Methods for creating novel antibacterial agents using chimeric antisense oligonucleotides

FIELD OF THE INVENTION: Development of novel antibacterial agents by the use of chimeric antisense oligonucleotides coupled with cell penetrating peptides that bind specific bacterial RNAs and inhibit their functions.

SUMMARY OF THE INVENTION

We have devolved novel methods to employ various antisense oligonucleotides attached to cell- penetrating peptides as antibacterial agents that target specific bacterial mRNAs and inhibit bacterial growth of many pathogenic bacterial species. The application of these methods can procedure many antibacterial agents that can speed up the development of novel antibacterial drugs. Such novel drugs can treat the current multiple-drug resistant bacterial strains.

DETAILED DESCRIPTION

Background

In recent years, infections caused by multidrug-resistant bacterial pathogenic strains have

185 become a huge issue to public healthcare systems, causing sepsis and loss of life of a huge

number of humans worldwide as detailed in the papers: Penchovsky, R. et al., Expert Opin Drug Discov. (2015) 10, 631-650; ⁶ Penchovsky, R. et al Expert Opin Drug Discov. (2013) 8, 65-82; ⁷ Penchovsky, R., Biomacromolecules, (2013) 14, 1240- 1249. ⁸

In fact, the misuse of antibiotics has led to the emergence of a huge number of resistant bacterial 190 strains over the past 30 years, including Staphylococcus aureus, Neisseria gonorrhoeae,

Escherichia coli, Mycobacterium tuberculosis and many others. Unfortunately, efforts to produce new antibiotics were not sufficient to cope with the emergence of these new antibiotic- resistant (AR) strains. It is commonly believed that bacteria can develop resistance against any antibiotic. Therefore, it is very important for the well-being of the humankind to invent novel 195 methods that can speedily and accurately engineer new antibiotics against AR bacterial

pathogens. For instance, in the past, researching from the former USSR have developed phage - based antibacterial therapies as an alternative to small molecule antibiotics.

In this patent application, we describe novel comprehensive methods for engineering new antibiotics based on various types of ASOs that are attached to cell penetrating peptides (CPPs).

200 In the patent application, we make four types of novel and original claims, which are all directly connected to the methods for creating novel antibacterial agents with chimeric antisense oligonucleotides (ASOs). The first type of claims from claim 1 to 18 concerns ASO sequences attached to the CPP named pVEC that have an antibacterial effect against the mentioned bacterial pathogens (Table 1). All ASO sequences are original. The second type of claims, from

205 19 to 24, include several mRNAs in various pathogenic bacteria that we have been targeted with ASOs by us for the first time (see the Example section). The mRNA sequences in claims 23 and 24 are claimed for the first time here as antibacterial drug targets at all. Note that parts at the 5'- end of mRNAs in claims from 19 to 22 are already claimed as antibacterial targets by small module and peptide drugs only (patent applications: EP2471925, ¹ US20080269258, ²

210 US20100041742, ³ US20100286082, ⁴ US20100324123 ⁵ ). In contrast to these claims, we claim the whole sequences of these mRNAs as antibacterial targets with ASOs only, excluding small molecules and peptides. Therefore, our claims in this group are also original. The third group of claims, from 25 to 35, are on the application of several CPPs (Table 2) as carriers of ASOs, which are covalently attached to them. We are the first to make specific claims of the application

215 of these CPPs as carriers of ASOs to living cells. Note that in the low concentration of CPP-ASO molecules that we used in our experiments, none of the CPPs has antibacterial properties by itself. The last sort of claims, from 36 to 37, include the application of two chemical procedures for coupling of CPPs to ASOs. We also are the first to make specific claims of the application these chemical procedures for coupling of CPPs to ASOs. All claims are consequential steps in

220 the process of making novel antibacterial agents based on ASOs. All claims have novel

applications for creating novel antibacterial agents using chimeric antisense oligonucleotides.

Materials and methods

Table 1: Antisense chimeric oligonucleotides-oligopeptide molecules: The peptides start with their N-ends. PNA stands for Peptide nucleic acid; PS-DNA stands for Phosphorothioate 225 DNA; and LNA stands for Locked Nucleic Acid. All nucleic acid oligonucleotides start with their 5'-ends. Where the down case "i" stands for "2'-0-CH3" of the DNA oligomers while the down case "2" stands PS -modification of DNA the DNA oligomers. The "aar" stands for amino acid residues while the "nt" stands for nucleotides.

SEQ ID pVEC:

Lys Ser His Ala His Ala Gin Lys Arg He Arg Arg Arg

No: 13 ADK 18 aar

Leu He He Leu Leu

mRNA PS-DNA: G l A l T l T2T2T2G2C2T2T2C2T2T2T2 A2C2C2T2A2 A iT 1 T 1

22 nt

SEQ ID Lys Ser His Ala His Ala Gin Lys Arg He Arg Arg Arg pVEC: No: 14 ADK

Leu He He Leu Leu 18 aar mRNA

GATTTTGCTTCTTTACCTAATT PNA:22nt

SEQ ID Lys Ser His Ala His Ala Gin Lys Arg He Arg Arg Arg pVEC:

ADK

No: 15 Leu He He Leu Leu 18aar mRNA

GATTTTGCTTCTTTACCTAATT LNA:22nt

SEQ ID Lys Ser His Ala His Ala Gin Lys Arg He Arg Arg Arg pVEC:

GMK

No: 16 Leu He He Leu Leu 18 aar, PS mRNA

C 1 A 1 Ai C2T2T2C2T2T2T2T2C2T2T2G2C2T2T2C2 Ai T 1 T 1 DNA:22nt

SEQ ID Lys Ser His Ala His Ala Gin Lys Arg He Arg Arg Arg pVEC:

GMK

No: 17 Leu He He Leu Leu 18 aar mRNA

CAACTTCTTTTCTTGCTTCATT PNA:22nt

SEQ ID Lys Ser His Ala His Ala Gin Lys Arg He Arg Arg Arg pVEC:

GMK

No: 18 Leu He He Leu Leu 18 aar mRNA

CAACTTCTTTTCTTGCTTCATT LNA:22nt Table 2: List of cell penetrating peptides (CPPs) as carriers of ASOs. The peptides start with their N-ends.

