COMBINATORIAL LIBRARY COMPOUNDS

This application claims priority under 35 U.S. C. § 119 (e) from United States Provisional Application Serial No. 62/435,861, filed December 19, 2016 which is hereby incorporated by reference in its entirety.

FIELD

Disclosed herein are methods of estimating metabolic stability of compounds including a ligand operatively linked to a recognition element. The methods generally involve contacting the compounds with one or more metabolic degradation agents, removing the metabolic degradation agents and contacting and identifying ligands which bind to a target. In some embodiments, the compounds have been contacted with the same target and ligands identified prior to contacting with the compounds with one or more metabolic degradation agents.

BACKGROUND

Combinatorial libraries, which were first developed over thirty years ago, now routinely identify novel, high affinity ligands for wide variety of biological targets (e.g., receptors, enzymes, nucleic acids, etc.) and hence are of increasing importance in drug discovery. Tagged combinatorial libraries, particularly libraries which use DNA as a tag to record the synthetic steps undergone by ligands operatively attached to the DNA, are of current interest. Advances in DNA sequencing, PCR technology and ligand assay development, provide methods to identify and select ligands operatively linked to DNA that bind to a biological target, from complex mixtures of ligands operatively linked to DNA (Harbury, et aL, U.S. Patent No. 7,479,472; Liu et aL, U.S Patent No. 7,070,928; Liu et aL, U.S Patent No. 7,223,545; Liu et aL, U.S. Patent No. 7,442,160; Liu et aL, U.S. Patent No. 7,491,160; Liu et aL, U.S. Patent No. 7,557,068; Liu et aL, U.S. Patent No. 7,771,935; Liu et aL, U.S. Patent No. 7,807,408; Liu et aL, U.S. Patent No. 7,998,904; Liu et aL, U.S. Patent No. 8,017,323; Liu et aL, U.S. Patent No. 8,183,178; Pedersen et a , U.S. Patent No. 7,277,713; Pedersen et aL, U.S. Patent No. 7,413,854; Gouliev et al, U.S. Patent No. 7,704,925; Franch et al, U.S. Patent No. 7,915,201; Gouliev et al, U.S. Patent No. 8,722,583;

Freskgard et al, U.S. Patent Application No. 2006/0269920; Freskgard et al, U.S. Patent Application No. 2012/0028812; Hansen et al, U.S. Patent No.

7,928,211; Hansen et al, U.S. Patent No. 8,202,823; Hansen et al, U.S. Patent Application No. 2013/0005581; Hansen et al, U.S. Patent Application No.

2013/0288929; Neri et al, U.S. Patent No. 8,642,514; Neri et al, U.S. Patent No. 8,673,824; Neri et al, U.S. Patent Application No. 2014/01288290; Morgan et al, U.S. Patent No. 7,972,992; Morgan et al, U.S. Patent No. 7,935,658; Morgan et al, U.S. Patent Application No. 2011/0136697; Morgan et al, U.S. Patent No. 7,972,994; Morgan et al, U.S. Patent No. 7,989,395; Morgan et al, U.S. Patent No. 8,410,028; Morgan et al, U.S. Patent No. 8,598,089; Morgan et al, U.S. Patent Application Serial No. 14/085,271; Wagner et al, U.S. Patent Application No. 2012/0053901; Keefe et a/., U.S. Patent Application No. 2014/0315762; Dower et al, U.S. Patent No. 6,140,493; Lerner et a/., U.S. Patent No. 6,060,596; Dower et al, U.S. Patent No. 5,789, 162; Lerner et al, U.S. Patent No. 5,723,598; Dower et al; U.S. Patent No. 5,708,153; Dower et al, U.S. Patent No. 5,639,603; and Lerner et al, U.S. Patent No. 5,573,905).

However, most combinatorial libraries where ligands are operatively linked with tagging moieties are assayed for a single activity, i.e., binding affinity for a biological target. Frequently, other properties, such as, for example, bioavailability, stability under physiological conditions, toxicity and/or lipophilicity (important for absorption and distribution) are also of great significance in identifying suitable drug candidates. Stability under physiological conditions is essential for successful drug administration. For example, compounds with high first pass clearance are generally undesirable candidates for further development. The ability to accurately estimate metabolic stability is very limited and experimental measurement of these parameters is essential in drug development.

