CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. provisional application titled "Methods and Compositions for Treatment of Cystic Fibrosis," having serial number 62/299,651 , filed on February 25, 2016, which is entirely incorporated herein by reference.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

This invention was made with government support under grant number DK065988 awarded by the National Institutes of Health and Grant Numbers R026-C 1 1 and

BOUCHE15R0 awarded by the Cystic Fibrosis Foundation. The government has certain rights to the invention.

SEQUENCE LISTING

This application contains a sequence listing filed in electronic form as an ASCI I .txt file entitled 222109-2600_ST25.txt, created on February 16, 2017 and having a size of 5 KB. The content of the sequence listing is incorporated herein in its entirety.

BACKGROUND

Cystic Fibrosis (CF) is a genetic disorder that affects the body's production of mucus, sweat, and digestive fluids, leading to complications in the respiratory system, digestive system, and other organs. While CF is a life limiting disease, due to better treatment options, people with CF are living longer, more productive lives than they did in the past. CF arises from mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes a chloride ion channel. CFTR is expressed in many organs, including the lungs, pancreas, salivary glands, kidneys, liver, sweat glands, and reproductive tract.

Different mutations can occur in the gene, and the type of mutation affects the severity of the resulting condition. In many cases the CFTR protein encoded by the mutated CFTR gene may be functional but, due to misfolding or other problem, cannot make it to the cell membrane, which leads to disease symptoms.

Improper chloride transport from defective CFTR leads to thickened mucous secretions, persistent bacterial infections, lung tissue damage and malnutrition due to poor vitamin absorption. The lungs are the organ most commonly studied in CF because of the severity of the effects at that site. The thickened mucus in the lungs provides an environment favorable for microbial growth. The most common bacterial species found in CF is

Pseudomonas aeruginosa, with 80% of adult CF patients colonized by the bacteria. Chronic bacterial infection leads to immune system activation and release of neutrophilic proteases. However, instead of clearing the bacteria, tissue damage typically ensues. In fact, >90% of CF patients' deaths are due to chronic lung infection and respiratory failure.

Vitamin D is a principal factor that maintains calcium homeostasis and is required for bone development and maintenance. Vitamin D deficiency during bone development causes rickets. Adult vitamin D deficiency, which is common in the elderly population, can cause secondary hyperparathyroidism that can result in osteomalacia and increased risk of fracture. Vitamin D deficiency is also common among patients with CF, with as much as 60% having serum vitamin D levels below 30ng/ml (75nM), even with supplementation. This deficiency, which may result from malabsorption of the fat-soluble nutrient, as well as other potential causes, can lead to low bone mass, osteoporosis, and fractures in CF patients. Most recently, vitamin D deficiency has been associated with increased pulmonary exacerbations, increased bacterial infection, and inflammation in CF patients.

Vitamin D is currently recommended as a dietary supplement for all patients with osteoporosis or decreased bone mass and has been reported to prevent bone loss and decrease fracture incidence for both healthy individuals and CF patients. Recent evidence has indicated an interrelationship between vitamin D and health beyond just bone, including effects on preventing or at least partially protecting against certain autoimmune diseases such as diabetes and multiple sclerosis, and inhibition of proliferation of a number of malignant cells such as breast and prostate cancer cells. Furthermore, vitamin D deficiency has been associated with increased susceptibility to respiratory infections.

SUMMARY

The present disclosure provides methods for topically administering vitamin D compounds to the respiratory tissues of a host, methods for treating cystic fibrosis and other respiratory disorders in a host, methods of increasing the amount of membrane localized cystic fibrosis conductance regulator (CFTR) in a host, methods of decreasing epithelial sodium channel (ENaC) activity in respiratory tissue epithelial cells in a host, and compositions including an aerosol formulation comprising a vitamin D compound in the form of cholecalciferol (D ₃ ).

Embodiments of methods of the present disclosure include topically administering to the respiratory tissue of a host with cystic fibrosis an effective amount of a composition comprising a vitamin D compound, where the vitamin D compound is effective to increase the amount of membrane localized cystic fibrosis conductance regulator (CFTR) on respiratory tissue epithelial cells in the host. The present disclosure also describes methods of treatment for cystic fibrosis, the method including topically administering to the respiratory tissues of a host in need of treatment for cystic fibrosis an effective amount of a composition comprising a vitamin D compound in the form of cholecalciferol (D ₃ ) and a pharmaceutically acceptable carrier, where the vitamin D compound is effective to alleviate at least one respiratory symptom of the host.

Embodiments of the present disclosure also include methods of treatment for cystic fibrosis, the methods including treating cystic fibrosis by topically administering to the respiratory tissues of a host in need of treatment for cystic fibrosis an effective amount of a composition comprising a vitamin D compound, where the vitamin D compound is effective to increase the amount of membrane localized cystic fibrosis conductance regulator (CFTR) on respiratory tissue epithelial cells of the host and is effective to alleviate at least one respiratory symptom of the host.

Methods of the present disclosure further include decreasing epithelial sodium channel (ENaC) activity in respiratory tissue epithelial cells in a host with cystic fibrosis by topically administering to the respiratory tissue of the host an effective amount of a composition comprising a vitamin D compound, wherein the vitamin D compound is effective to decrease the ENaC activity in the respiratory tissue epithelial cells in the host.

Methods of the present disclosure also include methods of increasing the amount of membrane localized cystic fibrosis conductance regulator (CFTR) on respiratory tissue epithelial cells, the methods including topically administering directly to the respiratory tissue of a host an effective amount of a composition comprising a vitamin D compound in the form of cholecalciferol (D ₃ ), where the vitamin D compound is converted to 25-hydroxyvitamin D ₃ (250HD ₃ ) by the host epithelial cells, where the 250HD ₃ is converted to 1 ,25- dihydroxy vitamin D ₃ (1 ,25(OH) ₂ D ₃ ) by the host.

Embodiments of the present disclosure also include methods of treating a respiratory condition in a host, the methods including topically administering to the respiratory tissue of the host an effective amount of a composition comprising a vitamin D compound, where the vitamin D compound is effective to increase the amount of membrane localized cystic fibrosis conductance regulator (CFTR) on respiratory tissue epithelial cells of the host, decrease epithelial sodium channel (ENaC) activity in the respiratory tissue epithelial cells of the host, or both.

The present disclosure also describes compositions including an aerosol formulation comprising a vitamin D compound in the form of cholecalciferol (D ₃ ) and a pharmaceutically acceptable carrier, where the composition is adapted for aerosol delivery by a nebulizer, personal inhaler, or other respiratory airway delivery device. Other methods, compositions, features, and advantages of the present disclosure will be or become apparent to one with skill in the art upon examination of the following drawings and detailed description. It is intended that all such additional compositions, methods, features, and advantages be included within this description, and be within the scope of the present disclosure.

BRIEF DESCRIPTION OF THE DRAWINGS

Further aspects of the present disclosure will be more readily appreciated upon review of the detailed description of its various embodiments, described below, when taken in conjunction with the accompanying drawings. The components in the drawings are not necessarily to scale, emphasis instead being placed upon clearly illustrating the principles of the present disclosure. Moreover, in the drawings, like reference numerals designate corresponding parts throughout the several views.

FIG. 1 is a bar graph illustrating the induction of CFTR mRNA in cultured human bronchial epithelial (HBE) cells by administration of 1 ,25(OH) ₂ D ₃ . Cultures of primary normal human bronchial epithelial cells (NHBE), or growth enhanced HBE cell lines (BEAS-2B, UNC-CF 1 T), or well-differentiated NHBE cultures from a non-CF donor or CF donor (all in triplicate) were treated with either ethanol control, or 10nM 1 ,25(OH) ₂ D ₃ for 6 hours. Total mRNA was isolated and CFTR was quantified by quantitative RT-PCR relative to β2- microglobulin. Data are shown as mean +/- SEM .

FIG. 2 illustrates induction of CFTR protein in UNC-CF1 T cells after treatment with 10nM 1 ,25(OH) ₂ D ₃ or 0.1 % ethanol vehicle only for 24 hours and shows flow cytometry of permeabilized cells stained with an anti-CFTR antibody followed by a fluorescent secondary antibody (from I to r, first peak: unstained cells; second peak: ethanol; third peak:

1 ,25(OH) ₂ D ₃ treated cells) .

FIG. 3 is a series of digital images illustrating fluorescent microscopy of cells grown on coverslips, treated with the ethanol vehicle only or 1 ,25(OH) ₂ D ₃ . Cultures were either permeabilized with 0.5% Tween or not permeabilized, fixed and stained for CFTR (green) and DAPI (blue) and visualized by confocal fluorescence microscopy. Magnification = 200X.

FIGS. 4A-C illustrate activation of vitamin D in airway epithelial cells. FIG . 4A illustrates total mRNA isolated from cultured BEC from a non-CF donor and a CF patient and subjected to RT-PCR using primers specific for CYP27B1 , CYP27A1 and CYP2R1 . FIG . 4B illustrates protein expression by BEAS2B and HEK293 ells lysed and subjected to western blot analysis using antibodies to the hydroxylases, with β-actin as a loading control. FIG. 4C is a set of bar graphs illustrating conversion of Vitamin D ₃ to 250HD ₃ . BECs obtained from three healthy patients (top) and three CF patients (bottom) were treated with indicated doses of vitamin D ₃ or vehicle control for 24 hours, after which time 250HD ₃ levels were measured in supernatant. *p<0.05 vs. control.

FIGS 5A-5B are bar graphs illustrating activation of vitamin D in HBE cells. FIG . 5A shows induction of Cyp24A1 mRNA expression in 3 cell types (NHBE, UNC-N3T, and Beas- 2B) after treatment with the inactive parent vitamin D at 6 and 24 hours vs. ethanol control only. FIG. 5B shows expression of CFTR (as well as CYP24A1 mRNA levels) in apically stimulated (submerged or apical surface vitamin D exposure) cultures (FIG . 5B) .

FIG. 6 is a bar graph illustrating vitamin D-mediated regulation of Keratin 18 and Aha1 . Data are shown as mean +/- SEM . Differences compared to control are significant in both cases at p<0.00001 .

FIG. 7 is a bar graph illustrating induction of Cyp24A1 and CFTR gene expression in mouse tracheas after intranasal administration. C57BI/6 mice (n=5) were inoculated with 25μΙ/η8Γβ5 of 10 ^"6 M 1 ,25(OH) ₂ D ₃ in 0.1 % ethanol, or vehicle control. After 6 hours, mice were sacrificed and tracheas removed. Shown, mean values (+/- SEM) CFTR (blue) and CYP24A1 (red) mRNA levels normalized to β-actin. Increases in both Cyp24A1 and CFTR mRNA levels are significant, p<0.006 by t-test.

Figures 8A-8B are bar graphs illustrating the induction of gene expression in the tracheas of mice by intranasally delivered vitamin D (as inactive vitamin D ₃ , or as

1 ,25(OH) ₂ D ₃ ) vs. ethanol control. FIG. 8A shows induction as a function of CYP224A1 mRNA levels, and FIG. 8B shows relative CFTR mRNA levels.

