METHODS OF DIAGNOSING VIRAL INFECTIONS

AND VACCINES THERETO

RELATED APPLICATIONS

This application claims priority from U.S. Provisional Patent Application No. 63/012,943 filed April 21, 2020 and U.S. Provisional Patent Application No. 63/072,986 filed September 1, 2020, each of which is incorporated by reference in its entirety.

SEQUENCE LISTING STATEMENT

The ASCII file, entitled 86888 Sequence Listing.txt, created on 13 April 2021, comprising 40,960 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.

FIELD AND BACKGROUND OF THE INVENTION

The present invention, in some embodiments thereof, relates to methods of diagnosing a viral infections and vaccines thereto.

Diagnostic testing for viral infection is critical to tracking the virus, understanding epidemiology, informing case management, and to suppressing transmission.

Concentrating on the disease that stirred the world on 2019-2020, clinical diagnosis of COVID-19 is mainly based on epidemiological history, clinical manifestations and some auxiliary examinations, such as nucleic acid detection, CT scan, immune identification technology (Point-of-care Testing (POCT) of IgM/IgG, enzyme-linked immunosorbent assay (ELISA)) and blood culture. However, the clinical symptoms and signs of patients infected with SARS-CoV-2 are highly atypical, including respiratory symptoms, cough, fever, dyspnea, and viral pneumonia.

There is therefore a need to develop a tool for robust diagnosis of COVID-19, with epidemiological insights that can be used to advance vaccine development.

Additional background art includes:

US Patent Application No. 20190055545

SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided a method of diagnosing a SARS-Cov-2 infection in a subject in need thereof, the method comprising: (a) providing a phage display library comprising phages displaying on their surface peptides encoded by SARS-Cov-2, wherein the phage display library comprises the peptides at a level above a predetermined threshold;

(b) contacting the library with a biological sample of the subject, the biological sample comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides, wherein presence of immunecomplexes resultant of the immunocomplexation are indicative of a SARS-Cov-2 infection.

According to some embodiments of the invention, the method further comprising characterizing immunoglobulins of the immunocomplexes so as to identify past or current infection.

According to some embodiments of the invention, the phage display library comprises phages displaying on their surface peptides encoded by SARS-CoV-2, MERS-CoV, SARS-CoV, hCoV-OC43, hCoV-HKUl, hCoV-229E and/or hCoV-NL63. According to an aspect of some embodiments of the present invention there is provided a method of identifying an antigen that can be used to develop a vaccine against a virus of interest, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides encoded by a virus of interest, wherein the phage display library comprises the peptides at a level above a predetermined threshold;

(b) separately contacting the library with biological samples of a plurality of subjects representing symptomatic infected subjects and asymptomatic infected subjects or recovered subjects, the biological samples comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides;

(c) identifying antigenic peptides present or enriched in the immunocomplexes of the asymptomatic infected subjects or the recovered subjects compared to the symptomatic infected subjects, the antigenic peptides can be used to develop a vaccine against a virus of interest.

According to some embodiments of the invention, the asymptomatic infected subjects are selected based on at least one additional parameter selected from the group consisting of age, smoking, lifestyle, body mass index (BMI), marker expression.

According to an aspect of some embodiments of the present invention there is provided a method of identifying an antigen that can be used to identify an asymptomatic subject infected with a virus of interest, the method comprising: (a) providing a phage display library comprising phages displaying on their surface peptides encoded by a virus of interest, wherein the phage display library comprises the peptides at a level above a predetermined threshold;

(b) separately contacting the library with biological samples of a plurality of subjects representing a control group comprising at least one of symptomatic infected subjects, recovered subjects and uninfected subjects and a test group comprising asymptomatic infected subjects, the biological samples comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides; (c) identifying antigenic peptides in the immunocomplexes resultant of the immunocomplexation present or enriched in the test group compared to the control group, the antigenic peptides can be used to identify an asymptomatic subject infected with the virus of interest.

According to an aspect of some embodiments of the present invention there is provided a method of determining sensitivity of a subject to a SARS-CoV-2 infection, the method comprising: determining an antibody reactivity to a plurality of antigens of a plurality of human Coronaviruses, wherein an antibody reactivity above a predetermined threshold is indicative of low sensitivity to SARS-CoV-2 infection. According to some embodiments of the invention, the plurality of antigens are displayed as peptides on a phage display library, and wherein said phage display library comprises said peptides at a level above a predetermined threshold.

According to an aspect of some embodiments of the present invention there is provided a method of identifying an antigen that can be used to develop a vaccine against a virus of interest, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides encoded by a virus of interest, wherein the phage display library comprises the peptides at a level above a predetermined threshold;

(b) separately contacting the library with biological samples of a plurality of subjects infected with the virus the biological samples comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides; (c) identifying antigenic peptides in the immunocomplexes which are at a level above a predetermined threshold, the antigenic peptides can be used to develop a vaccine against the virus.

According to an aspect of some embodiments of the present invention there is provided a method of identifying an antigen that can be used as a universal vaccine against a virus, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides encoded by a plurality of viruses of a genus of interest, wherein the phage display library comprises the peptides at a level above a predetermined threshold; (b) separately contacting the library with biological samples of a plurality of subjects infected with a virus of the genus, the biological samples comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides;

(c) identifying antigenic peptides in the immunocomplexes which are shared between different subjects infected with different types of Coronaviruses, the antigenic peptides can be used to develop a vaccine against a virus of the genus.

According to some embodiments of the invention, the plurality of viruses comprise zoonotic viruses.

According to some embodiments of the invention, the plurality of viruses comprise non- zoonotic viruses.

According to some embodiments of the invention, the genus is Coronaviruses.

According to some embodiments of the invention, the plurality of Coronaviruses comprise SARS-CoV-2, MERS-CoV and SARS-CoV.

According to some embodiments of the invention, the subjects infected with the virus are selected from the group consisting of symptomatic infected, asymptomatic infected and recovered from infection with the Coronavirus.

According to some embodiments of the invention, the plurality of subjects comprises human and non-human subjects.

According to some embodiments of the invention, the virus is a zoonotic virus. According to some embodiments of the invention, the virus is pathogenic to human beings.

According to some embodiments of the invention, the virus is selected from the group consisting of Coronavirus, influenza virus, Ebola virus; Dengue fever; SARS-CoV; West Nile virus; Yellow fever virus; Zika virus; MERS-CoV; Marburg virus; Rabies; Smallpox; Hantavirus; Rotavirus; HIV and hepatitis B, C, D or E.

According to some embodiments of the invention, the virus is a respiratory disease causing virus. According to some embodiments of the invention, the virus is a Coronavirus.

According to some embodiments of the invention, the virus is selected from the group consisting of SARS-CoV-2, MERS-CoV and SARS-CoV.

According to some embodiments of the invention, the virus is selected from the group consisting of hCoV-OC43, hCoV-HKUl, hCoV-229E and hCoV-NL63 According to some embodiments of the invention, the peptides comprise at least 10 ³ peptides.

According to some embodiments of the invention, the peptides are of a Coronavirus protein or open reading frame such as but not limited to Orflab, Nsp 1/2/3/4/5/6/7/8/9/10/11/12/13/14/15 or Nspl6, Orf3a, Orf6, Orf7/8/9/10, (S)pike, (E)nvelope, (M)embrane, (N)ucleoplasmid or a combination of same.

According to some embodiments of the invention, the peptides are of a Spike (S) protein of a Coronavirus (e.g., SARS-CoV-02).

According to some embodiments of the invention, the identifying comprise isolating optionally by immunoprecipitation. According to some embodiments of the invention, the immunoprecipitation is effected with protein A/G/L.

According to some embodiments of the invention, the peptides are less than 500, 200, 100 amino acids long, optionally 50-80 amino acids long.

According to some embodiments of the invention, the identifying is effected by next generation sequencing.

According to some embodiments of the invention, the predetermined threshold is at least 0.1 %, 1 %, 5 %, 10 % or more.

According to some embodiments of the invention, the antigenic peptide or peptides identified according to the method is for use as a vaccine. According to some embodiments of the invention, the vaccine is against an infection with a Coronavirus.

According to some embodiments of the invention, the vaccine comprises a peptide which comprises an amino acid sequence according to below:

Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced. In the drawings:

FIGs. 1A-K: A phage displayed antigen library (a) of human Coronaviruses’ peptide antigens (b) applied to serum samples of unexposed individuals and recovered COVID-19 patients (c) detects a high serum prevalence of seasonal hCoVs, interindividual variability of antibody repertoires against SARS-CoV-2, and cross-reactive antibody responses from SARS- CoV-2 infection (d-k). The numbers of proteins per strain in panel b include polyproteins being split into 14 separate proteins d-k. All bound antigens of the hCoV library are shown in panel d, the following panels depict binding against peptides of each hCoV strain separately. The illustration of the SARS-CoV-2 virion is reproduced from CDC PHIL #23312 released as public domain (CDC/ Alissa Eckert, MSMI; Dan Higgins, MAMS), the phylogenetic tree is reproduced form Wu et al. (1) [open access]

FIGs. 2A-B: Cross-reactive and selective antibody binding of SARS-CoV-2 peptides and other hCoVs clusters in similar regions of the spike (a) and nucleocapsid (b) protein. Alignments of S- and N-proteins of all hCoVs, the dark line next to the strain identifier represents the protein sequence indicating gaps in the consensus alignment. Peptides bound in more than five unexposed (‘U’) individuals or recovered COVID-19 patients (‘C’) are shown as arrows above the corresponding protein sequence. The abundance of binding in ‘U’ and ‘C’ is indicated as percentages written next to the peptides. Grey arrows indicate similar recognition in unexposed individuals and COVID-19 patients, blue arrows indicate more than two-fold overrepresented binding in COVID-19 patients. Peptides marked with an asterisk appear at significantly different abundances (passing FDR correction) between unexposed individuals and recovered COVID-19 patients, by scoring the difference between the two distributions of the log fold changes (number of reads of bound peptides vs. baseline sequencing of phages not undergoing IPs) of the two groups (Table S2). The domain structure on top of each panel is based on SARS-CoV-2 S- (32)/N- (33) proteins, positions in other hCoVs shift along the alignment. Due to the different lengths of S- and N- proteins, the two panels are not drawn at the same scale.

FIGs. 3A-C: Principal component analysis (PC A) separates between hCoV antibody responses of unexposed individuals and recovered COVID-19 patients (a) and a machine learning predictor accurately identifies infected individuals (b,c). Gradient boosting decision trees (XGBoost classifier (34)) with leave-one-out cross-validation were used for these predictions on hCoV peptides bound in >4 (5%) individuals. Area under the curve (b) and precision-recall curve (c) of predicting COVID-19 status from antibody responses against hCoV peptides (abbreviations: PPV - positive predictive value). FIGs. 4A-B show control antigens included in the library demonstrate low background signal of unspecific binding against random peptides and reproducible antibody recognition of previously reported viral antigens (12) with similar abundances between unexposed individuals and recovered COVID-19 patients (b). DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

The present invention, in some embodiments thereof, relates to methods of diagnosing a viral infections and vaccines thereto.

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

Coronavirus disease (COVID-19) is an infectious disease caused by a new virus.

The disease causes respiratory illness (like the flu) with symptoms such as a cough, fever, and in more severe cases, difficulty breathing and death. SARS-CoV-2 the pathogen causing the disease is of the Coronavirus family, and is the third recorded outbreak after SARS and MERS. The repeated outbreaks in human population points to the need to develop new means for diagnosis, vaccination, disease treatment and population monitoring.

