Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
METHODS OF MODULATING CELLULAR ACTIVITY AND COMPOSITIONS THEREFOR
Document Type and Number:
WIPO Patent Application WO/2008/025069
Kind Code:
A1
Abstract:
The specification discloses methods for modulating hematopoietic cell number and/or activity and especially hematopoietic stem cell functional activity. The specification further provides methods of screening epigenetic modulators and other agents that modulate the level and/or activity of polycomb proteins such as Suz12. Genetically modified non-human animals and genetically modified cells that are Suz12 deficient are also contemplated together with their use and the use of animal models of hematopoietic and particularly platelet deficiency to develop epigenetic modifier agents.

Inventors:
HILTON, Douglas, James (244 Research Road, Warrandyte, Victoria 3113, AU)
MAJEWSKI, Ian (8 Lewis Street, Flemington, Victoria 3031, AU)
ALEXANDER, Warren, Scott (13 Park Street, Moonee Ponds, Victoria 3039, AU)
BLEWITT, Marnie, Elisabeth (59 Bridge Street, Northcote, Victoria 3070, AU)
DE GRAAF, Carolyn, Anne (15/36 Cromwell Road, South Yarra, Victoria 3141, AU)
Application Number:
AU2007/001243
Publication Date:
March 06, 2008
Filing Date:
August 28, 2007
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
THE WALTER AND ELIZA HALL INSTITUTE OF MEDICAL RESEARCH (1G Royal Parade, Parkville, Victoria 3052, AU)
HILTON, Douglas, James (244 Research Road, Warrandyte, Victoria 3113, AU)
MAJEWSKI, Ian (8 Lewis Street, Flemington, Victoria 3031, AU)
ALEXANDER, Warren, Scott (13 Park Street, Moonee Ponds, Victoria 3039, AU)
BLEWITT, Marnie, Elisabeth (59 Bridge Street, Northcote, Victoria 3070, AU)
DE GRAAF, Carolyn, Anne (15/36 Cromwell Road, South Yarra, Victoria 3141, AU)
International Classes:
C12N15/09; A61K48/00; A61P5/50; A61P7/06; A61P11/06; A61P19/02; A61P31/18; A61P35/02; C12N15/113
Attorney, Agent or Firm:
HUTCHISON, Jane, E. et al. (Davies Collison Cave, 1 Nicholson StreetMelbourne, Victoria 3000, AU)
Download PDF:
Claims:

Claims:

1. A method of enhancing the number and/or activity of a hematopoietic cell comprising administering an effective amount of an agent that modulates chromatin modification and gene expression in the cell.

2. A method of claim 1 wherein the agent modulates the acetylation or methylation status of chromatin.

3. A method of claim 1 wherein the agent is a demethylating agent, a methylation inhibitor, a histone de-acetylase inhibitor, a histone acetyl-transferase mimic or analog.

4. A method of enhancing the number and/or activity of a hematopoietic cell comprising administering an effective amount of an agent that modulates the level or activity of Suzl2 polypeptide or Suzl2 polynucleotide or a complex comprising Suzl2 or which modulates the level or activity of a target of Suzl2 or a target of a complex comprising Suzl2 in said cells.

5. The method of claim 4 wherein the agent is a demethylating agent, a methylation inhibitor, an s-adenosylhomocysteine hydrolase inhibitor or a gene silencing agent.

6. The method of claim 4 wherein the agent down modulates the level or activity of Suzl2 polypeptide or Suzl2 polynucleotide or a complex comprising Suzl2 in said cell.

7. The method of claim 4 wherein the agent modulates the level or activity of a target of Suzl2 polypeptide or of a target of a complex comprising Suzl2 in said cell.

8. The method of 7 wherein the target is a gene listed in Table 12, 13 or 14.

9. The method of claim 8 wherein the target gene expression is enhanced at least 2 fold.

10. The method of any one of claim 1 to 9 wherein the agent is administered ex vivo.

11. The method of any one of claims 1 to 9 wherein the agent is administered in vivo.

12. The method of any one of claims 1 to 9 wherein the agent is administered in vitro.

13. The method of claim 11 wherein the agent is administered to a subject suffering from or at risk of developing thrombocytopenia.

14. The method of claim 11 wherein the agent is administered to a subject suffering from or at risk of developing: anemia, pancytopenia, leukopenia, leukemias, Hodgkin's disease, non-Hodgkin's lymphoma, acute lymphocytic anemia (ALL), plasmacytomas, multiple myeloma, Burkitt's lymphoma, arthritis, asthma, AIDS, autoimmune disease, rheumatoid arthritis, granulomatous disease, immune deficiency, inflammatory bowel disease, sepsis, neutropenia, neutrophilia, psoriasis, immune reactions to transplanted organs and tissues, systemic lupus erythematosis, hemophilia, hypercoagulation, diabetes mellitus, endocarditis, meningitis, Lyme Disease or allergies.