FIG. 9 is bar graph illustrating the effect of vitamin D treatment (administered via injection) on mice in vivo. Data are shown as mean +/- SEM . The increase in CYP24A1 mRNA was significant at al days relative to control, p<0.05.

FIGS. 10A-10B illustrate the effect of vitamin D on ion transport. FIG. 10A illustrates an Ussing chamber analysis of one non-CF donor sample, treated with ethanol vehicle alone, or with 1 ,25(OH) ₂ D ₃ in triplicate. It illustrates a tracing of short circuit current across the epithelial cells as a function of time, with vertical arrows indicating when the indicated chemicals were added to the Ussing chamber. FIG . 10B is a bar graph illustrating the mean relative ENaC activity (measured as function of amiloride sensitive short circuit current) in triplicate wells from 18 different (CF and non-CF) donors.

DESCRIPTION

Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described.

Any publications and patents cited in this specification that are incorporated by reference are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed.

As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of biology, medicine, biochemistry, molecular biology, pharmacology, and the like, which are within the skill of the art. Such techniques are explained fully in the literature.

It must be noted that, as used in the specification and the appended embodiments, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of cells. In this specification and in the embodiments that follow, reference will be made to a number of terms that shall be defined to have the following meanings unless a contrary intention is apparent.

As used herein, the following terms have the meanings ascribed to them unless specified otherwise. In this disclosure, "consisting essentially of or "consists essentially" or the like, when applied to methods and compositions encompassed by the present disclosure refers to compositions like those disclosed herein, but which may contain additional structural groups, composition components or method steps (or analogs or derivatives thereof as discussed above). Such additional structural groups, composition components or method steps, etc. , however, do not materially affect the basic and novel characteristic(s) of the compositions or methods, compared to those of the corresponding compositions or methods disclosed herein. "Consisting essentially of or "consists essentially" or the like, when applied to methods and compositions encompassed by the present disclosure have the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.

Prior to describing the various embodiments, the following definitions are provided and should be used unless otherwise indicated.

Definitions

In describing the disclosed subject matter, the following terminology will be used in accordance with the definitions set forth below.

As used in the present application, the term "vitamin D compound" includes any compound being vitamin D or an analogue or metabolite thereof that is capable of treating pulmonary symptoms of cystic fibrosis. Vitamin D compounds include, but are not limited to, vitamins D2 (ergocalciferol) and D3 (cholecalciferol) (sometimes collectively referred to as "calciferol") ; compounds and isomers and derivatives of these compounds, such as vitamin D2 and D3 prohormones (e.g. , 25-hydroxyvitamin D ₂ (250HD ₂ ) and 25-hydroxyvitamin D ₃ (250HD ₃ ), collectively "calcidiol"); active vitamin D2 and D3 (e.g. , 1 ,25-dihydroxyvitamin D ₂ (1 ,25(OH) ₂ ) and 1 ,25-dihydroxyvitamin D ₃ (1 ,25(OH) ₂ D ₃ ), collectively "calcitriol"); metabolites of these compounds; and combinations of the above. Vitamin D compounds may also include less common vitamin D compounds such as vitamin D1 compounds, vitamin D2 compounds, vitamin D4 compounds, and the like, as well as synthetic versions of the above mentioned Vitamin D compounds. A list of some vitamin D compounds can be found in WO 2009/1 15398, which is hereby incorporated by reference. As used herein , "active vitamin D compounds" are vitamin D compounds that are ligands for the vitamin D receptor (VDR ligands). In embodiments, "active vitamin D ₃ " refers to 1 ,25-dihydroxyvitamin D ₃

(1 ,25(OH) ₂ D ₃ ), "inactive vitamin D ₃ " refers to cholecalciferol, and "intermediate vitamin D ₃ " or "vitamin D ₃ prohormone" refers to 25-hydroxyvitamin D ₃ (250HD ₃ ), with similar references for the vitamin D ₂ inactive, intermediate, and active forms. The term "aerosol," "aerosol formulation," or "aerosolized" composition refers to a suspension of solid or liquid particles in a gas. As used herein "aerosol" may be used generally to refer to a compound (e.g., a vitamin D compound) that has been vaporized, nebulized, or otherwise converted from a solid or liquid form to an inhalable form including suspended solid or liquid drug particles. An aerosol may include other compounds in addition to the active compound. The other compounds may also be solid, liquid, or gas an in inhalable form.

As used herein, "respiratory system" refers to the system of organs in the body responsible for the intake of oxygen and the expiration of carbon dioxide. The system generally includes all the air passages from the nose to the pulmonary alveoli. In mammals it is generally considered to include the lungs, bronchi, bronchioles, trachea, nasal passages, and diaphragm. For purposes of the present disclosure, delivery of a compound to the "respiratory system" indicates that a drug is delivered to one or more of the air passages of the respiratory system, in particular to the lungs.

As used herein, the term "respiratory disorder" refers to a condition of the respiratory system of a host in which the respiratory function of the host is less than normal/typical for a host of the same age, gender, etc. For instance, such disorder may include symptoms such as, but not limited to, shortness of breath, inadequate blood oxygen levels, improper functioning of the lungs, airways, etc., excessive mucus production, labored breathing, and the like. Example respiratory disorders include, but are not limited to, cystic fibrosis (CF), chronic obstructive pulmonary disease (COPD), emphysema, chronic bronchitis, and the like.

As used herein, the term "formulation" generally refers to any mixture, solution, suspension, or the like, which contains an active ingredient and a carrier and has physical properties such that when the formulation is moved through an inhaler or respirator device as described herein, the formulation is in a form that is delivered/inhaled/blown by positive pressure into the lungs of a patient. The active ingredient may be a vitamin D compound (as defined above). The carrier may be any pharmaceutically acceptable flowable agent that is compatible for delivery with the active agent. The formulation may also include, but are not limited to, other active agents/drugs, such as but not limited to, pulmonary surfactants. Useful drugs include agents defined in this document, systemically-active drugs delivered to the airways, and useful diagnostics including those used in connection with ventilation imaging. Formulations may be, for example, solutions, e.g., aqueous solutions, ethanoic solutions, aqueous/ethanoic solutions, saline solutions, colloidal suspensions and microcrystalline suspensions. In embodiments, formulations can be solutions or suspensions of compounds in a low boiling point propellant. In some embodiments, the formulations can be in solid form. Solid form preparations include powders, tablets, dispersible granules, and capsules. Solid form preparations will be vaporized or aerosolized by an appropriate inhaler and/or respirator device, so as to be inhaled by a host or patient. Pharmaceutically acceptable excipients can be volatile or nonvolatile. Volatile excipients, when heated, are concurrently volatilized, aerosolized, and inhaled with the active agent. Classes of such excipients are known in the art and include, without limitation, gaseous, supercritical fluid, liquid, and solid solvents. The following is a list of exemplary carriers within the classes: water; terpenes, such as menthol; alcohols, such as ethanol, propylene glycol, glycerol and other similar alcohols; dimethylformamide; dimethylacetamide; wax; supercritical carbon dioxide; dry ice; and mixtures thereof.

Although the vitamin D compounds and formulations of the present disclosure may be referenced as being delivered by inhalation or utilized by the respiratory or pulmonary system, it will be appreciated that such delivery includes not only oral inhalation or intratracheal administration, but also administration to nasal passageways and nasal membranes, which is also within the scope of this present disclosure. The drugs and formulations discussed here are subject to delivery by inhalation via an oral or nasal route as well as other methods of administration topically to the respiratory tissues of a host.

The terms "polypeptide" and "protein" as used herein refer to a polymer of amino acids of three or more amino acids in a serial array, linked through peptide bonds. The term "polypeptide" includes proteins, protein fragments, protein analogues, oligopeptides, and the like. The term "polypeptides" contemplates polypeptides as defined above that are encoded by nucleic acids, produced through recombinant technology (isolated from an appropriate source such as a bird), or synthesized. The term "polypeptides" further contemplates polypeptides as defined above that include chemically modified amino acids or amino acids covalently or non-covalently linked to labeling ligands.

The terms "polynucleotide," "oligonucleotide," and "nucleic acid sequence" are used interchangeably herein and include, but are not limited to, coding sequences

(polynucleotide(s) or nucleic acid sequence(s) which are transcribed and translated into polypeptide in vitro or in vivo when placed under the control of appropriate regulatory or control sequences); control sequences (e.g. , translational start and stop codons, promoter sequences, ribosome binding sites, polyadenylation signals, transcription factor binding sites, transcription termination sequences, upstream and downstream regulatory domains, enhancers, silencers, and the like); and regulatory sequences (DNA sequences to which a transcription factor(s) binds and alters the activity of a gene's promoter either positively (induction) or negatively (repression)). No limitation as to length or to synthetic origin is suggested by the terms described herein.

The term "gene" or "genes" as used herein refers to nucleic acid sequences

(including RNA and/or DNA) that encode genetic information for the synthesis of a whole RNA, a whole protein, or any portion of such whole RNA or whole protein. A "gene" typically refers to a hereditary unit corresponding to a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instruction for a characteristic(s) or trait(s) in an organism. The term "gene product" refers to RNAs or proteins that are encoded by the gene.

The terms "treat", "treating", and "treatment" are an approach for obtaining beneficial or desired clinical results. Specifically, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilization (e.g. , not worsening) of disease, delaying or slowing of disease progression, substantially preventing spread of disease, amelioration or palliation of the disease state, and remission (partial or total) whether detectable or undetectable. In addition, "treat", "treating", and "treatment" can also be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease. As used herein, the terms "prevent," "prophylactically treat," or "prophylactically treating" refer to completely, substantially, or partially preventing a disease/condition or one or more symptoms thereof in a host.

Similarly, "delaying the onset of a condition" can also be included in "prophylactically treating", and refers to the act of increasing the time before the actual onset of a condition in a patient that is predisposed to the condition. With respect to cystic fibrosis, "preventing" or "prophylactic treatment" can include preventing the development and appearance of new symptoms of cystic fibrosis in a host.

The term "host," "subject," or "patient" refers to any living entity in need of treatment, including humans, mammals (e.g. , cats, dogs, horses, mice, rats, pigs, hogs, cows, and other cattle), birds (e.g. , chickens), and other living species that are in need of treatment. In particular, the term "host" includes humans. As used herein, the term "human host" or "human subject" is generally used to refer to human hosts. In the present disclosure the term "host" typically refers to a human host, so when used alone in the present disclosure, the word "host" refers to a human host unless the context clearly indicates the intent to indicate a non-human host. Hosts that are "predisposed to" condition(s) can be defined as hosts that do not exhibit overt symptoms of one or more of these conditions but that are genetically, physiologically, or otherwise at risk of developing one or more of these conditions.