The present inventor has harnessed the robust capabilities of phage display technology towards characterization of viral infection at the individual level and at the population level. Using this tool, the present inventor probed for high resolution antibody binding against all human Coronaviruses (hCoVs) represented in this case as 1,539 peptides with a phage- displayed antigen library. Broad serum antibody responses against peptides of seasonal hCoVs in up to 75% of individuals were detected. Recovered COVID-19 patients exhibited distinct antibody repertoires targeting variable SARS-CoV-2 epitopes, and could be accurately classified from unexposed individuals (AUC=0.96). Up to 50% of recovered patients also mounted antibody responses against unique epitopes of seasonal hCoV-OC43, that were not detectable in unexposed individuals. These results indicate substantial interindividual variability and antibody cross-reactivity between hCoVs from the direction of SARS-CoV-2 infections towards seasonal hCoVs. The present high throughput assay allows profiling preexisting antibody responses against seasonal hCoVs cost-effectively and could inform on their protective nature against SARS-CoV-2.

Thus, according to an aspect of the invention there is a method of diagnosing a SARS- Cov-2 infection in a subject in need thereof, the method comprising: (a) providing a phage display library comprising phages displaying on their surface peptides encoded by SARS-Cov-2, wherein the phage display library comprises the peptides at a level above a predetermined threshold;

(b) contacting the library with a biological sample of the subject, the biological sample comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides, wherein presence or a predetermined pattern of immunecomplexes resultant of the immunocomplexation are indicative of a SARS-Cov-2 infection.

As used herein “predetermined pattern” refers to the profile of immunocomplexes (see Figures ld-k).

Embodiments of the present invention infer that in order to better diagnose COVID19 for instance, one should not be limited to the detection of a specific antigenic determinant of SARS- CoV-2 but rather analyze immunocomplexation to a plurality of distinct peptides of the virus and preferably even to peptides of other Coronaviruses.

It is the profile of antibody binding to the plurality of peptides analyzed in unexposed individuals (for instance samples of individuals taken before 2019 or even before 2018, when there are no reported infections by SARS-CoV-2) and infected (symptomatic or asymptomatic) that is referred to herein as “pattern” which is considered for diagnosis.

As used herein “Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the virus strain that causes coronavirus disease 2019 (COVID-19) in human subjects, a respiratory illness. SARS-CoV-2 is a positive-sense single-stranded RNA virus. It was previously referred to by its provisional name 2019 novel coronavirus (2019-nCoV) and the Wuhan Virus.

Taxonomically, SARS-CoV-2 is a strain of severe acute respiratory syndrome-related coronavirus (SARSr-CoV). It is believed to have zoonotic origins and has close genetic similarity to bat coronaviruses, suggesting it emerged from a bat-borne virus. An intermediate animal reservoir such as a pangolin is also thought to be involved in its introduction to humans.

As used herein the term “diagnosing” refers to determining presence or absence of a pathology (e.g., COVID-19), classifying a pathology or a symptom, determining a severity of the pathology, monitoring pathology progression, forecasting an outcome of a pathology and/or prospects of recovery and screening of a subject for a specific disease.

According to some embodiments of the invention, screening of the subject for a specific disease is followed by substantiation of the screen results using gold standard methods. Thus, corroboration of diagnosis can be done using Gold-standard methods. The standard method of testing is real-time reverse transcription polymerase chain reaction (rRT-PCR). The test is typically done on respiratory samples obtained by a nasopharyngeal swab, however a nasal swab or sputum sample may also be used. Results are generally available within a few hours to two days. Blood tests can be used. Antibody tests (which may detect active infections and whether a person had been infected in the past) can also be used.

Alternatively or additionally, chest CT scans may be helpful to diagnose COVID-19 in individuals with a high clinical suspicion of infection. Bilateral multilobar ground-glass opacities with a peripheral, asymmetric and posterior distribution are common in early infection. Subpleural dominance, crazy paving (lobular septal thickening with variable alveolar filling), and consolidation may appear as the disease progresses.

As used herein “biological sample” refers to a bodily sample of fluid or tissue which comprises immunoglobulins. For example, bodily samples, which can be used include, body fluids such as whole blood, serum, plasma, cerebrospinal fluid, urine, lymph fluids, and various external secretions of the respiratory, intestinal and genitourinary tracts, tears, saliva, milk as well as white blood cells.

According to a specific embodiment, the sample comprises blood or potions thereof such as serum or plasma.

According to a specific embodiment, the sample comprises a respiratory tract secretion e.g., nasal swab or sputum sample, such as that obtained by a nasopharyngeal swab.

The subject may be selected from the group consisting of symptomatic infected, asymptomatic infected and recovered from infection with the virus of interest e.g., Coronavirus e.g., SARS-CoV-2.

As used herein, the term "display library" refers to a library comprising a plurality of peptides derived from a single virus or a plurality of viruses that are displayed on the surface of a bacteriophage. It will be appreciated that the library used according to the present teachings can also be displayed on yeast, or bacteria or any other display vehicle. Methods for using such phage, yeast or bacterial display libraries are well known to those of skill in the art.

The display library can be produced to express peptides of a single virus, a plurality of viruses of different species, families or genera. This depends on the intended use. In any case, the presentation of the peptides of interest in the library is at a level above a predetermined threshold. In other words, the library is designed and dedicated for the search of viral peptides e.g., of a specific species, family or genus. Thus, the level of presentation can be above, 50 %, 60 %, 70 %, 80 %, 90 % or even the complete library is of viral peptides. According to a specific embodiment, the phage display library comprises phages displaying on their surface peptides encoded by SARS-CoV-2, MERS-CoV, SARS-CoV, hCoV- OC43, hCoV-HKUl, hCoV-229E and/or hCoV-NL63.

According to a specific embodiment, the phage display library comprises phages displaying on their surface peptides encoded by SARS-CoV-2, MERS-CoV and/or SARS-CoV.

According to a specific embodiment, the phage display library comprises phages displaying on their surface peptides encoded by common cold viruses e.g., hCoV-OC43, hCoV- HKU1, hCoV-229E and/or hCoV-NL63.

According to another embodiment, the predetermined threshold is at least 0.1 %, 1 %, 5 %, 10 %, which still represent a dedicated library.

In one embodiment, it is contemplated herein that the plurality of peptides will represent a substantially complete set of peptides from a single species of a virus. In other embodiments, the peptides represent a substantially complete set of peptides from a group of viruses such as belonging to a single family (e.g., human Coronaviruses, e.g., of common cold e.g., hCoV- OC43, hCoV-HKUl, hCoV-229E and/or hCoV-NL63 optionally with other Coronaviruses e.g., SARS-CoV-2, MERS-CoV and/or SARS-CoV) or a single genus. In one embodiment, the phage display library comprises a substantially complete set of peptides from viruses known to infect humans (or a subgroup thereof).

General methods for producing a phage display library are known to those of skill in the art and/or are described in e.g., Larman et al. (2011) Nature Biotechnology 29(6); 535-541, which is incorporated herein by reference in its entirety.

In some embodiments, the display library comprises 10,000-300,000 peptides, 50,000- 300,000 peptides, 100,000-300,000 peptides, 150,000-300,000 peptides, 200,000-300,000 peptides. According to a specific embodiment, the library comprises 500-2000 peptides. According to a specific embodiment, the library comprises 500-3000 peptides. According to a specific embodiment, the library comprises 500-4000 peptides. According to a specific embodiment, the library comprises 500-5000 peptides. According to a specific embodiment, the library comprises 1000-2000 peptides.

In some embodiments, the display library comprises 10-300,000 peptides, 10-1000 peptides, 10-100 peptides, 100-10,000 peptides, 100-1,000 peptides, 1000-10,000 peptides, 5,000-10,0000 peptides, 10-5,000 peptides, 100-5,000 peptides, 1,000-5,000 peptides. According to a specific embodiment, the library comprises 500-2000 peptides. According to a specific embodiment, the library comprises 500-3000 peptides. According to a specific embodiment, the library comprises 500-4000 peptides. According to a specific embodiment, the library comprises 500-5000 peptides. According to a specific embodiment, the library comprises 1000-2000 peptides.

In some embodiments, the phage display library comprises less than 500,000 peptide sequences. In other embodiments, the phage display library comprises more than 9000, more than 8000, more than 7000, more than 6000, more than 5000, more than 4000, more than 3000, more than 2000, more than 1000, more than 750, more than 500, more than 250, more than 100, more than 50 or more than 25 peptide sequences. In other embodiments, the phage display library comprises at least 100, at least 200, at least 500, at least 1000, at least 5000, at least 10,000 peptide sequences or more. It will be appreciated by one of ordinary skill in the art that as the length of the individual peptide sequences increase, the total number of peptide sequences in the library can decrease without loss of any pathogen sequences (and vice versa).

In some embodiments, the phage display library comprises less than 10,000 peptide sequences. In other embodiments, the phage display library comprises less than 9000, less than 8000, less than 7000, less than 6000, less than 5000, less than 4000, less than 3000, less than 2000, less than 1000, less than 750, less than 500, less than 250, less than 100, less than 50 or less than 25 peptide sequences. In other embodiments, the phage display library comprises at least 100, at least 200, at least 500, at least 1000, at least 5000, at least 10,000 peptide sequences or more but no more than 500,000 peptides. It will be appreciated by one of ordinary skill in the art that as the length of the individual peptide sequences increase, the total number of peptide sequences in the library can decrease without loss of any pathogen sequences (and vice versa).

In some embodiments, the phage display library comprises peptides derived from at least 1 protein sequences (e.g., viral protein sequences), from at least 10 protein sequences , at least 20 protein sequences, at least 30 protein sequences, at least 40 protein sequences, at least 50 protein sequences, at least 60 protein sequences, at least 70 protein sequences, at least 80 protein sequences, at least 90 protein sequences, at least 100 protein sequences, at least 200 protein sequences, at least 300 protein sequences, at least 400 protein sequences, at least 500 protein sequences.

As used herein “protein sequence” relates to a naturally occurring viral protein.

According to a specific embodiment, the phage display library comprises peptides derived from 1-10,000 protein sequences, 1-5,000 protein sequences, 1-2,000 protein sequences, 1-1,000 protein sequences, 1-500 protein sequences, 1-100 protein sequences, 1-50 protein sequences, 1-20 protein sequences, 1-10 protein sequences, 5-10 protein sequences, 5-15 protein sequences, 5-20 protein sequences. According to a specific embodiment, the peptides are derived from a SPIKE protein of a Coronavirus, e.g., SARS-CoV-2 (e.g., as shown in the protein design of the attached figures). Other viral proteins/coding sequences thereof can be used too.

In some embodiments, the phage display library comprises a plurality of proteins sequence that have less than 90% shared identity; in other embodiments the plurality of protein sequences have less than 85% shared identity, less than 80% shared identity, less than 75% shared identity, less than 70% shared identity, less than 65% shared identity, less than 60% shared identity, less than 55% shared identity, less than 50% shared identity or even less.

In some embodiments, the phage display library comprises a plurality of proteins sequence that have more than 90% shared identity; in other embodiments the plurality of protein sequences have more than 85% shared identity, more than 80% shared identity, more than 75% shared identity, more than 70% shared identity, more than 65% shared identity, more than 60% shared identity, more than 55% shared identity, more than 50% shared identity or even more.

Identity can be determined using Blast and default parameters (though other algorithms for protein/nucleic acid alignment are known in the art and can be used. Manual determination is also contemplated).

The composition of the library can be selected based on the intended use as will be further detailed below.

For instance, for the purpose of diagnosing COVID19, the library can consist of a SARS- CoV-2 derived peptides, or from a plurality of viruses which cause similar symptoms or from Coronaviruses, see above.

The virus can infect human but not necessarily confined to human.

According to a specific embodiment, the virus infects non-human subjects.

Exemplary pathogenic viruses may belong to the following families: Adenoviridae, Picornaviridae, Herpesviridae, Hepadnaviridae, Flaviviridae, Retroviridae, Orthomyxoviridae, Paramyxoviridae, Papovaviridae, Polyomavirus, Rhabdoviridae, Togaviridae. Particular pathogenic viruses contemplated by the present invention are those that cause smallpox, influenza, mumps, measles, chickenpox, ebola, or rubella.