Although, metabolic stability can be routinely measured for individual organic compounds, methods for measuring metabolic stability for ligands operatively linked to recognition elements in a complex mixture of similar ligands such as those provided by tagged combinatorial chemistry methods have not yet been developed. Accordingly, what is needed are methods for measuring metabolic stability for members of combinatorial libraries, where the ligands are operatively linked with recognition elements. Such methods will greatly assist in identifying compounds derived from combinatorial libraries with properties amenable to further optimization as drug candidates and accordingly, increase the efficiency of drug development.

SUMMARY Provided herein are compounds and methods which satisfy these and other needs. In one aspect, a method for identifying ligands which are stable to metabolic degradation is provided. The method includes the steps of incubating a combinatorial library which includes ligands operatively linked to recognition elements with one or more metabolic degradation agents, removing the metabolic degradation agents, contacting the ligands with a target, eluting ligands which bind to the target and identifying the ligands which bind to the target.

In another aspect, another method for identifying ligands which are stable to metabolic degradation is provided. The method includes the steps of contacting a combinatorial library which includes ligands operatively linked to recognition elements with a target, removing ligands which do not bind to the target, eluting ligands which bind to the target, incubating the ligands which bind to the target with one or more metabolic degradation agents, removing the metabolic degradation agents, contacting the ligands incubated with metabolic degradation agents with the target, eluting ligands incubated with metabolic degradation agents which bind to the target and identifying ligands incubated with metabolic degradation agents which bind to the target.

In still another aspect, a method for identifying a ligand operatively linked to a recognition element which is metabolically degraded is provided. The method includes the steps of incubating the ligand with a metabolic degradation agent and isolating the metabolite of the ligand. In still another aspect, another method for identifying a ligand operatively linked to a recognition element which is metabolically degraded is provided. The method includes the steps of measuring the amount of the ligand, incubating the ligand with a metabolic degradation agent and comparing the amount of the ligand before incubation to the amount after incubation.

BRIEF DESCRIPTION OF THE FIGURES

The Figure illustrates that the peak area of the atrovastin conjugate (DC 1068) decreased with all three CYP3A4 preparations.

DETAILED DESCRIPTION

Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this invention belongs. If a plurality of definitions for a term exists, those in this section prevail unless stated otherwise.

It must be noted that as used herein and in the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a tag" includes a plurality of such tags and reference to "the compound" includes reference to one or more compounds and equivalents thereof known to those skilled in the art, and so forth.

It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely", "only" and the like in connection with the recitation of claim elements, or the use of a "negative" limitation.

As used herein, and unless otherwise specified, the terms "about" and "approximately," when used in connection with a property with a numeric value or range of values indicate that the value or range of values may deviate to an extent deemed reasonable to one of ordinary skill in the art while still describing the particular property. Specifically, the terms "about" and "approximately," when used in this context, indicate that the numeric value or range of values may vary by 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2% or 0.1%) of the recited value or range of values while still describing the particular solid form.

"Antibody" as used herein refers to a protein comprising one or more polypeptides substantially or partially encoded by immunoglobulin genes or fragments of immunoglobulin genes, e.g., a fragment containing one or more complementarity determining region (CDR). The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes. Light chains are typically classified as either, e.g., kappa or lambda. Heavy chains are typically classified e.g., as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. A typical immunoglobulin (antibody) structural unit comprises a tetramer. In nature, each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these light and heavy chains respectively. Antibodies exist as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)'2 (fragment antigen binding) and Fc (fragment crystaliizable, or fragment complement binding). F(ab)'2 is a dimer of Fab, which itself is a light chain joined to VH-CH1 by a disulfide bond. The F(ab)'2 may be reduced under mild conditions to break the disulfide linkage in the hinge region thereby converting the (Fab') ₂ dimer into a Fab' monomer. The Fab' monomer is essentially a Fab with part of the hinge region. The Fc portion of the antibody molecule corresponds l argely to the constant region of the immunoglobulin heavy chain, and is responsible for the antibody's effector function (see, Fundamental Immunology, 4 edition. W.E. Paul, ed., Raven Press, N.Y. (1998), for a more detailed description of antibody fragments). While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such Fab' or Fc fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology, peptide display, or the like. Thus, the term antibody, as used herein, also includes antibody fragments either produced by the modification of whole antibodies or synthesized de novo using recombinant DNA methodologies. Antibodies also include single-armed composite monoclonal antibodies, single chain antibodies, including single chain Fv (sFv) antibodies in which a variable heavy and a variable light chain are joined together (directly or through a peptide linker) to form a continuous polypeptide, as well as diabodies, tribodies, and tetrabodies (Pack et al. (1995) JMolBiol 246:28; Biotechnol I 1 : 1271;

and Biochemistry 31 : 1579). The antibodies are, e.g., polyclonal, monoclonal, chimeric, humanized, single chain, Fab fragments, fragments produced by an Fab expression library, or the like.