SEQ ID Val Lys Arg Lys Lys Lys Pro Ala Lys Leu S413-PVrev, No selective, 20

No: 25 Val Lys Lys Leu Leu Thr Lys Trp Leu Ala Viral aar

SEQ ID No selective, 9

Arg Arg Arg Gin Arg Arg Lys Lys Arg

No: 26 Tat, Viral aar

SEQ ID Lys Ser His Ala His Ala Gin Lys Arg He No selective, 18 No: 27 Arg Arg Arg Leu He He Leu Leu pVEC, Viral aar

Val Lys Arg Lys Lys Lys Pro Gin Ser Trp

SEQ ID

Lys Thr Trp Trp Thr Lys Trp Trp Thr Lys pep-l-k, Bacteria, 21 aar

No: 28

Lys Synthetic

SEQ ID Arg Val Arg Arg Arg Asn Arg Arg Thr Arg FHV coat, Eukaryotes, 15

No: 29 Asn Arg Arg Arg Arg Viral aar

Note that all CPPs presented in Table 2 were subjects to the current patent application only in regards to their properties to deliver ASOs that are attached to them in bacterial and/or in eukaryotic cells. The mechanisms of inhibition of mRNA translation with ASOs are depicted in 235 Figure 1. It can be used three types of ASOs such as PS-DNA, LNA, and PNA. PS-DNA works via RNase H that recognizes the PS-DNA/mRNA hybrid and cleaves the mRNA part of it (Figure 102). The PNA and LNA just block the mRNA translation by hybridizing to the region, which includes the initiation codon (Figure 103).

A spectrophotometer measures the density of the bacterial culture (OD 600nm 0.5 - 0.9). If the 240 cell density is greater than 0.9, a dilution (1: 1000) is made to reach the required density of the bacterial cells. After dilution, pre-sterilized cuvettes are used to measure the cell density. The cuvettes contain diluted bacterial cells, MgCl ₂ , and sterile water, which are used as a control, while other samples contain and ASO. The optical density is measured on every half hour for eight hours. The ASO is determined as a function of time and optical density of the bacterial 245 cells. The bacteria cells were inoculated in LB medium and incubated at optimal for them

temperature as Staphylococcus aureus ( S. aureus ) and Escherichia coli (E. coli) were incubated at 37 ^° C and Bacillus subtilis (B. subtilis) at 30 ^° C. After growth, an appropriate dilution is made and the growth of the bacterial cells is measured in the presence of different concentrations ASO.

EXAMPLES

250 Example 1: Inhibitory action of antisense oligonucleotide for FMN riboswitch

The inhibitory effect of SEQ ID No: 1 (ASO-1, Figure 2) designed to bind to the complementary sequence of the aptamer domain of the FMN riboswitch is demonstrated in cells of human conditional pathogenic bacteria S. aureus and E. coli and in non-pathogenic to human bacteria B. subtilis. In the samples containing the highest concentration (2000 nM) of SEQ ID No: 1 (ASO-

255 1, Figure 2) it is observed a maximum inhibition of the bacterial growth of B. subtilis, E. coli and mostly of S. aureus (Figure 301). The line with the rectangles shows the bacterial growth of B. subtilis in the presence of SEQ ID No: 1 (ASO-1, Figure 2) which reaches a maximum of around 0.3 optical units after an incubation time of four hours. The line with the circles shows the bacterial growth of E. coli in the presence of SEQ ID No: 1 (ASO-1, Figure 2) which reaches a

260 maximum of around 0.3 optical units after an incubation time of four hours. SEQ ID No: 1

(ASO-1, Figure 2) inhibits mostly the bacterial growth of S. aureus as shown by the line with the triangles in Figure 301. The bacterial growth reaches a maximum of around 0.2 optical units after an incubation time of three and a half hours. An ASO-2 is also used, but it does not bind specifically to RNAs in B. subtilis (the line with the rhombs, Figure 301) and E. coli (the line with the upside down triangles, Figure 301) and, therefore should not inhibit the growth of these bacteria. They reach a maximum of 1.3 optical units after an incubation time of four hours.

ASO-2 (Figure 2) serves as a negative control to demonstrate the specific action of SEQ ID No: 1 (ASO-1, Figure 2). The lack of inhibition of bacterial growth of B. subtilis and E. coli in the presence of ASO-2 (Figure 2) is an indicator that the DNA part from the chimeric oligomer does not hybridize nonspecifically to RNAs expressed in these bacteria. The bacterial growth of the three bacteria, S. aureus (the line with the triangles, Fig 301), E. coli (the line with the circles, Figure 301) and B. subtilis (the line with the rectangles, Figure 301) in the presence of SEQ ID No: 1 (ASO-1, Figure 2), reaches minimum of less than 0.1 optical units after incubation time of seven hours. While the bacterial growth of E. coli (the line with the upside down triangles, Figure 301) and B. subtilis (the line with the rhombs, Figure 301) in the presence of ASO-2 (Figure 2) reaches minimum of less than 0.3 optical units after incubation time of seven hours.

The next samples are with 1000 nM concentration of SEQ ID No: 1 (ASO-1, Figure 2). This concentration of SEQ ID No: 1 (ASO-1, Figure 2) inhibits the bacterial growth of B. subtilis, E. coli and S. aureus (Figure 302) at the same level as the higher concentration of SEQ ID No: 1 (ASO-1, Figure 2) shown in Figure 302. In the presence of SEQ ID No: 1 (ASO-1, Figure 2) the bacterial growth of B. subtilis (the line with the rectangles, Figure 302) and E. coli (the line with the circles, Figure 302) reaches a maximum of less than 0.4 optical units after an incubation time of four hours. While the bacterial growth of S. aureus reaches a maximum of less than 0.3 optical units after an incubation time of three and a half hours (the line with the triangles, Figure 302). The ASO-2 (Figure 2) does not inhibit the bacterial growth of E. coli (the line with the upside down triangles, Figure 302) and B. subtilis (the line with the rhombs, Figure 302) as they reach a maximum of 1.3 optical units after an incubation time of four hours. In the presence of SEQ ID No: 1 (ASO-1, Figure 2) the bacterial growth of the three bacteria, S. aureus (the line with the triangles, Figure 302), E. coli (the line with the circles, Figure 302) and B. subtilis (the line with the rectangles, Figure 302), reaches minimum of 0.1 optical units after incubation time of seven hours. While in the presence of ASO-2 (Figure 2) the bacterial growth of E. coli (the line with the upside down triangles, Figure 302) and B. subtilis (the line with the rhombs, Figure 302) reaches minimum of around 0.3 optical units after incubation time of seven hours.