According to a specific embodiment, the virus is an RNA virus.

According to a specific embodiment, the virus is a DNA virus.

According to a specific embodiment, the virus is a zoonotic virus.

According to a specific embodiment, the virus is pathogenic to human beings.

According to a specific embodiment, the virus is selected from the group consisting of Coronavirus, influenza virus, Ebola virus; Dengue fever; SARS-CoV; West Nile virus; Yellow fever virus; Zika virus; MERS-CoV; Marburg virus; Rabies; Smallpox; Hantavirus; Rotavirus; HIV and hepatitis B, C, D or E.

According to a specific embodiment, the virus is a respiratory disease causing virus.

According to a particular embodiment, the virus is one which brings about a respiratory infection (e.g. an upper respiratory tract infection and/or a lower respiratory tract infection).

Thus, according to a particular embodiment, the pathogenic virus is an influenza virus (e.g. influenza virus A - (e.g. H1N1, H2N2, H3N2, H5N1, H7N7, H1N2, H9N2, H7N2, H7N3, H10N7 and H7N9), influenza virus B or influenza virus C).

In another embodiment, the pathogenic virus is a parainfluenza virus (hPIV) including the human parainfluenza virus type 1 (hPIV-1) (causes croup); the human parainfluenza virus type 2 (hPIV-2) (causes croup and other upper and lower respiratory tract illnesses), the human parainfluenza virus type 3 (hPIV-3) (associated with bronchiolitis and pneumonia) and the human parainfluenza virus type 4 (hPIV-4).

In yet another embodiment, the pathogenic virus is a respiratory syncytial virus (RSV).

As used herein “Coronavirus” refers to enveloped positive-stranded RNA viruses that belong to the family Coronaviridae and the order Nidovirales.

Examples of Corona viruses which are contemplated herein include, but are not limited to, 229E, NL63, OC43, and HKU1 with the first two classified as antigenic group 1 and the latter two belonging to group 2, typically leading to an upper respiratory tract infection manifested by common cold symptoms.

However, Coronaviruses, which are zoonotic in origin, can evolve into a strain that can infect human beings leading to fatal illness. Thus particular examples of Coronaviruses contemplated herein are SARS-CoV, MERS-CoV, and the recently identified SAR-CoV-2 [causing 2019-nCoV (also referred to as “COVID-19”)].

The expansion of genetic diversity among Coronaviruses and their consequent ability to cause disease in human beings is mainly achieved through infecting peridomestic animals, which serve as intermediate hosts, nurturing recombination and mutation events.

Accordingly embodiments of the invention refer to a non-human subject.

According to another embodiment, the subject is a human subject.

According to a specific embodiment, the subject does not exhibit clinical symptoms of infection (non-infected or carrier).

It would be appreciated that any Coronavirus strain is contemplated herein even though SAR-CoV-2 is emphasized in a detailed manner. In some embodiments, the display library comprises protein sequences from at least 3 unique pathogens or at least 5 unique; in other embodiments the library comprises protein sequences from at least 10, at least 20, at least 50, at least 75, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000 unique pathogens up to and including protein sequences from all viruses known to cause disease in a human or other mammal.

In order to distinguish viral and non-viral infection the library can include peptides of pathogens other than viruses.

In other embodiments, the library consists of viral sequences.

In some embodiments, the peptides of the phage display library are at least 10 amino acids long; in other embodiments the protein sequences are at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450 amino acids or more in length.

In some embodiments, the peptides of the phage display library are 10-500 amino acids long; in other embodiments the protein sequences are 10-400 amino acids long, in other embodiments the protein sequences are 10-400 amino acids long , in other embodiments the protein sequences are 10-350 amino acids long, in other embodiments the protein sequences are 10-300 amino acids long, in other embodiments the protein sequences are 10-250 amino acids long, in other embodiments the protein sequences are 10-250 amino acids long, in other embodiments the protein sequences are 10-200 amino acids long, in other embodiments the protein sequences are 10-100 amino acids long, in other embodiments the protein sequences are 10-50 amino acids long, in other embodiments the protein sequences are 40-100 amino acids long, in other embodiments the protein sequences are 50-80 amino acids long. According to a specific embodiment, the protein sequences are 50-60 amino acids long. In some embodiments, each peptide of the library will overlap at least one other peptide by at least 5 amino acids. In other embodiments, each peptide of the phage library will overlap at least one other peptide by at least 10, at least 15, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 32, at least 35, at least 40 amino acids or more.

In some embodiments, each peptide of the library will overlap at least one other peptide by at least 5 amino acids. In other embodiments, each peptide of the phage library will overlap at least one other peptide by no more than 10, 15, 20, 25 30 amino acids.

In certain embodiments, the display library can comprise peptides from at least 1 family (e.g., Coronavirus) or sub-family (e.g., human Coronavirus) of related viruses e.g., SARS-CoV- 2. In other embodiments, the display library can comprise peptides from at least 2 families, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 peptides from at least 1 family or sub-family of viruses in any desired combination.

As mentioned, in embodiments related to the diagnosis of the SARS-CoV-2, the method of diagnosis involves contacting the library with a biological sample of the subject, the biological sample comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides, wherein presence of immunecomplexes resultant of the immunocomplexation are indicative of a SARS-Cov-2 infection.

Thus, the biological sample is contacted with the library. Thus the reaction mixture may comprise additional buffers, salts, osmotic agents, etc. to facilitate the formation of complexes between the peptides in the phage display library when the reaction sample is contacted with a biological sample comprising the immunoglobulins.

In some embodiments, a biological sample is treated to remove cells or other biological particulates. Methods for removing cells from a blood or other biological sample are well known in the art and can include e.g., centrifugation, ultrafiltration, immune selection, or sedimentation etc. Immunoglobulins can be detected from a biological sample or a sample that has been treated as described above or as known to those of skill in the art.

When needed a control sample is used in the assay. For example the control can be of validated uninfected individual(s) (e.g., demographically matched individual). Alternatively or additionally, the subject is defined as an unexposed individual (as explained above).

The samples can be annotated for various demographic and/or physiological parameters, For example, of age, smoking, lifestyle, body mass index (BMI), marker expression, gender, pathology, predisposition to a pathology, exposure to an infectious disease (e.g., HIV), kinship, death from the same disease, treatment with the same drug, exposure to chemotherapy, exposure to radiotherapy, exposure to hormone therapy, exposure to surgery, exposure to the same environmental condition (e.g., such as carcinogens, pollutants, asbestos, TCE, perchlorate, benzene, chloroform, nicotine and the like), the same genetic alteration or group of alterations, expression of the same gene or sets of genes (e.g., samples can be from individuals sharing a common haplotype, such as a particular set of HLA alleles), and the like. As used herein “marker expression” refers to an RNA or protein marker that is known to be associated with a certain physiological feature. CRP and inflammation, PSA and pancreatic cancer etc.

Such information can be used to glean insight about the diagnosed disease or to provide further instructions to the diagnosed subject.

In some embodiments, the methods and assays described herein comprise a step of contacting modified bacteriophage or the phage display library as described herein with a biological sample that comprises, or is suspected of comprising, the immunoglobulin. Any antiviral immunoglobulins (i.e., antibodies) present in the biological sample will bind to bacteriophage(s) that display the cognate antigen.

In certain embodiments, it is desirable to separate the immunocomplexes in the biological sample from any free bacteriophage(s) that are not bound to an antibody in the sample. In one embodiment, immunoglobulins from the reaction sample are immobilized on a solid support to permit one to separate out the unbound phage. Antibody immobilization can be achieved using methods routine to those of ordinary skill in the art. Essentially any method that permits one to specifically immobilize IgM, IgA, or IgG subclasses (e.g., IgG4) can be used to immobilize immunoglobulins from the sample, including immunoglobulins that are complexed to one or more bacteriophage. In some embodiments, Protein A, Protein G, Protein L or a combination thereof is/are used to immobilize the antibody to permit removal of unbound phage. Such methods are known to those of ordinary skill in the art and as such are not described in detail herein.

In some embodiments, the peptide or protein used to immobilize immunoglobulins from the reaction mixture can be attached to a solid support, such as, for example, magnetic beads (e.g., micron-sized magnetic beads), Sepharose beads, agarose beads, a nitrocellulose membrane, a nylon membrane, a column chromatography matrix, a high performance liquid chromatography (HPLC) matrix or a fast performance liquid chromatography (FPLC) matrix for purification. For example, the reaction mixture comprising bacteriophage and immunoglobulins can be contacted with magnetic beads coated with Protein A, Protein G and/or Protein LG. The Protein will bind to immunoglobulins in the mixture and immobilize them on the beads. This process also immobilizes any phage particles bound by the immunoglobulins. In one embodiment, a magnet can be used to separate the immobilized phage from unbound phage.

As used herein, the term "Magnetic bead" means any solid support that is attracted by a magnetic field; such solid supports include, without limitation, DYNABEADS™, BIOMAG™. Streptavidin, MPG7 Streptavidin, Streptavidin MAGNE SPHERE™., Streptavidin Magnetic Particles, AFFINITIP™, any of the MAGA™ line of magnetizable particles, BIOMAG™. Superparamagnetic Particles, or any other magnetic bead to which a molecule (e.g., an oligonucleotide primer) may be attached or immobilized.

Following a step to remove any unbound phage, the peptides in the bound phage/antibody complexes can be identified using e.g., PCR. Although not necessary, the immunocomplexes comprising the phage and bound immunoglobulin can first be released from the solid support using appropriate conditions e.g., temperature, pH, etc. In some embodiments, the sample is subjected to conditions that will permit lysis of the phage (e.g., heat denaturation). In one embodiment, the nucleic acids from the lysed phage is subjected to an amplification reaction, such as a PCR reaction. In one embodiment, the nucleic acids encoding a phage- displayed peptide comprise a common adapter sequence for PCR amplification.

As used herein the term "adapter sequence" refers to a nucleic acid sequence appended to a nucleic acid sequence encoding a phage-displayed peptide. In one embodiment, the identical adaptor sequence is appended to the end of each phage-displayed peptide in the phage display library; that is, the adaptor sequence is a common sequence on each nucleic acid of the plurality of nucleic acids encoding a peptide in the phage display library. In one embodiment, the adaptor sequence is of sufficient length to permit annealing of a common PCR primer. For example, adaptor sequences useful with the methods described herein are preferably heterologous or artificial nucleotide sequences of at least 15, and preferably 20 to 30 nucleotides in length. An adaptor sequence as described herein can be, but is not necessarily random.

In such embodiments, a PCR primer is designed to bind to the common adapter sequence for amplification of the DNA corresponding to a phage-displayed peptide.

In some embodiments, a detectable label is used in the amplification reaction to permit detection of different amplification products. As used herein, "label" or "detectable label" refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) signal, and which can be operatively linked to a polynucleotide, such as a PCR primer. Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, mass spectrometry, binding affinity, hybridization radiofrequency, nanocrystals and the like. A primer of the present invention may be labeled so that the amplification reaction product may be "detected" by "detecting" the detectable label. "Qualitative or quantitative" detection refers to visual or automated assessments based upon the magnitude (strength) or number of signals generated by the label. A labeled polynucleotide (e.g., an oligonucleotide primer) according to the methods of the invention can be labeled at the 5' end, the 3' end, or both ends, or internally. The label can be "direct", e.g., a dye, or "indirect", e.g., biotin, digoxin, alkaline phosphatase (AP), horse radish peroxidase (HRP). For detection of "indirect labels" it is necessary to add additional components such as labeled immunoglobulins, or enzyme substrates to visualize the captured, released, labeled polynucleotide fragment. In a preferred embodiment, an oligonucleotide primer is labeled with a fluorescent label. Suitable fluorescent labels include fluorochromes such as rhodamine and derivatives (such as Texas Red), fluorescein and derivatives (such as 5-bromomethyl fluorescein), Lucifer Yellow, IAEDANS, 7-Me.sub.2N-coumarin-4-acetate, 7-OH-4-CH.sub.3- coumarin-3 -acetate, 7-NH.sub.2-4-CH.sub.3-coumarin-3-acetate (AMCA), monobromobimane, pyrene tri sulfonates, such as Cascade Blue, and monobromorimethyl-ammoniobimane (see for example, DeLuca, Immunofluorescence Analysis, in Antibody As a Tool, Marchalonis, et al., eds., John Wiley & Sons, Ltd., (1982), which is incorporated herein by reference).