The term "expression," as used herein, describes the process undergone by a structural gene to produce a polypeptide. It is a combination of transcription and translation. Expression generally refers to the "expression" of a nucleic acid to produce a polypeptide, but it is also generally acceptable to refer to "expression" of a polypeptide, indicating that the polypeptide is being produced via expression of the corresponding nucleic acid. As used herein "upregulate" refers to the act of increasing the expression and/or activity of a protein or other gene product relative to the expected or average expression or activity of the protein in a corresponding cell or organism (e.g., upregulation of CFTR or Krt18 in a respiratory tissue cell of a CF patient means increasing expression or activity of the protein relative to what is expected in a typical, untreated, respiratory tissue cell of a CF patient). Similarly, "downregulation" refers to decreasing the expression and/or activity of a protein or other gene product relative to the expected or average expression or activity of the protein in a corresponding cell or organism, (e.g., downregulation of Aha1 in a respiratory tissue cell of a CF patient means decreasing expression or activity of the protein relative to what is expected in a typical, untreated, respiratory tissue cell of a CF patient).

As used herein "increase" can refer to the activity, function, or amount of a protein or gene product relative to an unmodified, untreated, expected, or average (e.g., a control) in a corresponding cell or organism. For instance, "increasing the amount" of membrane localized CFTR in a cell, tissue, or host organism indicates that the cell or host in question has a greater amount of membrane localized CFTR than in a corresponding cell, tissue, or host organism that has not been treated. Similarly, "decrease" can refer to the activity, function, or amount of a protein or gene product relative to an unmodified, untreated, expected, or average (e.g., a control) in a corresponding cell or organism. For instance, "decreasing the activity" of a protein in a cell, tissue, or host organism indicates that the cell or host in question has a lower activity of the protein than a corresponding untreated or unmodified cell or organism.

By "administration" is meant introducing a compound of the present disclosure into a subject; it may also refer to the act of providing a composition of the present disclosure to a subject (e.g., by prescribing). The preferred route of administration of the compositions of the present disclosure is endotracheal administration or other administration directly to the respiratory system of a host. By "direct administration" to the respiratory tissues of a host is meant that the composition (e.g., a composition including a vitamin D compound of the present disclosure) is directly administered or applied to these tissues as opposed to a systemic delivery where the compound must first be metabolized by the host system. An embodiment of direct administration would be topical administration to the tissues of interest, (e.g. respiratory epithelial tissues), such as by inhalation or other intra-tracheal

administration.

The term "effective amount" or "therapeutically effective amount" refers to a sufficient amount of the vitamin D compound to achieve the desired result (e.g., increasing the amount of membrane localized CFTR, treating/alleviating respiratory symptoms of CF, etc.) at a reasonable benefit/risk ratio applicable to any medical treatment. The term "respiratory airway delivery device" refers to an inhaler, nebulizer, respirator, or other type of device that is designed/configured to allow delivery of a composition (e.g., in an aerosol formulation or other formulation appropriate for delivery via respiration) via the airways (e.g., oral, nasal, tracheal) of a patient to provide direct (e.g., topical) delivery of the formulation to all or portions of the respiratory tissues of a patient.

As used herein, the following terms have the meanings ascribed to them unless specified otherwise. In this disclosure, "consisting essentially of or "consists essentially" or the like, when applied to methods and compositions encompassed by the present disclosure, refers to compositions like those disclosed herein but which may contain additional structural groups, composition components or method steps (or analogs or derivatives thereof as discussed above). Such additional structural groups, composition components or method steps, etc., however, do not materially affect the basic and novel characteristic(s) of the compositions or methods, compared to those of the corresponding compositions or methods disclosed herein. "Consisting essentially of or "consists essentially" or the like, when applied to methods and compositions encompassed by the present disclosure have the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.

Discussion

The embodiments of the present disclosure encompass compositions and methods of treating cystic fibrosis (CF) and/or other respiratory disorders. Embodiments of the present disclosure also include methods of altering ion transport physiology at the epithelial cell surface, by increasing the amount of membrane localized cystic fibrosis conductance regulator (CFTR) and/or by reducing the amount of epithelial sodium channel (ENaC) activity in a patient with CF. In embodiments, these methods are accomplished by direct administration of vitamin D compounds to the respiratory tissues of the patient, and the like. The present disclosure describes, and the examples below demonstrate, the discovery that inactive vitamin D compounds (e.g., calciferol, etc.) can be activated by lung cells and respiratory tract epithelial cells to the active form (e.g., calcitriol), a role previously believed to be relegated to liver and kidney cells. Further, the present disclosure demonstrates that, when delivered directly to respiratory tissue cells of patients with CF, the vitamin D compound(s) is effective to increase the level of CFTR on the membrane of cells and/or to decrease ENaC activity, which helps ameliorate the physiological defect in CF.

The hormonally active form of vitamin D3, 1 ,25-dihydroxyvitamin D3 (1 ,25(OH) ₂ D ₃ ), is produced by two sequential hydroxylations of vitamin D. It has been generally accepted that this occurs initially by one of a number of 25-hydroxylases in the liver (leading to 25- hydroxyvitamin D ₃ , or 250HD ₃ ) , and then by 25-hydroxyvitamin Dl a-hydroxylase (1 a- (OH)ase) in the kidney [1 , 2]. Multiple 25-hydroxylases are reported to convert vitamin D ₃ to 250HD ₃ , with the best-studied being Cyp27A1 and Cyp2R1 [3, 4]. 250HD ₃ is then transported to the kidneys where it undergoes a second hydroxylation step by the 1 -alpha- hydroxylase Cyp27B1 to be converted to the active 1 ,25(OH) ₂ D ₃ [5, 6]. The metabolism for vitamin D2 follows the same sequence.

The actions of 1 ,25(OH) ₂ D ₃ are mediated, similar to other steroid hormones, by a nuclear receptor (vitamin D receptor, VDR) which heterodimerizes with the retinoid X receptor and interacts with a specific DNA sequence (the vitamin D response element (VDRE)) in target genes and modulates their transcription [7, 8]. While the VDR/1 ,25(OH) ₂ D ₃ transcription complex can take several hours to result in an observable change in cellular activities, 1 ,25(OH) ₂ D ₃ has also been reported to rapidly affect intracellular processes by binding membrane VDR or 1 ,25D ₃ -membrane-associated, rapid response steroid-binding protein (1 ,25D ₃ -MARRS) receptor to turn on a number of kinases, such as protein kinases A and C [9- 1 1 ]. The mechanisms involved in VDR mediated transcription are now being defined. It is possible that cell and promoter-specific functions of VDR may be mediated through differential recruitment of co-activators, and that cooperation between VDR and VDR co-activators may be a mechanism that couples extracellular signals to vitamin D action.

Although it is known that vitamin D is important for calcium homeostasis [1 ], there is renewed interest in vitamin D because of experimental evidence indicating that 1 ,25(OH) ₂ D ₃ has numerous other functions including immunomodulatory effects [12]. Thus, therapeutic appeal of vitamin D lies in its antimicrobial and anti-inflammatory properties. Vitamin D downregulates the expression of inflammatory cytokines IL-6 and IL-8, which have been reported to be upregulated in CF patients [13, 14]. These anti-inflammatory properties could prevent recruitment of neutrophils, which contribute to the lung tissue damage. Although a potential therapeutic role for vitamin D in CF treatment existed, how to get activated vitamin D to the cells remained an obstacle.

The vast majority of research into the activity and effects of vitamin D in human health have focused on systemic introduction, usually by oral supplementation, as vitamin D is very safe, even at high doses, and easily absorbed and stored. In CF, however, this absorption is often reduced, leading to a chronic hypovitaminosis D, which cannot easily be remedied by systemic supplementation. Further, even with nutritional or parenteral supplementation, serum 250HD ₃ levels will only rise to a specific level, due to the feedback mechanism, based on the induction of the vitamin D-inactivating enzyme 24-hydroxylase, encoded by the CYP24A1 gene. Thus with oral supplementation, the requirement for multiorgan activation combined with poor vitamin D absorption in CF patients would most likely lead to insufficient levels of activated vitamin D reaching the lungs and ultimately no change in CFTR. While treating patients with either 250HD ₃ or 1 ,25(OH) ₂ D ₃ would avoid the need for multiple hydroxylations, treating with either metabolite is not feasible because of their short half-lives of several hours when ingested and the dangerous side effect of hypercalcemia [15-18]. As of now, these two forms are only used to raise calcium levels in patients on long-term renal dialysis.

The investigators of the present disclosure have shown that 1 ,25(OH) ₂ D ₃ can regulate innate immunity in airway epithelium by increased production of LL-37 and other mediators, which subsequently increased the killing of bacteria on the surface of these cells [19, 20]. It was also shown that this induction involves the interaction of several transcription factors leading to an increase in VDR-mediated gene induction [21 ]. Now in the present disclosure, the data provided in the examples below clearly demonstrates the induction of CFTR mRNA and protein in cultured airway epithelial cells (AEC), from both non-CF and CF individuals as well as in vivo in mice when introduced intranasally. While progress has been made with regard to mechanisms involved in the regulation of a number of genes by 1 ,25(OH) ₂ D ₃ , nothing is known about the mechanisms involved in the effects of 1 ,25(OH) ₂ D ₃ on CFTR. Determining the effects of 1 ,25(OH) ₂ D ₃ on CFTR gene expression and protein function, as well as how proteins interact with the CFTR promoter in response to

1 ,25(OH) ₂ D ₃ enhances our understanding of how 1 ,25(OH) ₂ D ₃ affects CF, and provides a novel therapeutic agent for treatment, possibly as an adjunctive therapy together with other CFTR modulators. These modulators include correctors, such as VX-809, which corrects the folding and processing defect of the DF508 mutation [22], and potentiators such as VX-770, which increase the flow of ions through CFTR that is already at the surface, as observed in patients with the G551 D mutation [23].

Topical application of vitamin D is a newly developed therapy that is currently only used on the skin to treat certain dermatological conditions, as a safe and effective mechanism for the introduction of high concentrations of vitamin D and its metabolites to a specific location. The methods of the present disclosure are believed to be the first demonstration of introduction of vitamin D directly to the respiratory system of a host (e.g. topical application to respiratory tissues, e.g. , tracheal, bronchial, and lung tissues, via airways) in order to circumvent the issues related to CF malabsorption of vitamin D, the systemic regulation of 250HD ₃ levels, to increase CFTR mRNA and protein levels and/or to decrease activity of the epithelial sodium channel (ENaC). Before the demonstration in the present disclosure of the ability of respiratory tissue cell to convert inactive forms of Vitamin D compounds to active forms, this route of administration would likely have been dismissed. The present disclosure demonstrates the effect of 1 ,25(OH) ₂ D ₃ on CFTR both in vitro and in vivo, the conversion of vitamin D ₃ to active 1 ,25(OH) ₂ D ₃ in lung epithelial cells, and the feasibility of topical administration of vitamin D to the airways.