At the next concentration of SEQ ID No: 1 (ASO-1, Figure 2) of 700 nM, an inhibition of the bacterial growth of B. subtilis, E. coli and S. aureus is also observed at the same level as in the previous two higher concentrations (Figure 303). The line with the rectangles shows the bacterial growth of B. subtilis in the presence of SEQ ID No: 1 (ASO-1, Figure 2) which reaches a maximum of around 0.4 optical units after an incubation time of four hours. While the line with the circles shows the bacterial growth of E. coli and reaches the same maximum as B. subtilis in the presence of SEQ ID No: 1 (ASO-1, Figure 2). The line with the triangles shows the bacterial growth of S. aureus in the presence of SEQ ID No: 1 (ASO-1, Figure 2) which reaches a maximum of less than 0.3 optical units after an incubation time of three and a half hours. In the presence of ASO-2 (Figure 2) the bacterial growth of E. coli (the line with the upside down triangles, Figure 303) and B. subtilis (the line with the rhombs, Figure 303) reaches a maximum of 1.3 optical units after an incubation time of four hours. In the presence of SEQ ID No: 1 (ASO-1, Figure 2) the bacterial growth of the three bacteria, S. aureus (the line with the triangles, Figure 303), E. coli (the line with the circles, Figure 303) and B. subtilis (the line with the rectangles, Figure 303), reaches minimum of 0.1 optical units after incubation time of seven hours. While in the presence of ASO-2 (Figure 2), the bacterial growth of E. coli (the line with 310 the upside down triangles, Figure 303) and B. subtilis (the line with the rhombs, Figure 303) reaches minimum of around 0.3 optical units after incubation time of seven hours.

At a concentration of SEQ ID No: 1 (ASO-1, Figure 2) of 350 nM, there is no inhibition of the bacterial growth of B. subtilis, E. coli. Only in S. aureus is observed a small portion of inhibition (Figure 304). In the presence of SEQ ID No: 1 (ASO-1, Figure 2), B. subtilis (the line with the

315 rectangles, Figure 304) and E. coli (the line with the circles, Figure 304) reach a maximum of 1.3 optical units after an incubation time of four and a half hours while S. aureus reaches a maximum of around 1.1 optical units after an incubation time of four hours. A minimum inhibitory concentration (MIC) is the lowest concentration in which an inhibition of the bacterial growth is observed. MIC80 is a standard used to calculate the minimum concentration of the

320 relevant antibiotic molecule for 80% inhibition of the bacterial growth. For the ASO that

hybridizes with the complementary sequence of the aptamer domain of the FMN riboswitch and controls gene expression of the ribD operon, MIC80 is 700 nM, 4.5 μ /ηι1. This concentration includes ASO and pVEC, which is a cell penetrating peptide (CPP). In this concentration it is observed a maximum inhibition of the bacterial growth and a maximum survival of the human

325 cell line of the non-small lung cancer A549. The effect is bacteriostatic. The FMN riboswitch is one of the most common riboswitches in bacteria. In Rfam database, the FMN riboswitch was detected in 3098 species of bacteria. Of them, 30 are pathogenic to human bacteria: Bacillus anthracis, Clostridium perfringens, Listeria monocytogenes, Staphylococcus aureus, Clostridium botulinum, Clostridium tetani, Clostridium difficile, Staphylococcus epidermidis, Staphylococcus

330 saprophyticus, Enter ococcus faecalis, Enterococcus faecium, Vibrio cholera, Echerichia coli, Shigella sonnei, Brucella abortus, Brucella melitensis, Brucella suis, Yersinia pestis, Brucella canis, Pseudomonas aeruginosa, Salmonella enterica, Haemophilus influenzae, Stretococcus pneumoniae, Stretococcus pyogenes, Bordetella pertussis, Streptococcus agalactiae, Francisella tularensis, Salmonella typhi, Acinetobacter baumannii and Klebsiella pneumoniae.

335 Example 2: Inhibitory action of antisense oligonucleotide for glmS riboswitch

The inhibitory effect of SEQ ID No: 2 (ASO-1, Figure 5) designed to bind to the complementary sequence of the aptamer domain of the glmS riboswitch is demonstrated in cells of human conditional pathogenic bacteria S. aureus and E. coli and in non-pathogenic to human bacteria B. subtilis. The sequence of SEQ ID No: 2 (ASO-1, Figure 5) is designed to be fully

340 complementary only with the sequence of S. aureus while the sequences of E. coli and B. subtilis have some mismatches and SEQ ID No: 2 (ASO-1, Figure 5) cannot bind specifically. ASO-2 (Figure 5) is used as a negative control and does not have any influence on the growth of the bacteria.

In the samples containing the highest concentration of SEQ ID No: 2 (ASO-1, Figure 5), 2000 345 nM, it is observed a maximum inhibition of the bacterial growth of S. aureus while in E. coli and B. subtilis there is no inhibition (Figure 601). The line with the triangles shows the bacterial growth of S. aureus in the presence of SEQ ID No: 2 (ASO-1, Figure 5), which reaches a maximum of around 0.3 optical units after an incubation time of three hours. The line with the circles shows the bacterial growth of E. coli while the line with the rectangles shows the bacterial 350 growth of B. subtilis. In the presence of SEQ ID No: 2 (ASO-1, Figure 5), they reach a

maximum of around 1.3 optical units after an incubation time of five hours (Figure 601). The lack of inhibition of bacterial growth of B. subtilis and E. coli in the presence of SEQ ID No: 2 (ASO-1, Figure 5) is an indicator that the pVEC from the chimeric oligomer does not inhibit the bacterial growth by itself. The bacterial growth of E. coli (the line with the circles, Figure 601) 355 and B. subtilis (the line with the rectangles, Figure 601) reaches a minimum of 0.3 optical units in the presence of SEQ ID No: 2 (ASO-1, Figure 5) after an incubation time of seven and a half hours. While the bacterial growth of S. aureus (the line with the triangles, Figure 601) reaches a minimum of 0.1 optical units after an incubation time of seven and a half hours.

The following samples are with 1000 nM concentration of SEQ ID No: 2 (ASO-1, Figure 5).