The methods described herein can benefit from the use of labels including, e.g., fluorescent labels. In one aspect, the fluorescent label can be a label or dye that intercalates into or otherwise associates with amplified (usually double-stranded) nucleic acid molecules to give a signal. One stain useful in such embodiments is SYBR Green (e.g., SYBR Green I or II, commercially available from Molecular Probes Inc., Eugene, Oreg). Others known to those of skill in the art can also be employed in the methods described herein. An advantage of this approach is reduced cost relative to the use of, for example, labeled nucleotides.

As used herein, the term "amplified product" refers to polynucleotides which are copies of a portion of a particular polynucleotide sequence and/or its complementary sequence, which correspond in nucleotide sequence to the template polynucleotide sequence and its complementary sequence. An "amplified product," can be DNA or RNA, and it may be double- stranded or single-stranded.

In an exemplary embodiment, the phage are lysed by heat denaturation and PCR is used to amplify the DNA region corresponding to the displayed peptide sequence. One of the PCR primers contains a common adaptor sequence which can be amplified in a second PCR reaction by another set of primers to prepare the DNA for ILLUMINA™ high throughput sequence. Unique barcoded oligonucleotides in the second PCR reaction are used to amplify different samples and pool them together in one sequencing run to e.g., reduce cost and/or permit simultaneous detection of multiple phage-displayed peptides.

According to some embodiments of the invention, the immunoglobulins of the immunocomplexes are also characterized so as to identify the state of infection i.e., past or current infection based on antibody serotyping. The first time someone is exposed to a foreign substance, like a virus, it may take the immune system up to two weeks to make an antibody blueprint and to produce enough of a specific antibody to fight the infection. This initial response consists primarily of IgM antibodies. Several weeks later, usually after the immediate threat has passed and the infection has resolved, the body creates IgG antibodies. It remembers the blueprint for fighting this microorganism and maintains a small supply of antibodies (a mixture of both IgM and IgG). The next time the body is exposed to the same foreign substance, it will respond much more strongly and quickly, to provide primarily IgG antibody protection. Hence IgM, IgG levels or ratio thereof may imply as to the state of the infection. It will be appreciated that antibodies contemplated by the present teachings relate to IgG,

IgA, IgM or any subtype.

The present teachings also provide a method of identifying an antigen that can be used to identify an asymptomatic subject infected with a virus of interest, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides encoded by a virus of interest, wherein the phage display library comprises the peptides at a level above a predetermined threshold;

(b) separately contacting the library with biological samples of a plurality of subjects representing a control group comprising at least one of symptomatic infected subjects, recovered subjects and uninfected subjects and a test group comprising asymptomatic infected subjects, the biological samples comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides;

(c) identifying antigenic peptides in the immunocomplexes resultant of the immunocomplexation present or enriched in the test group compared to the control group, the antigenic peptides can be used to identify an asymptomatic subject infected with the virus of interest

Such peptides can be beneficially used to identify asymptomatic subjects even at very early stages of the infection. Therefore, such peptides can be used in diagnostic kits for identification of asymptomatic subjects. Such subjects are endowed with superior prognosis and their plasma/serum can be used as potential therapy against the virus. Peptide of immunopeptide complexes (phage+immunoglobulin) can be used in drug/vaccine development.

As used herein “symptomatic infected” refers to a subject or group of subjects which are found positive for the virus using a viral assay such as by RT-PCT, serology or other marker based test and exhibit at least one symptom associated with the viral infection. As used herein “recovered” refers to a subject or group of subjects which were found positive for the virus using a viral assay such as by RT-PCT, serology or other marker based test and exhibited at least one symptom associated with the viral infection, however recovered to exhibit a repeated negative results in the viral assay.

As used herein “uninfected” refers to a subject or a group of subjects which are negative for the virus using a viral assay such as by RT-PCT, serology or other marker based test and exhibit no symptom for the disease.

As used herein “asymptomatic infected” refers to a subject or group of subjects which are found positive for the virus using a viral assay such as by RT-PCT, serology or other marker based test but does not exhibit a symptom associated with the viral infection throughout the time of infection.

The term “separately contacting” refers to separate samples of each subject tested or pooling of samples such as belonging to the different categories but minimally, those who are tested vs. control e.g., in this case asymptomatic infected (test) and symptomatic infected subjects, recovered subjects and uninfected subjects (control).

There is a large variability in severity of viral infections and especially COVID-19. 80 % only mildly effected, 10-20 % requiring hospitalization and about 5 % global death-to-case ration with unknown number of asymptomatic carriers.

Thus, there is provided a method of determining sensitivity of a subject to a SARS-CoV- 2 infection, the method comprising: determining an antibody reactivity to a plurality of antigens of a plurality of human Coronaviruses, wherein an antibody reactivity above a predetermined threshold is indicative of low sensitivity to SARS-CoV-2 infection.

It is envisaged that past infection with human Coronavirus (not SARS-CoV-2_ would impart protection against severe symptoms of COVID19.

As used herein “sensitivity” refers to sensitivity to infection and/or level of symptoms in infected subjects.

According to a specific embodiment, the plurality of antigens are displayed as peptides on a phage display library, and wherein said phage display library comprises said peptides at a level above a predetermined threshold.

In some embodiments, the present assays aim to correlate molecular and life-style factors that may protect some individuals (i.e., interchangeably used with “subjects”) so as to ultimately reach an asymptomatic infection. Thus, according to some embodiments, asymptomatic infected subjects are selected based on at least one additional parameter selected from the group consisting of age, smoking, lifestyle, body mass index (BMI), marker expression, underlying medical conditions (e.g., asthma, chronic lung disease, diabetes, serious heart conditions, chronic kidney disease, severe obesity, nursing home or long term care facility, immunocompromised and/or liver disease), microbiome, metabolomics, diet and the like.

For instance, age groups e.g., below 60, above 60; below 65, above 65; below 70, above 70; below 75, above 75; below 50, above 50; below 55, above 55; below 45, above 45. According to a specific embodiment, the test group age is 40-70. According to a specific embodiment, the test group age is 40-67. According to a specific embodiment, the test group age is 40-65. According to a specific embodiment, the test group age is 40-60.

According to a specific embodiment, the molecular profiling of the individuals (subjects) is deep molecular profiling involving deep sequencing techniques as well known in the art (e.g., see further below e.g., next generation sequencing).

Subject characterization for any of the embodiments described herein can be done by lab tests (e.g., molecular markers), and lifestyle profiling e.g., questionnaires.

As used herein “population” refers to at least 10 individuals, 100 individuals, 200 individuals, 300 individuals, 500 individuals, 1000 individuals, 2000 individuals, 5000 individuals, 10,000 individuals, 50,000 individuals, 100,000 individuals, 500,000 individuals, 1,000,000 individuals or more.

The characterization can be done once or repeatedly.

Such Cohort studies (e.g., of at least thousands of individuals) can yield both molecular and lifestyle factors governing protection and susceptibility to the virus (e.g., Coronavirus) and can be used as basis for protective medications and treatments e.g., pre/probiotics, supplements and the like.

Analysis at the levels of the immunoglobulins and optionally factors such as described hereinabove, can be done during the outbreak and alternatively or additionally as a follow up following the outbreak, thereby revealing protective factors.

Population-wide studies can also be done by comparing samples of individuals before an outbreak, during and/or after.

The present teachings can also be used in vaccine development such as for a Coronavirus of interest and SARS-CoV-2 in particular.

Thus, according to an aspect there is provided a method of identifying an antigen that can be used to develop a vaccine against a virus of interest, the method comprising: (a) providing a phage display library comprising phages displaying on their surface peptides encoded by a virus of interest, wherein the phage display library comprises the peptides at a level above a predetermined threshold;

(b) separately contacting the library with biological samples of a plurality of subjects representing symptomatic infected subjects and asymptomatic infected subjects or recovered subjects, the biological samples comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides;

(c) identifying antigenic peptides present or enriched in the immunocomplexes of the asymptomatic infected subjects or the recovered subjects compared to the symptomatic infected subjects, the antigenic peptides can be used to develop a vaccine against a virus of interest.

As used herein “enriched” refers to at least 5 %, 10 %, 20 %, 50 %,k 70 %, 90 %„ 2 fold, 3 fold, 5 fold, 10 fold or more compared to their level of presentation in the library prior to screening. This method is based on the concept that a differential immune response is present in those subjects that have been infected but have not suffered from the disease (no clinical symptoms) or have recovered from it. The targets of such an immune response can be used to develop a vaccine.

The viral target can be any viral target, such as those described hereinabove. As mentioned, the subjects are further annotated/classified according to a parameter such as described above, e.g., age, smoking, lifestyle, body mass index (BMI), marker expression.

Such a classification can be used to identify robust vaccines i.e., such that are effective on a large portion of the population, or population-specific, e.g., above 60 years old that can benefit from such a vaccine in particular. According to an aspect, there is provided a method of identifying an antigen that can be used to develop a vaccine against a virus of interest, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides encoded by a virus of interest, wherein the phage display library comprises the peptides at a level above a predetermined threshold; (b) separately contacting the library with biological samples of a plurality of subjects infected with the virus the biological samples comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides; (c) identifying antigenic peptides in the immunocomplexes which are at a level above a predetermined threshold, the antigenic peptides can be used to develop a vaccine against the virus.

According to an aspect, there is provided a method of identifying an antigen that can be used as a universal vaccine against a virus, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides encoded by a plurality of viruses of a genus of interest, wherein the phage display library comprises the peptides at a level above a predetermined threshold;

(b) separately contacting the library with biological samples of a plurality of subjects infected with a virus of the genus (e.g., human only, animal only or combined), the biological samples comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides;

(c) identifying antigenic peptides in the immunocomplexes which are shared between different subjects infected with different types of Coronaviruses, the antigenic peptides can be used to develop a vaccine against a virus of the genus.

As used herein the phrase “universal vaccine” refers to a vaccine, which is effective for combating/protecting against more than a single strain or species of a pathogen. For instance, a vaccine against any Coronavirus is a universal vaccine.

The universal vaccine can also be cross-species e.g., human and animal viruses e.g., human Coronavirus and Avian Coronavirus.

According to a specific embodiment, the antigenic peptide or peptides (identified according to the methods described herein) can used as a vaccine.

According to a specific embodiment the vaccine is against an infection with a Coronavirus.

According to a specific embodiment, the vaccine is limited to regions which were found differentially immunogenic in exposed and unexposed individuals of Figures 2a-b (at least 90 % level of identity).

According to a specific embodiment, the vaccine is limited to regions which were found differentially over immunogenic in exposed versus unexposed individuals of Figures 2a-b (at least 90 % level of identity).

According to a specific embodiment the vaccine comprises a peptide which comprises an amino acid sequence according to below:

The building of the display library, preparation of the samples and/or identification of the peptides presented by the display system can be done in small scale or large scale depending on the nature of the study and those of skills in the art will know which systems to select. High-Throughput Systems

In certain embodiments, the detection of a phage-displayed peptide comprises high throughput detection of a plurality of peptides simultaneously, or near simultaneously. In some embodiments, the high-throughput systems use methods similar to DNA sequencing techniques.