"Coding template" as used herein mean nucleic acid sequences which each comprise a plurality of hybridization sequences (i.e., codons) and a functional group or a linking entity or a iigand. The "hybridization sequences" refer to oligonucleotides comprising between about 3 and up to 100, 3 and up to 50, and from about 5 to about 30 nucleic acid subunits. Such coding templates are capable of directing the synthesis of the combinatorial library based on the catenated hybridization sequences. The coding template is operativelv linked to a functional group or optionally a linking entity. Coding templates may be immobilized by capture templates and direct combinatorial library synthesis in DPCC. In some embodiments, coding templates are oligonucleotides. In some embodiments, the hybridization sequences are 20 nucleic acid subunits. In other embodiments, hybridization sequences are separated by constant spacer sequences. Constant spacer sequences refer to oligonucleotides comprising between about 3 and up to 100, 3 and up to 50, and from about 5 to about 30 nucleic acid subunits." refer to oligonucleotides comprising between about 3 and up to 100, 3 and up to 50, and from about 5 to about 30 nucleic acid subunits. In some embodiments, the constant spacer sequences are 20 nucleic acid subunits.

"Combinatorial library" as used herein refers to a library of molecules containing a large number, typically between 10 ³ and 10 ¹⁵ or more different compounds typically characterized by different sequences of subunits, or a combination of different side chains functional groups and linkages. In some embodiments, a combinatorial library includes more than 10 ² molecules.

"Compounds" refers to compounds encompassed by structural formulae disclosed herein and includes any specific compounds within these formulae whose structure is disclosed herein. Compounds may be identified either by their chemical structure and/or chemical name. When the chemical structure and chemical name conflict, the chemical structure is determinative of the identity of the compound. The compounds described herein may contain one or more chiral centers and/or double bonds and therefore, may exist as stereoisomers, such as double-bond isomers (i.e. , geometric isomers), enantiomers or diastereomers. Accordingly, the chemical structures depicted herein encompass all possible enantiomers and stereoisomers of the illustrated compounds including the stereoisomerically pure form (e.g. , geometrically pure, enantiomerically pure or diastereomerically pure) and enantiomeric and stereoisomeric mixtures.

Enantiomeric and stereoisomeric mixtures can be resolved into their component enantiomers or stereoisomers using separation techniques or chiral synthesis techniques well known to the skilled artisan. The compounds may also exist in several tautomeric forms including the enol form, the keto form and mixtures thereof. Accordingly, the chemical structures depicted herein encompass all possible tautomeric forms of the illustrated compounds. The compounds described also include isotopically labeled compounds where one or more atoms have an atomic mass different from the atomic mass conventionally found in nature. Examples of isotopes that may be incorporated into the compounds described herein include, but are not limited to, ² H, ¾, ¹³ C, ¹⁴ C, ¹⁵ N, ¹⁸ 0, ¹⁷ 0, ³⁵ S, etc. In general, it should be understood that all isotopes of any of the elements comprising the compounds described herein may be found in these compounds. Compounds may exist in unsolvated or unhydrated forms as well as solvated forms, including hydrated forms and as N-oxides. In general, compounds may be hydrated, solvated or N-oxides. Certain compounds may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated herein and are intended to be within the scope of the present invention. Further, it should be understood, when partial structures of the compounds are illustrated, that brackets indicate the point of attachment of the partial structure to the rest of the molecule.

"Depsipeptide" as used herein refers to a peptide as defined herein where one or more of amide bonds are replaced by ester bonds.

"Nucleic acid" as used herein refers to an oligonucleotide analog as defined below as well as a double stranded DNA and RNA molecule. A DNA and RNA molecule may include the various analogs defined below.

"Oligonucleotides" or "oiigos" as used herein refer to nucleic acid oligomers containing between about 3 and up to about 300, and typically from about 5 to about 300 nucleic acid subunits. In the context of oiigos (e.g., hybridization sequence) which direct the synthesis of library compounds, the oiigos may include or be composed of naturally-occurring nucleotide residues, nucleotide analog residues, or other subunits capable of forming

sequence-specific base pairing, when assembled in a linear polymer, with the proviso that the polymer is capable of providing a suitable substrate for strand-directed polymerization in the presence of a polymerase and one or more nucleotide triphosphates, e.g., conventional deoxyribonucleotides. A

"known-sequence oligo" is an oiigo whose nucleic acid sequence is known.

