METHODS AND COMPOSITIONS FOR TREATING NON-ERK MAPK PATHWAY INHIBITOR-RESISTANT CANCERS CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Patent Application Serial No. 61/919,551 , filed on December 20, 2013 which application is incorporated by reference herein in its entirety.

FIELD OF INVENTION

[0002] The present invention provides, inter alia, methods, pharmaceutical compositions, and kits for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway inhibitor therapy.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0003] This application contains references to amino acids and/or nucleic acid sequences that have been filed concurrently herewith as sequence listing text file "0375608.txt", file size of 356 KB, created on December 18, 2014. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1 .52(e)(5).

BACKGROUND OF THE INVENTION

[0004] Drug inhibitors that target components of the mitogen-activated protein kinases (MAPK) signaling pathway show clinical efficacy in a variety of cancers, particularly those bearing mutations in the BRAF protein kinase. Both RAF and MEK inhibitors are approved for single-agent use in advanced metastatic BRAF mutant melanoma. Either alone or in combination, BRAF and MEK inhibitor activity is unpredictable in other cancers, with promising efficacy in BRAF mutant thyroid and lung cancer, but only marginal activity in BRAF mutant colorectal cancer.

[0005] As with other targeted therapies, patterns of disease response to RAF and MEK inhibitors appear to be influenced by the intrinsic genetic heterogeneity present in the cancers where the drugs are used. For instance, it has been shown that certain genetic alterations, including PTEN and other changes that activate the PI3K cell growth signaling pathway, may predict a poor initial response, and/or relatively rapid progression, in BRAF mutant melanoma treated with the RAF inhibitor vemurafenib. Likewise, direct mutations in MEK gene loci appear to emerge in tumors that have progressed following either BRAF, MEK, or combined drug treatment. Several additional examples, from RAS and RAF gene amplification and splicing mutations, suggest that acquired drug resistance is produced when oncogenic pleiotropy encounters the selective pressure of targeted drug treatment.

[0006] In view of the foregoing, there is a need for novel targeted agents that would ideally inhibit diverse nodes of oncogenic pathways, and also be effective in combinations by inducing a burden of selective pressures that exceeds the adaptive capacity of diverse cancer genomes. The present application is directed to meeting these and other needs.

SUMMARY OF THE INVENTION

[0007] One embodiment of the present invention is a method for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway inhibitor therapy. The method comprises administering to the subject an effective amount of BVD- 523 or a pharmaceutically acceptable salt thereof.

[0008] Another embodiment of the present invention is a method for treating or ameliorating the effects of a cancer in a subject. The method comprises:

(a) identifying a subject with cancer that has become refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or BRAF and MEK inhibitor therapy; and

(b) administering to the subject with said refractory or resistant cancer an effective amount of an ERK inhibitor, which is BVD- 523 or a pharmaceutically acceptable salt thereof.

[0009] A further embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject, which cancer is refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or both. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

[0010] Another embodiment of the present invention is a method for identifying a subject having cancer who would benefit from therapy with an ERK inhibitor. The method comprises:

(a) obtaining a biological sample from the subject; and

(b) screening the sample to determine whether the subject has one or more of the following markers:

(i) a switch between RAF isoforms, (ii) upregulation of receptor tyrosine kinase

(RTK) or NRAS signaling,

(iii) reactivation of mitogen activated protein kinase (MAPK) signaling,

(iv) the presence of a MEK activating mutation,

(v) amplification of mutant BRAF,

(vi) STAT3 upregulation,

(vii) mutations in the allosteric pocket of MEK that directly block binding of inhibitors to MEK or lead to constitutive MEK activity,

wherein the presence of one or more of the markers confirms that the subject's cancer is refractory or resistant to BRAF and/or MEK inhibitor therapy and that the subject would benefit from therapy with an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.

[0011] A further embodiment of the present invention is a pharmaceutical composition for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy. The composition comprises a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

[0012] Another embodiment of the present invention is a kit for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy. The kit comprises any of the pharmaceutical compositions according to the present invention packaged together with instructions for its use. [0013] Another embodiment of the present invention is a method for inhibiting phosphorylation of RSK in a cancer cell that is refractory or resistant to a non-ERK MAPK pathway inhibitor. The method comprises contacting the cancer cell with an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof for a period of time sufficient for phosphorylation of RSK in the cancer cell to be inhibited.

BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0015] FIGS. 1 A-C show the progress of a dose escalation study in a human malignant melanoma cell line (A375 cells) for month 1 . Various treatments (trametinib (a type 2 MEK inhibitor), dabrafenib (a BRAF inhibitor), and BVD-523 (an ERK1/2 inhibior)) are as labeled.

[0016] FIGS. 2A-H show the results of a proliferation assay that tracks changes in sensitivity to the escalated agent(s) at month 1 . Various treatments (trametinib, dabrafenib, BVD-523, and pacitaxel) are as labeled on the top of the graph. The caption to the right of the graph shows the various types of cells generated from the dose escalation study. For example, "dabrafenib" refers to the cells that have been treated with the highest dose of dabrafenib from month 1 of the dose escalation study. Parental refers to the control cells that have not been treated with drugs. FIGS. 2A-2C and 2G are normalized to control, whereas FIGS. 2D-2F and 2H show the raw data. [0017] FIGS. 3A-3D show the progress of a dose escalation study in A375 cells for month 2. Various treatments (trametinib, dabrafenib, and BVD- 523) are as labeled.

[0018] FIGS. 4A-H show the results of a proliferation assay that tracks changes in sensitivity to the escalated agent(s) at month 2. Various treatments (trametinib, dabrafenib, BVD-523, and pacitaxel) are as labeled on the top of the graph. The caption to the right of the graph shows the various types of cells generated from the dose escalation study. For example, "dabrafenib" refers to the cells that have been treated with the highest dose of dabrafenib from month 2 of the dose escalation study. Parental refers to the control cells that have not been treated with drugs. FIGS. 4A-4C and 4G are normalized to control, whereas FIGS. 4D-4F and 4H show the raw data.

[0019] FIGS. 5A-H show only the parental and BVD-523 cell line data from FIG. 4. Various treatments (trametinib, dabrafenib, BVD-523, and pacitaxel) are as labeled. FIGS. 5A-5C and 5G are normalized to control, whereas FIGS. 5D-5F and 5H show the raw data.

[0020] FIGS. 6A-D show the progress of the dose escalation study in a human malignant cell line (A375 cells) for month 3. Various treatments (trametinib, dabrafenib, and BVD-523) are as labeled.

[0021] FIG. 7 is a histogram showing the results of a proliferation assay as applied to cells grown in the DMSO control wells from the dose escalation assay.

[0022] FIGS. 8A-D are a set of line graphs showing proliferation assays for month 3 of the study. Various treatments (trametinib, dabrafenib, BVD- 523, and pacitaxel) are as labeled on the top of the graph. The caption to the right of the graph shows the various types of cells generated from the dose escalation study. For example, "dabrafenib" refers to the cells that have been treated with the highest dose of dabrafenib from month 3 of the dose escalation study. Parental refers to the control cells that have not been treated with drugs.

[0023] FIGS. 9A-D show only the parental, dabrafenib, and BVD-523 cell line data from FIG. 8.

[0024] FIG. 10A is a dose matrix showing % inhibition of the trametinib/dabrafenib combination in A375 cells using the Alamar Blue cell viability assay. FIG. 10B is a dose matrix showing excess over Bliss for the trametinib/dabrafenib combination. FIGS. 10C and 10D show % viability relative to DMSO only treated controls for dabrafenib and trametinib single agent treatments in A375 cells using the Alamar Blue cell viability assay. FIG. 10E shows % viability relative to DMSO only treated controls for dabrafenib and trametinib combination treatments in A375 cells using the Alamar Blue cell viability assay.

[0025] FIG. 1 1A is a dose matrix showing % inhibition of the trametinib/dabrafenib combination in A375 cells using the CellTiter-Glo cell viability assay. FIG. 1 1 B is a dose matrix showing excess over Bliss for the trametinib/dabrafenib combination. FIGS. 1 1 C and 1 1 D show % viability relative to DMSO only treated controls for dabrafenib and trametinib single agent treatments in A375 cells using the CellTiter-Glo cell viability assay. FIG. 1 1 E shows % viability relative to DMSO only treated controls for dabrafenib and trametinib combination treatments in A375 cells using the CellTiter-Glo cell viability assay. [0026] FIG. 12A is a dose matrix showing % inhibition of the BVD- 523/dabrafenib combination in A375 cells using the Alamar Blue cell viability assay. FIG. 12B is a dose matrix showing excess over Bliss for the BVD- 523/dabrafenib combination. FIGS. 12C and 12D show % viability relative to DMSO only treated controls for dabrafenib and BVD-523 single agent treatments in A375 cells using the Alamar Blue cell viability assay. FIG. 12E shows % viability relative to DMSO only treated controls for dabrafenib and BVD-523 combination treatments in A375 cells using the Alamar Blue cell viability assay.

[0027] FIG. 13A is a dose matrix showing % inhibition of the BVD- 523/dabrafenib combination in A375 cells using the CellTiter-Glo cell viability assay. FIG. 13B is a dose matrix showing excess over Bliss for the BVD- 523/dabrafenib combination. FIGS. 13C and 13D show % viability relative to DMSO only treated controls for dabrafenib and BVD-523 single agent treatments in A375 cells using the CellTiter-Glo cell viability assay. FIG. 13E shows % viability relative to DMSO only treated controls for dabrafenib and BVD-523 combination treatments in A375 cells using the CellTiter-Glo cell viability assay.

[0028] FIG. 14A is a dose matrix showing % inhibition of the trametinib/BVD-523 combination in A375 cells using the Alamar Blue cell viability assay. FIG. 14B is a dose matrix showing excess over Bliss for the trametinib/BVD-523 combination. FIGS. 14C and 14D show % viability relative to DMSO only treated controls for BVD-523 and trametinib single agent treatments in A375 cells using the Alamar Blue cell viability assay. FIG. 14E shows % viability relative to DMSO only treated controls for BVD-523 and trametinib combination treatments in A375 cells using the Alamar Blue cell viability assay.

[0029] FIG. 15A is a dose matrix showing % inhibition of the trametinib/BVD-523 combination in A375 cells using the CellTiter-Glo cell viability assay. FIG. 15B is a dose matrix showing excess over Bliss for the trametinib/BVD-523 combination. FIGS. 15C and 15D show % viability relative to DMSO only treated controls for BVD-523 and trametinib single agent treatments in A375 cells using the CellTiter-Glo cell viability assay. FIG. 15E shows % viability relative to DMSO only treated controls for BVD- 523 and trametinib combination treatments in A375 cells using the CellTiter- Glo cell viability assay.

[0030] FIGS. 16A-D are a set of images showing Western blot analysis of MAPK signaling in A375 cells after a 4 hour treatment with various concentrations (in nM) of BVD-523, dabrafenib (Dab), and Trametinib (Tram). 40 pg of total protein was loaded in each lane except where indicated otherwise. In this experiment, duplicate samples were collected. FIGS. 16A and 16B show results from duplicate samples. Similarly, FIGS. 16C and 16D also show results from duplicate samples. In FIGS. 16A and 16B, pRSK1 had a relatively weak signal in A375 cells compared to other markers. A different pRSK1 -S380 antibody from Cell Signaling (cat. #1 1989) was tested but did not give a detectable signal (data not shown). In FIGS. 16C and 16D, pCRAF-338 gave a minimal signal.

[0031] FIGS. 17A-D are a set of images showing Western blot analysis of MAPK signaling in a human colorectal carcinoma cell line (HCT1 16 cells) after a 4 hour treatment with various concentrations (in nM) of BVD-523, dabrafenib (Dab), and Trametinib (Tram). 40 of total protein was loaded in each lane except where indicated otherwise. In this experiment, duplicate samples were collected. FIGS. 17A and 17B show results from duplicate samples. Similarly, FIGS. 17C and 17D also show results from duplicate samples. In FIGS. 17A-17B, pRSK1 levels appear to be very low in HCT1 16 cells, and in FIGS. 17C and 17D, pCRAF-338 signal was also very weak.