Thus, the present disclosure demonstrates that the inactive form of vitamin D (cholecalciferol) is activated by the airway epithelial cells to the active form and that topical treatment of air-liquid interface cultured HBE cells with cholecalciferol also leads to induction of CFTR. The data show that this occurs in two cultured cell lines, as well as in well- differentiated, polarized primary HBE cell cultures from CF patients and non-CF donors and that induction is accompanied by an increase in protein levels on the surface of these cells. This demonstrates that the inactive form of vitamin D can be administered therapeutically via the airways to the respiratory tissues of a CF patient, where it will be converted to the active form of vitamin D to increase levels of CFTR mRNA in the cytoplasm as well as on the surface of the airway epithelium. This provides a safe and inexpensive therapy or adjunctive therapy to increase CFTR mRNA and protein levels to enhance the activity of CFTR correctors and potentiators to treat patients with CF.

Methods of the present disclosure thus include, among others, methods of using vitamin D compounds for treatment of CF and methods of increasing the amount of membrane localized cystic fibrosis conductance regulator (CFTR) in a patient with CF. In embodiments, the vitamin D compounds of the present disclosure, when delivered directly to the respiratory tissues of a host, are effective to treat symptoms of CF in the host by mediating the level of certain proteins in the host. In embodiments, the vitamin D compounds are effective to increase the amount of membrane localized CFTR in a CF patient, which helps to control respiratory symptoms. In embodiments the vitamin D compounds are effective to decrease the amount of ENaC activity present in airway epithelial cells in a CF patient, which helps to control respiratory symptoms. In

embodiments, the vitamin D compounds, when delivered directly to the respiratory tissues of a host with CF, are effective to increase membrane localized CFTR by upregulating or downregulating other proteins (e.g., Keratin 18 (Krt18), Keratin 8 (Krt8), Activator of Hsp90 ATPase-1 (Aha1), etc.) that are involved in the mediation of CFTR production and maintenance in epithelial tissue cells.

In embodiments, methods of the present disclosure for treatment of cystic fibrosis include treating CF by administering directly to the respiratory tissues of a host in need of treatment for CF an effective amount of a composition comprising a vitamin D compound such that the vitamin D compound is effective to alleviate at least one respiratory symptom of the host. In embodiments, delivering the vitamin D compound or a pharmaceutical composition including the compound directly to the respiratory tissue of a host includes topically administering the vitamin D compound to the respiratory tissues of the host, including tissues such as, but not limited to, lung tissues and other airway epithelial tissues (e.g., alveoli, bronchioles, bronchial epithelial tissues, tracheal epithelial tissues, nasal epithelial tissues, etc.). In embodiments, topical administration to the respiratory tissues of a host is accomplished by administering the vitamin D compound via the airways of the host (such as oral or nasal inhalation, endotracheal administration, and the like). Examples of methods for airway delivery of compounds to the respiratory tissues of a host include, but are not limited to, inhalation (e.g. with the use of inhaler, nasal spray, nebulizer or other similar device), or, in if the patient is sedated or otherwise unconscious, the compound can be delivered endotracheal^ (e.g., via an intubation tube or respirator).

In order to facilitate delivery of a vitamin D compound directly to the respiratory tissues of a host, the composition comprising the vitamin D compound may be in the form of an aerosol formulation, or other inhalable formulation (e.g., powder, fine mist, etc.). The aerosol formulations can be made according to methods known to those of skill in the art. The composition may also include a pharmaceutically acceptable carrier as well as other inactive and active compounds for treatment of symptoms of CF or other respiratory conditions, such as surfactants, other active agents used in the treatment of respiratory symptoms of CF, etc. The method may include delivery of a composition consisting essentially of a vitamin D compound and a pharmaceutically acceptable carrier.

In the methods of treatment of CF of the present disclosure, the aerosol or other inhalable formulation of vitamin D compound is administered directly to the respiratory tissues of the host such that the compound contacts the respiratory tissue epithelial cells of the host. In embodiments, the respiratory tissue epithelial cells include bronchial epithelial cells, lung epithelial cells, and combinations of lung and bronchial epithelial cells.

Vitamin D compounds useful in the methods of the present disclosure include, but are not limited to, inactive vitamins D2 and D3 (e.g., ergocalciferol (vitamin D ₂ ) and cholecalciferol (vitamin D ₃ ), collectively referred to as "calciferol"); vitamin D2 and D3 prohormones (e.g., 25-hydroxyvitamin D ₂ (250HD ₂ ) and 25-hydroxyvitamin D ₃ (250HD ₃ ), collectively "calcidiol"); active vitamin D2 and D3 (e.g., 1 ,25-dihydroxyvitamin D ₂ (1 ,25(OH) ₂ ) and 1 ,25-dihydroxyvitamin D ₃ (1 ,25(OH) ₂ D ₃ ), collectively "calcitriol"); metabolites of these compounds and combinations of the above. As discussed above, vitamin D compounds may also include less common vitamin D compounds such as Vitamin D1 , Vitamin D4, as well as synthetic versions of the above mentioned Vitamin D compounds.

In embodiments, the D compound administered is an inactive form of a vitamin D compound (e.g., ergocalciferol and/or cholecalciferol) and is converted to an active vitamin D compound (e.g., calcitriol, such as, 1 ,25-dihydroxyvitamin D ₂ (1 ,25(OH) ₂ ) and/or 1 ,25- dihydroxy vitamin D ₃ (1 ,25(OH) ₂ D ₃ )) by lung epithelial cells.

In embodiments, the vitamin D compound is effective to increase the amount of membrane localized cystic fibrosis conductance regulator (CFTR) on respiratory tissue epithelial cells of the host. As described in more detail in the example below, it has been shown that the vitamin D compound can be effective to upregulate Keratin 18 (Krt18), Keratin 8 (Krt8), or both, in the respiratory tissue epithelial cells of the host. The

upregulation of Krt 18 and/or Krt8 may increase membrane localized CFTR by stabilizing the CFTR. The examples below also demonstrate that the vitamin D compound can be effective to downregulate another protein called activator of Hsp90 ATPase-1 (Aha1) in the respiratory tissue epithelial cells of the host. Downregulation of Aha1 may increase membrane localized CFTR since downregulation of Aha1 rescues misfolded CFTR. The examples below also demonstrate that administration of the vitamin D compound is effective to decrease activity of the epithelial sodium channel (ENaC) in human bronchial epithelial cells in culture, which helps prevent formation of a dehydrated airway surface layer (ASL) lining of the respiratory tract that can occur due to overactive ENaC. Dehydration, and thus thinning, of the ASL results in many respiratory symptoms in CF patients as well as in other respiratory disorders, such as chronic obstructive pulmonary disease (COPD). The combined activity of increasing CFTR and decreasing ENaC appear to reduce dehydration of the ASL. Thus, the examples demonstrate that administration of a vitamin D compound to the respiratory tissue epithelial cells interrupts pathways that cause dehydration of the ASL responsible respiratory symptoms of subjects, providing a viable treatment for patients with such symptoms.

Methods of the present disclosure therefore also include increasing the amount of membrane localized cystic fibrosis conductance regulator (CFTR) on respiratory epithelial tissues in a host with cystic fibrosis. Methods of the present disclosure also include decreasing ENaC activity in a host with cystic fibrosis as well as both increasing the amount of membrane localized CFTR on respiratory tissue cells and decreasing ENaC activity. In embodiments, such methods include administering directly to the respiratory tissue of the host an effective amount of a composition comprising a vitamin D compound, such that the vitamin D compound is effective to increase the amount of membrane localized CFTR, decrease ENaC activity, or both. In embodiments this method is useful to treat a patient with a respiratory disorder, such as, but not limited to, CF, COPD, and other disorders associated with decreased CFTR activity, increased ENaC activity, or both.

In embodiments, the amount of membrane localized CFTR in the host with cystic fibrosis is greater after treatment with CFTR than the amount of membrane localized CFTR in the same host prior to treatment with the vitamin D compound. In embodiments, the amount of membrane localized CFTR in the host with cystic fibrosis is greater than a reference amount of membrane localized CFTR in hosts having cystic fibrosis who have not been treated with the vitamin D compound. As used herein, a reference amount refers to a reference standard for comparison that is calculated based on an average of amounts of membrane localized CFTR from a certain number of patients with CF. In embodiments, the reference amount may be based on patients meeting similar criteria as the patient being treated, such as age, weight, time since diagnosis, severity of symptoms, type of mutation, etc.

The present disclosure also includes compositions for use in the methods of the present disclosure described above. Although vitamin D compositions are known, the present disclosure provides embodiments of aerosolized and aerosolizable formulations including the vitamin D compounds described above. An embodiment of a composition of the present disclosure includes an aerosolized formulation including a vitamin D compound in the form of cholecalciferol (D ₃ ) and an pharmaceutically acceptable carrier, wherein the composition is adapted for aerosol delivery by a nebulizer, personal inhaler, or other respiratory airway delivery device,

Additional details regarding the tests and methods of the present disclosure are provided in the Examples below. The specific examples below are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. Without further elaboration, it is believed that one skilled in the art can, based on the description herein, utilize the present disclosure to its fullest extent. All publications recited herein are hereby incorporated by reference in their entirety.

It should be emphasized that the embodiments of the present disclosure, particularly, any "preferred" embodiments, are merely possible examples of the implementations, merely set forth for a clear understanding of the principles of the disclosure. Many variations and modifications may be made to the above-described embodiment(s) of the disclosure without departing substantially from the spirit and principles of the disclosure. All such modifications and variations are intended to be included herein within the scope of this disclosure, and protected by the following embodiments.

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to perform the methods and use the compositions and compounds disclosed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C, and pressure is at or near atmospheric. Standard temperature and pressure are defined as 20°C and 1 atmosphere.

It should be noted that ratios, concentrations, amounts, and other numerical data may be expressed herein in a range format. It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a concentration range of "about 0.1 % to about 5%" should be interpreted to include not only the explicitly recited concentration of about 0.1 wt% to about 5 wt%, but also include individual concentrations (e.g., 1 %, 2%, 3%, and 4%) and the sub-ranges (e.g. , 0.5%, 1 .1 %, 2.2%, 3.3%, and 4.4%) within the indicated range. In an embodiment, the term "about" can include traditional rounding according to significant figures of the numerical value. In addition, the phrase "about 'x' to y" includes "about 'x' to about 'y"\

EXAMPLES

Now having described the embodiments of the present disclosure, in general, the following Examples describe some additional embodiments of the present disclosure. While embodiments of the present disclosure are described in connection with the following examples and the corresponding text and figures, there is no intent to limit embodiments of the present disclosure to this description. On the contrary, the intent is to cover all alternatives, modifications, and equivalents included within the spirit and scope of embodiments of the present disclosure.

EXAMPLE 1

Induction of CFTR mRNA and protein in cultured HBE cells and activation of inactive vitamin D

The present example describes the effect of 1 ,25(OH) ₂ D ₃ on CFTR in vitro and the conversion of vitamin D ₃ to active 1 ,25(OH) ₂ D ₃ in lung epithelial cells.