A number of DNA sequencing techniques are known in the art, including fluorescence- based sequencing methodologies (See, e.g., Birren et ah, Genome Analysis: Analyzing DNA, 1, Cold Spring Harbor, N.Y.). In some embodiments, automated sequencing techniques understood in the art are utilized. In some embodiments, the high-throughput systems described herein use methods that provide parallel sequencing of partitioned amplicons (e.g., W02006084132). In some embodiments, DNA sequencing is achieved by parallel oligonucleotide extension (See, e.g., U.S. Pat. No. 5,750,341, and U.S. Pat. No. 6,306,597). Additional examples of sequencing techniques include the Church polony technology (Mitra et al., 2003, Analytical Biochemistry 320, 55-65; Shendure et al., 2005 Science 309, 1728-1732; U.S. Pat. No. 6,432,360, U.S. Pat. No. 6,485,944, U.S. Pat. No. 6,511,803), the 454 picotiter pyrosequencing technology (Margulies et al., 2005 Nature 437, 376-380; US 20050130173), the Solexa single base addition technology (Bennett et al., 2005, Pharmacogenomics, 6, 373-382; U.S. Pat. No. 6,787,308; U.S. Pat. No. 6,833,246), the Lynx massively parallel signature sequencing technology (Brenner et al. (2000). Nat. Biotechnol. 18:630-634; U.S. Pat. No. 5,695,934; U.S. Pat. No. 5,714,330), and the Adessi PCR colony technology (Adessi et al. (2000). Nucleic Acid Res. 28, E87; WO 00018957).

Next-generation sequencing (NGS) methods share the common feature of massively parallel, high-throughput strategies, with the goal of lower costs in comparison to older sequencing methods (see, e.g., Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7:287-296). NGS methods can be broadly divided into those that typically use template amplification and those that do not. Amplification-requiring methods include pyrosequencing commercialized by Roche as the 454 technology platforms (e.g., GS 20 and GS FLX), the Solexa platform commercialized by ILLUMINA™, and the Supported Oligonucleotide Ligation and Detection™ (SOLiD) platform commercialized by APPLIED BIOSYSTEMS™. Non-amplification approaches, also known as single-molecule sequencing, are exemplified by the HELISCOPE™ platform commercialized by HELICOS BIO SYSTEMS™, and emerging platforms commercialized by VISIGEN™, OXFORD NANOPORE TECHNOLOGIES LTD., and PACIFIC BIOSCIENCES™, respectively.

In pyrosequencing (Voelkerding et al, Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbial., 7:287-296; U.S. Pat. No. 6,210,891; U.S. Pat. No. 6,258,568), template DNA is fragmented, end-repaired, ligated to adaptors, and clonally amplified in-situ by capturing single template molecules with beads bearing oligonucleotides complementary to the adaptors. Each bead bearing a single template type is compartmentalized into a water-in-oil microvesicle, and the template is clonally amplified using a technique referred to as emulsion PCR. The emulsion is disrupted after amplification and beads are deposited into individual wells of a picotitre plate functioning as a flow cell during the sequencing reactions. Ordered, iterative introduction of each of the four dNTP reagents occurs in the flow cell in the presence of sequencing enzymes and luminescent reporter such as luciferase. In the event that an appropriate dNTP is added to the 3' end of the sequencing primer, the resulting production of ATP causes a burst of luminescence within the well, which is recorded using a CCD camera. It is possible to achieve read lengths greater than or equal to 400 bases, and 10 ⁶ sequence reads can be achieved, resulting in up to 500 million base pairs (Mb) of sequence.

In the SOLEXA/ILLUMINA platform (Voelkerding et al., Clinical Chem., 55. 641-658, 2009; MacLean et al., Nature Rev. Microbial., 7:287-296; U.S. Pat. No. 6,833,246; U.S. Pat. No. 7,115,400; U.S. Pat. No. 6,969,488), sequencing data are produced in the form of shorter-1 ength reads. In this method, single-stranded fragmented DNA is end-repaired to generate 5'- phosphorylated blunt ends, followed by Klenow-mediated addition of a single A base to the 3' end of the fragments. A-addition facilitates addition of T-overhang adaptor oligonucleotides, which are subsequently used to capture the template-adaptor molecules on the surface of a flow cell that is studded with oligonucleotide anchors. The anchor is used as a PCR primer, but because of the length of the template and its proximity to other nearby anchor oligonucleotides, extension by PCR results in the "arching over" of the molecule to hybridize with an adjacent anchor oligonucleotide to form a bridge structure on the surface of the flow cell. These loops of DNA are denatured and cleaved. Forward strands are then sequenced with reversible dye terminators. The sequence of incorporated nucleotides is determined by detection of post incorporation fluorescence, with each fluor and block removed prior to the next cycle of dNTP addition. Sequence read length ranges from 36 nucleotides to over 50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.

Sequencing nucleic acid molecules using SOLID™ technology (Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbial., 7:287-296; U.S. Pat. No. 5,912,148; U.S. Pat. No. 6,130,073) also involves fragmentation of the template, ligation to oligonucleotide adaptors, attachment to beads, and clonal amplification by emulsion PCR. Following this, beads bearing template are immobilized on a derivatized surface of a glass flow cell, and a primer complementary to the adaptor oligonucleotide is annealed. However, rather than utilizing this primer for 3' extension, it is instead used to provide a 5' phosphate group for ligation to interrogation probes containing two probe-specific bases followed by 6 degenerate bases and one of four fluorescent labels. In the SOLID™ system, interrogation probes have 16 possible combinations of the two bases at the 3' end of each probe, and one of four fluors at the 5' end. Fluor color, and thus identity of each probe, corresponds to specified color-space coding schemes. Multiple rounds (usually 7) of probe annealing, ligation, and fluor detection are followed by denaturation, and then a second round of sequencing using a primer that is offset by one base relative to the initial primer. In this manner, the template sequence can be computationally re-constructed, and template bases are interrogated twice, resulting in increased accuracy. Sequence read length averages 35 nucleotides, and overall output exceeds 4 billion bases per sequencing run.

In certain embodiments, nanopore sequencing is employed (see, e.g., Astier et al., J. Am. Chem. Soc. 2006 Feb. 8; 128(5)1705-10). The theory behind nanopore sequencing has to do with what occurs when a nanopore is immersed in a conducting fluid and a potential (voltage) is applied across it. Under these conditions a slight electric current due to conduction of ions through the nanopore can be observed, and the amount of current is exceedingly sensitive to the size of the nanopore. As each base of a nucleic acid passes through the nanopore, this causes a change in the magnitude of the current through the nanopore that is distinct for each of the four bases, thereby allowing the sequence of the DNA molecule to be determined.

In certain embodiments, HELISCOPE™ by HELICOS BIOSCIENCES™ is employed (Voelkerding et al., Clinical Chem., 55. 641-658, 2009; MacLean et al., Nature Rev. Microbial, 7:287-296; U.S. Pat. No. 7,169,560; U.S. Pat. No. 7,282,337; U.S. Pat. No. 7,482,120; U.S. Pat. No. 7,501,245; U.S. Pat. No. 6,818,395; U.S. Pat. No. 6,911,345; U.S. Pat. No. 7,501,245). Template DNA is fragmented and polyadenylated at the 3' end, with the final adenosine bearing a fluorescent label. Denatured polyadenylated template fragments are ligated to poly(dT) oligonucleotides on the surface of a flow cell. Initial physical locations of captured template molecules are recorded by a CCD camera, and then label is cleaved and washed away. Sequencing is achieved by addition of polymerase and serial addition of fluorescently-labeled dNTP reagents. Incorporation events result in fluor signal corresponding to the dNTP, and signal is captured by a CCD camera before each round of dNTP addition. Sequence read length ranges from 25-50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.

The Ion Torrent technology is a method of DNA sequencing based on the detection of hydrogen ions that are released during the polymerization of DNA (see, e.g., Science 327(5970); 1190 (2010); U.S. Pat. Appl. Pub. Nos. 20090026082, 20090127589, 20100301398, 20100197507, 20100188073, and 20100137143). A microwell contains a template DNA strand to be sequenced. Beneath the layer of microwells is a hypersensitive ISFET ion sensor. All layers are contained within a CMOS semiconductor chip, similar to that used in the electronics industry. When a dNTP is incorporated into the growing complementary strand a hydrogen ion is released, which triggers a hypersensitive ion sensor. If homopolymer repeats are present in the template sequence, multiple dNTP molecules will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal. This technology differs from other sequencing technologies in that no modified nucleotides or optics are used. The per base accuracy of the Ion Torrent sequencer is .about.99.6% for 50 base reads, with .about.100 Mb generated per run. The read-length is 100 base pairs. The accuracy for homopolymer repeats of 5 repeats in length is about 98%.

Another exemplary nucleic acid sequencing approach that can be adapted for use with the methods described herein was developed by STRATOS GENOMICS, Inc, and involves the use of XPANDOMERS™. This sequencing process typically includes providing a daughter strand produced by a template-directed synthesis. The daughter strand generally includes a plurality of subunits coupled in a sequence corresponding to a contiguous nucleotide sequence of all or a portion of a target nucleic acid in which the individual subunits comprise a tether, at least one probe or nucleobase residue, and at least one selectively cleavable bond. The selectively cleavable bond(s) is/are cleaved to yield an XPANDOMER™ of a length longer than the plurality of the subunits of the daughter strand. The XPANDOMER™ typically includes the tethers and reporter elements for parsing genetic information in a sequence corresponding to the contiguous nucleotide sequence of all or a portion of the target nucleic acid. Reporter elements of the XPANDOMER™ are then detected. Additional details relating to XPANDOMER™- based approaches are described in, for example, U.S. Pat. Pub No. 20090035777, entitled "HIGH THROUGHPUT NUCLEIC ACID SEQUENCING BY EXPANSION," filed Jun. 19, 2008, which is incorporated herein in its entirety.

Other emerging single molecule sequencing methods include real-time sequencing by synthesis using a VISIGEN™ platform (Voelkerding et al., Clinical Chem., 55: 641-58, 2009; U.S. Pat. No. 7,329,492; U.S. patent application Ser. No. 11/671,956; U.S. patent application Ser. No. 11/781,166) in which immobilized, primed DNA template is subjected to strand extension using a fluorescently-modified polymerase and florescent acceptor molecules, resulting in detectable fluorescence resonance energy transfer (FRET) upon nucleotide addition. Another real-time single molecule sequencing system developed by PACIFIC

BIOSCIENCES™ (Voelkerding et al., Clinical Chem., 55. 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7:287-296; U.S. Pat. No. 7,170,050; U.S. Pat. No. 7,302,146; U.S. Pat. No. 7,313,308; U.S. Pat. No. 7,476,503) utilizes reaction wells 50-100 nm in diameter and encompassing a reaction volume of approximately 20 zeptoliters (10 ²¹ L). Sequencing reactions are performed using immobilized template, modified phi29 DNA polymerase, and high local concentrations of fluorescently labeled dNTPs. High local concentrations and continuous reaction conditions allow incorporation events to be captured in real time by fluor signal detection using laser excitation, an optical waveguide, and a CCD camera. In certain embodiments, the single molecule real time (SMRT) DNA sequencing methods using zero-mode waveguides (ZMWs) developed by Pacific Biosciences, or similar methods, are employed. With this technology, DNA sequencing is performed on SMRT chips, each containing thousands of zero-mode waveguides (ZMWs). A ZMW is a hole, tens of nanometers in diameter, fabricated in a 100 nm metal film deposited on a silicon dioxide substrate. Each ZMW becomes a nanophotonic visualization chamber providing a detection volume of just 20 zeptoliters (10 ²¹ L). At this volume, the activity of a single molecule can be detected amongst a background of thousands of labeled nucleotides. The ZMW provides a window for watching DNA polymerase as it performs sequencing by synthesis. Within each chamber, a single DNA polymerase molecule is attached to the bottom surface such that it permanently resides within the detection volume. Phospholinked nucleotides, each type labeled with a different colored fluorophore, are then introduced into the reaction solution at high concentrations which promote enzyme speed, accuracy, and processivity. Due to the small size of the ZMW, even at these high, biologically relevant concentrations, the detection volume is occupied by nucleotides only a small fraction of the time. In addition, visits to the detection volume are fast, lasting only a few microseconds, due to the very small distance that diffusion has to carry the nucleotides. The result is a very low background.