[0032] FIGS. 18A-D are a set of images showing Western blot analysis of cell cycle and apoptosis signaling in A375 melanoma cells after a 24 hour treatment with various concentrations (in nM) of BVD-523 ("BVD523"), trametinib ("tram") and/or dabrafenib ("Dab") as labelled. 50 g of total protein was loaded in each lane except where indicated otherwise. In this experiment, duplicate samples were collected. FIGS. 18A and 18B show results from duplicate samples. Similarly, FIGS. 18C and 18D also show results from duplicate samples. In FIGS. 18A and 18B, no band of a size corresponding to cleaved PARP (89 kDa) was apparent.

[0033] FIG. 19 shows that BVD-523 can treat acquired resistance to targeted drugs in-vivo. A patient-derived line, ST052C, was isolated from a BRAFV600E melanoma patient that progressed following 10 months of therapy with MAPK-pathway directed therapies. Treated ex vivo, ST052C exhibited acquired cross-resistance to dabrafenib at 50 mg/kg BID. Meanwhile, BVD-523 was effective in ST052C as a single-agent at 100 mg/kg BID.

[0034] FIG. 20 is a flowchart showing the dose escalation protocol used herein. [0035] FIG. 21 shows a schematic of the mitogen-activated protein kinases (MAPK) pathway.

[0036] FIG. 22 shows the results of single agent proliferation assays.

Proliferation results are shown for treatment with BVD-523 (FIG. 22A), SCH772984 (FIG. 22B), Dabrafenib (FIG. 22C), Trametinib (FIG. 22D), and Paclitaxel (FIG. 22E).

[0037] FIG. 23 shows the results of the combination of BVD-523 and Dabrafenib. FIG. 23A shows a dose matrix showing inhibition (%) for the combination in RKO parental cells. FIG. 23B - FIG. 23C show the results of single agent proliferation assays for the combination in 23A. FIG. 23D shows Loewe excess for the combination in 23A and FIG. 23E shows Bliss excess for the combination in 23A. FIG. 23F shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+) - clone 1 cells. FIG. 23G - FIG. 23H show the results of single agent proliferation assays for the combination in 23F. FIG. 23I shows Loewe excess for the combination in 23F and FIG. 23J shows Bliss excess for the combination in 23F. FIG. 23K shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+) - clone 2 cells. FIG. 23L - FIG. 23M show the results of single agent proliferation assays for the combination in 23K. FIG. 23N shows Loewe excess for the combination in 23K and FIG. 230 shows Bliss excess for the combination in 23K.

[0038] FIG. 24 shows the results of the combination of SCH772984 and Dabrafenib. FIG. 24A shows a dose matrix showing inhibition (%) for the combination in RKO parental cells. FIG. 24B - FIG. 24C show the results of single agent proliferation assays for the combination in 24A. FIG. 24D shows Loewe excess for the combination in 24A and FIG. 24E shows Bliss excess for the combination in 24A. FIG. 24F shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+) - clone 1 cells. FIG. 24G - FIG. 24H show the results of single agent proliferation assays for the combination in 24F. FIG. 24I shows Loewe excess for the combination in 24F and FIG. 24J shows Bliss excess for the combination in 24F. FIG. 24K shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+) - clone 2 cells. FIG. 24L - FIG. 24M show the results of single agent proliferation assays for the combination in 24K. FIG. 24N shows Loewe excess for the combination in 24K and FIG. 240 shows Bliss excess for the combination in 24K.

[0039] FIG. 25 shows the results of the combination of Trametinib and Dabrafenib. FIG. 25A shows a dose matrix showing inhibition (%) for the combination in RKO parental cells. FIG. 25B - FIG. 25C show the results of single agent proliferation assays for the combination in 25A. FIG. 25D shows Loewe excess for the combination in 25A and FIG. 25E shows Bliss excess for the combination in 25A. FIG. 25F shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+) - clone 1 cells. FIG. 25G - FIG. 25H show the results of single agent proliferation assays for the combination in 25F. FIG. 25I shows Loewe excess for the combination in 25F and FIG. 25J shows Bliss excess for the combination in 25F. FIG. 25K shows a dose matrix showing inhibition (%) for the combination in RKO MEK1 (Q56P/+) - clone 2 cells. FIG. 25L - FIG. 25M show the results of single agent proliferation assays for the combination in 25K. FIG. 25N shows Loewe excess for the combination in 25K and FIG. 250 shows Bliss excess for the combination in 25K.

[0040] FIG. 26A shows Lowe Volumes for the combinations tested.

FIG. 26B shows Bliss Volumes for the combinations tested. FIG. 26C shows Synergy Scores for the combinations tested.

[0041] FIG. 27 shows the changes in MAPK and Effector Pathway Signaling in MEK acquired resistance. Isogenic RKO parental and MEK1 (Q56P/+) cells were treated with compound for 4 or 24h and then immuno- blotted with the indicated antibodies. Dabrafenib was the BRAF inhibitor and trametinib was the MEK inhibitor. FIG. 27A shows increased signaling in RKO MEK1 (Q56P/+) cells. FIG 27B - FIG. 27C show the results of a 4 hour treatment in Experiment 1 (See, Example 7) in RKO Parental (27B) and RKO MEK1 (Q56P/+) (27C) cells. FIG. 27D - FIG. 27E show the results of a 4 hour treatment in Experiment 2 (See, Example 7) in RKO Parental (27D) and RKO MEK1 (Q56P/+) (27E) cells. FIG. 27F - FIG. 27G show the results of a 4 hour treatment in Experiment 2 (See, Example 7) in RKO Parental (27F) and RKO MEK1 (Q56P/+) (27G) cells. FIG. 27H - FIG. 27I show a summary of results in RKO Parental (27H) and RKO MEK1 (Q56P/+) (27I) cells.

[0042] FIG. 28 shows the results of the combination of BVD-523 and SCH772984. FIG. 28A shows a dose matrix showing inhibition (%) for the combination in A375 cells. FIG. 28B - FIG. 28C show the results of single agent proliferation assays for the combination in 28A. FIG. 28D shows Loewe excess for the combination in 28A and FIG. 28E shows Bliss excess for the combination in 28A. DETAILED DESCRIPTION OF THE INVENTION

[0043] One embodiment of the present invention is a method for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway inhibitor therapy. The method comprises administering to the subject an effective amount of BVD- 523 or a pharmaceutically acceptable salt thereof.

[0044] As used herein, the terms "treat," "treating," "treatment" and grammatical variations thereof mean subjecting an individual subject to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject, e.g., a patient. In particular, the methods and compositions of the present invention may be used to slow the development of disease symptoms or delay the onset of the disease or condition, or halt the progression of disease development. However, because every treated subject may not respond to a particular treatment protocol, regimen, process or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject population, e.g., patient population. Accordingly, a given subject or subject population, e.g., patient population may fail to respond or respond inadequately to treatment.

[0045] As used herein, the terms "ameliorate", "ameliorating" and grammatical variations thereof mean to decrease the severity of the symptoms of a disease in a subject.

[0046] As used herein, a "subject" is a mammal, preferably, a human. In addition to humans, categories of mammals within the scope of the present invention include, for example, farm animals, domestic animals, laboratory animals, etc. Some examples of farm animals include cows, pigs, horses, goats, etc. Some examples of domestic animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.

[0047] In the present invention, BVD-523 corresponds to a compound according to formula (I):

and pharmaceutically acceptable salts thereof. BVD-523 may be synthesized according to the methods disclosed, e.g., in U.S. Patent No. 7,354,939. Enantiomers and racemic mixtures of both enantiomers of BVD-523 are also contemplated within the scope of the present invention. BVD-523 is an ERK1/2 inhibitor with a mechanism of action that is believed to be, e.g., unique and distinct from certain other ERK1/2 inhibitors, such as SCH772984 and the pyrimidinal structure used by Hatzivassiliou et al. (2012). For example, other ERK1/2 inhibitors, such as SCH772984, inhibit autophosphorylation of ERK (Morris et al., 2013), whereas BVD-523 allows for the autophosphorylation of ERK while still inhibiting ERK. (See, e.g., FIG. 18). [0048] As used herein, the words "resistant" and "refractory" are used interchangeably. Being "resistant" to non-ERK MAPK pathway inhibitor therapy treatments means that non-ERK MAPK inhibitors have reduced efficacy in treating cancer.

[0049] As used herein, a "non-ERK MAPK inhibitor" means any substance that reduces the activity, expression or phosphorylation of proteins or other members of the MAPK pathway that results in a reduction of cell growth or an increase in cell death, with the exception of ERK1/2 inhibitors. As used herein, an "ERK1 /2 inhibitor" means those substances that (i) directly interact with ERK1 and/or ERK2, e.g. , by binding to ERK1 /2 and (ii) decrease the expression or the activity of ERK1 and/or ERK2 protein kinases. Therefore, inhibitors that act upstream of ERK1/2, such as MEK inhibitors and RAF inhibitors, are not ERK1/2 inhibitors according to the present invention (but they are non-ERK MAPK inhibitors). Non-limiting examples of ERK1/2 inhibitors according to the present invention include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), BVD-523 (BioMed Valley Discoveries, Inc.), SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof, and combinations thereof.

[0050] An overview of the mammalian MAPK cascades is shown in FIG. 21 . The MAPK pathway is reviewed in e.g., Akinleye et al., 2013. Briefly, with respect to the ERK1/2 module in FIG. 21 (light purple box), the MAPK 1 /2 signaling cascade is activated by ligand binding to receptor tyrosine kinases (RTK). The activated receptors recruit and phosphorylate adaptor proteins Grb2 and SOS, which then interact with membrane-bound GTPase Ras and cause its activation. In its activated GTP-bound form, Ras recruits and activates RAF kinases (A-RAF, B-RAF, and C-RAF/RAF-1 ). The activated RAF kinases activate MAPK 1/2 (MKK1/2), which in turn catalyzes the phosphorylation of threonine and tyrosine residues in the activation sequence Thr-Glu-Tyr of ERK1 /2. With respect to the JNK/p38 module (yellow box in FIG. 21 ), upstream kinases, MAP3Ks, such as MEKK1 /4, ASK1/2, and MLK1/2/3, activate MAP2K3/6 (MKK3/6), MAP2K4 (MKK4), and MAP2K7 (MKK7). These MAP2K's then activate JNK protein kinases, including JNK1 , JNK2, and JNK3, as well as p38 α/β/γ/δ. To execute their functions, JNKs activate several transcription factors, including c-Jun, ATF-2, NF-ATc1 , HSF-1 and STAT3. With respect to the ERK5 module (blue box in FIG. 21 ), the kinases upstream of MAP2K5 (MKK5) are MEKK2 and MEKK3. The best characterized downstream target of MEK5 is ERK5, also known as big MAP kinase 1 (BMK1 ) because it is twice the size of other MAPKs.

[0051] Non-limiting examples of non-ERK MAPK pathway inhibitors according to the present invention include RAS inhibitors, RAF inhibitors (such as, e.g., inhibitors of A-RAF, B-RAF, C-RAF (RAF-1 )), MEK inhibitors, and combinations thereof. Preferably, the non-ERK MAPK pathway inhibitors are BRAF inhibitors, MEK inhibitors, and combinations thereof.

[0052] As used herein, a "RAS inhibitor" means those substances that (i) directly interact with RAS, e.g., by binding to RAS and (ii) decrease the expression or the activity of RAS. Non-limiting exemplary RAS inhibitors include, but are not limited to, farnesyl transferase inhibitors (such as, e.g., tipifarnib and lonafarnib), farnesyl group-containing small molecules (such as, e.g., salirasib and TLN-4601 ), DCAI, as disclosed by Maurer (Maurer ei a/., 2012) , Kobe0065 and and Kobe2602, as disclosed by Shima (Shima ei a/.,

2013) , HBS 3 (Patgiri ei a/., 201 1 ), and AIK-4 (Allinky).