Materials and Methods

Cell Culture

Human bronchial epithelial (HBE) cells were from two sources. Normal HBE cells (NHBE) were purchased from Lonza (Walkersville, MD) and grown in bronchial epithelial growth medium (BEGM) from the same company. CF HBE cells were obtained from lungs explanted during transplantation under IRB-approved protocols and were cultured at an air liquid interface (ALI) until well differentiated using well described protocols [24], which is hereby incorporated by reference herein). UNCN3T (non-CF) and UNCCF1 T (CF) cells were provided by University of North Carolina, and have been described previously [25]. BEAS-2B cells were obtained from the American Type Culture Collections (Rockville, MD) and grown in BEGM medium. HEK293 cells were a generous gift University of Florida and were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum and penicillin/streptomycin (Thermo Scientific, Rockford, IL). All cells were grown at 37°C in 5% C0 ₂ . Submerged cells were grown in 12-well plates and cells grown at an ALI were cultured in Transwell® inserts (Fisher Scientific, Pittsburgh, PA).

RNA isolation, RT-PCR, and PCR

After cells were treated with 1 ,25(OH) ₂ D ₃ (Sigma-Aldrich, St. Louis, MO) or vitamin D ₃ , total RNA was isolated using RNeasy Plus Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, and was reverse transcribed using iScipt cDNA synthesis kit (Bio-Rad, Hercules, CA) using the T100 ThermoCycler (Bio-Rad). RT-PCR was performed using SoAdvanced Universal SYBR Green Supermix (Bio-Rad) using the CFX96 Real Time PCR Detection System (Bio-Rad). Data was analyzed with CFX Manager Software (Bio- Rad). For PCR, cDNA was amplified using iProof HF Master (Bio-Rad) and fragments were visualized on a 2% agarose gel. Bands were cut out and sent to UF Interdisciplinary Center for Biotechnology Research for Sanger sequencing to confirm identity of the bands, β-2 - macroglobulin (B2M) was used as the reference gene and primers for both RT-PCR and PCR are listed in Table 1 and were designed and purchased from Integrated DNA

Technologies (Coralville, IA).

Table 1

Cyp2R1 PCR AGAGACCCAGAAGTGTTCCAT (SEQ ID NO: 15) F

Cyp2R1 PCR GTCTTTCAGCACAGATGAGGTA (SEQ ID NO: 16) R

Cyp27A1 PCR CACAAACTCCCGGATCATAGAA (SEQ ID NO: 17) F

Cyp27A1 PCR C AAG G AC AG C AATG C G ATAAAG (SEQ ID NO: 18) R

Western blot

Cells were lysed using RIPA buffer. Samples were mixed with LDS sample buffer (Thermo Scientific) and run on a 10% NuPAGE Tris-Acetate gel (Thermo Scientific) .

Proteins were transferred using the iBIot (Thermo Fisher) transfer apparatus to nitrocellulose membranes. Membranes were blocked in 5% milk in Tris-buffered saline with Tween 20 (TBS-T) and incubated with either anti-Cyp2R1 (Abeam Inc. , Boston, MA), anti-Cyp27A1 EPR7529 (Abeam), anti-Cyp27B1 H-90 (Santa Cruz Biotechnology) or anti-p-actin BA3R (Thermo Fisher) overnight and bands were visualized by chemiluminescence. Densiometric analysis of the bands was performed using ImageJ software.

Confocal Microscopy and Flow Cytometry

Cells were treated with 1 ,25(OH) ₂ D ₃ (Sigma-Aldrich, St. Louis MO) and fixed with 2% paraformaldehyde (Santa Cruz Biotechnology, Santa Cruz, CA) . For surface CFTR staining, cells were subsequently blocked in 1 % BSA and incubated with anti-CFTR H-182 (Santa Cruz Biotechnology) overnight. Cells were washed with phosphate-buffered saline and incubated with CruzFluor 488 (Santa Cruz Biotechnology) for 1 hour at room temperature. Fluorescence was visualized using the Leica TCS-SP5 at the University of Florida

Interdisciplinary Center for Biotechnology Research.

For intracellular staining of CFTR, cells were permeabilized after fixation with 0.5% TWEEN 20 (Sigma) in PBS. Cells were then blocked in 1 % BSA and the same steps as above were followed. Fluorescence was detected by either confocal microscopy using the Leica TCS-SP5 or flow cytometry using the FACS Calibur cytometer (BD Biosciences, San Jose, CA) . Confocal data was analyzed using LAS AF Lite Software (Leica, Buffalo Grove, IL) and flow cytometry data was analyzed with FCS Express 4 (De Novo Software, Glendale, CA) .

250HD ₃ ELISA

Bronchial epithelial cells (n=3) from non-CF controls or CF-bronchial epithelial cells (n=3) (Lonza) cultured on collagen coated-6 well plates were treated with vitamin D ₃ (Sigma Aldrich) for 24 hours. All experiments were conducted in the absence of fetal bovine serum. Ethanol matched to the highest vitamin D ₃ dose was used as a vehicle control. Supernatants were collected and 250HD ₃ measured by enzyme immunoassay (EIA) (Immunodiagnostic Systems, Fountain Hills, AZ) according to the manufacturer's instructions. Media with vitamin D3 alone was also assessed for 250HD ₃ and these values were subtracted from the total 250HD ₃ levels reported. The assay detection limit for the 250HD ₃ EIA is 5-152 ng/mL.

Statistical Analysis

The results obtained from three independent experiments were expressed as the fold change relative to EtOH-treated cells ± standard error of the mean (SEM). Each independent experiment was also run in technical triplicates. All differences were analyzed by a two- tailed unpaired Student's t-test. Statistics for the ELISA were performed with oneway ANOVA with post-hoc multiple comparisons versus the control group. A p-value of p<0.05 was considered statistically significant.

Results

Effect of 1 ,25(OH) ₂ D ₃ on CFTR expression in bronchial epithelial cells

To quantify the effect of vitamin D on CFTR gene expression, cultured commercially available cell lines (NHBE and BEAS-2B), immortalized primary cells (UNCN3T and UNCCF1 T), and primary differentiated cell lines were treated with 10 nM 1 ,25(OH) ₂ D ₃ for either 6 or 24 hours and the change in CFTR mRNA levels was quantified. All primary patient and UNCCF1 T cells are positive for the F508del mutation. RNA was harvested, and RT-qPCR was performed. Significant increases in CFTR mRNA levels were observed in all cultures at 6 hr. (FIG. 1). In five of the six samples, maximum upregulation was achieved by 6 hours. In the other two samples, CFTR expression was greatest after 24 hours.

To quantify the effect of vitamin D on CFTR protein expression, UNCCF1 T cells were treated with 10 nM 1 ,25(OH) ₂ D ₃ for 24 hours, fixed, permeabilized, and stained for total CFTR protein. Flow cytometry revealed a second population of cells with a greater fluorescence compared to the EtOH control, which suggests that there was an overall increase in total protein with 1 ,25(OH) ₂ D ₃ treatment (FIG. 2).

The effect of 1 ,25(OH)2D ₃ on surface expression of CFTR in CF cells

The F508del mutation leads to an improperly folded CFTR, and subsequent degradation of the protein prior to reaching the membrane. Therefore, surface expression of CFTR was evaluated by confocal microscopy. UNCCF1 cells were treated with 1 ,25(OH) ₂ D ₃ for 4 and 24 hours and then cells were permeabilized and stained for both extracellular and intracellular CFTR protein using immunofluorescence. Intracellular protein was detected in EtOH-treated cells, which is expected because F508del mutants are capable of CFTR protein translation, and the protein reaches the cell surface. After both 4 and 24 hours, there is an increase in total fluorescence and therefore total protein, which is consistent with the flow cytometry data (FIG. 3). In addition, there is increased fluorescence at the perimeter of these cells, suggesting that 1 ,25(OH) ₂ D ₃ increases surface CFTR expression. To detect surface CFTR, UNCCF1 cells were fixed, but not permeabilized, and stained for CFTR. As expected, no surface CFTR was detected in the EtOH treated conditions. However, as shown in FIG. 3, after both 4 and 24 hours of 1 ,25(OH) ₂ D ₃ treatment, CFTR was detected on the surface, suggesting that 1 ,25(OH) ₂ D ₃ can not only increase CFTR mRNA and protein, but also bring CFTR to the surface of the cell.

The conversion of vitamin D ₃ to 250HD ₃ in bronchial epithelial cells

Bronchial epithelial cells are known to convert 250HD ₃ to 1 ,25(OH) ₂ D ₃ due to the expression of the 1 -alpha hydroxylase Cyp27B1 in these cells [26]. However, both 250HD ₃ and 1 ,25(OH) ₂ D ₃ are not useful clinically due to their dietary short half-life and negative effects on the kidneys, respectively [15-17]. Therefore, it was determined if bronchial epithelial cells could convert the dietary vitamin D ₃ to 250HD ₃ and ultimately 1 ,25(OH) ₂ D ₃ . First, the presence of the two most significant 25-hydroxylases, Cyp27A1 and Cyp2R1 , was determined in primary non-CF donors and cystic fibrosis patients (FIG. 4A) . In all samples, Cyp2R1 and Cyp27A1 expression was detected by PCR and confirmed by DNA sequencing. A similar pattern of expression in BEAS-2B cells was also observed (not shown). Expression of Cyp2R1 and Cyp27A1 protein was also confirmed by western blot of BEAS-2B whole cell lysate. Alongside BEAS-2B cells, kidney HEK293 cell lysates were also probed for both 25- hydroxylases as well as Cyp27B1 . However, very low to undetectable levels of Cyp27A1 and Cyp2R1 were found in the HEK cell line, especially compared to the BEAS-2B cell line. Cyp27B1 was expressed in both HEK293 and BEAS-2B cells, although substantially higher in the kidney cells, which was expected due to the kidney's previously established major role in vitamin D metabolism (FIG. 4B). To confirm that this activation occurs, NHBE cells were treated with vitamin D at increasing concentrations, and 250HD ₃ levels were quantified in the supernatant by ELISA. The result shown in FIG. 4C demonstrates a dose-dependent increase in 250HD ₃ levels, indicating that the vitamin D ₃ was converted to 250HD ₃ by the cultured cells. In addition to NHBEs from healthy donors, we also examined if diseased, CF- derived epithelial cells were capable of converting vitamin D ₃ to 250HD ₃ . A very similar conversion compared to NHBE's was found and it was confirmed that disease does not impact bronchial epithelial cells ability to metabolize vitamin D locally.