"Oligonucleotide analog" as used herein refers to a nucleic acid that has been modified and which is capable of some or ail of the chemical or, biological activities of the oligonucleotide from which it was derived. An oligonucleotide analog will generally contain phosphodiester bonds, although in some cases, oligonucleotide analogs are included that may have alternate backbones.

Modifications of the ribose-phosphate backbone may facilitate the addition of additional moieties such as labels, or may be done to increase the stability and half-life of such molecules. In addition, mixtures of naturally occurring nucleic acids and analogs can be made. Alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. The oligonucleotides may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence. The oligonucleotide may be DNA, RNA, locked DNA or a hybrid, where the nucleic acid contains any combination of deoxyribo-and

ribo-nucleotides, and any combination of bases, including uracil, uridine, adenine, thymine, cytosine, guanine, inosine, xathanine hypoxathanine,

isocytosine, isoguanine, etc.

"Operatively linked," as used herein, means at least two chemical structures joined together in such a way as to remain linked through the various manipulations described herein. Typically, a iigand or functional group and the coding nucleotide are linked covalently via an appropriate linker. The linker is at least a bivalent moiety with a site of attachment for the oligonucleotide and a site of attachment for the Iigand or a functional group. For example, when the functional moiety is a polyamide compound, the poiyamide compound can be attached to the linking group at the N-terminus, the C-terminus or via a functional group on one of the side chains. The linker is sufficient to separate the Iigand and the oligonucleotide by at least one atom and in some embodiments by more than one atom. In most embodiments, the linker is sufficiently flexible to allow the Iigand to bind target molecules in a manner which is independent of the oligonucleotide. "Peptide" as used herein refers to a polymer of amino acid residues between about 2 and 50 amino acid residues, between about 2 and 20 amino acid residues, or between about 2 and 10 residues. Peptides include modified peptides such as, for example, glycopeptides, PEGylated peptides, lipopeptides, peptides conjugated with organic or inorganic ligands, peptides which contain peptide bond isosteres (e.g., [CH ₂ S], ψί Π ! >Ν! ! > |, \|/[NHCO], ψ ΌΠ Η, ψ[(Ε) or (Ζ) CH=CH], etc. and also include cyclic peptides. In some embodiments, the amino acid residues may be any L-ot-amino acid, D- -amino residue, N-alkyl variants thereof or combinations thereof. In other embodiments, the amino acid residues may any L-a-amino acid, D-a-amino residue, β-amino acids, τ-amino acids, N-alkyl variants thereof or combinations thereof. "Peptide nucleic acid" as used herein refers to oligonucleotide analogues where the sugar phosphate backbone of nucleic acids has been replaced by psuedopeptide skeleton (e.g., N-(2-aminoethyl)-glycine) (Nielsen et al, U.S. Patent No. 5,539,082; Nielsen et al, U.S. Patent No. 5,773,571; Burchardi. el a/.. U.S. Patent No. 6,395,474). "Peptoid" as used herein refers to polymers of poly N-substituted glycine

(Simon et al., Proc. Natl Acad. Sci. (1992) 89(20) 9367-9371) and include cyclic variants thereof.

"Polypeptide" as used herein refers to a polymer of amino acid residues typically comprising greater than 50 amino acid residues and includes cyclic variants thereof. Polypeptide includes proteins (including modified proteins such as glycoproteins, PEGyiated proteins, lipoproteins, polypeptide conjugates with organic or inorganic iigands, etc.) receptor, receptor fragments, enzymes, structural proteins (e.g., collagen) etc. In some embodiments, the amino acid residues may be any L-a-amino acid, D-a-amino residue, or combinations thereof. In other embodiments, the amino acid residues may be any L-a-amino acid, D-a-amino residue, N-alkyl variants thereof or combinations thereof.

"Recognition Element" as used herein refers to an oligonucleotide, single or double-stranded RNA, single or double-stranded DNA, a DNA binding protein, a locked nucleic acid, a RNA binding protein, a peptide nucleic acid, a peptide, a depsipeptide, a polypeptide, an antibody, a peptoid, a polymer, a polysiloxanes, an inorganic compound of molecular weight greater that 50 daltons, organic compounds of molecular weight between about 2000 daltons and about 50 daltons or a combination thereof. "Salt" refers to a salt of a compound, which possesses the desired pharmacological activity of the parent compound. Such salts include: (1) acid addition salts, formed with inorganic acids such as hydrochloric acid,

hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or formed with organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl) benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid,

2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2.2.2]-oct-2-ene-l-carboxylic acid, glucoheptonic acid,

3-phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, muconic acid, and the like; or (2) salts formed when an acidic proton present in the parent compound is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion, or an aluminum ion; or coordinates with an organic base such as ethanolamine, diethanolamine, triethanolamine, N-methylglucamine and the like. In some embodiments, salts may be formed when an acidic proton present can react with inorganic bases (e.g., sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide, calcium hydroxide, etc.) and organic bases (e.g., ethanolamine, diethanolamine, triethanolamine, tromethamine, N- methylglucamine, etc.). In some embodiments, the salt is pharmaceutically acceptable. Reference will now be made in detail to embodiments of the invention.