360 This concentration of SEQ ID No: 2 (ASO-1, Figure 5) inhibits the bacterial growth of S. aureus (Figure 602) at the same level as the higher concentration of SEQ ID No: 2 (ASO-1, Figure 5) shown on Figure 601. While this concentration of SEQ ID No: 2 (ASO-1, Figure 5) shown in Figure 602 has no effect on the bacterial growth of E. coli and B. subtilis same as the higher concentration of SEQ ID No: 2 (ASO-1, Figure 5) shown in Figure 601. In the presence of SEQ

365 ID No: 2 (ASO-1, Figure 5), the bacterial growth of S. aureus (the line with the triangles, Figure 602) reaches a maximum of 0.3 optical units after an incubation time of three and a half hours. While the bacterial growth of E. coli (the line with the circles, Figure 602) and B. subtilis (the line with the rectangles, Figure 602) reaches a maximum of 1.3 optical units after an incubation time of five hours. The bacterial growth of the two bacteria, E. coli (the line with the circles,

370 Figure 602) and B. subtilis (the line with the rectangles, Figure 602) reaches a minimum of 0.3 optical units in the presence of SEQ ID No: 2 (ASO-1, Figure 5) after an incubation time of seven hours and a half. While the bacterial growth of S. aureus (the line with the triangles, Figure 601) reaches a minimum of 0.1 optical units after an incubation time of seven hours and a half.

375 At the next concentration of SEQ ID No: 2 (ASO-1, Figure 5) of 700 nM, an inhibition of the bacterial growth of S. aureus is also observed as it reaches a maximum of around 0.4 optical units after an incubation time of four hours (the line with the triangles, Figure 603). While the bacterial growth of E. coli (the line with the circles, Figure 5C) and B. subtilis (the line with the rectangles, Figure 603) in the presence of SEQ ID No: 2 (ASO-1, Figure 5) reaches the same

380 maximum and minimum as in the previous two concentration shown in Figure 601 and Figure 602. The bacterial growth of S. aureus reaches a minimum of 0,loptical units after an incubation time of seven and a half hours (the line with the triangles, Figure 603).

At a concentration of SEQ ID No: 2 (ASO-1, Figure 5) of 350 nM, there is no inhibition of the bacterial growth of B. subtilis, E. coli, and S. aureus. In the presence of SEQ ID No: 2 (ASO-1,

385 Figure 5), the bacterial growth of S. aureus reaches a maximum of around 1.1 optical units after an incubation time of four and a half hours (the line with the triangles, Figure 604). The bacterial growth of E. coli (the line with the circles, Figure 604) and B. subtilis (the line with the rectangles, Figure 604) reach the same maximum as in the previous three concentration shown in Figures 601, 602 and 603. At the lowest concentration of SEQ ID No: 2 (ASO-1, Figure 5) of

390 150 nM, the inhibition of the bacterial growth of B. subtilis, E. coli and S. aureus is entirely absent. The last two concentrations of SEQ ID No: 2 (ASO-1, Figure 5) cannot inhibit the bacterial growth of the tested bacteria. The kinetics of growth of these bacteria was identical with the kinetics of the growth of the bacteria in the samples with no SEQ ID No: 2 (ASO-1, Figure 606). For the ASO that hybridizes with the complementary sequence of the aptamer

395 domain of the glmS riboswitch and controls gene expression of the gene that encodes the glmS enzyme, MIC 80% is 700 nM, 5 μ ηύ. This concentration includes ASO and pVEC CPP. The glmS riboswitch is found in 800 bacterial species, of which 11 are pathogenic to human: Bacillus anthracis, Clostridium perfringens, Listeria monocytogenes, Staphylococcus aureus, Clostridium botulinum, Clostridium tetani, Clostridium difficile, Staphylococcus epidermidis, Staphylococcus

400 saprophyticus, Enterococcus faecalis and Enterococcus faecium. Example 3: Inhibitory action of antisense oligonucleotide for SAM-I on the bacterial growth

The inhibitory effect of SEQ ID No: 3 (ASO-1, Figure 8) designed to bind to the complementary 405 sequence of the aptamer domain of the SAM-I riboswitch is demonstrated in cells of

unconditional human pathogen Listeria monocytogenes ( L. monocytogenes) and in the conditional human pathogen S. aureus (Figure 10). Cells of the conditional pathogen E. coli are also used as a control experiment in which there should be no inhibitory effect of the bacterial growth of E. coli as the SAM-I riboswitch is not present.

410 In the samples containing the highest concentration of SEQ ID No: 3 (ASO-1, Figure 8) (2000 nM) it is observed a maximum inhibition of the bacterial growth of S. aureus and L.

monocytogenes (Figure 901). The line with the triangles in Figure 901 shows the bacterial growth of L. monocytogenes in the absence of SEQ ID No: 3 (ASO-1, Figure 8), which reaches a maximum of about 1.3 optical units after an incubation time of three and a half hours. In

415 contrast, for the same bacteria in the presence of SEQ ID No: 3 (ASO-1, Figure 8) was observed a maximum of less than 0.3 optical units after an incubation time of four hours (the line with the upside down triangles, Figure 901). For S. aureus in the absence of SEQ ID No: 3 (ASO-1, Figure 8) is observed a maximum of approximately 1.3 optical units after an incubation time of four hours (the line with the rectangles, Figure 901). In contrast, for S. aureus in the presence of

420 SEQ ID No: 3 (ASO-1, Figure 8), is observed a maximum of 0.3 optical units after an incubation time of four hours (the line with the circles, Figure 901). In the two bacteria, S. aureus and L. monocytogenes, in the absence of SEQ ID No: 3 (ASO-1, Figure 8), is observed a minimum of bacterial growth of 0.6 optical units after an incubation time of five and a half hours (the lines with the rectangles and with the triangles Figure 901). While, in the presence of SEQ ID No: 3

425 (ASO-1, Figure 8), is observed a minimum of 0.1 optical units after an incubation time of five and a half hours (the lines with circles and with the upside down triangles, Figure 901).

The following samples contain SEQ ID No: 3 (ASO-1, Figure 8) in the concentration of 1000 nM. This concentration of SEQ ID No: 3 (ASO-1, Figure 8) inhibits the bacterial growth ofL. monocytogenes as well as in the higher concentration of SEQ ID No: 3 (ASO-1, Figure 8). While

430 in S. aureus a strong inhibition is observed (Figure 902). The line with the upside down triangles shows the bacterial growth of L. monocytogenes in the presence of SEQ ID No: 3 (ASO-1, Figure 8) which reaches a maximum of less than 0.4 optical units after incubation of four hours (Figure 902). The line with the circles shows the bacterial growth of S. aureus in the presence of SEQ ID No: 3 (ASO-1, Figure 8), which reaches a maximum of less than 0.3 optical units after

435 an incubation time of three and a half hours (Figure 902). The bacterial growth of the, S. aureus and L. monocytogenes in the absence of SEQ ID No: 3 (ASO-1, Figure 8) reaches maximum of about 1.3 optical units, such as L. monocytogenes reaches this maximum after incubation of three and a half hours (the line with the triangles, Figure 902), while S. aureus after four hours (thte line with rectangles, Figure 902). The two bacteria reach a minimum of bacterial growth as in

440 presence as in the absence of SEQ ID No: 3 (ASO-1, Figure 8), of 0.1 optical units after

incubation of seven hours.