Processes and systems for such real time sequencing that can be adapted for use with the methods described herein include, for example, U.S. Pat. No. 7,405,281, U.S. Pat. No. 7,315,019, U.S. Pat. No. 7,313,308, U.S. Pat. No. 7,302,146, U.S. Pat. No. 7,170,050, U.S. Pat. Pub. Nos. 20080212960, 20080206764, 20080199932, 20080176769, 20080176316,

20080176241, 20080165346, 20080160531, 20080157005, 20080153100, 20080153095,

20080152281, 20080152280, 20080145278, 20080128627, 20080108082, 20080095488,

20080080059, 20080050747, 20080032301, 20080030628, 20080009007, 20070238679,

20070231804, 20070206187, 20070196846, 20070188750, 20070161017, 20070141598,

20070134128, 20070128133, 20070077564, 20070072196, 20070036511, and Korlach et al. (2008) PNAS 105(4); 1176-81, all of which are herein incorporated by reference in their entireties.

Subsequently, in some embodiments, the data produced comprises sequence data from multiple barcoded DNAs. Using the known association between the barcode and the source of the DNA, the data can be deconvoluted to assign sequences to the source subjects, samples, organisms, etc. The sequences are mapped, in some embodiments, to a reference DNA sequence (e.g., a viral DNA or the peptide to the viral protein). Some embodiments provide a processor, data storage, data transfer, and software comprising instructions to assign genotypes. Some embodiments of the technology provided herein further comprise functionalities for collecting, storing, and/or analyzing data. For example, some embodiments comprise the use of a processor, a memory, and/or a database for, e.g., storing and executing instructions, analyzing data, performing calculations using the data, transforming the data, and storing the data. In some embodiments, the processor is configured to calculate a function of data derived from the sequences determined. In some embodiments, the processor performs instructions in software configured for medical or clinical results reporting and in some embodiments the processor performs instructions in software to support non-clinical results reporting.

In some embodiments, the detection of a phage-displayed peptide comprises PCR with barcoded oligonucleotides. As used herein, the term "barcode" refers to a unique oligonucleotide sequence that allows a corresponding nucleic acid base and/or nucleic acid sequence to be identified. In certain aspects, the nucleic acid base and/or nucleic acid sequence is located at a specific position on a larger polynucleotide sequence (e.g., a polynucleotide covalently attached to a bead). In certain embodiments, barcodes can each have a length within a range of from 4 to 36 nucleotides, or from 6 to 30 nucleotides, or from 8 to 20 nucleotides. In certain aspects, the melting temperatures of barcodes within a set are within 10 °C, of one another, within 5 °C of one another, or within 2 °C, of one another. In other aspects, barcodes are members of a minimally cross-hybridizing set. That is, the nucleotide sequence of each member of such a set is sufficiently different from that of every other member of the set that no member can form a stable duplex with the complement of any other member under stringent hybridization conditions. In one aspect, the nucleotide sequence of each member of a minimally cross- hybridizing set differs from those of every other member by at least two nucleotides. Barcode technologies are known in the art and are described in e.g., Winzeler et al. (1999) Science 285:901; Brenner (2000) Genome Biol. 1:1 Kumar et al. (2001) Nature Rev. 2:302; Giaever et al. (2004) Proc. Natl. Acad. Sci. USA 101:793; Eason et al. (2004) Proc. Natl. Acad. Sci. USA 101:11046; and Brenner (2004) Genome Biol. 5:240.

Once the peptide, the nucleic acid or the immunoglobulin of interest is identified it can be synthesized (e.g., the immunoglobulin sequenced and DNA designed and cloned) and used for the vaccination of treatment of the viral infection.

The peptide, DNA (DNA vaccine) or immunoglobulin of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients. As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism. Herein the term "active ingredient" refers to the peptide, DNA (DNA vaccine) or immunoglobulin accountable for the biological effect.

Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. Techniques for formulation and administration of drugs may be found in “Remington’s

Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.

Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially trans nasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.

Conventional approaches for drug delivery to the central nervous system (CNS) include: neurosurgical strategies (e.g., intracerebral injection or intracerebroventricular infusion); molecular manipulation of the agent (e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB) in an attempt to exploit one of the endogenous transport pathways of the BBB; pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers); and the transitory disruption of the integrity of the BBB by hyperosmotic disruption (resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide). However, each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method. Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.

Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by nasal inhalation, the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuos infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.

The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (peptide, DNA (DNA vaccine) or immunoglobulin) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., viral infection e.g., COVID-19) or prolong the survival of the subject being treated.

Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 P-1)·

Dosage amount and interval may be adjusted individually to provide peptide, DNA (DNA vaccine) or immunoglobulin levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.

The term “treating” refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.

As used herein, the term “preventing” refers to keeping a disease, disorder or condition from occurring in a subject who may be at risk for the disease, but has not yet been diagnosed as having the disease.

As used herein, the term "vaccine" refers to a preparation of antigenic determinants that is used to induce formation of antibodies or immunity against the pathogen, i.e., Coronavirus. A vaccine is given to provide immunity to the disease, for example, COVID-19, which is caused by SARS-CoV-2 viruses. The present invention provides vaccine compositions that are immunogenic and provide protection. As used herein an "effective dose" generally refers to that amount of the polypeptide or polynucleotide of the invention sufficient to induce immunity, to prevent and/or ameliorate the Crononavirus infection or to reduce at least one symptom of infection. An effective dose may refer to the amount of the polypeptide or polynucleotide sufficient to delay or minimize the onset of a Coronavirus infection. An effective dose may also refer to the amount of the polypeptide or polynucleotide that provides a therapeutic benefit in the treatment or management of Coronavirus infection. Further, an effective dose is the amount with respect to the polypeptide or polynucleotide of the invention alone, or in combination with other therapies, that provides a therapeutic benefit in the treatment or management of Corona viral infection. An effective dose may also be the amount sufficient to enhance a subject's (e.g., a human's) own immune response against a subsequent exposure to Coronavirus. Levels of immunity can be monitored, e.g., by measuring amounts of neutralizing secretory and/or serum antibodies, e.g., by plaque neutralization, complement fixation, enzyme-linked immunosorbent, or microneutralization assay. In the case of a vaccine, an "effective dose" is one that prevents disease or reduces the severity of symptoms.

The invention comprises an antigenic formulation comprising the polypeptide or polynucleotide of embodiments of the invention. In one embodiment, the formulations of the invention comprise a formulation comprising the peptide, DNA or immunoglobulin of the invention and a pharmaceutically acceptable carrier or excipient. Pharmaceutically acceptable carriers include but are not limited to saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, and combinations thereof. A thorough discussion of pharmaceutically acceptable carriers, diluents, and other excipients is presented in Remington's Pharmaceutical Sciences (Mack Pub. Co. N.J. current edition). The formulation should suit the mode of administration. In another embodiment, the formulation is suitable for administration to humans, preferably is sterile, non-particulate, and/or non-pyrogenic.

The formulation, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The formulation can be a solid form, such as a lyophilized powder suitable for reconstitution, a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.

The invention comprises a vaccine comprising the peptide, DNA or immunoglobulin of the invention and an adjuvant. As also well known in the art, the immunogenicity of a particular composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Adjuvants have been used experimentally to promote a generalized increase in immunity against unknown antigens (e.g., U.S. Pat. No. 4,877,611). Immunization protocols have used adjuvants to stimulate responses for many years, and as such, adjuvants are well known to one of ordinary skill in the art. Some adjuvants affect the way in which antigens are presented. For example, the immune response is increased when protein antigens are precipitated by alum. Emulsification of antigens also prolongs the duration of antigen presentation. The inclusion of any adjuvant described in Vogel et al., "A Compendium of Vaccine Adjuvants and Excipients (2 ^nd edition)," herein incorporated by reference in its entirety for all purposes, is envisioned within the scope of this invention.

Exemplary, adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants and aluminum hydroxide adjuvant. Other adjuvants comprise GMCSP, BCG, aluminum hydroxide, MDP compounds, such as thur-MDP and nor-MDP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL). RIBI, which contains three components extracted from bacteria, MPL, trehalose dimycolate (TDM) and cell wall skeleton (CWS) in a 2% squalene/Tween 80 emulsion also is contemplated. MF-59, Novasomes™ MHC antigens may also be used. It will be appreciated that the libraries described herein are also contemplated regardless of their use. Such libraries can be enriched for Coronavirus peptides, COVID19 peptides and the like.

As used herein the term “about” refers to ± 10 %.

The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to" .

The term “consisting of’ means “including and limited to”.

The term "consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof. Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements. Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non-limiting fashion.

The Examples are illustrated in the attached figures.

Additional Examples:

EXAMPLE A Antibody repertoires against hCoVs and cross-reactivities

Antibody binding against SARS-CoV-2 is typically assessed by ELISAs against full length proteins/domains (20, 21) or by resolving crystal structures (14, 22). Pinpointing protein segments recognized by cross-reactive antibodies of all human Coronaviruses (hCoVS) requires higher resolution methods. Phage immunoprecipitation sequencing (PhIP-Seq) relies on the display of synthetic oligo libraries on T7 phages (11, 12). Thereby displayed antigens can be rationally selected allowing to probe for hundred thousands of antigens in parallel. After mixing of the phage library with serum antibodies, unbound phages are washed away after immunoprecipitation and enriched phages are detected by next generation sequencing (Figure la). The present inventors have generated a PhIP-Seq library covering all open reading frames of hCoVs as 64 amino acid (aa) sections with 20 aa overlaps between adjacent peptides

(Figure lb). The library also includes positive controls which confirmed detection of antibody responses against viruses previously reported to elicit population wide immunity (12) and negative controls that did not show substantial binding (Figures 4A-B). Figures 4A-B show peptide negative controls within the hCoV antigen library included

42 random peptides, peptides of the human protein SAPK4 (which should not elicit autoreactive antibodies in healthy individuals), and an HIV protein (with HIV infection being an exclusion criterion for participation in this study). Only 1/42 random peptides and one peptide of the human protein SAPK4 were bound in a single individual, indicating a low background of unspecific binding (or cross-reactivity). Yet, this result indicates that peptides appearing at low signal strengths in single individuals may arise from nonspecific binding. To eliminate such peptides, the following analyses of viral antigens (with population wide seroprevalence previously reported (12)) was performed using a cut-off of at least two peptides appearing per virus per individual (or peptides occurring in at least four individuals) to count as positive. Following analyses of hCoV binding and predictions were performed with these or even more stringent cutoffs.

Serum prevalence for non-hCoV viral antigens were similar between unexposed individuals and recovered COVID-19 patients (b). The slight differences of seroprevalence in unexposed individuals and recovered COVID-19 patients for Human adenovirus C and Influenza A virus antigens may be due the cohort sizes or age/gender differences.

The present inventors tested IgG antibody binding against this hCoV library with 32 serum samples of individuals unexposed to SARS-CoV-2, that had been collected in 2013/2014 (23) before the COVID-19 outbreak (Figure lc). These antibody repertoires were compared to 32 samples of recovered COVID-19 patients obtained in April and May 2020. In total nearly

100,000 antibody-peptide interactions (1,539 hCoV peptides in each of the 64 individuals) were assayed. Employing strict Bonferroni correction, 240/1,539 peptides were enriched in at least one individual, with an average of 9 hCoV peptides significantly bound per unexposed individual and 19 hCoV peptides in recovered COVID-19 patients. Most analyses were based on antibody responses against 57 hCoV peptides from 32 different hCoV proteins, shared by more than five individuals of either group and seven peptides showing significantly different abundances between the groups (Table 1 below).