[0053] As used herein, a "RAF inhibitor" means those substances that (i) directly interact with RAF, e.g., by binding to RAF and (ii) decrease the expression or the activity of RAF, such as, e.g., A-RAF, B-RAF, and C-RAF (RAF-1 ). Non-limiting exemplary RAF inhibitors, including BRAF inhibitors, include:

Compound

Compound

Compound

 2014/071749

Compound 23

(Id), Compound 24

Compound 25

Compound 26

Compound 27

Compound 28 (Id.), Compound 30

Compound 31

Compound 32

Compound 33 Compound 34 d.),

Compound 35

{Id.),

Compound 36 ,

Compound 37 W.),

Compound 38

(Id.), Compound 39

(Id ),

Compound 40 (Id.),

AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ- 761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Institute of Cancer Research), dabrafenib (GSK21 18436), DP- 4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmith Kline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 51 26766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM- 336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.

[0054] As used herein, a "MEK inhibitor" means those substances that (i) directly interact with MEK, e.g., by binding to MEK and (ii) decrease the expression or the activity of MEK. Thus, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEF inhibitors according to the present invention. Non-limiting examples of MEK inhibitors include anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4- bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzoimidaz ole-5- carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)- oxanaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), RDEA1 19 (Ardea Biosciences/Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), RO092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1 ,4- diamino-2,3-dicyano-1 ,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal ef a/., 2010), pharmaceutically acceptable salts thereof, and combinations thereof. [0055] In one aspect of this embodiment, substantially all phosphorylation of ribosomal s6 kinase (RSK) is inhibited after administration of BVD-523 or a pharmaceutically acceptable salt thereof. As used herein in the context of RSK phosphorylation, "substantially all" means a reduction of greater than 50% reduction, preferably greater than 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% reduction.

[0056] In another aspect of this embodiment, the cancer has MAPK activity. As used herein, having "MAPK activity" means that proteins downstream of ERK are still active, even if proteins upstream of ERK may not be active. Such a cancer may be a solid tumor cancer or a hematologic cancer.

[0057] In the present invention, cancers include both solid and hemotologic cancers. Non-limiting examples of solid cancers include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (such as osteosarcoma), brain cancer, breast cancer, carcinoid cancer, carcinoma, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing family of cancers, extracranial germ cell cancer, eye cancer, gallbladder cancer, gastric cancer, germ cell tumor, gestational trophoblastic tumor, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma, kidney cancer, large intestine cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, liver tumor/cancer, lung tumor/cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome, myeloproliferative disorders, nasopharyngeal cancer, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pituitary cancer, plasma cell neoplasm, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell cancer, transitional cell cancer of the renal pelvis and ureter, salivary gland cancer, Sezary syndrome, skin cancers (such as cutaneous t-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.

[0058] Examples of hematologic cancers include, but are not limited to, leukemias, such as adult/childhood acute lymphoblastic leukemia, adult/childhood acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia, lymphomas, such as AIDS-related lymphoma, cutaneous T-cell lymphoma, adult/childhood Hodgkin lymphoma, mycosis fungoides, adult/childhood non-Hodgkin lymphoma, primary central nervous system lymphoma, Sezary syndrome, cutaneous T-cell lymphoma, and Waldenstrom macroglobulinemia, as well as other proliferative disorders such as chronic myeloproliferative disorders, Langerhans cell histiocytosis, multiple myeloma/plasma cell neoplasm, myelodysplastic syndromes, and myelodysplastic/myeloproliferative neoplasms.

[0059] Preferably, the cancer is selected from the group consisting of a cancer of the large intestine, breast cancer, pancreatic cancer, skin cancer, and endometrial cancers. More preferably, the cancer is melanoma. [0060] In another aspect of this embodiment, the method further comprises administering to the subject at least one additional therapeutic agent effective for treating or ameliorating the effects of the cancer. The additional therapeutic agent may be selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.

[0061] As used herein, an "antibody" encompasses naturally occurring immunoglobulins as well as non-naturally occurring immunoglobulins, including, for example, single chain antibodies, chimeric antibodies (e.g. , humanized murine antibodies), and heteroconjugate antibodies (e.g. , bispecific antibodies). Fragments of antibodies include those that bind antigen, (e.g., Fab', F(ab') ₂ , Fab, Fv, and rlgG). See also, e.g., Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, III.); Kuby, J., Immunology, 3rd Ed ., W.H. Freeman & Co., New York (1998). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. The term "antibody" further includes both polyclonal and monoclonal antibodies.

[0062] Examples of therapeutic antibodies that may be used in the present invention include rituximab (Rituxan), Cetuximab (Erbitux), bevacizumab (Avastin), and Ibritumomab (Zevalin).

[0063] Cytotoxic agents according to the present invention include DNA damaging agents, antimetabolites, anti-microtubule agents, antibiotic agents, etc. DNA damaging agents include alkylating agents, platinum-based agents, intercalating agents, and inhibitors of DNA replication. Non-limiting examples of DNA alkylating agents include cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of platinum-based agents include cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of intercalating agents include doxorubicin, daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of inhibitors of DNA replication include irinotecan, topotecan, amsacrine, etoposide, etoposide phosphate, teniposide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Antimetabolites include folate antagonists such as methotrexate and premetrexed, purine antagonists such as 6-mercaptopurine, dacarbazine, and fludarabine, and pyrimidine antagonists such as 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Anti- microtubule agents include without limitation vinca alkaloids, paclitaxel (Taxol®), docetaxel (Taxotere®), and ixabepilone (Ixempra®). Antibiotic agents include without limitation actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.

[0064] Cytotoxic agents according to the present invention also include an inhibitor of the PI3K/Akt pathway. Non-limiting examples of an inhibitor of the PI3K/Akt pathway include A-674563 (CAS # 552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041 164 (5-benzo[1 ,3]dioxol-5- ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro- benzo[1 ,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5- quinoxilin-6-methylene-1 ,3-thiazolidine-2,4-dione), AT7867 (CAS # 857531 - 00-1 ), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS # 32387-96-5), CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS # 612847-09-3, CAS # 681281 -88-9, CAS # 75747-14-7, CAS # 925681 -41 -0, CAS # 98510- 80-6, CCT128930 (CAS # 885499-61 -6), CH5132799 (CAS # 1007207-67-1 ), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS # 902779-59-3), GS-1101 (CAL-101 ) (Gilead Sciences), GSK 690693 (CAS # 937174-76-0), H-89 (CAS # 127243-85-0), Honokiol, IC871 14 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS # 108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS # 1032350- 13-2), ML-9 (CAS # 105637-50-1 ), Naltrindole Hydrochloride, OXY-1 1 1A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS # 1 191951 -57-1 ), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3- alpha/delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta/gamma inhibitors, Intellikine (Intellikine Inc.), PI3- delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, lntellikine-1 (Intellikine Inc.), PI3K delta/gamma inhibitors, lntellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS # 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1 126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, Tetrahydro Curcumin, TG100-1 15 (Targegen Inc., San Diego, CA), Triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

[0065] In the present invention, the term "toxin" means an antigenic poison or venom of plant or animal origin. An example is diphtheria toxin or portions thereof.

[0066] In the present invention, the term "radionuclide" means a radioactive substance administered to the patient, e.g., intravenously or orally, after which it penetrates via the patient's normal metabolism into the target organ or tissue, where it delivers local radiation for a short time. Examples of radionuclides include, but are not limited to, 1-125, At-21 1 , Lu-177, Cu-67, I- 131 , Sm-153, Re-186, P-32, Re-188, ln-1 14m, and Y-90.

[0067] In the present invention, the term "immunomodulator" means a substance that alters the immune response by augmenting or reducing the ability of the immune system to produce antibodies or sensitized cells that recognize and react with the antigen that initiated their production. Immunomodulators may be recombinant, synthetic, or natural preparations and include cytokines, corticosteroids, cytotoxic agents, thymosin, and immunoglobulins. Some immunomodulators are naturally present in the body, and certain of these are available in pharmacologic preparations. Examples of immunomodulators include, but are not limited to, granulocyte colony- stimulating factor (G-CSF), interferons, imiquimod and cellular membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, and synthetic cytosine phosphate-guanosine (CpG).

[0068] In the present invention, the term "photoactive therapeutic agent" means compounds and compositions that become active upon exposure to light. Certain examples of photoactive therapeutic agents are disclosed, e.g., in U.S. Patent Application Serial No. 201 1/0152230 A1 , "Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy."

[0069] In the present invention, the term "radiosensitizing agent" means a compound that makes tumor cells more sensitive to radiation therapy. Examples of radiosensitizing agents include misonidazole, metronidazole, tirapazamine, and trans sodium crocetinate. [0070] In the present invention, the term "hormone" means a substance released by cells in one part of a body that affects cells in another part of the body. Examples of hormones include, but are not limited to, prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, antimullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin- releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, Cortisol, progesterone, calcitriol, and calcidiol.

[0071] Some compounds interfere with the activity of certain hormones or stop the production of certain hormones. These hormone-interfering compounds include, but are not limited to, tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds are also within the meaning of hormone in the present invention.

[0072] As used herein, an "anti-angiogenesis" agent means a substance that reduces or inhibits the growth of new blood vessels, such as, e.g., an inhibitor of vascular endothelial growth factor (VEGF) and an inhibitor of endothelial cell migration. Anti-angiogenesis agents include without limitation 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-a, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.

[0073] Another embodiment of the present invention is a method for treating or ameliorating the effects of a cancer in a subject. The method comprises:

(a) identifying a subject with cancer that has become refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or BRAF and MEK inhibitor therapy; and

(b) administering to the subject with said refractory or resistant cancer an effective amount of an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.

[0074] Suitable and preferred subjects are as disclosed herein. In this embodiment, the methods may be used to treat the cancers disclosed above. In accordance with the present invention, the cancer may have MAPK activity.

[0075] In one aspect of this embodiment, identifying a subject with cancer that is refractory or resistant to BRAF and/or MEK inhibitor therapy comprises:

(a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has become resistant to an inhibitor therapy selected from the group consisting of BRAF inhibitor therapy, MEK inhibitor therapy, and combinations thereof.

[0076] In the present invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsies. Biological samples are obtained from a subject by routine procedures and methods which are known in the art.

[0077] Preferably, screening for a cancer that is refractory or resistant to BRAF inhibitor therapy may comprise, e.g., identifying (i) a switch between RAF isoforms, (ii) upregulation of RTK or NRAS signaling, (iii) reactivation of mitogen activated protein kinase (MAPK) signaling, (iv) the presence of a MEK activating mutation, and combinations thereof.

[0078] A switch between RAF isoforms may occur in subjects having acquired resistance to BRAF inhibitor therapy. To detect such a switch, BRAF inhibitor-resistant tumor cells may be retrieved from a patient and analyzed via Western blotting for ERK and phospho-ERK levels in the presence of a BRAF inhibitor. Comparison with BRAF inhibitor-sensitive cells treated with a BRAF inhibitor may reveal higher levels of phospho-ERK in BRAF inhibitor-resistant tumor cells, implying that a switch has taken place in which another RAF isoform phosphorylates ERK in place of BRAF. Confirmation of which RAF isoform has taken over may involve sh/siRNA- mediated knockdown of ARAF and CRAF individually in BRAF inhibitor- resistant cells exposed to a BRAF inhibitor, followed by subsequent Western blotting for ERK and phospho-ERK levels. If, for example, ARAF knockdown in BRAF inhibitor-resistant cells exposed to a BRAF inhibitor still results in high levels of phospho-ERK, it would indicate that CRAF has taken over phosphorylating ERK. Likewise, if CRAF was knocked down in BRAF inhibitor-resistant cells exposed to BRAF inhibitor and ERK was still highly phosphorylated, it would mean that ARAF has taken over ERK phosphorylation. RAF isoform switching may also involve simultaneous knockdown of ARAF and CRAF in BRAF inhibitor-resistant cells in the presence of BRAF inhibitor, effectively blocking all RAF-mediated phosphorylation. A resulting decrease in ERK phosphorylation would indicate that the BRAF inhibitor-resistant cells have the capacity to switch between RAF isoforms in order to phosphorylate ERK (Villanueva, et al., 2010).