The next used concentration SEQ ID No: 3 (ASO-1, Figure 8) is 700 nM. At this concentration, an inhibition of the bacterial growth of L. monocytogenes and S. aureus is also observed as in the previous two concentrations of SEQ ID No: 3 (ASO-1) (Figure 903). In the presence of SEQ ID 445 No: 3 (ASO-1, Figure 8), L. monocytogenes reaches a maximum of bacterial growth of around 0.5 optical units after an incubation time of four hours (the line with the upside down triangles, Figure 903). While S. aureus in the presence of SEQ ID No: 3 (ASO-1, Figure 8) reaches a maximum of bacterial growth by less than 0,4 optical units after an incubation time of three and a half hours (the line with the circles, Figure 903). The lines with the triangles and with the 450 rectangles show the maximum of the bacterial growth of L. monocytogenes as well as of S.

aureus in the absence of SEQ ID No: 3 (ASO-1, Figure 8) of 1.3 optical units after an incubation time of four hours (Figure 903). A minimum of 0,1 optical units was observed in L.

monocytogenes and S. aureus, after an incubation time of seven hours in the presence of SEQ ID No: 3 (ASO-1, Figure 8), shown in Figure 903 with the upside down triangles and with the 455 circles lines. In L. monocytogenes is observed a minimum of 0.2 optical units after an incubation time of seven hours in the absence of SEQ ID No: 3 (ASO-1, Figure 8), while in S. aureus is observed a minimum of 0.3 optical units (the line with the rectangles, Figure 903).

In the next concentration of 350 nM of SEQ ID No: 3 (ASO-1, Figure 8) almost no difference is observed in the bacterial growth of L. monocytogenes and S. aureus as in the presence as well in

460 the absence of SEQ ID No: 3 (ASO-1, Figure 904). In both bacteria in the presence of SEQ ID No: 3 (ASO-1, Figure 8) is observed a maximum of bacterial growth of approximately 1.2 optical units (the lines with the upside down triangles and with the circles, Figure 904) after incubation time of four hours and there is no difference with the bacterial growth observed in the absence of SEQ ID No: 3 (ASO-1, Figure 8) (the lines with the triangles and with the rectangles,

465 Figure 904). At the lowest concentration of 150 nM of SEQ ID No: 3 (ASO-1, Figure 8) there is no inhibition of the bacterial growth of L. monocytogenes and S. aureus (Figure 905). Both bacteria reach maximum of bacterial growth of 1.3 optical units in the absence (the lines with the triangles and with the rectangles, Figure 905) or in the presence of SEQ ID No: 3 (ASO-1, Figure 8) (the upside down triangles and with the circles lines, Figure 905) after an incubation

470 time of four hours.

The highest concentration of 2000 nM of SEQ ID No: 3 (ASO-1, Figure 8) is also used in bacterial cells of E. coli, but no inhibition of the bacterial growth is observed since SAM-I is not present and SEQ ID No: 3 (ASO-1, Figure 8) cannot bind specifically. The kinetics of bacterial growth of E. coli is identical with the samples with no SEQ ID No: 3 (ASO-1, the line with the

475 upside down triangles and with the triangles, Figure 906). For the ASO that hybridizes with the complementary sequence of the aptamer domain of the SAM-I riboswitch and controls gene expression of the S-box operon, MIC 80% is 4.5 μ§/ιη1. This concentration includes ASO and pVEC CPP. Riboswitch for SAM-I is found only in Gram-positive pathogenic bacteria. This riboswitch is present in the following 9 pathogenic bacteria: Bacillus anthracis, Clostridium

480 perfringens, Listeria monocytogenes, Staphylococcus aureus, Clostridium botulinum,

Clostridium tetani, Clostridium difficile, Staphylococcus saprophyticus and Streptococcus epidermidis.

Example 4: Inhibitory action of antisense oligonucleotide for TPP riboswitch

The inhibitory effect of SEQ ID No: 4 (ASO-1, Figure 11) designed to bind to the

485 complementary sequence of the aptamer domain of the TPP riboswitch is demonstrated in cells of human obligatory pathogenic bacteria L. monocytogenes and in non-pathogenic to human bacteria B. subtilis (Figure 13).

In the samples containing the highest concentration of SEQ ID No: 4 (ASO-1, 2000 nM, Figure 11), it is observed a maximum inhibition of the bacterial growth of L. monocytogenes and B. 490 subtilis (Figure 1201). The line with the circles shows the bacterial growth of L. monocytogenes in the presence of SEQ ID No: 4 (ASO-1, Figure 11), which reaches a maximum of less than 0.3 optical units after an incubation time of four hours. The upside down triangle line shows the bacterial growth of B. subtilis in the presence of SEQ ID No: 4 (ASO-1, Figure 11), which reaches a maximum of more than 0.3 optical units after an incubation time of five hours. In the 495 absence of SEQ ID No: 4 (ASO-1, Figure 11), the bacterial growth of L. monocytogenes reaches a maximum of 1.3 optical units after incubation time of five hours (the line with the rectangles, Figure 1201) while the bacterial growth of B. subtilis reaches a maximum of 1.4 optical units after incubation time of four hours (the line with the triangles, Figure 1201). The bacterial growth of L. monocytogenes (the line with the circles, Figure 1201) and B. subtilis (the line with

500 the upside down triangles, Figure 1401) reach a minimum of 0.1 optical units after an incubation time of seven hours in the presence of SEQ ID No: 4 (ASO-1, Figure 11). While in the absence of SEQ ID No: 4 (ASO-1, Figure 11), the bacterial growth of L. monocytogenes (the line with the rectangles, Figure 1201) and B. subtilis (the line with the triangles, Figure 1201) reach a minimum of 0.2 optical units after an incubation time of seven and a half hours.