After confirming bronchial epithelial cells express both Cyp27A1 and Cyp2R1 , three non-CF cultured lung epithelial cell lines (NHBE, UNCN3T and BEAS-2B) were treated with 10 μΜ D ₃ for 6 and 24 hours to quantify expression change in the 1 ,25(OH) ₂ D ₃ dependent gene Cyp24A1 (FIG . 5A). Cyp24A1 was upregulated 31 fold after 6 hours and 6 fold at 24 hours in NHBE cells. Total mRNA was isolated after 6 and 24 hours, and CYP24A1 gene expression was quantified by QRT-PCR. Cyp24A1 was upregulated 62 fold at 6 hours and increased to 132 fold relative to the control in UNCN3 cells. In BEAS-2B cells, Cyp24A1 was upregulated only 12.5 fold and was the least amount of the three cell lines at 6 hours, but by 24 hours, Cyp24A1 expression was the greatest of the cell lines at 300 fold. In addition, the relative expression of LL-37 was also quantified, which is known to be upregulated after 1 ,25(OH) ₂ D ₃ treatment in bronchial epithelial cells. Like Cyp24A1 , LL-37 was upregulated in all three cell lines, with BEAS-2B cells expressing the greatest levels after 24 hours of vitamin D ₃ treatment (data not shown). Because these genes can only be upregulated in the presence of 1 ,25(OH) ₂ D ₃ , the upregulation observed with vitamin D ₃ treatment strongly implies vitamin D ₃ is converted to the active 1 ,25(OH) ₂ D ₃ , which is then responsible for the changes in gene expression.

Topical administration of vitamin D in vitro

While oral supplementation may be considered as a way to increase overall 1 ,25(OH) ₂ D ₃ levels in the airway to induce CFTR in CF patients, disadvantages to such oral supplementation exist, as discussed above. Thus, topical application was tested in light of the discovery that respiratory epithelial cells can convert inactive vitamin D3 to the active form. Therefore, the effect of delivery of vitamin D to the apical surface of BEAS-2B cells grown both submerged and at the air liquid interface (ALI) with vitamin D ₃ for 6 hours we examined, and an increase in CFTR expression was observed (FIG. 5B). In this experiment, vitamin D ₃ was added at 10nM in the submerged culture, as in the experiments above, to approximate physiological levels found in the circulation. On the apical surface the vitamin D ₃ was applied in a small volume (1 ΟΟμΙ) at 10μΜ on the apical surface of ALI cultures for 6 hours in order to demonstrate the ability to deliver high concentrations to the airway surface that could be rapidly converted to the active form. CFTR was quantified as above relative to 0.1 % ethanol treated cultures. Induction in all cases was significant at p<0.001 .

Mechanism of induction

Examination of the putative promoter region of CFTR suggests the possibility of at least three VDRE sequences in the 5' flanking region (data not shown), which suggests a VDR-mediated induction of CFTR. However, it is unclear as to why there would be a concomitant increase in CFTR protein in the AF508 cells (see FIGs. 1 and 2, discussed above). During the course of the research, RNAseq was carried out on mRNA from NHBE cells treated with 1 ,25(OH) ₂ D ₃ for 24 hours. Briefly, UNC-CF1 cells were incubated with either ethanol or 1 ,25(OH) ₂ D ₃ , and mRNA levels of Krt18 (FIG. 6, right bar) and Aha1 (FIG. 6, left bar) were quantified by QRT-PCR. Optimal times are shown for each gene: for Krt18 optimal time of induction was 4 hours, and for Aha1 optimal time for reduction was 24 hours.

Data was observed that suggest at least two other potential mechanisms that could lead to this increase in protein levels and surface localization. Keratin 18 (Krt18) is an intermediate filament protein which stabilizes CFTR and increases its surface protein expression [27]. The RNAseq data indicated a 2-fold induction of Krt18 mRNA in these cells. This was confirmed in UNC-CF1 cells, with an optimal induction seen at 6 hours (FIG. 6, right-hand bar). A similar level of induction of Krt8 was observed, which dimerizes with Krt18 (data not shown). Aha1 is a heat shock protein 90 (Hsp90) co-chaperone. Downregulation of Aha 1 rescues misfolded CFTR in CF cells [28]. The RNAseq showed a 2.4-fold

downregulation of Aha 1 in NHBE cells, and this was confirmed in UNC CF1 cells, with the lowest levels observed after 24 hour treatment (FIG. 6, left-hand bar). Similar results were observed in UNC N3 cells (not shown). Thus, either or both of these vitamin D-regulated gene products could assist in the proper localization of CFTR.

Discussion

The above results show that vitamin D and its metabolites are able to increase CFTR mRNA and protein levels, as well as surface expression of the protein in both normal and F508del CF airway epithelial cells. In this most prevalent CF mutation, CFTR protein is synthesized, but does not fold correctly. This misfolding results in degraded protein, no surface expression of CFTR, and ultimately no chloride transport. Thus, treatment of BEC with vitamin D could provide a benefit to individuals with this and other mutations where CFTR surface localization is defective.

With 1 ,25(OH) ₂ D ₃ treatment, CFTR mRNA, protein, and surface expression were upregulated significantly in bronchial epithelial cells. These changes were detected through qPCR, flow cytometry and confocal microscopy and were observed through a wide variety of cultured and primary lung epithelial cells from both CF and non-CF donors. As we were able to observe an increase in CFTR protein levels as early as 6 hours, it is believed that vitamin D may simultaneously be acting on multiple pathways: the standard transcriptional pathway, and one that regulates CFTR transport. While all cultures demonstrated induction of CFTR mRNA, there was variability in both the extent of induction and the timing. This can be seen both in cell lines and patient samples. This may be due to variability in other aspects of gene regulation between the cells, which are known to exist in vitamin D-mediated gene regulation [29].

The standard mechanism of transcriptional activation would involve the entry of 1 ,25(OH) ₂ D ₃ into the cell, followed by the VDR-mediated activation of the transcription of CFTR, which would lead to an overall increase in CFTR protein expression. When analyzing the promoter region for transcription factor binding sites using the JASPAR database, several weak putative VDREs were detected. Considering that the CFTR mRNA increased approximately two fold in most cell types tested, a weak VDRE may account for these low levels. However, it would likely not account for the increase in surface expression seen so early. Vitamin D is also known to have numerous intracellular nongenomic roles in addition to transcriptional activation. 1 ,25(OH) ₂ D ₃ has been reported to activate intracellular signaling molecules such as protein kinases A and C, phosphatidylinositol 3-kinase, phospholipase C as well as open calcium channels [30-32]. Therefore, vitamin D could also be affecting CFTR transport post-transcriptionally. There also exist proteins that are common to both CFTR and the vitamin D pathway. For example, vitamin D has been reported to interact with the heat shock proteins and other intracellular chaperones, such as Bag-1 , which help to correct CFTR folding and surface expression [33]. A second protein common to both pathways is ERp57, which has been found to be complexed with F508del CFTR but also serves as the vitamin D receptor found in the plasma membrane [34-36]. Therefore, vitamin D may be binding to these molecules to allow for correct CFTR folding.

These findings demonstrate that 1 ,25(OH) ₂ D ₃ upregulates CFTR, and could be potentially useful therapeutically. 1 ,25(OH) ₂ D ₃ , while effective in vitro, has its limitations as a therapy. It only has a half-life of several hours and has the undesirable side effect of hypercalcemia. Currently, it is only approved to raise calcium levels in patients undergoing long-term dialysis. The precursor, 250HD ₃ has a longer half-life in the serum, but like 1 ,25(OH) ₂ D ₃ , is only approved for increasing serum calcium due to the same negative side effects. Vitamin D ₃ is the form most commonly taken as an oral supplement and is the most stable, but it must be converted to 250HD ₃ in the liver and 1 ,25(OH) ₂ D ₃ in the kidney to be activated. It is known that BEC can convert 250HD ₃ to 1 ,25(OH) ₂ D ₃ [26]. We demonstrate here for the first time that these epithelial cells not only express the hydroxylases to convert vitamin D ₃ to 250HD ₃ , but treatment with vitamin D ₃ also activates 1 ,25(OH) ₂ D ₃ dependent genes. More importantly, vitamin D ₃ treatment also exhibited the same increase in CFTR mRNA as the 1 ,25(OH) ₂ D ₃ treatment. HEK cells were unable to activate these genes after vitamin D ₃ treatment nor was any substantial protein expression of 25-hydroxylases detected. This was not surprising due to the fact that HEK cells are kidney cells and are primarily focused on the second conversion.

The ability of lung cells to metabolize 1 ,25(OH) ₂ D ₃ from vitamin D ₃ has several important implications. First, this opens the possibility of other cell types outside the liver possessing the ability to undergo both conversion steps which would greatly redefine what is understood about vitamin D metabolism. In addition, the new data we present here of vitamin D ₃ conversion to 250HD ₃ and to 1 ,25(OH) ₂ D ₃ also introduces the prospect of a new method to inexpensively maximize 1 ,25(OH) ₂ D ₃ exposure to the lungs. EXAMPLE 2- CFTR expression mediated by intranasally administered Vitamin D

In the present Example, to demonstrate the ability of vitamin D and its metabolites to induce CFTR gene expression in vivo, ethanol, vitamin D3 or 1 ,25(OH) ₂ D ₃ (in 0.1 % ethanol/PBS) were introduced into the nares of mice

Materials and Methods

Procedures, materials and methods are as described in Example 1 above, except as indicated below.

Animal experiments

All animal experiments were conducted in accordance with University of Florida Animal Care and Use Committee. C57BL/6J mice were obtained directly through University of Florida ACS Breeding. Mice were sedated with an injection of 40 mg/kg ketamine and 5 mg/kg xylazine (Sigma-Aldrich) and were intranasally administered 50 μΙ_ (25 μί/ηΒΓβε) 1 μΜ 1 ,25(OH) ₂ D ₃ (Sigma-Aldrich) or EtOH vehicle control (Sigma-Aldrich) for 6 hours with n=5 per condition. After 6 hours, mice were sacrificed, nasal epithelia, trachea, and lungs were obtained, and RNA was isolated as described above and RT-PCR was performed. In another experiment, 10μΙ of vehicle control (0.1 % ethanol/PBS) or vehicle containing 10 ^"6 M vitamin D ₃ or 1 ,25D ₃ in 1 % ethanol were introduced by intranasal inoculation. After 6 hours, mice were sacrificed, tracheas were removed, and airway tissues were dissected.

Results

To demonstrate the feasibility of topical delivery of vitamin D in vivo, mice were intranasally treated with EtOH , or 1 μΜ 1 ,25(OH) ₂ D ₃ for 6 hours, sacrificed, and the nasal epithelia, trachea, and lungs were harvested. RT-qPCR confirmed Cyp24A1 mRNA upregulation in both the nasal epithelia (data not shown) and trachea in 1 ,25(OH) ₂ D ₃ -treated mice. CFTR mRNA expression was also upregulated in the 1 ,25(OH) ₂ D ₃ treated mice (FIG. 7) .

For the experiment testing both inactive vitamin D ₃ and 1 ,25D ₃ , results are shown in the graphs of FIGS. 8A and 8B, which demonstrate that both genes (CYP24A1 and CFTR) are induced by intranasal delivery of vitamin D ₃ and 1 ,25D ₃ . Results show fold increase in mRNA levels of CYP24A1 (8A) or CFTR (8B) relative to control. Results are shown as means +/- SEM and differences are significant with p<0.05 by t-test.