[0079] Upregulation of RTK or NRAS signaling may also be a cause of BRAF inhibitor resistance. Detection may, e.g., first involve using Western blotting protocols with phospho-specific antibodies to analyze the activation of the downstream RAF effectors MEK1/2 and ERK1/2. If BRAF inhibitor- resistant cells show high activation levels of these proteins in the presence of a BRAF inhibitor, RTK or NRAS upregulation may be the cause. Gene expression profiling (or other related methods) of BRAF inhibitor-resistant cells in the presence of a BRAF inhibitor may reveal higher expression levels of KIT, MET, EGFR, and PDGFRp RTKs as compared to BRAF inhibitor- sensitive cells. Real-time quantitative polymerase chain reaction experiments, or other similar procedures, focusing on any of these genes may confirm higher expression levels while phospho-RTK arrays (R&D Systems, Minneapolis, MN) may show elevated activation-associated tyrosine phosphorylation. Alternatively, NRAS activation may be detected by various gene sequencing protocols. Activating mutations in NRAS, particularly Q61 K, may indicate that B-RAF signaling has been bypassed. In melanoma cells, activated NRAS uses C-RAF to signal to MEK-ERK. Thus, activated NRAS may enable a similar bypass pathway in BRAF inhibitor-resistant cells exposed to BRAF inhibitor. Further confirmation of these mechanisms in a given BRAF inhibitor-resistant sample may be accomplished, for example, using sh/siRNA-mediated knockdown of upregulated RTKs or activated NRAS in the presence of BRAF inhibitor. Any significant levels of growth inhibition may indicate that upregulation of RTK or NRAS signaling is the cause of BRAF inhibition in that particular sample (Nazarian, et al., 2010).

[0080] Detecting reactivation of MAPK signaling in BRAF inhibitor- resistant cells may indicate another bypass mechanism for BRAF inhibitor resistance. COT and C-RAF have been shown to be upregulated in a BRAF V600E background exposed to BRAF inhibitor. Quantiative real-time RT- PCR, e.g., may reveal increased COT expression in BRAF inhibitor-resistant cells in the presence of BRAF inhibitor. Furthermore, sh/siRNA-mediated knockdown of COT in BRAF inhibitor-resistant cells in the presence of BRAF inhibitor may reduce the viability of BRAF inhibitor-resistant cells, indicating that these particular cells may be sensitive to COT inhibition and/or combination BRAF inhibitor/MEK inhibitor treatments (Johannessen, et al., 2010).

[0081] Reactivation of MAPK signaling may also be accomplished in a BRAF inhibitor-resistant background by activating mutations in MEK1 . Targeted, massively parallel sequencing of genomic DNA from a BRAF inhibitor-resistant tumor may reveal activating mutations in MEK1 , such as C121 S, G128D, N122D, and Y130, among others. Other, undocumented mutations in MEK1 may be analyzed by, for example, expressing the particular mutation in a BRAF inhibitor-sensitive cell line such as A375. Determining levels of growth inhibition in these cells upon exposure to BRAF inhibitor may indicate if the MEK1 mutation is causing resistance to BRAF inhibitory therapy. To confirm such a finding, Western blotting for elevated levels of phospho-ERK1/2 in cells ectopically expressing the MEK1 mutation may indicate that the MEK1 mutation is allowing the BRAF inhibitor-resistant tumor to bypass BRAF and promote phosphorylation of ERK through MEK1 (Wagle, et al., 201 1 ).

[0082] In accordance with the present invention, screening for a cancer that is refractory or resistant to MEK inhibitor therapy may comprise, e.g., identifying (i) amplification of mutant BRAF, (ii) STAT3 upregulation, (iii) mutations in the allosteric pocket of MEK that directly block binding of inhibitors to MEK or lead to constitutive MEK activity, and combinations thereof.

[0083] Amplification of mutant BRAF may cause MEK inhibitor resistance. MEK inhibitor resistance is typically associated with high levels of phosphorylated ERK and MEK in the presence of a MEK inhibitor, which may be assessed via, for example, Western blotting. Amplification of mutant BRAF in MEK inhibitor-resistant cell lines may be detected by, for example, fluorescence in situ hybridization (FISH) or quantitative PCR from genomic DNA of the resistant cell lines. Confirmation that BRAF amplification is a primary cause of MEK inhibitor resistance may entail using BRAF-targeted sh/siRNAs in resistant cells. If a significant decrease in MEK or ERK phosphorylation is observed, BRAF amplification may be a suitable target for further therapeutic approaches. (Corcoran, et al., 2010).

[0084] Identifying STAT3 upregulation may indicate that a particular tumor sample is resistant to MEK inhibitor therapy. Genome-wide expression profiling may reveal the STAT3 pathway to be upregulated in a tumor. Other techniques, such as Western blotting for phospho-STAT3 and real-time qPCR for the STAT pathway-associated genes JAK1 and IL6ST may reveal upregulated STAT3. Further confirmation that STAT3 upregulation causes MEK inhibitor resistance in a particular sample may comprise the use of sh/siRNAs against STAT3 in the sample followed by appropriate Western blotting for MEK and ERK activation as well as phospho-STAT3 and total STAT3. Growth inhibition studies may show that STAT3 knockdown sensitizes previously MEK inhibitor-resistant cells to MEK inhibition. A similar effect may be seen if the sample were exposed to a STAT3 inhibitor such as JSI-124. Additional confirmation that STAT3 upregulation is the cause of MEK inhibitor resistance in a particular tumor could arise from Western blotting for BIM expression, including BIM-EL, BIM-L, and BIM-SL. BIM expression leads to MEK inhibitor-induced apoptosis, thus STAT3 upregulation may lower BIM levels. STAT3 is known to regulate the expression of miR 17-92, which suppresses BIM expression. Upregulated STAT3 may lead to higher levels of miR 17-92, which will lower BIM levels and promote resistance to MEK inhibition. Thus, real-time qPCR of miR 17- 92 levels may also assist in assessing whether STAT3 upregulation is causing MEK inhibition resistance in a particular sample. (Dai, et al., 201 1 ). [0085] Mutations in the allosteric pocket of MEK that can directly block binding of inhibitors to MEK or lead to constitutive MEK activity may be detected by methods disclosed below. Such mutations have been identified previously by Emery and colleagues (Emery, et al., 2009) as well as Wang and colleagues (Wang et al., 201 1 ). Other mutations may affect MEK1 codons located within or abutting the N-terminal negative regulatory helix, such as P124L and Q56P. (Id.).

[0086] Methods for identifying mutations in nucleic acids, such as the above identified MEK genes, are known in the art. Nucleic acids may be obtained from biological samples. In the present invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsies. Biological samples are obtained from a subject by routine procedures and methods which are known in the art.

[0087] Non-limiting examples of methods for identifying mutations include PCR, sequencing, hybrid capture, in-solution capture, molecular inversion probes, fluorescent in situ hybridization (FISH) assays, and combinations thereof.

[0088] Various sequencing methods are known in the art. These include, but are not limited to, Sanger sequencing (also referred to as dideoxy sequencing) and various sequencing-by-synthesis (SBS) methods as disclosed in, e.g., Metzker 2005, sequencing by hybridization, by ligation (for example, WO 2005021786), by degradation (for example, U.S. Patent Nos. 5,622,824 and 6,140,053) and nanopore sequencing (which is commercially available from Oxford Nanopore Technologies, UK). In deep sequencing techniques, a given nucleotide in the sequence is read more than once during the sequencing process. Deep sequencing techniques are disclosed in e.g., U.S. Patent Publication No. 20120264632 and International Patent Publication No. WO2012125848.

[0089] PCR-based methods for detecting mutations are known in the art and employ PCR amplification, where each target sequence in the sample has a corresponding pair of unique, sequence-specific primers. For example, the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method allows for rapid detection of mutations after the genomic sequences are amplified by PCR. The mutation is discriminated by digestion with specific restriction endonucleases and is identified by electrophoresis. See, e.g., Ota et al., 2007. Mutations may also be detected using real time PCR. See, e.g., International Application publication No. WO2012046981 .

[0090] Hybrid capture methods are known in the art and are disclosed in e.g., U.S. Patent Publication No. 20130203632 and U.S. Patent Nos. 8,389,219 and 8,288,520. These methods are based on the selective hybridization of the target genomic regions to user-designed oligonucleotides. The hybridization can be to oligonucleotides immobilized on high or low density microarrays (on-array capture), or solution-phase hybridization to oligonucleotides modified with a ligand (e.g. biotin) which can subsequently be immobilized to a solid surface, such as a bead (in-solution capture).

[0091] Molecular Inversion Probe (MIP) techniques are known in the art and are disclosed in e.g. , Absalan et al., 2008. This method uses MIP molecules, which are special "padlock" probes (Nilsson et al, 1994) for genotyping. A MIP molecule is a linear oligonucleotide that contains specific regions, universal sequences, restriction sites and a Tag (index) sequence (16-22 bp). A MIP hybridizes directly around the genetic marker/SNP of interest. The MIP method may also use a number of "padlock" probe sets that hybridize to genomic DNA in parallel (Hardenbol et al., 2003). In case of a perfect match, genomic homology regions are ligated by undergoing an inversion in configuration (as suggested by the name of the technique) and creating a circular molecule. After the first restriction, all molecules are amplified with universal primers. Amplicons are restricted again to ensure short fragments for hybridization on a microarray. Generated short fragments are labeled and, through a Tag sequence, hybridized to a cTag (complementary strand for index) on an array. After the formation of Tag-cTag duplex, a signal is detected.

[0092] The following Tables 1 , 2, and 3 show the SEQ ID Nos. of representative nucleic acid and amino acid sequences of wild type BRAF, N- RAS, and MEK1 from various animals in the sequence listing. These sequences may be used in methods for identifying subjects with mutant BRAF, N-RAS, and MEK1 genotypes.

Table 1 - BRAF sequences

SEQ ID NO. polypeptide or Organism Other nucleic acid information sequence

cuniculus

polypeptide rabbit,

Oryctolagus

8 cuniculus

nucleic acid guinea pig, Cavia

9 porcellus

polypeptide guinea pig, Cavia

10 porcellus

nucleic acid dog, Canis lupus variant x1

11 familiaris

polypeptide dog, Canis lupus variant x1

12 familiaris

nucleic acid dog, Canis lupus variant x2

13 familiaris

polypeptide dog, Canis lupus variant x2

14 familiaris

15 nucleic acid cat, Felis catus

16 polypeptide cat, Felis catus

17 nucleic acid cow, Bos taurus variant X1

18 polypeptide cow, Bos taurus variant X1

19 nucleic acid cow, Bos taurus variant X2

20 polypeptide cow, Bos taurus variant X2

21 nucleic acid cow, Bos taurus variant X3

22 polypeptide cow, Bos taurus variant X3

23 nucleic acid cow, Bos taurus variant X4

24 polypeptide cow, Bos taurus variant X4

25 nucleic acid cow, Bos taurus variant X5

26 polypeptide cow, Bos taurus variant X5

27 nucleic acid cow, Bos taurus variant X6

28 polypeptide cow, Bos taurus variant X6

29 nucleic acid cow, Bos taurus variant X7

30 polypeptide cow, Bos taurus variant X7

31 nucleic acid cow, Bos taurus variant X8

32 polypeptide cow, Bos taurus variant X8

33 nucleic acid cow, Bos taurus variant X9

34 polypeptide cow, Bos taurus variant X9

35 nucleic acid cow, Bos taurus variant X10

36 polypeptide cow, Bos taurus variant X10

37 nucleic acid cow, Bos taurus variant X1 1

38 polypeptide cow, Bos taurus variant X1 1

39 nucleic acid cow, Bos taurus variant 2

40 polypeptide cow, Bos taurus variant 2

41 nucleic acid horse, Equus

caballus

42 polypeptide horse, Equus

caballus SEQ ID NO. polypeptide or Organism Other nucleic acid information sequence

43 nucleic acid chicken, Gallus

gallus

44 polypeptide chicken, Gallus

gallus

Table 2 - N-RAS sequences

Table 3 - MEK1 sequences

SEQ ID NO. polypeptide or Organism

nucleic acid

sequence

70 polypeptide rabbit, Oryctolagus cuniculus

71 nucleic acid guinea pig, Cavia porcellus

72 polypeptide guinea pig, Cavia porcellus

73 nucleic acid dog, Canis lupus familiaris

74 polypeptide dog, Canis lupus familiaris

75 nucleic acid cat, Felis catus

76 polypeptide cat, Felis catus

77 nucleic acid cow, Bos taurus

78 polypeptide cow, Bos taurus

79 nucleic acid horse, Equus caballus

80 polypeptide horse, Equus caballus

81 nucleic acid chicken, Gallus gallus

82 polypeptide chicken, Gallus gallus

[0093] In another aspect of this embodiment, the method further comprises administering at least one additional therapeutic agent, preferably an inhibitor of the PI3K Akt pathway, as disclosed herein.