505 The next samples are with 1000 nM concentration of SEQ ID No: 4 (ASO-1, Figure 11). This concentration of SEQ ID No: 4 (ASO-1, Figure 11) inhibits the bacterial growth of L.

monocytogenes and B. subtilis (Figure 1202) at the same level as the higher concentration of SEQ ID No: 4 (ASO-1, Figure 1201). In the presence of SEQ ID No: 4 (ASO-1, Figure 11), the bacterial growth of L. monocytogenes reaches a maximum of 0.3 optical units after an incubation

510 time of four hours (the line with the circles, Figure 1202). While the bacterial growth of B.

subtilis is in the presence of SEQ ID No: 4 (ASO-1, Figure 11) it reaches a maximum of around 0.4 optical units after an incubation time of three and a half hours (the line with the upside down triangles, Figure 1202). In the absence of SEQ ID No: 4 (ASO-1, Figure 11), the bacterial growth of L. monocytogenes reaches maximum of 1.3 optical units after incubation time of five

515 and a half hours (the line with the rectangles, Figure 1202) while B. subtilis reaches maximum of 1.3 optical units after incubation time of three and a half hours (the line with the triangles, Figure 1202). As in the previous higher concentration shown in Figure 1201, the bacterial growth of L. monocytogenes (the line with the circles, Figure 1202) and B. subtilis (the line with the upside down triangles, Figure 1202) in the presence of SEQ ID No: 4 (ASO-1, Figure 11),

520 reach minimum of 0.1 optical units after incubation time of seven hours. In the absence of SEQ ID No: 4 (ASO-1, Figure 11). They reach a minimum of 0.2 optical units for both L.

monocytogenes (the line with the rectangles, Figure 1202) and for B. subtilis (the line with the triangles, Figure 1202) after an incubation time of seven and a half hours.

At the next concentration of SEQ ID No: 4 (ASO-1, Figure 11) of 700 nM, an inhibition of the

525 bacterial growth of L. monocytogenes and B. subtilis (Figure 1203) is also observed as in the previous two higher concentration shown in Figure 1201 and 1202. The line with the circles shows the bacterial growth of L. monocytogenes, while the line with the upside down triangles shows the bacterial growth of B. subtilis, which reach a maximum of 0.4 optical units in the presence of SEQ ID No: 4 (ASO-1, Figure 11), after an incubation time of three hours. While in

530 the absence of SEQ ID No: 4 (ASO-1, Figure 11) the bacterial growth of L. monocytogenes (the line with the rectangles, Figure 1202) and B. subtilis (the line with the triangles, Figure 1202) reach a maximum of 1.3 optical units after an incubation time of four hours. The bacterial growth of L. monocytogenes in the presence of SEQ ID No: 4 (ASO-1, Figure 11) (the line with the circles, Figure 1203) and B. subtilis (the line with the upside down triangles, Figure 1202)

535 reach a minimum of 0.1 optical units after incubation time of seven hours. While in the absence of SEQ ID No: 4 (ASO-1, Figure 11) the bacterial growth of L. monocytogenes (the line with the rectangles, Figure 1202) and B. subtilis (the line with the triangles, Figure 1202) reach minimum of 0.2 optical units after incubation time of seven and a half hours. At a concentration of SEQ ID No: 4 (ASO-1, Figure 11) of 350 nM, there is no inhibition of the bacterial growth of

540 L. monocytogenes and B. subtilis (Figure 1204). In the presence of SEQ ID No: 4 (ASO-1,

Figure 11), the bacterial growth of L. monocytogenes (the line with the circles, Figure 1204) reaches a maximum of 1.2 optical units after an incubation time of three hours for L.

monocytogenes and four hours for B. subtilis (the line with the upside down triangles, Figure 1204).

545 At the lowest concentration of SEQ ID No: 4 (ASO-1, Figure 11) of 150 nM, the inhibition of the bacterial growth of L. monocytogenes and B. subtilis entirely absent (Figure 1205). The last two concentrations of SEQ ID No: 4 (ASO-1, Figure 11) cannot inhibit the bacterial growth of the tested bacteria. The kinetics of growth of these bacteria was identical with the kinetics of the growth of E. coli in the presence and absence of SEQ ID No: 4 (ASO-1, Figure 11 and Figure

550 1206). SEQ ID No: 4 (ASO-1, Figure 11) cannot inhibit the bacterial growth of E. coli because the TPP riboswitch is not present in E. coli and SEQ ID No: 4 (ASO-1, Figure 11) cannot bind specifically and inhibit the bacterial growth. For the ASO that hybridizes with the

complementary sequence of the aptamer domain of the TPP riboswitch and controls gene expression of the relevant operon, MIC80 is 750 nM, 5.2 μ§/ιη1. This concentration includes

555 ASO and pVEC CPP. TPP riboswitch is widely spread in human bacterial pathogens. It is

present in 40 pathogens of which is prevalent in the following 15 pathogenic bacteria:

Francisella tularensis, Helicobacter pylori, Klebsiella pneumoniae, Leptospira interrogans, Legionella pneumophila, Neisseria gonorrheae, Neisseria meningitides, Pseudiminas aeruginosa, Salmonella enterica, Enterobacter sp., Corynebacterium diphtheriae, Enterococcus

560 faecium, Mycobacterium leprae, Streptococcus agalactiae and Listeria monocytogenes.

REFERENCES

Patent citations:

1. EP2471925. Methods and compositions related to riboswitches that control alternative splicing. Inventors: Ronald Breaker, Narasimhan Sudarsan, Andreas

565 Wachter, Ming Tatt Cheah.

2. US20080269258. Riboswitches, structure-based compound design with riboswitches, and methods and compositions for use of and with riboswitches. Inventors: Ronald R. Breaker, Jinsoo Lim, Kenneth F. Blount, Isabela Puskarz, Robert Batey.

3. US20100041742. Riboswitches, methods for their use, and compositions for use with 570 riboswitches. Inventors: Ronald R. Breaker, Ali Nahvi, Narasimhan Sudarsan,

Margaret S. Ebert, Wade Winkler, Jeffrey E. Barrick, John K. Wickiser.

4. US20100286082. Riboswitches and methods and compositions for use of and with

riboswitches. Ronald R. Breaker, Zasha Weinberg, Narasimhan Sudarsan, Joy Xin Wang, Michelle M. Meyer, Adam Roth, Elizabeth E.Regulski.

575 5. US20100324123. GlmS riboswitches, structure -based compound design with glmS riboswitches, and methods and compositions for use of and with glmS riboswitches. Ronald R. Breaker, Jinsoo Lim, Scott A. Strobel, Jesse C. Cochrane.

Non-patent citations:

6. Penchovsky, R., and Traykovska, M., "Designing drugs that overcome antibacterial 580 resistance: where do we stand and what should we do?" Expert Opinion on Drug

Discovery (2015) 10, 631-650.

7. Penchovsky, R. and Stoilova C.C., Riboswitch-based antibacterial drug discovery

using high-throughput screening methods. Expert Opinion on Drug Discovery,

(2013) 8, 65-82

585 8. Penchovsky, R., Computational design and biosensor applications of small molecule- sensing allosteric ribozymes. Biomacromolecules (2013) 14, 1240-1249. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. A general scheme of antisense oligonucleotide based inhibition in bacteria.