While the invention will be described in conjunction with these embodiments, it will be understood that it is not intended to limit the invention to the

embodiments, infra. To the contrary, it is intended to cover alternatives, modifications, and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims. Methods of Estimating Metabolic Stability of Tagged Combinatorial Library

Compounds

Described herein are methods for estimating metabolic stability of compounds which include a ligand operatively linked to a recognition element. In some instances, the compounds may be members of combinatorial libraries and the methods may simultaneously provide estimates of metabolic stability of a number of members of the combinatorial libraries.

Combinatorial libraries are well known and may be synthesized by methods known in the art (Harbury, et al, U.S. Patent No. 7,479,472; Liu et al, U.S Patent No. 7,070,928; Liu et a/., U.S Patent No. 7,223,545; Liu et al, U.S.

Patent No. 7,442, 160; Liu et al, U.S. Patent No. 7,491,160; Liu et al, U.S.

Patent No. 7,557,068; Liu et al, U.S. Patent No. 7,771,935; Liu et al, U.S.

Patent No. 7,807,408; Liu et al, U.S. Patent No. 7,998,904; Liu et al, U.S.

Patent No. 8,017,323; Liu et al, U.S. Patent No. 8, 183,178; Pedersen et al, U.S. Patent No. 7,277, 713; Pedersen et al, U.S. Patent No. 7,413,854; Gouliev et al,

U.S. Patent No. 7,704,925; Franch et al, U.S. Patent No. 7,915,201; Gouliev et al, U.S. Patent No. 8,722,583; Freskgard et al, U.S. Patent Application No.

2006/0269920; Freskgard et al, U.S. Patent Application No. 2012/0028812;

Hansen et al, U.S. Patent No. 7,928,211; Hansen et al, U.S. Patent No.

8,202,823; Hansen et al, U.S. Patent Application No. 2013/0005581; Hansen et al, U.S. Patent Application No. 2013/0288929; Neri et al, U.S. Patent No.

8,642,514; Neri et al, U.S. Patent No. 8,673,824; Neri et al, U.S. Patent

Application No. 2014/01288290; Morgan et al, U.S. Patent No. 7,972,992;

Morgan et al, U.S. Patent No. 7,935,658; Morgan et al, U.S. Patent Application No. 2011/0136697; Morgan et al, U.S. Patent No. 7,972,994; Morgan et al, U.S.

Patent No. 7,989,395; Morgan et al, U.S. Patent No. 8,410,028; Morgan et al,

U.S. Patent No. 8,598,089; Morgan et al, U.S. Patent Application Serial No.

14/085,271; Wagner et al, U.S. Patent Application No. 2012/0053901; Keefe et al, U.S. Patent Application No. 2014/0315762; Dower et al, U.S. Patent No. 6, 140,493; Lerner et al, U.S. Patent No. 6,060,596; Dower et al, U.S. Patent No.

5,789,162; Lerner et al, U.S. Patent No. 5,723,598; Dower et al; U.S. Patent No. 5,708,153; Dower et a/., U.S. Patent No. 5,639,603; and Lerner et a/., U.S. Patent No. 5,573,905).

Without wishing to be bound by theory, the structure of the ligand may determine the relative metabolic stability of members of combinatorial libraries. The recognition elements (i.e., tags) are typically isomeric polymers and thus possess similar physiochemical properties. Accordingly, the structure of ligands may control the metabolic stability of compounds, which include ligands operatively linked to recognition elements. Metabolic stability of compounds which include a ligand operatively linked to a recognition element in

combinatorial libraries may be estimated without modification or after binding of the recognition element to either a complementary moiety or a modified complementary moiety, infra.