[0094] A further embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject, which cancer is refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or both. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

[0095] Suitable and preferred subjects are as disclosed herein. In this embodiment, the methods may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds, resistance profiles, and MAPK activity identified above. Methods of identifying such mutations are also as set forth above. [0096] In a further aspect of this embodiment, the method further comprises administering to the subject at least one additional therapeutic agent, preferably an inhibitor of the PI3K/Akt pathway, as disclosed herein.

[0097] Another embodiment of the present invention is a method for identifying a subject having cancer who would benefit from therapy with an ERK inhibitor. The method comprises:

(a) obtaining a biological sample from the subject; and

(b) screening the sample to determine whether the subject has one or more of the following markers:

(i) a switch between RAF isoforms,

(ii) upregulation of RTK or NRAS signaling,

(iii) reactivation of mitogen activated protein kinase (MAPK) signaling,

(iv) the presence of a MEK activating mutation,

(v) amplification of mutant BRAF,

(vi) STAT3 upregulation,

(vii) mutations in the allosteric pocket of MEK that directly block binding of inhibitors to

MEK or lead to constitutive MEK activity,

wherein the presence of one or more of the markers confirms that the subject's cancer is refractory or resistant to BRAF and/or MEK inhibitor therapy and that the subject would benefit from therapy with an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.

[0098] Suitable and preferred subjects are as disclosed herein. In this embodiment, the methods may be used to identify a subject having cancers disclosed above, including those cancers with the mutational backgrounds, resistance profiles, and MAPK activity identified above. Methods of identifying such mutations are also as set forth above.

[0099] In one aspect of this embodiment, the method further comprises administering BVD-523 or a pharmaceutically acceptable salt thereof to a subject having one or more of the markers. Preferably, the method additionally comprises administering to the subject having one or more of the markers at least one additional therapeutic agent, preferably an inhibitor of the PI3K/Akt pathway, as disclosed herein.

[0100] An additional embodiment of the present invention is a pharmaceutical composition for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy. The composition comprises a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

[0101] Suitable and preferred subjects and types of non-ERK MAPK pathway inhibitor therapy are as disclosed herein. In this embodiment, the pharmaceutical composition may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds, resistance profiles, and MAPK activity identified above. Methods of identifying such mutations are also as set forth above.

[0102] In one aspect of this embodiment, the pharmaceutical composition further comprises at least one additional therapeutic agent, preferably an inhibitor of the PI3K/Akt pathway, as disclosed herein. [0103] Another embodiment of the present invention is a kit for treating or ameliorating the effects of a cancer in a subject, which cancer is refractory or resistant to non-ERK MAPK pathway therapy. This kit comprises any pharmaceutical composition according to the present invention packaged together with instructions for its use.

[0104] The kits may also include suitable storage containers, e.g., ampules, vials, tubes, etc., for each pharmaceutical composition and other reagents, e.g., buffers, balanced salt solutions, etc., for use in administering the pharmaceutical compositions to subjects. The pharmaceutical compositions and other reagents may be present in the kits in any convenient form, such as, e.g., in a solution or in a powder form. The kits may further include a packaging container, optionally having one or more partitions for housing the pharmaceutical composition and other optional reagents.

[0105] Suitable and preferred subjects and types of non-ERK MAPK pathway inhibitor therapy are as disclosed herein. In this embodiment, the kit may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds, resistance profiles, and MAPK activity identified herein. Methods of identifying such mutations are as set forth above.

[0106] In one aspect of this embodiment, the kit further comprises at least one additional therapeutic agent, preferably an inhibitor of the PI3K/Akt pathway, as disclosed herein.

[0107] Another embodiment of the present invention is a method for inhibiting phosphorylation of RSK in a cancer cell that is refractory or resistant to a non-ERK MAPK pathway inhibitor. The method comprises contacting the cancer cell with an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof for a period of time sufficient for phosphorylation of RSK in the cancer cell to be inhibited. In this embodiment, "contacting" means bringing BVD-523 or a pharmaceutically acceptable salt thereof and optionally one or more additional therapeutic agents into close proximity to the cancer cells. This may be accomplished using conventional techniques of drug delivery to mammals, or in the in vitro situation by, e.g., providing BVD- 523 or a pharmaceutically acceptable salt thereof and optionally other therapeutic agents to a culture media in which the cancer cells are located. In the ex vivo situation, contacting may be carried out by, e.g., providing BVD- 523 or a pharmaceutically acceptable salt thereof and optionally other therapeutic agents to a cancerous tissue.

[0108] Suitable and preferred types of non-ERK MAPK pathway inhibitors are as disclosed herein. In this embodiment, effecting cancer cell death may be accomplished in cancer cells having various mutational backgrounds, resistance profiles, and MAPK activity as disclosed above. Methods of identifying such mutations are also as set forth above.

[0109] The methods of this embodiment, which may be carried out in vitro, ex vivo, or in vivo, may be used to effect cancer cell death, by e.g., killing cancer cells, in cells of the types of cancer disclosed herein.

[0110] In one aspect of this embodiment, greater than 50% of RSK phosphorylation is inhibited. In another aspect of this embodiment, greater than 75% of RSK phosphorylation is inhibited. In an additional aspect of this embodiment, greater than 90% of RSK phosphorylation is inhibited. In a further aspect of this embodiment, greater than 95% of RSK phosphorylation is inhibited. In another aspect of this embodiment, greater than 99% of RSK phosphorylation is inhibited. In an additional aspect of this embodiment, 100% of RSK phosphorylation is inhibited.

[0111] In a further aspect of this embodiment, the cancer cell is a mammalian cancer cell. Preferably, the mammalian cancer cell is obtained from a mammal selected from the group consisting of humans, primates, farm animals, and domestic animals. More preferably, the mammalian cancer cell is a human cancer cell.

[0112] In a further aspect of this embodiment, the contacting step comprises administering BVD-523 or a pharmaceutically acceptable salt to a subject from whom the cancer cell was obtained.

[0113] In the present invention, an "effective amount" or a "therapeutically effective amount" of a compound or composition disclosed herein is an amount of such compound or composition that is sufficient to effect beneficial or desired results as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts may be determined empirically, and making such determinations is within the skill of the art. It is understood by those skilled in the art that the dosage amount will vary with the route of administration, the rate of excretion, the duration of the treatment, the identity of any other drugs being administered, the age, size, and species of mammal, e.g. , human patient, and like factors well known in the arts of medicine and veterinary medicine. In general, a suitable dose of a compound or composition according to the invention will be that amount of the composition, which is the lowest dose effective to produce the desired effect. The effective dose of a compound or composition of the present invention may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.

[0114] A suitable, non-limiting example of a dosage of a BVD-523 and other anti-cancer agents disclosed herein is from about 1 mg/kg to about 2400 mg/kg per day, such as from about 1 mg/kg to about 1200 mg/kg per day, 75 mg/kg per day to about 300 mg/kg per day, including from about 1 mg/kg to about 100 mg/kg per day. Other representative dosages of such agents include about 1 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, 50 mg/kg, 60 mg/kg, 70 mg/kg, 75 mg/kg, 80 mg/kg, 90 mg/kg, 100 mg/kg, 125 mg/kg, 150 mg/kg, 175 mg/kg, 200 mg/kg, 250 mg/kg, 300 mg/kg, 400 mg/kg, 500 mg/kg, 600 mg/kg, 700 mg/kg, 800 mg/kg, 900 mg/kg, 1000 mg/kg, 1 100 mg/kg, 1200 mg/kg, 1300 mg/kg, 1400 mg/kg, 1500 mg/kg, 1600 mg/kg, 1700 mg/kg, 1800 mg/kg, 1900 mg/kg, 2000 mg/kg, 2100 mg/kg, 2200 mg/kg, and 2300 mg/kg per day. The effective dose of BVD-523 and other anti-cancer agents disclosed herein, may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.

[0115] The BVD-523, other inhibitors, and various other anti-cancer agents disclosed herein, or a pharmaceutical composition of the present invention may be administered in any desired and effective manner: for oral ingestion, or as an ointment or drop for local administration to the eyes, or for parenteral or other administration in any appropriate manner such as intraperitoneal, subcutaneous, topical, intradermal, inhalation, intrapulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intraarterial, intrathecal, or intralymphatic. Further, BVD-523, other inhibitors, and various other anticancer agents disclosed herein, or a pharmaceutical composition of the present invention may be administered in conjunction with other treatments. BVD-523, other inhibitors, and various other anti-cancer agents disclosed herein, or a pharmaceutical composition of the present invention may be encapsulated or otherwise protected against gastric or other secretions, if desired.

[0116] The pharmaceutical compositions of the invention comprise one or more active ingredients in admixture with one or more pharmaceutically- acceptable diluents or carriers and, optionally, one or more other compounds, drugs, ingredients and/or materials. Regardless of the route of administration selected, the agents/compounds of the present invention are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art. See, e.g., Remington, The Science and Practice of Pharmacy (21 ^st Edition, Lippincott Williams and Wilkins, Philadelphia, PA.).

[0117] Pharmaceutically acceptable diluents or carriers are well known in the art (see, e.g., Remington, The Science and Practice of Pharmacy (21 ^st Edition, Lippincott Williams and Wilkins, Philadelphia, PA.) and The National Formulary (American Pharmaceutical Association, Washington, D.C.)) and include sugars (e.g., lactose, sucrose, mannitol, and sorbitol), starches, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (e.g., ethyl alcohol, propyl alcohol, and benzyl alcohol), polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and tryglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoesters), and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (e.g., corn, germ, olive, castor, sesame, cottonseed, and groundnut), cocoa butter, waxes (e.g., suppository waxes), paraffins, silicones, talc, silicylate, etc. Each pharmaceutically acceptable diluent or carrier used in a pharmaceutical composition of the invention must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Diluents or carriers suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable diluents or carriers for a chosen dosage form and method of administration can be determined using ordinary skill in the art.

[0118] The pharmaceutical compositions of the invention may, optionally, contain additional ingredients and/or materials commonly used in pharmaceutical compositions. These ingredients and materials are well known in the art and include (1 ) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, hydroxypropylmethyl cellulose, sucrose and acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethyl cellulose and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, and sodium lauryl sulfate; (10) suspending agents, such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth; (1 1 ) buffering agents; (12) excipients, such as lactose, milk sugars, polyethylene glycols, animal and vegetable fats, oils, waxes, paraffins, cocoa butter, starches, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonites, silicic acid, talc, salicylate, zinc oxide, aluminum hydroxide, calcium silicates, and polyamide powder; (13) inert diluents, such as water or other solvents; (14) preservatives; (15) surface-active agents; (16) dispersing agents; (17) control-release or absorption-delaying agents, such as hydroxypropylmethyl cellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin, and waxes; (18) opacifying agents; (19) adjuvants; (20) wetting agents; (21 ) emulsifying and suspending agents; (22), solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan; (23) propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane; (24) antioxidants; (25) agents which render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickening agents; (27) coating materials, such as lecithin; and (28) sweetening, flavoring, coloring, perfuming and preservative agents. Each such ingredient or material must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for a chosen dosage form and method of administration may be determined using ordinary skill in the art.

[0119] The pharmaceutical compositions of the present invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, powders, granules, a solution or a suspension in an aqueous or nonaqueous liquid, an oil-in-water or water-in-oil liquid emulsion, an elixir or syrup, a pastille, a bolus, an electuary or a paste. These formulations may be prepared by methods known in the art, e.g., by means of conventional pan- coating, mixing, granulation or lyophilization processes.