Table 1- Most frequent hCoV antigens bound in unexposed individuals and recovered COVID-19 patients. Abundance of antibody responses against peptides of hCoV proteins detected in more than four individuals of either cohort are listed. Multiple peptides originating from the same protein are summarized. The seven peptides indicated by bold text are significantly different between unexposed individuals and recovered COVID-19 patients, by scoring the difference between the two distributions of the log fold changes (number of reads of bound peptides vs. baseline sequencing of phages not undergoing IPs) of the two groups. Peptides passing FDR are marked with an ‘*’ and peptides passing also Bonferroni correction

Unexposed individuals showed abundant antibody responses against all seasonal hCoVs: Binding against peptides of hCoV-NL63 was detected in 75% of unexposed individuals, against hCoV-HKUl in 66%, against hCoV-229E in 63%, and against hCoV-OC43 in 38% (Figures lh- k, Table 1). The same peptides were bound at similar frequencies in recovered COVID-19 patients and originated mostly from S- or N-proteins (Table 1). Binding of any peptide from seasonal hCoV S- or N- proteins was detectable in 78% of unexposed individuals for hCoV- NL63, 75% for hCoV-HKUl, and 63% for hCoV-229E and hCoV-OC43 with these epitope resolved results being in agreement with previous studies on the seroprevalence of seasonal hCoVs using ELISAs (24).

Recovered COVID-19 patients’ sera showed, as expected, an overrepresentation of several peptides of SARS-CoV-2 that completely lacked binding in unexposed individuals, with five peptides passing FDR (false discovery rate) correction for being significantly different between the two groups of individuals (Table 1). While nearly all COVID-19 patients showed binding against at least one peptide in S- or N-proteins and some peptides being bound in up to 72% of recovered patients (Figure le), no convergence of antibody responses against the same peptide were detected in all individuals. This finding differs from near universal recognition of some viral epitopes previously observed for other human viruses (12) and replicated with controls in this study (Table 1 and figure above), suggesting that the antibody response against SARS-CoV-2 can exhibit substantial inter-individual variability.

COVID-19 serum samples showed also common binding against SARS-CoV-1, indicating detection of cross-reactivity of antibodies targeting SARS-CoV-2 (Fig. If) (14, 15), most notably one SARS-CoV-1 spike peptide had significantly enriched binding in up to 84% of COVID-19 recovered individuals compared to 6% of unexposed individuals (Table S2). A non- stmctural protein (NSP3) of SARS-CoV-1 was even bound in 13% of unexposed individuals and 22% of recovered, possibly owing to higher conservation of such NSPs underlying less selective pressure than S- and N-proteins mostly responsible for infectivity and targeted by neutralizing immune responses. A few other peptides were differentially enriched between the two groups, but did not pass FDR correction for significance of this difference, including a peptide of the MERS-CoV S-protein bound in 28% of COVID-19 sera and 3% (1/32) of unexposed individuals

(Fig· Ig)·

Strikingly, cross-reactive responses from SARS-CoV-2 also extended to the seasonal hCoVs-OC43 (Figure lh). One hCoV-OC43 spike peptide was bound in 50% of COVID-19 sera and 3% (1/32) of unexposed individuals, passing FDR correction for being differentially enriched between the two groups (Table 1). Another two peptides of hCoV-OC43 spike were not bound in unexposed individuals at all, but bound in up to 28% of COVID-19 patients, neither passing FDR correction (Table 1). Differential binding of hCoV-HKUl was less pronounced with one peptide occurring in 19% of COVID 19 patients and 3% (1/32) of unexposed individuals (Figure li) not passing FDR correction (Table 1). No cross-reactivities were detected against peptides from the alpha coronaviruses (hCoV-NL63 and CoV-229E), with COVID-19 patients and healthy individuals’ sera reacting at similar rates (Figures lj-k). Peptides eliciting cross-reactive antibody responses between SARS-CoV-2, SARS-CoV-1, and seasonal hCoVs typically originated from similar regions of S- (Figure 2a) and N- (Figure 2b) proteins. This data indicates that epitopes in the SARS-CoV-2 spike S2 region are frequently bound in COVID-19 patients and a target for cross-reactivity. Many recombinant SARS-CoV-2 vaccines in development focus either on the full-length spike or the RBD alone (25). The observed S2 reactivity could lead to differences between these designs, with responses against full-length S- protein vaccines potentially benefiting from cross-reactivities against seasonal hCoVs, which may not occur for RBD only vaccines.

When looking at the principal components of an analysis (PC A, Figure 3a) performed on the log fold change (number of reads of bound peptides vs. baseline sequencing of phages not undergoing immunoprecipitation) of significantly enriched oligos, unexposed individuals clustered together while recovered COVID-19 patients’ samples showed a greater spread. This illustrates the interindividual variability in hCoV antibody responses elicited by SARS-CoV-2.

Overall, this data indicates that substantial cross-reactivity between hCoVs observed for T cells (7, 8) also extends to antibody responses against seasonal hCoVs. Infection with SARS- CoV-2 mounts cross reactive antibodies against hCoV-OC43 antigens. The reverse direction of preexisting antibody responses targeting seasonal hCoVs recognizing SARS-CoV-2 is more difficult to assess. Binding of two SARS-CoV-2 epitopes in a few unexposed individuals (peptides from NSP2 in 19% and N protein in 6% (2/32), Table 1) was observed. The abundance of responses against NSP2 did not change in recovered COVID-19 patients, but binding of the N-protein antigen increased to 66% of recovered patients. The present inventors also detected additional SARS-CoV-2 peptides bound in single healthy individuals (including a spike peptide, Fig. 2a) similar to a population-wide abundance of 3% (1/32) in unexposed individuals reported by a recent study comparing four antibody tests for the SARS-CoV-2 S/N proteins (26). hCoV peptides bound at higher abundance in unexposed individuals than recovered COVID-19 patients, would suggest a protective nature.

Assessing the protective nature of these population wide preexisting responses would require comparing samples of the same individuals before and after contracting COVID-19 and information on the course (severity) of the disease. The COVID-19 cohort of this study consisted of patients who had experienced mild symptoms, and had not required hospitalization (testing positive in PCR and serological tests). Employing the present antigen library to compare antibody profiles against seasonal hCoVs between mild and severe COVID-19 cases could also inform on protective effects of cross-reactivity, as demonstrated for other aspects of the anti- SARS-CoV-2 immune response (27) and antibody binding of SARS-CoV-2 proteins (20). If severe patients exhibited fewer antibody responses against antigens of seasonal hCoVs, could point towards their protective nature. Moreover, possible detrimental effects of cross-reactive antibody responses originating from seasonal hCoVs leading to antibody-dependent enhancement (28) could be assessed with our hCoV antigen library.

EXAMPLE B hCov library based high throughput diagnostics

Testing for multiple hCoV antigens at high resolution in parallel could yield higher specificity than conventional tests based on single proteins of SARS-CoV-2 by improving discrimination from seasonal hCoVs. Most current SARS-CoV-2 serological tests rely on detection of entire S-/RBD or N-proteins, reporting an aggregate of binding against all epitopes within (21, 29). Interpreting the epitope-resolved antibody binding data reported by the present assay extends beyond conventional serological tests, as binding against various epitopes of all hCoV needs to be weighed. Machine learning was used to build a predictor that highly accurately separated COVID-19 patients from healthy controls based on antibody signatures (AUC=0.96, Figure 3b). Depending on the intended application and cutoffs employed (Figure 3c), this assay can display 100% specificity at 72% sensitivity (reporting virtually no false- positives) or 94% specificity at 91% sensitivity. Hence, in addition to informing on cross reactivity between hCoVs, the antigen library could also represent a tool for SARS-CoV-2 diagnostics.

From a technical perspective, the study shares general limitations of PhIP-Seq, most notable length constraints of presented peptides (64 aa in this study) by underlying oligo synthesis and lack of eukaryotic post translational modifications such as glycosylation. Opposed to neutralization assays carried out with live viruses and cell cultures (29), the present data does not inform on the neutralizing capacity of the observed binding events. While linear epitopes should be adequately covered, discontinuous, conformational epitopes relying on the correct folding of domains could be missed. No frequent binding to peptides of the RBD was detected (with one adjacent peptide bound in 25% of COVID-19 and 0% of unexposed individuals’ sera, Figure 2a), although other work and diagnostic tests relying on the full length RBD had reported common antibody responses in COVID-19 patients (14, 16, 17, 21). This discrepancy may be due antibody responses against conformational epitopes in the RBD and/or a lack of S protein glycans (30) in the phage displayed peptides.

While current oligo lengths employed in PhIP-Seq may underestimate conformational epitopes, it provides a unique layer of information unobtainable from working with full length antigens or isolated domains: Given the high resolution of the peptide approach, we pinpoint the exact bound regions revealing crucial targets of cross-reactivities. The hCoV antigen library can be leveraged to study extended cohorts of patients with mild/severe disease courses or samples collected pre/post COVID-19 infection, and could thereby inform on the potential protective nature of preexisting antibody responses against seasonal hCoVs. In addition, the present approach can be extended to other antibody isotypes such as IgA, the primary mucosal antibody. Given the low cost of processing phage displayed libraries in parallel (31), high accuracy (Figures 3b-c), and its excellent amenability for robot automation (12, 31), serological testing based on this hCoV library could be a broadly applicable tool to assess preexisting immunity at population-scale (with implications towards protection and herd immunity of SARS-CoV-2) as well as stratifying vaccine trial costs effectively.

Materials and methods

Samples

Serum samples of recovered COVID-19 patients were obtained from MDA (Magen David Adorn, the Israeli Red Cross equivalent). These samples had been collected from non- severe cases, who had not been hospitalized. Before sampling, patients had tested twice negative by RT-qPCR testing. Seropositivity of these samples had been confirmed by MDA with a commercial antibody test (Abbot, SARS-CoV-2 IgG, ref. 6R86-22/6R86-32). Control serum samples of unexposed individuals had been collected in 2013/2014 in Israel and reported in a previous study (23). Research with the COVID-19 serum samples has been approved by the Weizmann Institute of Science’s institutional review board (#1030-4), and by the Tel Aviv Sourasky Medical Center for the samples of unexposed individuals (#0658-12-TLV). Our cohorts of unexposed individuals and COVID-19 patients showed a different sex distribution and minor age differences (Fig. lc). While age/sex may influence COVID-19 serology of severe cases (5, 6), we do not expect these parameters to affect key conclusions of our study in mildly affected patients (with both cohorts also showing similar antibody responses against viral controls Figure 5b). hCoV antigen library design

Reference genomes of the seven hCoVs were downloaded from NCBI directly using amino acid sequences of the translated ORFs with the follow RefSeq accession numbers: SARS- CoV-2 - NC_045512.2, SARS-CoV-1 - NC_004718.3, MERS-CoV - NC_019843.3, hCoV- OC43 - NC_006213.1, hCoV-229E - NC_002645.1, hCoV-HKUl - NC_006577.2, and hCoV- NL63 - NC_005831.2

For each strain the nonstructural proteins (NSPs) part of the large polyprotein lab (polyprotein la was discarded if annotated) were separated. The SARS-CoV-2 polyprotein lab was cut according to the table published by Wu et al.(l). Additional strains’ polyproteins were processed by the following steps: NSPs 1-3 were cut by sequences reported in the literature (35). The remaining NSPs, which are naturally cut by 3Clike protease (3CLpro), were cut by the conserved protease cleavage site (small)-X-(L/I/V/F/M)-Q#(S/A/G), where X is any amino acid and # represents the cleavage position (36), and multiply sequence alignment as verification of the site. Specifically for SARS-CoV-2, four additional ORFs reported in the literature (1) (but not annotated in RefSeq NC_045512.2) were added.