In some embodiments, a method for identifying ligands which are stable to metabolic degradation is provided. The method includes the steps of incubating a combinatorial library which includes ligands operatively linked to recognition elements with one or more metabolic degradation agents, removing the metabolic degradation agents, contacting the ligands with a target, eluting ligands which bind to the target and identifying the ligands which bind to the target. In other embodiments, a method for identifying ligands which are stable to metabolic degradation is provided. The method includes the steps of contacting a combinatorial library which includes ligands operatively linked to recognition elements with a target, removing ligands which do not bind to the target, eluting ligands which bind to the target, incubating the ligands which bind to the target with one or more metabolic degradation agents, removing the metabolic degradation agents, contacting the ligands incubated with metabolic degradation agents with the target, eluting ligands incubated with metabolic degradation agents which bind to the target and identifying ligands incubated with metabolic degradation agents which bind to the target. In other embodiments, a method for identifying a ligand operatively linked to a recognition element which is metabolically degraded is provided. The method includes the steps of incubating the ligand with a metabolic degradation agent and isolating the metabolite of the ligand. In still other embodiments, a method for identifying a ligand operatively linked to a recognition element which is metabolically degraded is provided. The method includes the steps of measuring the amount of the ligand, incubating the ligand with a metabolic degradation agent and comparing the amount of the ligand before incubation to the amount after incubation. In some embodiments, the metabolic degradation agents are serum or liver microsomes or liver homogenates. In other embodiments, the metabolic degradation agents are peroxidases, cytochrome P450 enzymes or proteases. In still other embodiments, the proteases are serine, cysteine, threonine, aspartic, glutamic, metallo or asparagine proteases. In still other embodiments, the proteases are chymotrypsin, trypsin, pepsin, proteinase K or combinations thereof. In still other embodiments, the cytochrome P450 enzymes are cyp34A or cyp2D6.

The temperature at which the metabolic degradation agents are contacted with the enzyme are between about 0 °C and about 50 °C, between about 15 °C and about 40 °C or between about 25 °C and about 40 °C

In many of the above embodiments, nuclease inhibitors are included in the contacting step. The nuclease inhibitors may prevent degradation of nucleic acid containing recognition elements. The inhibitor may be a divalent metal chelator, such as, for example, EDTA. Compounds degraded by the metabolic degradation agents may be separated from unaffected compounds by methods including, but not limited to, centrifugation, filtration, electrophoresis or chromatography. In some embodiments, the amounts of compounds degraded and/or the amounts of compounds not degraded are measured by absorbance, fluorescence, radioactivity or quantitative mass spectrometry. In some embodiments, the recognition element is a single stranded DNA oligonucleotide, the ligand is a peptide or organic molecule. In other

embodiments, the recognition element is double stranded DNA, the ligand is a peptide or organic molecule

Those of skill in the art will appreciate that, when the recognition element is capable of binding a complementary moiety (e.g., oligonucleotide, single stranded DNA or RNA) that the metabolic stability of a compound which includes a ligand operatively linked to a recognition element may be estimated in a number of different configurations, including, but not limited, to the following. First, the metabolic stability of a compound which includes a ligand operatively linked to a recognition element may be estimated without any modification. Second, the metabolic stability of a compound which includes a ligand operatively linked to a recognition element may be estimated after binding to a complementary moiety.

In any of the above methods, compounds, which include a ligand operatively linked to a recognition element, may be affinity purified by binding to a target, which may be a biological target, such, as for example, a receptor, an enzyme, a protein, a cell, a membrane preparation, etc., prior to contacting with a metabolic degradation agent. In some embodiments, affinity purification enriches the mixture of compounds by removing non-binding members, hence providing metabolic stability estimates only for compounds which have demonstrated affinity for the target.

The above methods can also be used to measure the metabolic stability of a single compound which includes a ligand operatively linked to a recognition element as well as compounds that are members of a combinatorial library (i.e., a complex mixture).

In some of the above embodiments, the ligand is an oligonucleotide, single stranded RNA, single stranded DNA, double stranded RNA, double stranded DNA, a peptide, a depsipeptide, a peptoid or an organic compound of molecular weight of less than 2000 daltons. In other embodiments, the ligand is a peptide, a peptoid or an organic compound of molecular weight of less than 2000 daltons. In still other embodiments, the ligand is a peptide or an organic compound of molecular weight of less than 2000 daltons.

The ligand is operatively linked to a recognition element with a linker, which generally is any molecule or substance which performs the function of connecting the ligand to the recognition element. The distance between the ligand and the recognition element may be greater than about ΙθΑ, about 25 A, about 50A or about ΙΟθΑ.