Applications of ASOs that target specific mRNAs and inhibit bacterial growth. The figure

590 presents the inhibition of specific mRNAs targeted by three different types and chimeric

antisense oligonucleotides. All antisense oligonucleotides are coupled with cell penetrating peptides, which penetrate bacterial cells. After mRNA transcription (101), the inhibition of translation of specific protein expression can be achieved by mRNA decay via RNase H (102) or by prevention of mRNA translation (103). These approaches lead to growth inhibition of certain

595 pathogenic bacteria as described in this patent application (102 and 103).

Figure 2. Specific targeting of FMN aptamer domain in the ribD polycistronic mRNA by a chimeric antisense oligonucleotide (SEQ ID No: 1 (ASO-1)). (201) The chimeric antisense oligonucleotide binds to the complementary sequence of the FMN aptamer domain. (202) After binding of the chimeric antisense oligonucleotide with the FMN aptamer sequence, a double

600 stranded molecule is formed. (203) The double- stranded molecule is recognized by the RNase H, which binds it and triggers the enzymatic hydrolysis of mRNA. (204) The enzymatic hydrolysis of mRNA leads to no gene expression of the ribD operon.

Figure 3. Figure 3. Inhibition of bacterial growth by antisense oligonucleotide that targets FMN riboswitch mRNA. (301) SEQ ID No: 1 (ASO-1) in the concentration of 2000 nM, binds with

605 the mRNA for the FMN riboswitch and inhibits the bacterial growth of B. subtilis (the line with the rectangles), E. coli (the line with the circles) and S. aureus (the line with the triangles). In comparison with SEQ ID No: 1 (ASO-1), ASO-2 (Fig.2) does not inhibit the bacterial growth of B. subtilis (the rhombs) and E. coli (the upside down triangles). (302) SEQ ID No: 1 (ASO-1) in the concentration of 1000 nM, binds with the mRNA for the FMN riboswitch and inhibits the

610 bacterial growth of B. subtilis (the rectangles), E. coli (the circles) and S. aureus (the triangles).

In comparison with SEQ ID No: 1 (ASO-1), ASO-2 (Fig.2) does not inhibit the bacterial growth of B. subtilis (the rhombs) and E. coli (the upside down triangles). (303) SEQ ID No: 1 (ASO-1) in the concentration of 700 nM, binds with the mRNA for the FMN riboswitch and inhibits the bacterial growth of B. subtilis (the rectangles), E. coli (the circles) and S. aureus (the triangles).

615 In comparison with SEQ ID No: 1 (ASO-1), ASO-2 (Fig.2) does not inhibit the bacterial growth of B. subtilis (the rhombs) and E. coli (the upside down triangles). (304) SEQ ID No: 1 (ASO-1) in the concentration of 350 nM has no effect on inhibiting the bacterial growth in B. subtilis (the the rectangles), E. coli (the line with the circles) and S. aureus (the line with the triangles). (305) SEQ ID No: 1 (ASO-1) in the concentration of 150 nM has no effect on inhibiting the bacterial

620 growth in B. subtilis (the rectangles), E. coli (the circles) and S. aureus (the rectangles). (306) Bacterial growth of B. subtilis (the rectangles), E. coli (the circles) and S. aureus (the triangles) without ASO.

Figure 4. Alignment of the sequences in pathogenic bacteria containing the FMN riboswitch sequence. The pathogenic bacteria S. aureus, S. sapropyticus, S. epidermidis, L. monocytogenes, 625 B. anthracis, S. agalactiae, S. pneumonae, E. coli and the non-pathogenic bacteria B. subtilis contain the FMN riboswitch sequence.

Figure 5. Specific targeting of glmS aptamer domain in the glmS mRNA by a chimeric antisense oligonucleotide (SEQ ID No: 2 (ASO-1)). (501) The chimeric antisense oligonucleotide binds to the complementary sequence of the glmS ribozyme. (502) After binding of the chimeric

630 antisense oligonucleotide with the glmS sequence, a double stranded molecule is formed. (503) The double- stranded molecule is recognized by the RNase H, which binds it and triggers the enzymatic hydrolysis of mRNA. (504) The enzymatic hydrolysis of mRNA leads to no gene expression of the glmS. Figure 6. Inhibition of bacterial growth by antisense oligonucleotide that targets glmS

635 riboswitch mRNA. (601) SEQ ID No: 2 (ASO-1) in the concentration of 2000 nM inhibits the bacterial growth of S. aureus (the line with the triangles), but it does not inhibit the bacterial growth of B. subtilis (the rectangles) and E. coli (the circles). (602) SEQ ID No: 2 (ASO-1) in the concentration of 1000 nM inhibits the bacterial growth of S. aureus (the triangles), but it does not inhibit the bacterial growth of B. subtilis (the rectangles) and E. coli (the circles). (603) SEQ 640 ID No: 2 (ASO-1) in the concentration of 700 nM inhibits the bacterial growth of S. aureus (the triangles), but it does not inhibit the bacterial growth of B. subtilis (the rectangles) and E. coli (the circles). (604) SEQ ID No: 2 (ASO-1) in the concentration of 350 nM, does not inhibit the bacterial growth of S. aureus (the triangles) as same as for the bacterial growth of B. subtilis (the rectangles) and E. coli (the circles). (605) SEQ ID No: 2 (ASO-1) in the concentration of 150 645 nM, has no effect on inhibiting the bacterial growth of S. aureus (the triangles) as same as for the bacterial growth of B. subtilis (the rectangles) and E. coli (the circles). (606) Bacterial growth of S. aureus, B. subtilis and E. coli without SEQ ID No: 2 (ASO-1).

Figure 7. Alignment of the sequences in pathogenic bacteria containing the glmS riboswitch sequence. Only S. aureus has a full match with the glmS riboswitch sequence, while the

650 sequences of the other pathogenic bacteria have some mismatches.

Figure 8. Specific targeting of SAM-I aptamer domain in the S-box polycistronic mRNA by chimeric antisense oligonucleotide (SEQ ID No: 3 (ASO-1)). (801) The chimeric antisense oligonucleotide binds to the complementary sequence of the SAM-I aptamer domain. (802) After binding of the chimeric antisense oligonucleotide with the SAM-I aptamer sequence, a double

655 stranded molecule is formed. (803) The double- stranded molecule is recognized by the RNase H which binds it and triggers the enzymatic hydrolysis of RNA. (804) The enzymatic hydrolysis of RNA leads to no gene expression of the S-box operon.