[0120] Solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules and the like) may be prepared, e.g., by mixing the active ingredient(s) with one or more pharmaceutically-acceptable diluents or carriers and, optionally, one or more fillers, extenders, binders, humectants, disintegrating agents, solution retarding agents, absorption accelerators, wetting agents, absorbents, lubricants, and/or coloring agents. Solid compositions of a similar type may be employed as fillers in soft and hard-filled gelatin capsules using a suitable excipient. A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using a suitable binder, lubricant, inert diluent, preservative, disintegrant, surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine. The tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical- formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein. They may be sterilized by, for example, filtration through a bacteria-retaining filter. These compositions may also optionally contain opacifying agents and may be of a composition such that they release the active ingredient only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. The active ingredient can also be in microencapsulated form.

[0121] Liquid dosage forms for oral administration include pharmaceutically-acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. The liquid dosage forms may contain suitable inert diluents commonly used in the art. Besides inert diluents, the oral compositions may also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents. Suspensions may contain suspending agents.

[0122] The pharmaceutical compositions of the present invention for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more active ingredient(s) with one or more suitable nonirritating diluents or carriers which are solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound. The pharmaceutical compositions of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such pharmaceutically-acceptable diluents or carriers as are known in the art to be appropriate.

[0123] Dosage forms for the topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, drops and inhalants. The active agent(s)/compound(s) may be mixed under sterile conditions with a suitable pharmaceutically-acceptable diluent or carrier. The ointments, pastes, creams and gels may contain excipients. Powders and sprays may contain excipients and propellents.

[0124] The pharmaceutical compositions of the present invention suitable for parenteral administrations may comprise one or more agent(s)/compound(s) in combination with one or more pharmaceutically- acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain suitable antioxidants, buffers, solutes which render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Proper fluidity can be maintained, for example, by the use of coating materials, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. These pharmaceutical compositions may also contain suitable adjuvants, such as wetting agents, emulsifying agents and dispersing agents. It may also be desirable to include isotonic agents. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption.

[0125] In some cases, in order to prolong the effect of a drug {e.g., pharmaceutical formulation), it is desirable to slow its absorption from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility.

[0126] The rate of absorption of the active agent/drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally- administered agent/drug may be accomplished by dissolving or suspending the active agent/drug in an oil vehicle. Injectable depot forms may be made by forming microencapsule matrices of the active ingredient in biodegradable polymers. Depending on the ratio of the active ingredient to polymer, and the nature of the particular polymer employed, the rate of active ingredient release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue. The injectable materials can be sterilized for example, by filtration through a bacterial-retaining filter.

[0127] The formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampules and vials, and may be stored in a lyophilized condition requiring only the addition of the sterile liquid diluent or carrier, for example water for injection, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the type described above. [0128] The present invention provides treatment of cancer which is refractory or resistant to non-ERK APK pathway inhibitor therapy and discloses combinations shown to enhance the effects of ERK inhibitors. Herein, applicants have also shown that the combination of different ERK inhibitors is likewise synergistic. Therefore, it is contemplated that the effects of the combinations described herein can be further improved by the use of one or more additional ERK inhibitors. Accordingly, some embodiments of the present invention include one or more additional ERK inhibitors.

[0129] The following examples are provided to further illustrate the methods of the present invention. These examples are illustrative only and are not intended to limit the scope of the invention in any way.

EXAMPLES

Example 1

MATERIALS AND METHODS

[0130] Cancer cell lines were maintained in cell culture under standard media and serum conditions. For dose escalation studies, A375 cells were split, grown to about 40-60% confluence, and then treated with the initial dose of the specified drug. Table 4 shows a summary of drug treatments that were escalated.

Table 4 - Summary of Treatments Being Escalated

6 Trametinib (MEKi) + BVD-523 (ERKi)

[0131] Single agent dose escalations were performed based on Little et al., 2011 and are outlined in FIG. 20. Cells were then allowed to grow until 70-90% confluence and split. Split ratios were kept as "normal" as possible and reasonably consistent between treatments (e.g. a minimum of 50% of the normal split ratio of the parentals). Medium was refreshed every 3-4 days. When cells again reached about 40-60% confluence, the dose was escalated. In the event that the 40-60% window was missed, the cells were split again and dosed once they reached 40-60% confluence. Again, medium was refreshed every 3-4 days. The process was repeated as required (FIG. 20).

[0132] For single agent treatments, starting concentrations and dose increases were conducted by starting with the approximate IC ₅₀ , escalating in small increments or, gently, for the initial 4-5 doses, doubling the dose, increasing by the same increment for the next 4 doses, then moving to 1 .5- fold increases in concentration for subsequent doses.

[0133] For combination treatments, starting concentrations and dose increases were conducted by starting with half of the approximate IC50 of each compound (combination assay suggests this will result in about 40-70% inhibition range), escalating as per single agents (i.e. doing an initial doubling and then increasing by the same increment for the next 4 doses, then moving to 1 .5-fold increases in concentration). Table 5 shows the projected dose increases using these schemes. Table 5 - Projected Dose Increases - Month 1

[0134] Clonal resistant cell populations were derived from resistant cell pools by limiting dilution.

[0135] Proliferation assays were used to track changes in sensitivity to the escalated agent(s) at appropriate time intervals (e.g. each month, although the timing is dependent on adequate cell numbers being available). For proliferation assays, cells were seeded in 96-well plates at 3000 cells per well in drug-free DMEM medium containing 10% FBS and allowed to adhere overnight prior to addition of compound or vehicle control. Compounds were prepared from DMSO stocks to give a final concentration range as shown in FIGS. 2A-H. The final DMSO concentration was constant at 0.1 %. Test compounds were incubated with the cells for 96 hours at 37°C and 5% CO2 in a humidified atmosphere. Alamar Blue 10% (v/v) was then added and incubated for 4 hours and fluorescent product was detected using a BMG FLUOstar plate reader. The average media only background value was deducted and the data analyzed using a 4-parameter logistic equation in GraphPad Prism. Paclitaxel was used as a positive control.

[0136] Proliferation assays for month 1 were initiated at day 28 using cells growing in the concentrations of each agent indicated in Table 6.

Table 6 - Initial Concentrations of Drugs Used in Proliferation Assays - Month

1

[0137] Proliferation assays for month 2 were initiated at day 56 using cells growing in the concentrations of each agent indicated in Table 7.

Table 7 - Initial Concentrations of Drugs Used in Proliferation Assays - Month

2

Dab 127 nM - -

BVD-523 - - 0.8 μΜ

Tram + Dab 10 nM 2 nM -

Dab + BVD-523 12.5 nM - 0.4 μΜ

Tram + BVD-523 - 2 nM 0.32 μΜ

[0138] At the end of the 3 month escalation period, cultures were maintained at the top concentration for 2 weeks prior to the final round of proliferation assays and potential single cell cloning. As the proliferation assays/single cell cloning required actively proliferating cells, for treatments where cells were proliferating very slowly at the top concentration or that were only recently escalated, a backup culture was also maintained at a lower concentration (Table 8). For the BVD-523 treatment, where cells appeared to have almost completely stopped growing and looked particularly fragile at the top concentration (1 .8μΜ), cultures were maintained at a lower concentration for the 2 week period.

Table 8 - Details of Treatments Being Cultured at a Fixed Concentration for 2

Weeks

[0139] Proliferation assays for month 3 used cells growing in the concentrations of each agent indicated in Table 9.

Table 9 - Initial Concentrations of Drugs Used in Proliferation Assays - Month

3

[0140] For combination studies, A375 cells (ATCC) were seeded into triplicate 96-well plates at a cell density of 3000 cells/well in DMEM plus 10% FBS and allowed to adhere overnight prior to addition of test compound or vehicle control. Combinations were tested using a 10x8 dose matrix with a final DMSO concentration of 0.2%. A 96 hour assay incubation period followed, with subsequent addition of Alamar Blue 10% (v/v) and 4 hours incubation prior to reading on a fluorescent plate reader. After reading Alamar Blue, the medium/Alamar Blue mix was flicked off and 100μΙ of CellTiter- Glo/PBS (1 :1 ) added and the plates processed as per the manufacturers instructions (Promega). Media only background values were subtracted before the data was analysed. The Bliss additivity model was then applied.

[0141] In brief, predicted fractional inhibition values for combined inhibition were calculated using the equation Cbiiss =A + B - (A x B) where A and B are the fractional inhibitions obtained by drug A alone or drug B alone at specific concentrations. Cbiiss is the fractional inhibition that would be expected if the combination of the two drugs were exactly additive. Cbiiss values are subtracted from the experimentally observed fractional inhibition values to give an 'excess over Bliss' value. Excess over Bliss values greater than 0 indicate synergy, whereas values less than 0 indicate antagonism. Excess over Bliss values are plotted as heat maps ± SD.

[0142] The single and combination data are also presented as dose- response curves generated in GraphPad Prism (plotted using % viability relative to DMSO only treated controls).

[0143] For focused combination studies, the Alamar Blue viability assays were performed as described above for combination studies. Additionally, Caspase-Glo 3/7 assays were performed. In brief, HCT116 cells were seeded in triplicate in white 96-well plates at a cell density of 5000 cells/well in McCoy's 5A plus 10% FBS. A375 cells were seeded at a density of 5000 cells/well in DMEM plus 10% FBS. Cells were allowed to adhere overnight prior to addition of test compound or vehicle control. The final concentration of DMSO was 0.2%, and 800nM staurosporine was included as a positive control. 24 and 48 hour assay incubation periods were used. Then, Caspase-Glo® 3/7 50% (v/v) was added, plates were mixed for 5 minutes on an orbital shaker and incubated for 1 hour at room temperature prior to reading on a luminescent plate reader. Media only background values were subtracted before the data was analysed. Example 2

Dose Escalation and Proliferation Assays - Month 1

Dose Escalation Progress - Month 1

[0144] A375 cells were dose escalated using BVD-523, dabrafenib, and trametinib either as single agents or in combination. Doses were increased in small increments during the first month. Other than a marked reduction in growth rate, cells generally tolerated the escalations well and the doses were planned to be more aggressively escalated using larger increments in month 2. FIGS. 1 A-C show month 1 progress for the dose escalation studies.

Proliferation Assay Results - Month 1

[0145] Proliferation assays were performed to assess the response of the escalated cells lines vs. parental cell line, to BVD-523, dabrafenib, and trametinib treatments.

[0146] FIGS. 2A-H show normalized and raw proliferation assay results from month 1 of the studies. Note that differences in max signals in DMSO controls between different treatments (FIGS. 2D-F, 2H) suggest differential growth rates between treatments. These differences may influence the responses of lines to inhibitors in the proliferation assays.

[0147] Table 10 shows IC50 data for month 1 of the studies.

Table 10 - IC ₅ o Data - Month 1

*Par = Parental cell line

[0148] There were early hints that cells grown in the presence of escalating doses of dabrafenib or trametinib, either as single agents or in combinations, were exhibiting decreased responses to these two agents in proliferation assays.

[0149] In the early stages of month 2, the growth rate of cells in the dabrafenib only treatment notably increased relative to the early stages of month 1 . This enabled an increased rate of progression and suggested that resistance was becoming apparent.

Example 3

Dose Escalation and Proliferation Assays - Month 2

Dose Escalation Progress - Month 2

[0150] The second month of studies saw most treatments move into a phase where doses were increased in greater increments (1 .5-fold) compared to the initial gentle escalation phase. The single agent escalation of dabrafenib and trametinib was quickest, with cells growing in concentrations equivalent to 100x parental cell IC50 (FIGS. 3A,B). The single agent escalation of BVD-523 progressed more slowly compared to dabrafenib and trametinib (FIG. 3C). See FIG. 3D for a comparison of the single agent escalations. BVD-523 escalated cells had a more "fragile" appearance and there was a greater number of floating cells compared to the dabrafenib and trametinib escalated populations.

[0151] The combined agent escalations progressed more slowly than the single agent treatments. The BVD-523/trametinib combination was particularly effective in preventing cells from progressing.

Proliferation Assay Results - Month 2

[0152] Proliferation assays on single agent escalated dabrafenib and trametinib cell populations revealed modest shifts in the dose response curves, suggesting that an additional period of escalation would be beneficial to further enrich for resistant cells. Interestingly, in the proliferations assay, there was evidence to suggest that cells exposed to BVD-523 grew less well upon inhibitor withdrawal, perhaps indicating a level of addiction.