To compare the local vitamin D induction demonstrated above with systemic vitamin D mediated induction of gene expression in airway cells in vivo, wild-type C57BI/6 mice (n=5) mice were injected once daily with 25ng/200g body weight 1 ,25(OH) ₂ D ₃ (25ng/200g body weight) or control vehicle (90% polypropylene glycol/10% ethanol), daily for 1 ,2 or 3 days (as previously described [37], which is hereby incorporated by reference) . 24 hours after the third injection, mice were sacrificed, and lung and nasal epithelium were excised. Total mRNA was isolated, and CYP24A1 mRNA was quantified by QRT-PCR, relative to β- actin. The results shown in FIG. 9 demonstrate that this vitamin D-regulated gene is induced by systemic treatment with the active form of vitamin D in vivo, although the kinetics appears to vary between the tissues.

Discussion

One important hurdle that must be considered is how to deliver vitamin D to the lungs. CF patients may be chronically vitamin D deficient because they are unable to absorb fat-soluble vitamins. Whatever is successfully absorbed must undergo two hydroxylation steps in two different organs before the activated form can be delivered to the lung. Even with supplementation, it is unlikely that sufficient levels of 1 ,25(OH) ₂ D ₃ will reach the airway to induce CFTR expression. Topical administration of vitamin D ₃ , which would be converted locally, would therefore have an improved effect on CFTR as well as the additional benefit of the activation of antimicrobial and anti-inflammatory genes.

Since in vivo data for topical administration of vitamin D to the lung is absent in the literature, a mouse model was examined to determine the feasibility of this method.

1 ,25(OH)2D ₃ intranasally administered to mice for 6 hours upregulated both Cyp24A1 and CFTR in the nasal epithelia and trachea (FIG. 7) but no initial effect was observed in the lungs. This is most likely due to insufficient concentrations reaching the lungs, which could be improved by delivery of vitamin D ₃ through aerosolization. However, when all samples were obtained from the proximal lung, moderate Cyp24A1 upregulation was observed after treatment (data not shown). Data from experiments of delivery of inactive vitamin D ₃ as well as 1 ,25(OH) ₂ D ₃ (shown in FIG. 8A and 8B) demonstrated that not only can the prototypical vitamin D-responsive gene CYP24A1 be induced by topical administration of 1 ,25(OH) ₂ D ₃ or vitamin D ₃ , but also that mouse tracheal epithelium is capable of converting inactive vitamin D ₃ to the active form, and that this also had the desired effect of upregulation of CFTR.

Together, these data serve as proof of concept that 1 ,25(OH) ₂ D ₃ and/or the more stable inactive vitamin D ₃ can be topically administered and CFTR expression can be affected by that method of delivery. This is believed to be the first instance of topical administration of vitamin D by a method other than to the skin and represents a new approach to treat disorders involving genes expressed in the airway. The above examples demonstrate that vitamin D can induce the expression of CFTR in the airway cells, which is a first step to correcting the defect in many of the mutations of this disease.

While the vitamin D-mediated induction of CFTR shown here may only lead to a small effect on CFTR function, this may be sufficient to have effects on CF symptoms. Additional studies on the topical delivery of vitamin D directly to the airways in in aerosol formulations may be able to obtain higher efficiency and delivery in greater amounts to deeper respiratory tissues, such as lung tissues. Also, this effect could be combined with recently developed CFTR modifiers. To date, only two drugs are approved by the FDA to target CFTR in cystic fibrosis but each must be taken orally and both have displayed Iimitations clinically. Ivacaftor corrects faulty chloride ion transport and only can treat patients who have a CFTR mutation that allows CFTR to reach the surface, which amounts to just 4% of the CF population [38]. Lumacaftor is designed to treat patients with the more prevalent F508del mutation by correcting faulty CFTR processing, but only produces small effects on lung function and lower exacerbation rates [39-40]. Because the results here demonstrate that vitamin D results in increased CFTR surface localization in CF bronchial epithelial cells, it is believed that vitamin D can be utilized as a therapy for CF or as an adjunctive therapy to improve the efficacy of the approved drugs.

Currently, vitamin D is an appealing therapeutic agent for the treatment of CF due to its anti-inflammatory properties and ability to induce antimicrobial activity, but the results in this study suggest another, more direct role for vitamin D by increasing CFTR levels. Like the other drugs, vitamin D targets CFTR directly and is FDA approved, but is also inexpensive. Vitamin D is well-tolerated at high levels, which would minimize the concern of overdosing patients. Not only are the results presented promising on their own, but additional studies involving synergy of vitamin D and the FDA approved drugs holds great potential.

EXAMPLE 3-Effect of Vitamin D on epithelial Na channel (ENaC) activity

In the present Example, to determine the physiological effect of vitamin D treatment on the airway surface layer, cultures were treated with ethanol vehicle or 1 ,25(OH) ₂ D ₃ and tested for ion transport activity and reduction in amiloride-sensitive short circuit (/sc) as a measure of ENaC activity.

Materials and Methods

Primary human bronchial epithelial cells (BECs) were grown at an air liquate interface (ALI) until well-differentiated. ALI BEC well-differentiated cultures were then treated with 0.1 % ethanol vehicle or 10 nM 1 ,25(OH) ₂ D ₃ for 24 hours, and ion transport was quantified in Ussing chambers. This analysis was repeated in triplicate cultures from 18 different donors (8 non-CF, 9 AF508/AF508 CF and one G542X/G542X CF).

Results

The ethanol control only or 1 ,25(OH) ₂ D ₃ was added to a media of human bronchial epithelial cells grown at an air-liquid interface. 24 hours later, the cells were subjected to analysis in Ussing chambers, a device that enables assessment of ion channel activity. While a significant difference was not observed in short circuit current (/sc) stimulated by forskolin, which measures CFTR activity, a consistent 33% reduction in amiloride-sensitive /sc was observed, which is indicative of ENaC activity.

FIG. 10A illustrates a tracing of short circuit current across the epithelial cells as a function of time, with vertical arrows indicating when certain chemicals were added to the Ussing chamber. This demonstrates that the three cultures treated with 1 ,25(OH) ₂ D ₃ exhibited less current after amiloride treatment than the three cultures receiving an equal concentration of the ethanol vehicle control only, meaning that ENaC activity was decreased as a result of the 1 ,25(OH) ₂ D ₃ treatment.

FIG. 10B illustrates the mean relative ENaC activity (measured as function of amiloride- sensitive short circuit current) in triplicate wells from CF and non-CF donors, indicating that the effect of vitamin D treatment is consistent in both CF and non-CF respiratory epithelial cells. The results illustrate that the cultures treated with 1 ,25(OH) ₂ D ₃ had lower amiloride- sensitive short circuit current than cultures just receiving an equal concentration of the ethanol vehicle. This analysis was repeated in triplicate cultures, with a similar response in all 18 donors (FIG. 10B, dAmil), showing the average mean reduction in amiloride-sensitive /sc (n = 8 and 9 for non-CF and CF donors, respectively; for the

G542X/G542X donor, the mean of triplicates is shown). The mean reduction over all 18 patients was to 67.33+/-3.78% of the control value. The differences in amiloride-sensitive /sc (dAmil), when expressed as percent of the control, are all highly significant while baseline characteristics including transepithelial resistance (RT) were not changed (RT, FIG. 10B), nor was expression of α, β, γ ENaC subunit mRNA levels (data not shown).

Discussion

The airway surface layer (ASL) is a thin layer of salt, water, and protein that lines the respiratory tract and facilitates innate immunity in the lung. The ASL is made of two layers, one that is directly adjacent to the epithelial cells, which is called the periciliary layer (PCL), and another, called the mucus layer, which lies on top of the PCL. Maintaining a hydrated ASL provides a low-viscosity environment for cilia to beat effectively and to propel mucus, pathogens, and particles toward the mouth. Furthermore, a dehydrated ASL accelerates the development of mucus plugs, which can obstruct air flow and serve as focal points for bacterial colonization. ASL hydration is controlled by the transepithelial movement of ions and water. At the apical membrane of airway epithelia, anions are mostly secreted by CFTR, and Na ⁺ is absorbed by the epithelial sodium channel (ENaC). In the case of cystic fibrosis (CF), where CFTR is mutated and has disrupted or diminished function, the balance between anion secretion and Na ⁺ absorption is altered. Absence of functioning CFTR leads to reduced anion secretion and triggers hyperactive ENaC that excessively absorbs Na ⁺ , which together leads to dehydrated ASL.

The data above indicates that vitamin D consistently inhibits ENaC activity in primary human ALI BECs. Amiloride is an inhibitor of ENaC, so in the results above, the lower amiloride-sensitive short circuit current means that the added 1 ,25(OH) ₂ D ₃ decreased ENaC activity. A decrease in ENaC leads to a more hydrated ASL layer. In people with CF, 1 ,25(OH) ₂ D ₃ treatment would make the ASL less dehydrated, which is a major problem and contributing factor to the symptoms and progression of CF. Decreased ENaC activity is expected to improve ASL hydration in CF, which in turn should improve mucociliary clearance.

References

1 . Bikle, D.D. , J.S. Adams, and S. Christakos, Vitamin D: production, metabolism, mechanism of action and clinical requirements. , in Primer on the Metabolic Bone Diseases and Disorders of Mineral Metabolism, C.J. Rosen , Editor. 2013, Wiley Blackwell. p. 235-248.

2. Christakos, S. , D.V. Ajibade, P. Dhawan, A.J. Fechner, and L.J. Mady, Vitamin D: metabolism. Endocrinol Metab Clin North Am, 2010. 39(2): p. 243-53, table of contents.

3. T. Sakaki, N. Kagawa, K. Yamamoto, K. Inouye, Metabolism of vitamin D3 by

cytochromes P450, Front Biosci, 10 (2005) 1 19-134.

4. J.G. Zhu, J.T. Ochaiek, M . Kaufmann, G. Jones, H.F. Deluca, CYP2R1 is a major, but not exclusive, contributor to 25- hydroxy vitamin D production in vivo, Proc Natl Acad Sci U S A, 1 10 (2013) 15650-15655.

5. D.D. Bikle, Vitamin D metabolism, mechanism of action, and clinical applications, Chem Biol, 21 (2014) 319-329.

6. S. Christakos, P. Dhawan, A. Verstuyf, L. Verlinden, G . Carmeliet, Vitamin D: Metabolism, Molecular Mechanism of Action, and Pleiotropic Effects, Physiol Rev, 96 (2016) 365-408.

7. Pike, J.W. and M .B. Meyer, The vitamin D receptor: new paradigms for the regulation of gene expression by 1 ,25-dihydroxyvitamin D(3). Endocrinol Metab Clin North Am, 2010. 39(2): p. 255-69, table of contents.

8. Christakos, S. , Vitamin D gene regulation, in Principles of Bone Biology, J. P.

Bilezikian, L.G . Raisz, and T.J. Martin, Editors. 2008, Elsevier: San Diego, CA. p. 770-794.