The final list of proteins were cut to peptides of 64 amino acids (aa) with 20 aa overlaps (to cover all possible epitopes of the maximal length of linear epitope (37)) between adjacent peptides. The peptide aa sequences were reverse translated to DNA using the Escherichia coli codon usage (of highly expressed proteins), aiming to preserve the original codon usage frequencies, excluding restriction sites for cloning (EcoRI and Hindlll) within the coding sequence (CDS). The coding was re-performed, if needed, so that a barcode was formed in the CDS, by the 44 nt at the 3’ end of each oligo. Every such barcode is a unique sequence at Hamming distance three from all prior sequences in the library, which allows for correcting of a single read error in sequencing the barcode. For similar peptide sequences, alternative codons were used following E. coli codon usage, to achieve discrimination. Including the sequencing barcode as part of the CDS, rather than a separate barcode, allowed to use the entire oligo for encoding a peptide (and as opposed to completely omitting a barcode, it did not require sequencing the complete CDS). After finalizing the peptide sequence, the Eco \ and Hindlll restriction sites, stop codon, and annealing sequences for library amplification were added and obtained from Agilent Technologies as 230mer pool (library amplification primers, fwd: GGACCGCGACTGGAATTCT/SEQ ID NO: 8, rev: CCCGGGCATGAAGCTTTCA/SEQ ID NO: 9) and cloned into T7 phages following the manufacturers recommendations (Merck, T7Select®10-3 Cloning Kit, product number 70550-3).

In this process we had also included controls of viral proteins with high population wide seroprevalence previously reported (72) [11 proteins covered by 199 peptides] and negative controls of 42 random peptides and a human protein (SAP4K, 27 peptides) not expected to elicit binding in healthy individuals. Phage immunoprecipitation sequencing

The PhIP-Seq experiments were performed as outlined in a published protocol (77) with the following modifications: PCR plates for the transfer of beads and washing were blocked with 150 pL BSA (30 g/L in DPBS buffer, incubation overnight at 4°C) and BSA was added to diluted phage/buffer mixtures for immunoprecipitations (IPs) to 2 g/L. We reasoned that the Generalized Poisson (GP) distribution approach (38) for calling bound peptides may be biased by frequent binding within this hCoV library, leading to a skewed non-binding baseline for estimating GP parameters. Hence, we mixed the hCoV library with a library of 244,000 microbiota and viral antigens that had previously shown a reliable detectability and ratio of bound/unbound peptides (manuscript in preparation). Three microgram of serum IgG antibodies (measured by ELISA) were mixed with the phage library (4,000-fold coverage of phages per library variant). As technical replicates of the same sample were in excellent agreement, measurements were performed in single reactions.

The phage library and antibody mixtures were incubated in 96 deep well plates at 4°C with overhead mixing on a rotator. Forty microliters of a 1:1 mixture of protein A and G magnetic beads (Thermo Fisher Scientific, catalog numbers 10008D and 10009D, washed according to the manufacturers recommendations) were added after overnight incubation and incubated on a rotator for at 4°C. After four hours, the beads were transferred to PCR plates and washed twice as previously reported (77) using a Tecan Freedom Evo liquid handling robot with filter tips. The following PCR amplifications for pooled Illumina amplicon sequencing were performed with Q5 polymerase (New England Biolabs, catalog number M0493L) according to the manufacturers recommendations (primer pairs PCR1: tcgtcggcagcgtcagatgtgtataagagacagGTTACTCGAGTGCGGCCGCAAGC/SEQ ID NO: 10 and gtctcgtgggctcggagatgtgtataagagacagATGCTCGGGGATCCGAATTC/SEQ ID NO: 11, PCR2: Illumina Nextera combinatorial dual index primers, PCR3 [of PCR2 pools]:

AATGATACGGCGACCACCGA/SEQ ID NO: 12 and

CAAGCAGAAGACGGCATACGA/SEQ ID NO: 13 (11)). PCR3 products were cut from agarose gel and purified twice (lx QIAquick Gel Extraction Kit, lx QIAquick PCR purification kit; Qiagen catalog numbers 28704/28104) and sequenced on an Illumina NextSeq machine (custom primers for Rl: ttactcgagtgcggccgcaagctttca/SEQ ID NO: 14, and for R2: tgtgtataagagacagatgctcggggatccgaattct/SEQ ID NO: 15, R1/R244/31 nts). Paired end reads were processed as described below.

Data analysis

Enriched peptides were calculated (after down-sampling to 1.25 million IDable reads per sample, i.e. reads with a barcode within one error of the set of possible barcodes of the two mixed libraries for which the paired end matched the IDed oligo) by comparing reads of input coverage (library sequencing of phages before IPs) following a Generalized Poisson distribution approach, parameters for which were estimated for each sample separately, as previously reported (38). Derived p-values were subject to Bonferroni correction (p-value 0.05) for multiple hypothesis testing, and log-fold-change (number of reads of bound peptides vs. baseline sequencing of phages not undergoing IPs) was computed for all peptides which passed the threshold p-value, all other peptides were given a log-fold-change value of 0.

All oligo creation code, and analysis code was written in Python, using the libraries scikit-leam (39), scipy, statsmodels, pandas, numpy and matplotlib. Alignments shown in Fig. 2a-b were created with CLC Main Workbench 6 (default settings).

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.

REFERENCES

(other references are cited in the document) A. Wu et al. , Genome Composition and Divergence of the Novel Coronavirus (2019-nCoV) Originating in China. Cell Host Microbe. 27, 325-328 (2020). A. C. Walls et al. , Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein. Cell , 1-12 (2020). A. Sette, S. Crotty, Pre-existing immunity to SARS-CoV-2: the knowns and unknowns. Nat. Rev. Immunol. (2020), doi:10.1038/s41577-020-0389-z. N. Vabret et al. , Immunology of COVID-19: current state of the science. Immunity (2020), doi:10.1016/j.immuni.2020.05.002. E. P. Scully, J. Haverfield, R. L. Ursin, C. Tannenbaum, S. L. Klein, Considering how biological sex impacts immune responses and COVID-19 outcomes. Nat. Rev. Immunol. 20, 442-447 (2020). E. J. Marquez, J. Trowbridge, G. A. Kuchel, J. Banchereau, D. Ucar, The lethal sex gap: COVID-19. Immun. Ageing. 17, 1-8 (2020). A. Grifoni et al. , Targets of T Cell Responses to SARS-CoV-2 Coronavirus in Humans with COVID-19 Disease and Unexposed Individuals. Cell. 181, 1489-1501. el5 (2020). N. Le Bert et al., SARS-CoV-2-specific T cell immunity in cases of COVID-19 and SARS, and uninfected controls. Nature (2020), doi:10.1038/s41586-020-2550-z. J. Mateus et al. , Selective and cross-reactive SARS-CoV-2 T cell epitopes in unexposed humans. Science (80-. ). 21, eabd3871 (2020). D. J. Woodsworth, M. Castellarin, R. A. Holt, Sequence analysis of T-cell repertoires in health and disease. Genome Med. 5, 98 (2013). D. Mohan et al. , PhIP-Seq characterization of serum antibodies using oligonucleotide-encoded peptidomes. Nat. Protoc. 13, 1958-1978 (2018). G. J. Xu et al. , Viral immunology. Comprehensive serological profiling of human populations using a synthetic human virome. Science. 348, aaa0698 (2015). S. M. Kissler, C. Tedijanto, E. Goldstein, Y. H. Grad, M. Lipsitch, Projecting the transmission dynamics of SARS-CoV-2 through the postpandemic period. Science (80-. ). 182, eabb5793 (2020). B. Ju et al. , Human neutralizing antibodies elicited by SARS-CoV-2 infection. Nature. 584 (2020), doi : 10.1038/s41586-020-2380-z. A. Z. Wee et al. , Broad neutralization of SARS-related viruses by human monoclonal antibodies. Science ( 80- . ). 736, eabc7424 (2020). L. Premkumar et al. , The receptor binding domain of the viral spike protein is an immunodominant and highly specific target of antibodies in SARS-CoV-2 patients. Sci. Immunol. 5, 1-10 (2020). M. Yuan et al. , Science , in press, doi: 10.1126/science. abb7269. F. Amanat et al, medRxiv , in press, doi: 10.1101/2020.03.17.20037713. P. Kellam, W. Barclay, The dynamics of humoral immune responses following SARS-CoV-2 infection and the potential for reinfection. J. Gen. Virol. (2020), doi: 10.1099/jgv.0.001439. C. Atyeo et al. , Distinct Early Serological Signatures Track with SARS-CoV-2 Survival. Immunity , 1-9 (2020). R. Weissleder, H. Lee, J. Ko, M. J. Pittet, COVID-19 diagnostics in context. Sci. Transl. Med. 12, 1-6 (2020). C. O. Barnes et al. , Structures of human antibodies bound to SARS-CoV-2 spike reveal common epitopes and recurrent features of antibodies. Cell, 1-15 (2020). D. Zeevi et al, Personalized Nutrition by Prediction of Glycemic Responses. Cell. 163, 1079-94 (2015). G. J. Gorse, G. B. Patel, J. N. Vitale, T. Z. O’Connor, Prevalence of antibodies to four human coronaviruses is lower in nasal secretions than in serum. Clin. Vaccine Immunol. 17, 1875-1880

(2010). World Health Organization, Draft landscape of COVID-19 candidate vaccines - 13 August

2020, www(dot)who(dot)int/publications/m/item/draft-landscape-of-c ovid-19-candidate- vaccines L. Grzelak et al. , A comparison of four serological assays for detecting anti-SARS-CoV-2 antibodies in human serum samples from different populations. Sci. Transl. Med. 3103, 1-18 (2020). P. S. Arunachalam et al. , Systems biological assessment of immunity to mild versus severe COVID-19 infection in humans. Science. 6261, 1-18 (2020). A. M. Arvin et al. , A perspective on potential antibody-dependent enhancement of SARS-CoV- 2. Nature. 8, 1-11 (2020). F. Krammer, V. Simon, Serology assays to manage COVID-19. Science (80-. ). 368, 1060-1061 (2020). Y. Watanabe, J. D. Allen, D. Wrapp, J. S. Mclellan, M. Crispin, Site-specific glycan analysis of the SARS-CoV-2 spike. 9983, 1-9 (2020). H. B. Larman et al. , PhIP-Seq characterization of autoantibodies from patients with multiple sclerosis, type 1 diabetes and rheumatoid arthritis. J. Autoimmun. 43, 1-9 (2013). D. Wrapp et al. , Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science. 367, 1260-1263 (2020). Cubuk et al. (2020) The SARS-CoV-2 nucleocapsid protein is dynamic, disordered, and phase separates with RNA, preprint, www(dot)biorxiv(dot)org/content/10.1101/2020.06.17.158121vl T. Chen, C. Guestrin, in Proceedings of the 22nd ACM SIGKDD International Conference on Knowledge Discovery and Data Mining (ACM, New York, NY, USA, 2016; www(dot)dl(dot)acm(dot)org/doi/10.1145/2939672.2939785), pp. 785-794.

Supporting references X. Yang et al. , Proteolytic processing, deubiquitinase and interferon antagonist activities of Middle East respiratory syndrome coronavirus papain-like protease. J. Gen. Virol. 95, 614-626 (2014). E. J. Snijder, E. Decroly, J. Ziebuhr, The Nonstructural Proteins Directing Coronavirus RNA Synthesis and Processing. Adv. Virus Res. 96, 59-126 (2016). B. Forsstrom et al. , Dissecting antibodies with regards to linear and conformational epitopes. PLoS One. 10, 1-11 (2015). H. B. Larman et al. , Autoantigen discovery with a synthetic human peptidome. Nat. Biotechnol. 29, 535-41 (2011). Buitinck et al. API design for machine learning software: experiences from the scikit-learn, (2013) ECML PKDD Workshop: Languages for Data Mining and Machine Learning 108-122