[0153] FIGS. 4A-H show normalized and raw proliferation assay results from month 2 of the studies. Note that differences in max signals in DMSO controls between different treatments (FIGS. 4D-F, 4H) suggest differential growth rates between treatments. These differences may influence the responses of lines to inhibitors in the proliferation assays.

[0154] FIGS. 5A-H show normalized and raw proliferation assay results from month 2 of the studies with a focus on parental and BVD-523 line data only.

[0155] Table 1 1 shows IC ₅₀ data for month 2 of the studies. Relative IC50S were determined from 4-parameter curve fits in Prism. Table 1 1 - IC ₅ o Data - Month 2

Example 4

Dose Escalation and Proliferation Assays - Month 3

Dose Escalation Progress - Month 3

[0156] FIGS. 6A-C show single and combination agent escalation for month 3 of the studies. FIG. 6D shows a comparison of single agent escalations.

Proliferation Assay Results - Month 3

[0157] FIG. 7 shows an assessment of growth during the proliferation assay in DMSO control wells. FIGS. 8A-D show results from month 3 of the studies. FIGS. 9A-D show results from month 3 of the studies with a focus on single treatment cell lines.

[0158] Table 12 shows IC50 data for month 3 of the studies. Relative IC ₅₀ s were determined from 4-parameter curve fits in Prism. IC ₅₀ values were not determined for the cell line escalated with trametinib due to a lack of growth during the assay (ND: not done). Table 12 - IC ₅ o Data - Month 3

^* Par - Parental cell ine

[0159] Figure 19 shows single and combination agent escalation for month 3 of the studies. Cell line variants were obtained that could grow in the presence of dabrafenib or trametinib at concentrations greater than 100 times the IC ₅₀ of these agents in parental A375 cell. In comparison, cell lines resistant to BVD-523 could only be maintained in less than 10X of parental IC50 concentration. Sensitivity testing suggested dabrafenib and trametinib- resistant cell lines remained relatively sensitive to BVD-523; the increased IC50 "shift" for BVD-523 in resistant cell lines was more modest than those corresponding IC ₅₀ increases following dabrafenib or trametinib treatment. Likewise, compared to dabrafenib or trametinib treatment, more complete inhibition of cell growth was observed when resistant cell lines were treated with BVD-523 at concentrations 10-fold above its IC ₅₀ in the parental A375 line. In total, patterns of resistance and cross-sensitivity suggest BVD-523 may remain effective in settings of acquired resistance.

Example 5

Combination Study Results

[0160] As expected, A375 cells, which carry a BRAF (V600E) mutation, were sensitive to dabrafenib. Single agent IC ₅₀ values calculated using Alamar Blue (FIGS. 10, 12, 14) were generally slightly lower for Dabrafenib and BVD-523 compared to those derived using CellTiter-Glo (FIGS. 1 1 , 13, 15). Published IC50 values for Dabrafenib and Trametinib in a 72 hour CellTiter-Glo assay were 28 ± 16nM and 5 ± 3nM respectively (Greger ei a/., 2012; King ef a/., 2013) - the single agent results reported here are consistent with these values. There was some evidence for a window of synergy in all treatments. Variation between triplicates was low, however, there was some evidence of edge effects that likely explains the apparent enhanced growth observed in some treatments versus the no drug control (e.g. particularly apparent in the Trametinib/BVD-523 combination). This makes the interpretation of the Bliss analysis more challenging as in some treatments it may have resulted in the artefactual enhancement in the level of synergy.

[0161] The combination assays were repeated for A375 cells. Single agent BVD-523, Trametinib and Dabrafenib potencies were consistent with those reported in the previous studies disclosed herein.

[0162] In sum, taken together the data show that MEK and BRAF resistant cells could be overcome by treatment with the ERK inhibitor, BVD- 523.

Example 6

BVD-523 altered markers of MAPK kinase activity and effector function

[0163] For Western blot studies, HCT1 16 cells (5 x 10 ⁶ ) were seeded into 10 cm dishes in McCoy's 5A plus 10% FBS. A375 cells (2.5 x 10 ⁶ ) were seeded into 10 cm dishes in DMEM plus 10% FBS. Cells were allowed to adhere overnight prior to addition of the indicated amount of test compound (BVD-523) or vehicle control. Cells were treated for either 4 or 24 hours before isolation of whole-cell protein lysates, as specified below. Cells were harvested by trypsinisation, pelleted and snap frozen. Lysates were prepared with RIPA (Radio-lmmunoprecipitation Assay) buffer, clarified by centrifugation and quantitated by bicinchoninic acid assay (BCA) assay. 20- 50 g of protein was resolved by SDS-PAGE electrophoresis, blotted onto PVDF membrane and probed using the antibodies detailed in Table 13 (for the 4-hour treatment) and Table 14 (for the 24-hour treatment) below.

Table 13 - Antibody Details

0 milk

Table 14 - Antibody details

0 milk mouse

[0164] Figure 16-18 shows Western blot analyses of cells treated with BVD-523 at various concentrations for the following: 1 ) MAPK signaling components in A375 cells after 4 hours; 2) cell cycle and apoptosis signaling in A375 24 hours treatment with various amounts of BVD-523; and 3) MAPK signaling in HCT-1 16 cells treated for 4 hours. The results show that acute and prolonged treatment with BVD-523 in RAF and RAS mutant cancer cells in-vitro affects both substrate phosphorylation and effector targets of ERK kinases. The concentrations of BVD-523 required to induce these changes is typically in the low micromolar range.

[0165] Changes in several specific activity markers are noteworthy. First, the abundance of slowly migrating isoforms of ERK kinase increase following BVD-523 treatment; modest changes can be observed acutely, and increase following prolonged treatment. While this could indicate an increase in enzymatically active, phosphorylated forms of ERK, it remains noteworthy that multiple proteins subject to both direct and indirect regulation by ERK remain "off" following BVD-523 treatment. First, RSK1/2 proteins exhibit reduced phosphorylation at residues that are strictly dependent on ERK for protein modification (T359/S363). Second, BVD-523 treatment induces complex changes in the MAPK feedback phosphatase, DUSP6: slowly migrating protein isoforms are reduced following acute treatment, while total protein levels are greatly reduced following prolonged BVD-523 treatment. Both of these findings are consistent with reduced activity of ERK kinases, which control DUSP6 function through both post-translational and transcriptional mechanisms. Overall, despite increases in cellular forms of ERK that are typically thought to be active, it appears likely that cellular ERK enzyme activity is fully inhibited following either acute or prolonged treatment with BVD-523.

[0166] Consistent with these observations, effector genes that require MAPK pathway signaling are altered following treatment with BVD-523. The G1/S cell-cycle apparatus is regulated at both post-translational and transcriptional levels by MAPK signaling, and cyclin-D1 protein levels are greatly reduced following prolonged BVD-523 treatment. Similarly, gene expression and protein abundance of apoptosis effectors often require intact MAPK signaling, and total levels of Bim-EL increase following prolonged BVD- 523 treatment. As noted above, however, PARP protein cleavage and increased apoptosis were not noted in the A375 cell background; this suggests that additional factors may influence whether changes in BVD- 523/ERK-dependent effector signaling are translated into definitive events such as cell death and cell cycle arrest.

[0167] Consistent with the cellular activity of BVD-523, marker analysis suggests that ERK inhibition alters a variety of molecular signaling events in cancer cells, making them susceptible to both decreased cell proliferation and survival.

[0168] In sum, FIGS. 16-18 show that BVD-523 inhibits the MAPK signaling pathway and may be more favorable compared to RAF or MEK inhibition in this setting.

[0169] Finally, properties of BVD-523 may make this a preferred agent for use as an ERK inhibitor, compared to other agents with a similar activity. It is known that kinase inhibitor drugs display unique and specific interactions with their enzyme targets, and that drug efficacy is strongly influenced by both the mode of direct inhibition, as well as susceptibility to adaptive changes that occur following treatment. For example, inhibitors of ABL, KIT, EGFR and ALK kinases are effective only when their cognate target is found in active or inactive configurations. Likewise, certain of these inhibitors are uniquely sensitive to either secondary genetic mutation, or post-translational adaptive changes, of the protein target. Finally, RAF inhibitors show differential potency to RAF kinases present in certain protein complexes and/or subcellular localizations. In summary, as ERK kinases are similarly known to exist in diverse, variable, and complex biochemical states, it appears likely that BVD-523 may interact with and inhibit these targets in a fashion that is distinct and highly preferable to other agents. Example 7

Effects of BVD-523 and Benchmark ERK BRAF and MEK Inhibitors on

Viability and APK Signalling

Single Agent Proliferation Assay

[0170] Cells were seeded in 96-well plates at the densities indicated in Table 15 in McCoy's 5A containing 10% FBS and allowed to adhere overnight prior to addition of compound or vehicle control. Compounds were prepared from DMSO stocks to give the desired final concentrations. The final DMSO concentration was constant at 0.1 %. Test compounds were incubated with the cells for 96h at 37°C, 5% C0 ₂ in a humidified atmosphere. CellTiter-Glo® reagent (Promega, Madison, Wl) was added according to manufacturer's instructions and luminescence detected using the BMG FLUOstar plate reader (BMG Labtech, Ortenberg, Germany). The average media only background value was deducted and the data analysed using a 4-parameter logistic equation in GraphPad Prism (GraphPad Software, La Jolla, CA).

Combination Proliferation Assay

[0171] Cells were seeded into triplicate 96-well plates at the densities indicated in Table 15 in McCoy's 5A containing 10% FBS and allowed to adhere overnight prior to addition of test compound or vehicle control. Combinations were tested using a 10x8 dose matrix. The final DMSO concentration was constant at 0.2%.

[0172] Test compounds were incubated with the cells for 96h at 37°C, 5% CO ₂ in a humidified atmosphere. Cells were stained with Hoechst stain and fluorescence detected as described above. The average media only background value was deducted and the data analysed. [0173] Combination interactions across the dose matrix were determined by the Loewe Additivity and Bliss independence models using Chalice™ Combination Analysis Software (Horizon Discovery Group, Cambridge, MA) as outlined in the user manual (available at chalice.horizondiscovery.com/chalice- portal/documentation/analyzer/home.jsp). Synergy is determined by comparing the experimentally observed level of inhibition at each combination point with the value expected for additivity, which is derived from the single- agent responses along the edges of the matrix. Potential synergistic interactions were identified by displaying the calculated excess inhibition over that predicted as being additive across the dose matrix as a heat map, and by reporting a quantitative 'Synergy Score' based on the Loewe model. The single agent data derived from the combination assay plates were presented as dose-response curves generated in Chalice™.

Table 15 - Cell Line Seeding Density

Western Blotting

[0174] Cells were seeded into 6-well plates (Experiment 1 ) or 10cm dishes (Experiment 2) at the densities indicated in Table 15 in McCoy's 5A containing 10% FBS and allowed to adhere overnight prior to addition of compound or vehicle control. Test compounds were added and incubated with the cells for 4 or 24h at 37°C, 5% C0 ₂ in a humidified atmosphere. Cells were harvested by trypsinisation, pelleted by centrifugation and snap frozen on dry ice.

[0175] Lysates were prepared using RIPA buffer (50mM Tris- hydrochloride, pH 8.0; 150mM sodium chloride; 1 .0% Igepal CA-630 (NP-40); 0.5% sodium deoxycholate; 0.1 % sodium dodecyl sulphate; Ixcomplete EDTA-free protease inhibitor cocktail (Roche, Nutley, NJ; cat 05 892 791 001 ); I xphosSTOP phosphatase inhibitor cocktail (Roche Nutley, NJ; cat. 04 906 837 001 )) and clarified by centrifugation at 11 ,000 rpm for 10min in a bench-top centrifuge.

[0176] Total protein in the lysates was quantitated by BCA assay according to the manufacturer's instructions (Pierce™ BCA Protein Assay Kit; Thermo Scientific, Waltham, MA; cat. 23225), boiled in sample buffer (NuPAGE LDS Sample Buffer; (Invitrogen, Carlsbad, CA; cat. NP0007)) and stored at -80°C.