The linker may vary in structure and length. The linker may be hydrophobic or hydrophilie, long or short, rigid, semi rigid or flexible, etc. The linking group can comprise, for example, a polymethylene chain, such as a— (CH ₂ ) _K — chain or a poiy(ethylene glycol ) chain, such as a— (CH ₂ CH ₂ 0) _n chain, where in both cases n is an integer from 1 to about 20, S'-O-Dimethoxytrityi- 1 ',2'-Dideoxyribose-3 '-[(2-cyanoethyl)-(N, ^" N-diisopropyl)]-phosphoramidite; 9- O-Dimethoxytrityl-tri ethylene glycol, I -[(2-cyanoethyl)-( ,N-isopropyl)]- phosphorami dite; 3 -(4,4 '-Dimethoxytrityloxy)propyl - 1 -[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite; and 18-O-Dimethoxytritylhexaethyleneglycol, 1 ,- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, amino-carboxylic linkers (e.g., peptides (e.g., Z-Gly-Gly-Gly-Osu or Z-Gly-Gly-Gly-Gly-Gly-Gly-Osu), PEG (e.g., Fmoe-aminoPEG2000-NHS or amino-PEG (12-24)- HS), or alkane acid chains (e.g., Boc-e-aminocaproic acid-Osu)), click chemistry linkers (e.g., peptides (e.g., azidohomalanine-Gly-Gly-Gly-OSu or propargylglycine-Gly-Gly- Gly-OSu), PEG (e.g., azido-PEG-NHS), or alkane acid chains (e.g., 5- azidopentanoic acid, (S)-2-(azidomethyl)-l-Boc-pyrrolidine, or 4-azido-butan-l- oic acid N-hydroxysuccinimide ester)), thiol -reactive linkers (e.g., PEG (e.g., SM(PEG)n NHS-PEG-maieimide), alkane chains (e.g., 3-(pyridin-2- yldisulfanyl)-propionic acid-Osu or sulfosuccinimidyl 6-(3 '-[2- pyridyldithio]propionamido)hexanoate))), amidites for oligonucleotide synthesis (e.g., amino modifiers (e.g., 6-(trifluoroacetylamino)-hexyl-(2-cyanoethyl)-(N,N- diisopropyl)-phosphoramidite), thiol modifiers (e.g., S-trityl-6-mercaptohexyl-l - [(2-cyanoethyl)-( ,N-diisopropyl)]-phosphoramidite, or chick chemistry modifiers (e.g., 5-hexynl-TTT(T) ₀ . ₇ , 6-hexynl-TTT(T) ₀ . ₇ , 5-hexyn- l-yl-(2- cyanoethyl)-(N,N-diisopropyl)-phosphoramidite, 6-hexyn-l-yl-(2-cyanoethyl)- (N,N-dii sopropylj-phosphoram dite, 3 -dimethoxytrityloxy-2-(3 -(3 - propargyloxypropanamido)propanamido)propyl-l-0-succinoyl, long chain alkylamino CPG or 4-azido-butan-l-oie acid N-hydroxysuccinimide ester)). Additional examples of linkers are provided, infra.

Linkers may also include UV activated cross linkers. UV activated cross linkers are well known in the art and many examples thereof may be purchased from commercial suppliers, including but not limited to, Thermo Fisher

Scientific, 81 Wyman St., Waltham, MA 02451 and Santa Cruz Biotechnology, Inc. 10410 Finnel St., Dallas, TX. Exemplary UV activated cross linkers include, for example, N-5-azido-2-nitrobenzoyloxysuccinimide and succinimidyl 6-(4,4'- azipentami do)hexanoate .

Linkers also include polyvalent linkers which have multiple free sites for initiation of ligand synthesis. Examples include but are not limited to, linkers which include more than one amino group. Such compounds are known to the skilled artisan. In some embodiments, the polyvalent linker may be based on intermediates used to prepare functionalized dendrimers or functionalized dendrimers themselves which are available from a number of commercial suppliers such as, for example, Polymer Factory Sweden AB, Teknikringen 48, SE-114, 28 Stockholm, Sweden, Dendritech, Inc. 3110 Schuette Rd., Midland,

MI, 48642 or NanoSynthons LLC, 1200 N. Facher Ave., Mt. Pleasant, MI 48858.

Generally, the target can be any substance, including any molecule, for which identification of compounds with affinity is desirable. In some

embodiments, the target is a biological molecule. In other embodiments, the target is an enzyme, a receptor, an ion channel, a nucleic acid, a carbohydrate, protein-protein interface, a virus, bacteria, a eukaryotic cell or a prion.

