bistable circuit from synthetic transcriptional switches. Mol Syst Biol, 2.

Hockenberry, A.J. and Jewett, M.C. (2012) Synthetic in vitro circuits. Curr Opin Chem Biol, 16, 253-259.

Zadeh, J.N., Steenberg, CD., Bois, J.S., Wolfe, B.R., Pierce, M.B., Khan, A.R., Dirks,

R.M. and Pierce, N.A. (2011) NUPACK: Analysis and design of nucleic acid systems. Journal of computational chemistry, 32, 170-173.

Dirks, R.M., Bois, J.S., Schaeffer, J.M., Winfree, E. and Pierce, N.A. (2007)

Thermodynamic analysis of interacting nucleic acid strands. Siam Rev, 49, 65-88. 20. Dirks, R.M. and Pierce, N.A. (2003) A partition function algorithm for nucleic acid secondary structure including pseudoknots. J Comput Chem, 24, 1664-1677.

Dirks, R.M. and Pierce, N.A. (2004) An algorithm for computing nucleic acid base- pairing probabilities including pseudoknots. J Comput Chem, 25, 1295-1304. Lesnik, E.A. and Freier, S.M. (1995) Relative thermodynamic stability of DNA, RNA, and DNA:RNA hybrid duplexes: relationship with base composition and structure.

Biochemistry, 34, 10807-10815.

Chen, X., Briggs, N., McLain, J.R. and Ellington, A.D. (2013) Stacking nonenzymatic circuits for high signal gain. Proceedings of the National Academy of Sciences of the United States of America, 110, 5386-5391.

Jiang, Y., Li, B., Milligan, J. Bhadra, S. and Ellinton, A.D. (2013) Real-time detection of isothermal amplification reactions with thermostable catalytic hairpin assembly. Journal of the American Chemical Society, Submitted for publication.

Milligan, J.F., Groebe, D.R., Witherell, G.W. and Uhlenbeck, O.C. (1987)

Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nucleic acids research, 15, 8783-8798.

Rosa, M.D. (1979) Four T7 RNA polymerase promoters contain an identical 23 bp sequence. Cell, 16, 815-825.

Krupp, G. (1988) RNA synthesis: strategies for the use of bacteriophage RNA polymerases. Gene, 72, 75-89.

Price, S.R., Ito, N., Oubridge, C, Avis, J.M. and Nagai, K. (1995) Crystallization of RNAprotein complexes. I. Methods for the large-scale preparation of RNA suitable for crystallographic studies. Journal of molecular biology, 249, 398-408.

Ke, A. and Doudna, J.A. (2004) Crystallization of RNA and RNA-protein complexes.

Methods, 34, 408-414.

Martin, C.T., Muller, D.K. and Coleman, J.E. (1988) Processivity in early stages of transcription by T7 RNA polymerase. Biochemistry, 27, 3966-3974.

Zhang, D.Y. and Winfree, E. (2009) Control of DNA strand displacement kinetics using toehold exchange. Journal of the American Chemical Society, 131, 17303-17314.

Meyer, I.M. and Miklos, I. (2004) Co-transcriptional folding is encoded within RNA genes. BMC molecular biology, 5, 10.

Allen, P.B., Arshad, S.A., Li, B., Chen, X. and Ellington, A.D. (2012) DNA circuits as amplifiers for the detection of nucleic acids on a paperfluidic platform. Lab on a chip, 12, 2951- 2958.

Paige, J.S., Wu, K.Y. and Jaffrey, S.R. (2011) RNA mimics of green fluorescent protein. Science, 333, 642-646.

Hecker, K.H. and Rill, R.L. (1998) Error analysis of chemically synthesized

polynucleotides. BioTechniques, 24, 256-260. Tian, J.D., Gong, H., Sheng, N.J., Zhou, X.C., Gulari, E., Gao, X.L. and Church, G. (2004) Accurate multiplex gene synthesis from programmable DNA microchips. Nature, 432, 1050-1054.

Brakmann, S. and Grzeszik, S. (2001) An error-prone T7 RNA polymerase mutant generated by directed evolution. Chembiochem, 2, 212-219.

Zhang, D.Y. and Winfree, E. (2010) Robustness and modularity properties of a noncovalent DNA catalytic reaction. Nucleic acids research, 38, 4182-4197.

D.Y. Zhang, E. Winfree, J. Am. Chem. Soc. 2009, 131, 17303-17314

C. Ma, W. Wang, Z. Li, L. Cao, Q. Wang, Anal. Biochem. 2012, 429, 99-102

P. Yin, H.M.T. Choi, C.R. Calvert, N.A. Pierce, Nature 2008, 451, 318-U314

D. Y. Zhang, A.J. Turberfield, B. Yurke, E. Winfree, Science 2007, 318, 1121-1125 H. Zhang, F. Li, B. Dever, X. Li, X.C. Le, Chem. Rev. 2013, 113, 2812-2841

J. Liu, Z. Cao, Y. Lu, Chem. Rev. 2009, 109, 1948-1998

B. Li, X. Chen, A.D. Ellington, Anal. Chem. 2012, 84, 8371-8377

Y. Jiang, B. Li, J.N. Milligan, S. Bhadra, A.D. Ellington, J. Am. Chem. Soc. 2013, 135,

7430-7433

B. Li, Y. Jiang, X. Chen, A.D. Ellington, J. Am. Chem. Soc. 2012, 134, 13918-13921 J. Huang, X. Su, Z. Li, Anal. Chem. 2012, 84, 5939-5943

J. Ren, J. Wang, L. Han, E. Wang, J. Wang, Chem. Commun. 2011, 47, 10563-10565 X. Chen, N. Briggs, J.R. McLain, A.D. Ellington, Proc. Natl. Acad. Sci. USA 2013, 110,

5386-5391

J. SantaLucia, Proc. Natl. Acad. Sci. USA 1998, 95, 1460-1465

J. SantaLucia, D. Hicks, Annu. Rev. Cell Dev. Biol. 2004, 20, 415-440

S. Kwok, S.Y. Chang, J.J. Sninsky, A. Wang, Genome Res. 1994, 3, S39-S47

S. Kwok, D.E. Kellogg, N. McKinney, D. Spasic, L. Goda, C. Levenson, J.J. Sninsky,

Nucleic Acids Res. 1990, 18, 999-1005

J.N. Zadeh, CD. Steenberg, J.S. Bois, B.R. Wolfe, M.B. Pierce, A.R. Khan, R.M. Dirks,

N.A. Pierce, J. Comput. Chem. 2011, 32, 170-173

R.M. Dirks, J.S. Bois, J.M. Schaeffer, E. Winfree, N.A. Pierce, Siam Rev. 2007, 49, 65- 88

M. Dirks, N.A. Pierce, J. Comput. Chem. 2003, 24, 1664-1677

R.M. Dirks, N.A. Pierce, J. Comput. Chem. 2004, 25, 1295—1304

J. Compton, Nature 1991, 350, 91-92 T. Walker, M.S. Fraiser, J.L. Schram, M.C. Little, J.G. Nadeau, D.P. Malinowski, Nucleic Acids Res. 1992, 20, 1691—1696

T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino, T. Hase, Nucleic Acids Res. 2000, 28, E63

P.J. Paukstelis, J. Nowakowski, J. ^AA J. Birktoft, N.C. Seeman, Chem. Biol. 2004, 11,

11 19-1 126

H.D. Hill, S.J. Hurst, C.A. Mirkin, Nano Lett. 2009, 9, 317-321