[0177] Equal amounts of protein (40pg) were resolved on NuPAGE 4- 12% Bis-Tris gels (Invitrogen, Carlsbad, CA; cat. WG1402BOX) and blotted onto PVDF membranes using iBIot gel transfer stacks (Invitrogen, Carlsbad, CA; cat. IB4010-01 ) on an iBIot gel transfer device (Invitrogen Carlsbad, CA) according to the manufacturer's instructions.

[0178] Blots were probed using the antibodies and block conditions detailed in Table 16. Western blots were developed using Pierce™ ECL2 Western blotting substrate (Thermo Scientific, Waltham, MA; cat. 80196) and imaged using a FluorChem M Western blot imager (ProteinSimple, San Jose, CA). Table 16 - Antibodies and Western Blotting Conditions

[0179] The MEK1 (Q56P) mutation exemplifies a class of clinically relevant MEK1/2 activating mutations known to up-regulate the MAPK pathway and drive acquired resistance to BRAF or MEK inhibitors.

[0180] This study used a pair of RKO BRAF(V600E) cell lines that are isogenic for the presence or absence of a MEK1 (Q56P) activating mutation, to assess the effect that activating MEK mutations have in response to the novel ERK inhibitor BVD-523 versus other benchmark MAPK inhibitors.

[0181] Effects of on cell viability were assessed by quantitating cellular ATP levels using CellTiter-Glo® after 96h. Single agent assays demonstrated that the double mutant BRAF(V600E)::MEK1 (Q56P) cells displayed a markedly reduced sensitivity to inhibition with benchmark clinical BRAF (exemplified by Dabrafenib) or MEK (exemplified by Trametinib) inhibitors relative to the parental BRAF(V600E) cells, which demonstrates the suitability of this isogenic model for recapitulating the acquired resistance known to be associated with this class of mutation in the clinic (Table 17).

Table 17 - Single Agent IC50 Values

ft d . - n t cisfefrti!Oefii, Orrfy s artiai dose response fisfiieveci

[0182] In contrast, response to BVD-523 was identical in both the parental and double mutant cells, indicating that BVD-523 is not susceptible to this mechanism of acquired resistance.

[0183] These results were identical in two independently derived double mutant BRAF(V600E)::MEK1 (Q56P) cell line clones confirming that these differences in response versus the parental cells were specifically related to the presence of the MEK1 mutation rather than an unrelated clonal artifact (FIG. 22). Similar results were also observed with a second mechanistically distinct benchmark ERK inhibitor (SCH772984), which supports the notion that these observations are specifically related to inhibition of ERK and not due to an off-target effect.

[0184] The effect of combining BVD-523 with a BRAF inhibitor (exemplified by Dabrafenib) was also assessed in these cell lines across a matrix of concentrations using the Loewe Addivity or Bliss Independence models with Horizon's Chalice™ combination analysis software (FIG. 23 - FIG. 24). The presence of potentially synergistic interactions was then assessed by displaying the calculated excess inhibition over that predicted as being additive across the dose matrix as a heat map, and by calculating a "Volume Score' that shows whether the overall response to a combination is synergistic (positive values), antagonistic (negative values) or additive (~ 0).

[0185] The results suggest that the BVD-523::Dabrafenib combination was mainly additive in the parental and mutant cell line. In contrast, the combination of a MEK inhibitor (trametinib) plus Dabrafenib, while being mostly additive in the parental cell line, showed strong synergy in the double mutant BRAF(V600E)::MEK1 (Q56P) cell line (FIG. 25). Loewe Volumes, Bliss Volumes and Synergy scores for the combinations tested are shown in Tables 18 - 20, respectively and are shown graphed in FIG. 26.

Table 18 - Loewe Volumes

Table 19 - Bliss Volumes

Table 20 - Synergy Scores

[0186] Effects on MAPK pathway signally was assessed by Western blotting. The levels of basal ERK phosphorylation (DMSO samples) was markedly up-regulated in the MEK1 (Q56P)-expressing line relative to parental further confirming that this isogenic model faithfully recapitulates the expected phenotype for the expression of MEK activating acquired resistance mutations.

[0187] In the parental BRAF(V600E) RKO cells, a reduced level of RSK1/2 phosphorylation is observed following acute treatment with RAF, MEK and ERK kinase inhibitors at pharmacologically active concentrations. In contrast, isogenic, double mutant BRAFV600E::MEK1 Q56P cells do not exhibit reduced RSK phosphorylation following BRAF or MEK inhibitor treatment, while BVD-523 remains effective at similar concentrations (FIG. 27). The dotted lines indicate that the trametinib-treated samples (plus matched DMSO control) and blots are derived from a separate experiment to the BRAFi and BVD-523 treated samples.

[0188] Changes in effector gene signaling consistent with cell growth inhibition patterns are observed following prolonged inhibitor treatment. In parental RKO lines, a reduced level of phosphorylated pRB is observed following prolonged MEK and ERK inhibitor treatment. At the level of pRB modulation, MEK1 mutant lines appear insensitive to low concentration MEK inhibitor treatment, while higher concentrations remain effective. Critically, BVD-523 potency against pRB activity does not appear to be strongly affected by MEK mutation. Surprisingly, RAF inhibitor treatment does not affect pRB status, despite potent inhibition of upstream signaling, in both parental and MEK mutant backgrounds.

[0189] In summary, these results show that BVD-523 is not susceptible to acquired resistance driven by MEK activating mutations such as MEK1 (Q56P). In addition they suggest that in combination the interactions between BVD-523 and BRAFi (exemplified by Dabrafenib) are additive irrespective of the presence of a MEK activating mutation.

Example 8

Combination Interactions Between ERK inhibitors

[0190] RAF mutant melanoma cell line A375 cells were cultured in DMEM with 10% FBS and seeded into triplicate 96-well plates at an initial density of 2000 cells per well. Combination interactions between ERK inhibitors BVD-523 and SCH772984 were analized after 72 hours as described above in Example 4. Viability was determined using CellTiter-Glo® reagent (Promega, Madison, Wl) according to manufacturer's instructions and luminescence was detected using the BMG FLUOstar plate reader (BMG Labtech, Ortenberg, Germany).

[0191] Visualization of the Loewe and Bliss 'excess inhibition' heat maps suggested that the combination of BVD-523 and SCH772984 was mainly additive with windows of potential synergy in mid-range doses (FIG. 28).

[0192] In summary, these results suggest that interactions between BVD-523 and SCH772984 are at least additive, and in some cases synergistic.

Documents

ABSALAN, Famaz; Mostafa Ronaghi (2008). Molecular Inversion Probe

Assay. Methods in Molecular Biology 396. Humana Press, pp. 315-330 CORCORAN, R.B., et al. BRAF gene amplification can promote acquired resistance to MEK inhibitors in cancer cells harboring the BRAF V600E mutation. Sci Signal (2010);3(149): ra84.

DAI, B., et al. STAT3 mediates resistance to MEK inhibitor through microRNA miR-17. Cancer Res (201 1 );71 :3658-3668.

EMERY, CM., et al. MEK1 mutations confer resistance to MEK and B-RAF inhibition. PNAS (2009); 106(48):2041 1 -6.

GREGER, James G., et al. "Combinations of BRAF, MEK, and PI3K/mTOR inhibitors overcome acquired resistance to the BRAF inhibitor

GSK21 18436 dabrafenib, mediated by NRAS or MEK mutations."

Molecular cancer therapeutics 1 1 .4 (2012): 909-920.

HARDENBOL, P., et al. Multiplexed genotyping with sequence-tagged molecular inversion probes. Nat. Biotechnol. 2003, no.21 , p.673-678. HATZIVASSILIOU, Georgia, et al. "RAF inhibitors prime wild-type RAF to activate the MAPK pathway and enhance growth." Nature 464.7287

(2010): 431 -435.

JOHANNESSEN, CM., et al. COT/MAP3K8 drives resistance to RAF inhibition through MAP kinase pathway reactivation. Nature (2010);468(7326):968-972.

KING, Alastair J., et al. "Dabrafenib; preclinical characterization, increased efficacy when combined with trametinib, while BRAF/MEK tool combination reduced skin lesions." PloS one 8.7 (2013): e67583. LITTLE, A.S., et al., Amplification of the Driving Oncogene, KRAS or BRAF, Underpins Acquired Resistance to MEK1/2 Inhibitors in Colorectal Cancer Cells. Sci. Signal. 4, ra17 (201 1 ).

LIU, Dingxie, et al. "BRAF V600E maintains proliferation, transformation, and tumorigenicity of BRAF-mutant papillary thyroid cancer cells." Journal of Clinical Endocrinology & Metabolism 92.6 (2007): 2264-2271 .

MANANDHAR SP, Hildebrandt ER, Schmidt WK. Small-molecule inhibitors of the Rcel p CaaX protease. J Biomol Screen. 2007;12(7):983-993.

MAURER, T, Garrenton, LS, Oh, A, Pitts, K, Anderson, DJ, Skelton, NJ, Fauber, BP, Pan, B, Malek, S, Stokoe, D, Ludlam, MJC, Bowman, KK, Wu, J, Giannetti, AM, Starovasnik, MA, Mellman, I, Jackson, PK, Rudolph, J, Wang, W, Fang, G. Small-molecule ligands bind to a distinct pocket in Ras and inhibit SOS-mediated nucleotide exchange activity. PNAS. 2012;109(14):5299-304.

METZKER, Emerging technologies in DNA sequencing Genome Res. 2005.

15: 1767-1776

MITTAL, Rohit et al. "The acetyltransferase activity of the bacterial toxin YopJ of Yersinia is activated by eukaryotic host cell inositol hexakisphosphate." Journal of Biological Chemistry 285.26 (2010): 19927-19934.

NAZARIAN, R., et al. Melanomas acquire resistance to B-RAF (V600E) inhibition by RTK or N-RAS upregulation. Nature. 2010; 468(7326):973-977.

NILSSON, M., et al. Padlock probes: circularizing oligonucleotides for localized DNA detection. Science. 1994, no.265, p.2085-2088. OTA et al., Single nucleotide polymorphism detection by polymerase chain reaction-restriction fragment length polymorphism. Nat Protoc. 2007;2(11 ):2857-64.

PATGIRI, A, Yadav, KK, Arora, PS, Bar-Sagi, D. An orthosteric inhibitor of the Ras-Sos interaction. Nat Chem Biol. 201 1 ;7:585-587.

PORTER SB, Hildebrandt ER, Breevoort SR, Mokry DZ, Dore TM, Schmidt WK. Inhibition of the CaaX proteases Rcel p and Ste24p by peptidyl (acyloxy)methyl ketones. Biochim Biophys Acta.2007;1773(6):853- 862.

SHIMA, F, Yoshikawa, Y, Ye, M, Araki, M, Matsumoto, S, Liao, J, Hu, L, Sugimoto, T, Ijiri, Y, Takeda, A, Nishiyama, Y, Sato, C, Muraoka, S, Tamura, A, Osoda, T, Tsuda, K-l, Miyakawa, T, Fukunishi, H, Shimada, J, Kumasaka, Yamamoto, M, Kataoka, T. In silico discovery of small- molecule Ras inhibitors that display antitumor activity by blocking the Ras-effector interaction. PNAS. 2013;1 10(20):8182-7.

VILLANUEVA, J., et al. Acquired resistance to BRAF inhibitors mediated by a RAF kinase switch in melanoma can be overcome by cotargeting MEK and IGF-1 R/PI3K. Cancer Cell. 2010;18:683-695.

WAGLE, N., et al. Dissecting therapeutic resistance to RAF inhibition in melanoma by tumor genomic profiling. Journal of Clinical Oncology 2011 ;29(22):3085-3096.

WANG, H., et al. Identification of the MEK1 (F129L) activating mutation as a potential mechanism of acquired resistance to MEK inhibition in human cancers carrying the B-RAF V600E mutation. Cancer Res (201 1 );71 (16):5535-45.

[0193] All documents cited in this application are hereby incorporated by reference as if recited in full herein.

[0194] Although illustrative embodiments of the present invention have been described herein, it should be understood that the invention is not limited to those described, and that various other changes or modifications may be made by one skilled in the art without departing from the scope or spirit of the invention.