Biological targets include, but are not limited to, CD3, GPII/IIIA, CD20, IL2R, RSV F, TNF, Her2, CD33, CD52, CDl la, EGFR, IgE, VEGF, VEGF Fab, VLA4, C5, ILlbeta, EPCAM, P40 (IL12R), IL6R, RANKL, BLyS, B7.1/2, CD30, B anthrasis PA, Alpha IV/Beta VII, BAFF APRIL, CD2, CTLA4, C deficSclerostin A&B, ile Enterotoxin, ILla and b, IL5, IL6, IL6R, IL13, IL17a, IL17R, IL23, BLyS, CD20. Amyloid Beta, PCSK9, ST4, HGF, Folate Ralpha, CD22, EGFR2, PD1, cMET, NaV1.7 and GM3. Other biological targets include, for example, whole fixed or living cells, tissue sections and membrane preparations. The biological targets may be immobilized on a matrix by ionic, covalent, or magnetic methods.

The recognition element, in broadest terms, may be an oligonucleotide, a double stranded oligonucleotide, single stranded RNA, single stranded DNA, double stranded DNA, a double stranded RNA-DNA hybrid, a DNA binding protein, a RNA binding protein, a peptide nucleic acid, a peptide, a depsipeptide, a polypeptide, locked nucleic acids, an antibody or a peptoid. In some embodiments, the recognition element is an oligonucleotide, a double stranded oligonucleotide, single stranded RNA, a double stranded RNA-DNA hybrid, single stranded DNA, double stranded DNA or a peptide nucleic acid. In other embodiments, the recognition element is an oligonucleotide, single stranded DNA, single stranded RNA or double stranded DNA.

In some embodiments, the compounds described above may be members of combinatorial libraries and the method may simultaneously provide estimates metabolic stability of more than one member(s) of those particular combinatorial libraries. Combinatorial libraries include, but are not limited to, tagged combinatorial libraries described, supra.

As will be appreciated by the skilled artisan, the recognition element may include, but is not limited to, all tags or labels previously described in the art and all methods used to prepare such tags. In some embodiments, the precise chemical structure of the recognition element will not be of determinative importance in the methods described herein. Accordingly, the methods described herein may be used with any tagged combinatorial library, including those not yet known in the art.

As is known to the skilled artisan, identification of the compound(s) operatively linked to recognition element(s) can be accomplished by

identification of the recognition element(s). Generally, recognition elements may be identified by any method know to those of skill in the art including, for example, but not limited to, biological methods (e.g., affinity binding, sequencing, etc.) and chemical methods (e.g., MR, mass spectroscopy, etc.). In some embodiments, when the recognition element is a nucleic acid, identification involves amplification and sequencing amplified recognition elements or quantitative hybridization to complementary sequences. Amplification of nucleic acids, sequencing of nucleic acids and quantitative hybridization are conventional and are well known in the art.

The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention.

EXAMPLES

EXAMPLE : Measurement of Atorvastatin Degradation while

Attached to 20mer oligomer

Atorvastatin, as is well known, is oxidized by CYP3 A and various preparations containing CYP3 A3 to para hydroxy atorvastatin and ortho hydroxy atorvastatin with the site of oxidation being the benzene ring attached to the amide functionality of atorvastin. Atorvastatin, conjugated to a tegamine derivative of a 20mer (GCTCGTCGCATTCGGCACGC) and the 20-mer (GCTCGTCGCATTCGGCACGC) was incubated with several types of CYP preparations containing CYP3A4 (i.e., human liver microsomes (HLM), CypExp 3 A4 which is a CYP expressed in a permeabilized yeast cell, and Baculosome Cyp 3A4 which is a microsomal preparation of 3A4) which are commercially available.

The procedure for the incubations was as follows. Buffer (1M Tris-HCl, pH 7.5, 100mm, Cyp source and Rapidstart were combined. Atorvastatin was added and the incubation mixed at 1200 rpm at 37 °C overnight. Samples (60 iL of the mixture was removed and 60 iL of MeOH was added and this mixture was placed on ice) were removed immediately, at 40 ice minutes and 60 minutes. A final sample was removed after 22 hours of mixing. The samples were centrifuged at 14000 rpm for 10 minutes and supernatant was transferred to a well plate for HPLC-RP analysis under conventional conditions.

HPLC analysis depicted in Figure 1 demonstrated that the peak area of the atrovastin conjugate (DC 1068) decreased with all three preparations which indicates that measurement of hydroxylation of atorvastin conjugated to DNA is possible. Mass spectroscopy confirmed the presence of hydroxylated atorvastin conjugated to DNA in all three CYP34A incubations.