Figure 9. Inhibition of bacterial growth by antisense oligonucleotide that targets SAM-I riboswitch mRNA. (901) SEQ ID No: 3 (ASO-1) in concentration of 2000 nM, binds with the

660 mRNA SAM-I riboswitch and inhibits the bacterial growth of S. aureus (the circles) and L. monocytogenes (the upside down triangles) in comparison to the bacterial growth without SEQ ID No: 3 (ASO-l)( the rectangles for S. aureus and the triangles for L. monocytogenes). (902) SEQ ID No: 3 (ASO-1) in concentration of 1000 nM, binds with the mRNA for the SAM-I riboswitch and inhibits the bacterial growth of S. aureus (the circles) and L. monocytogenes

665 (upside down rectangles) in comparison to the bacterial growth without the SEQ ID No: 3 (ASO- 1) (the rectangles for S. aureus and the triangles for L. monocytogenes). (903) SEQ ID No: 3 (ASO-1) in concentration of 700 nM, binds with the mRNA for the SAM-I riboswitch and inhibits the bacterial growth S. aureus (the circles) and L. monocytogenes (the upside down triangles) in comparison with the bacterial growth without SEQ ID No: 3 (ASO-l)( the

670 rectangles for S. aureus and the triangles for L. monocytogenes). (904) SEQ IDONo: 3 (ASO-1) in the concentration of 350 nM has no effect in inhibiting the bacterial growth of S. aureus and L. monocytogenes. (905) SEQ ID No: 3 (ASO-1) in the concentration of 150 nM, has no effect in inhibiting the bacterial growth of S. aureus and L. monocytogenes. (906) Bacterial growth of E. coli (upside down triangle) and S. aureus (line with circle) in the presence of SEQ ID No: 3

675 (ASO-1) in the concentration of 2000 nM. SEQ ID No: 3 (ASO-1) has no effect on the bacterial growth of E. coli because it does not contain the SAM-I riboswitch and cannot bind specifically. Figure 10. Alignment of the aptamer sequences of the experimentally tested bacteria containing the SAM-I riboswitch. The tested bacteria are Bacillus subtilis, Staphylococcus aureus, and Listeria monocytogenes.

680 Figure 11. Specific targeting of TPP aptamer domain in the polycistronic mRNA by chimeric antisense oligonucleotide (SEQ ID No: 4 (ASO-1)). (1101) The chimeric antisense oligonucleotide binds to the complementary sequence of the TPP aptamer domain. (1102) After binding of the chimeric antisense oligonucleotide with the TPP aptamer sequence, a double stranded molecule is formed. (1103) The double- stranded molecule is recognized by the RNase 685 H, which binds it and triggers the cleavage of RNA. (1104) The cleavage of RNA leads to no gene expression.

Figure 12. Inhibition of bacterial growth by antisense oligonucleotide that targets TPP riboswitch mRNA. (1201) SEQ ID No: 4 (ASO-1) in concentration of 2000 nM, binds with the mRNA for the TPP riboswitch and inhibits the bacterial growth of L. monocytogenes (the

690 circles) and B. subtilis (the upside down triangles), while the bacterial growth of L.

monocytogenes (the rectangles) and B. subtilis (the triangles) in absence of SEQ ID No: 4 (ASO- 1) is not inhibited. (1202) SEQ ID No: 4 (ASO-1) in concentration of 1000 nM, binds with the mRNA for the TPP riboswitch and inhibits the bacterial growth of L. monocytogenes (the circles) and B. subtilis (the upside down triangles), while the bacterial growth of L.

695 monocytogenes (the rectangles) and B. subtilis (triangles line) in absence of SEQ ID No: 4

(ASO-1) is not inhibited. (1203) SEQ ID No: 4 (ASO-1) in concentration of 700, binds with the mRNA for the TPP riboswitch and inhibits the bacterial growth of L. monocytogenes (the circles) and B. subtilis (the upside down triangles) while the bacterial growth of L.

monocytogenes (the rectangles) and B. subtilis (the triangles) in absence of SEQ ID No: 4 (ASO-

700 1) is not inhibited. (1204) SEQ ID No: 4 (ASO-1) in the concentration of 350 nM has no effect in inhibiting the bacterial growth of L. monocytogenes (the circles) and B. subtilis (the upside down triangles). (1205) SEQ ID No: 4 (ASO-1) in the concentration of 150 nM, has no effect in inhibiting the bacterial growth of L. monocytogenes (the circles) and B. subtilis (the upside down triangles). (1206) Bacterial growth of E. coli (the circles) in presence of SEQ ID No: 4

705 (ASO-1) in the concentration of 2000 nM, has no effect on the bacterial growth because it does not contain the TPP riboswitch and SEQ ID No: 4 (ASO-1) cannot bind specifically.

Figure 13. Alignment of the sequences of pathogenic bacteria containing the TPP riboswitch sequence. The pathogenic bacteria Listeria monocytogenes, Streptococcus pyogenes,

Streptococcus pneumonae, Streptococcus agalactiae, Mycobacterium tuberculosis,

710 Mycobacterium leprae, Brucella meltensis, Staphylococcus epidermidis, Corynebacterium

diphtheriae, Salmonella enterica contain the TPP riboswitch sequence.

Figure 14. Immobilization of thiol-modified ASO to CPP by using of a heterobifunctional cross-linking reagent called 3-(2-pyridyldithio)propionyl hydrazide (PDPH) and 1-Ethyl- 3- (3- dimethylaminopropyl) carbodiimide (EDC). Firstly, the hydrazide group of PDHP reacts with

715 the carboxyl group of the CPP forming a bond (1401 and 1402). Secondly, the thiol group at the 5 '-end of the DNA oligomer reacts with the pyridyldithio group introduced on the CPP (1403). Figure 15. Chemical procedure for coupling of SH-modified ASOs and free carboxyl group at the C-end of CPP using Ν-ε-maleimidocaproic acid hydrazide (EMCH). The EMCH reacts with sulfide-modified ASO to yield ASO-hydrazide (1501). In the next step, free carboxyl group at

720 the C-terminus of CPP is activated by 1-Ethyl- 3- (3-dimethylaminopropyl) carbodiimide (EDC) As a result, a peptide-acyllsourea reactive ester is formed(1502). In the presence of ASO- hydrazide, the peptide-acyllsourea reactive ester forms a peptide bond between the CPP and the ASO-hydrazide is formed (1503).