9. R.K. Wali, C.L. Baum, M .D. Sitrin, T.A. Brasitus, 1 ,25(01-1)2 vitamin D3 stimulates membrane phosphoinositide turnover, activates protein kinase C, and increases cytosolic calcium in rat colonic epithelium, J Clin Invest, 85 (1990) 1296- 1303.

10. B.D. Boyan, J. Chen, Z. Schwartz, Mechanism of Pdia3-dependent 1 a,25-dihydroxy vitamin D3 signaling in musculoskeletal cells, Steroids, 77 (2012) 892-896. 1 1 . S. Tunsophon, I . Nemere, Protein kinase C isotypes in signal transduction for the

1 .25D3-MARRS receptor (ERp57/PDIA3) in steroid hormone-stimulated phosphate uptake, Steroids, 75 (2010) 307-313.

12. Christakos, S. , M . Hewison, D.G. Gardner, C.L. Wagner, I .N. Sergeev, E. Rutten,

A. G . Pittas, R. Boland, L. Ferrucci, and D.D. Bikle, Vitamin D: beyond bone. Ann N Y Acad Sci, 2013. 1287: p. 45-58.

13. Y. Zhang, D.Y. Leung, B.N. Richers, Y. Liu, L.K. Remigio, D.W. Riches, E. Goleva, Vitamin D inhibits monocyte/macrophage proinflammatory cytokine production by targeting MAPK phosphatase- 1 , J Immunol, 188 (2012) 2127-2135.

14. P. McNally, C. Coughlan, G. Bergsson, M. Doyle, C. Taggart, L. Adorini, M .R. Uskokovic,

B. El-Nazir, P. Murphy, P. Greally, CM . Greene, N.G . McElvaney, Vitamin D receptor agonists inhibit pro-inflammatory cytokine production from the respiratory epithelium in cystic fibrosis, J Cyst Fibros, 10 (201 1 ) 428-434.

15. G .R. Bailie, C.A. Johnson, Comparative review of the pharmacokinetics of vitamin D analogues, Semin Dial, 15 (2002) 352-357.

16. F. Baeke, T. Takiishi, H. Korf, C. Gysemans, C. Mathieu, Vitamin D: modulator of the immune system, Curr Opin Pharmacol, 10 (2010) 482-496.

17. J.L. Osborn, G .G. Schwartz, D.C. Smith, R. Bahnson, R. Day, D.L. Trump, Phase I I trial of oral 1 ,25-dihydroxyvitamin D (calcitriol) in hormone refractory prostate cancer, Urol Oncol, 1 (1995) 195-198.

18. H .A. Bischoff-Ferrari, B. Dawson-Hughes, E. Stocklin, E. Sidelnikov, W.C. Willett, J.O. Edel, H.B. Stahelin, S. Wolfram, A. Jetter, J. Schwager, J. Henschkowski, A. von

Eckardstein, A. Egli, Oral supplementation with 25(OH)D3 versus vitamin D3: effects on 25(OH)D levels, lower extremity function, blood pressure, and markers of innate immunity, J Bone Miner Res, 27 (2012) 160-169.

19. Rigo, I . , L. McMahon, P. Dhawan, S. Christakos, S. Yim, L.K. Ryan, and G . Diamond, Induction of triggering receptor expressed on myeloid cells (TREM-1 ) in airway epithelial cells by 1 ,25(OH)2 vitamin D3. Innate Immun, 201 1 . 18: p. 250-257.

20. Yim, S. , P. Dhawan, C. Ragunath, S. Christakos, and G. Diamond, Induction Of Cathelicidin In Normal And Cf Bronchial Epithelial Cells By 1 ,25-Dihydroxyvitamin D3. J. Cystic Fibrosis, 2007. 6: p. 403-410.

21 . Dhawan, P. , R. Wei, C. Sun, A.F. Gombart, H.P. Koeffler, G. Diamond, and S.

Christakos, C/EBPalpha and the Vitamin D Receptor Cooperate in the Regulation of Cathelicidin in Lung Epithelial Cells. J Cell Physiol, 2014.

22. Van Goor, F. , K.S. Straley, D. Cao, J. Gonzalez, S. Hadida, A. Hazlewood, J.

Joubran, T. Knapp, L.R. Makings, M . Miller, T. Neuberger, E. Olson, V. Panchenko, J.

Rader, A. Singh, J.H. Stack, R. Tung, P.D. Grootenhuis, and P. Negulescu, Rescue of DeltaF508-CFTR trafficking and gating in human cystic fibrosis airway primary cultures by small molecules. Am J Physiol Lung Cell Mol Physiol, 2006. 290(6): p. L1 1 17-30.

23. Van Goor, F., S. Hadida, P.D. Grootenhuis, B. Burton, D. Cao, T. Neuberger, A. Turnbull, A. Singh, J. Joubran, A. Hazlewood, J. Zhou, J. McCartney, V. Arumugam, C. Decker, J. Yang, C. Young, E.R. Olson, J.J. Wine, R.A. Frizzell, M. Ashlock, and P.

Negulescu, Rescue of CF airway epithelial cell function in vitro by a CFTR potentiator, VX- 770. Proc Natl Acad Sci U S A, 2009. 106(44): p. 18825-30.

24. M.L. Fulcher, S.H. Randell, Human nasal and tracheo-bronchial respiratory epithelial cell culture, Methods Mol Biol, 945 (2013) 109-121 .

25. M.L. Fulcher, S.E. Gabriel, J.C. Olsen, J.R. Tatreau, M. Gentzsch, E. Livanos, M.T. Saavedra, P. Salmon, S.H. Randell, Novel human bronchial epithelial cell lines for cystic fibrosis research, Am J Physiol Lung Cell Mol Physiol, 296 (2009) L82-91 .

26. S. Hansdottir, M.M. Monick, S.L. Hinde, N. Lovan, D.C. Look, G.W. Hunninghake, Respiratory epithelial cells convert inactive vitamin D to its active form: potential effects on host defense, J Immunol, 181 (2008) 7090-7099.

27. Duan, Y., Y. Sun, F. Zhang, W.K. Zhang, D. Wang, Y. Wang, X. Cao, W. Hu, C. Xie, J. Cuppoletti, T.M. Magin, H. Wang, Z. Wu, N. Li, and P. Huang, Keratin K18 increases cystic fibrosis transmembrane conductance regulator (CFTR) surface expression by binding to its C-terminal hydrophobic patch. J Biol Chem, 2012. 287(48): p. 40547-59.

28. Wang, X., J. Venable, P. LaPointe, D.M. Hutt, A.V. Koulov, J. Coppinger, C. Gurkan, W. Kellner, J. Matteson, H. Plutner, J.R. Riordan, J.W. Kelly, J.R. Yates, 3rd, and W.E. Balch, Hsp90 cochaperone Aha1 downregulation rescues misfolding of CFTR in cystic fibrosis. Cell, 2006. 127(4): p. 803-15.

29. J.W. Pike, M.B. Meyer, Fundamentals of vitamin D hormone-regulated gene expression, J Steroid Biochem Mol Biol, 144 Pt A (2014) 5-1 1 .

30. R. Civitelli, Y.S. Kim, S.L. Gunsten, A. Fujimori, M. Huskey, L.V. Avioli, K.A. Hruska, Nongenomic activation of the calcium message system by vitamin D metabolites in osteoblast-like cells, Endocrinology, 127 (1990) 2253-2262.

31 . R.K. Wali, J. Kong, M.D. Sitrin, M. Bissonnette, Y.C. Li, Vitamin D receptor is not required for the rapid actions of 1 ,25-dihydroxyvitamin D3 to increase intracellular calcium and activate protein kinase C in mouse osteoblasts, J Cell Biochem, 88 (2003) 794-801.

32. M.R. Haussler, P.W. Jurutka, M. Mizwicki, A.W. Norman, Vitamin D receptor (VDR)- mediated actions of 1 a,25(OH) ₂ vitamin D ₃ : genomic and non-genomic mechanisms, Best Pract Res Clin Endocrinol Metab, 25 (201 1) 543-559.

33. R.F. Chun, M. Gacad, L. Nguyen, M. Hewison, J.S. Adams, Co-chaperone potentiation of vitamin D receptor-mediated transactivation: a role for Bcl2-associated athanogene-1 as an intracellular-binding protein for 1 ,25-dihydroxyvitamin D3, J Mol Endocrinol, 39 (2007) 81 - 89.

34. J.D. Oliver, F.J. van der Wal, N.J. Bulleid, S. High, Interaction of the thiol-dependent reductase ERp57 with nascent glycoproteins, Science, 275 (1997) 86-88.

35. C.E. Jessop, T.J. Tavender, R.H. Watkins, J.E. Chambers, N.J. Bulleid, Substrate specificity of the oxidoreductase ERp57 is determined primarily by its interaction with calnexin and calreticulin, J Biol Chem, 284 (2009) 2194-2202.

36. T. Okiyoneda, K. Harada, M. Takeya, K. Yamahira, I. Wada, T. Shuto, M.A. Suico, Y. Hashimoto, H. Kai, Delta F508 CFTR pool in the endoplasmic reticulum is increased by calnexin overexpression, Mol Biol Cell, 15 (2004) 563-574.

37. Benn, B.S., D. Ajibade, A. Porta, P. Dhawan, M. Hediger, J.B. Peng, Y. Jiang, G.T. Oh, E.B. Jeung, L. Lieben, R. Bouillon, G. Carmeliet, and S. Christakos, Active intestinal calcium transport in the absence of transient receptor potential vanilloid type 6 and calbindin- D9k. Endocrinology, 2008. 149(6): p. 3196-205.

38. A.M. Jones, J.M. Helm, Emerging treatments in cystic fibrosis, Drugs, 69 (2009) 1903- 1910.

39. C.E. Wainwright, J.S. Elborn, B.W. Ramsey, Lumacaftor-lvacaftor in Patients with Cystic Fibrosis Homozygous for Phe508del CFTR, N Engl J Med, 373 (2015) 1783-1784.

40. J. P. Clancy, S.M. Rowe, F.J. Accurso, M.L. Aitken, R.S. Amin, M.A. Ashlock, M.

Ballmann, M.P. Boyle, I. Bronsveld, P.W. Campbell, K. De Boeck, S.H. Donaldson, H.L. Dorkin, J.M. Dunitz, P.R. Durie, M. Jain, A. Leonard, K.S. McCoy, R.B. Moss, J.M. Pilewski, D.B. Rosenbluth, R.C. Rubenstein, M.S. Schechter, M. Botfield, C.L. Ordonez, G.T.

Spencer-Green, L. Vernillet, S. Wisseh, K. Yen, M.W. Konstan, Results of a phase lla study of VX-809, an investigational CFTR corrector compound, in subjects with cystic fibrosis homozygous for the F508del-CFTR mutation, Thorax, 67 (2012) 12-18.

41 . (corresponds to ref 51 from gran app)