15. The method of claim 13 or 14 wherein the subject is receiving chemotherapy.

16. The method of any one of claim 1 to 15 wherein the hematopoietic cell is a hematopoietic stem cell.

17. The method of any one of claims 1 to 15 wherein the cell is treated prior to or after transplantation.

18. The method of claim 11 comprising identifying a subject suffering from or at risk

for a deficiency in hematopoietic stem cells.

19. A composition for the treatment or prevention of a condition associated with hematopoietic stem cell deficiency comprising an agent capable of modifying chromatic modification.

20. The composition of clam 19, wherein the agent modulates the acetylation or methylation status of chromatin.

21. The composition of claim 19 wherein the agent is a demethylating agent, a methylation inhibitor, a histone de-acetylase inhibitor, a histone acetyl-transferase mimic or analog.

22. A composition for enhancing the number and/or activity of hematopoietic cells comprising an effective amount of an agent that modulates the level or activity of Suzl2 polypeptide or Suzl2 polynucleotide or a complex comprising Suzl2 or which modulates the level or activity of a target of Suzl2 or a target of a complex comprising Suzl2 in said cells.

23. The composition of claim 22 wherein the agent is a demethylating agent, a methylation inhibitor, an s-adenosylhomocysteine hydrolase inhibitor or a gene silencing agent.

24. The composition of claim 22 wherein the agent down modulates the level or activity of Suzl2 polypeptide or Suzl2 polynucleotide or a complex comprising Suzl2 in said cell.

25. The composition of claim 22 wherein the agent modulates the level or activity of a target of Suzl2 polypeptide or of a target of a complex comprising Suzl2 in said cell.

26. The composition of claim 25 wherein the target is a gene listed in Table 12, 13 or 14.

27. The composition of claim 26 wherein the target gene expression is enhanced at least 2 fold.

28. The composition of any one of claim 19 to 27 suitable for administration in vivo, ex vivo or in vitro.

29. The composition of claim 28 wherein the agent is administered to a subject suffering from or at risk of developing thrombocytopenia.

30. The composition of claim 29 wherein the agent is administered to a subject suffering from or at risk of developing: anemia, pancytopenia, leukopenia, leukemias, Hodgkin's disease, non-Hodgkin's lymphoma, acute lymphocytic anemia (ALL), plasmacytomas, multiple myeloma, Burkitt's lymphoma, arthritis, asthma, AIDS, autoimmune disease, rheumatoid arthritis, granulomatous disease, immune deficiency, inflammatory bowel disease, sepsis, neutropenia, neutrophilia, psoriasis, immune reactions to transplanted organs and tissues, systemic lupus erythematosis, hemophilia, hypercoagulation, diabetes mellitus, endocarditis, meningitis, Lyme Disease or allergies.

31. The composition of claim 29 or 30 wherein the subject is receiving chemotherapy.

32. A composition for increasing bone marrow or hematopoietic cell transplant efficiency comprising an agent capable of modifying chromatin modification.

33. A composition for the treatment or prevention of thrombocytopenia comprising an agent capable of modifying chromatin modification.

34. A method of screening for an agent which modulates the number and/or functional

activity of hematopoietic cell, said method comprising:

(i) contacting the agent with a system comprising a target selected from the group consisting of a Suzl2 polypeptide, Suzl2 polynucleotide, PRC2/3, or

PRC2/3-binding polypeptide; and (ii) determining the presence of a complex between the agent and the target, a change in activity of the target, or a change in the level of activity of an indicator of the activity of the target.

35. A modified population of hematopoietic stem cells or bone marrow cells for administration to a subject in need thereof, wherein the cells have been treated with or comprise an agent or mutation that down regulates the level or activity of Suzl2 polypeptide or Suzl2 polynucleotide or a complex comprising Suzl2 in said cell.

36. The modified population of claim 35 wherein the agent is a demethylating agent, a methylation inhibitor, an s-adenosylhomocysteine hydrolase inhibitor or a gene silencing agent.

37. An isolated or genetically modified cell or non-human animal comprising such cells wherein a Suzl2 gene or Suzl2 polypetide is modified and the cell or animal produces a substantially reduced level or activity of Suzl2 polypeptide compared to a non-modified cell or animal of the same species.

38. The cell or organism of claim 37 wherein the modification is in one allele of the Suzl2 gene.

39. The cell or organism of claim 37 which is from a non-human primate, live stock animal, companion animal, laboratory test animal, captive wild animal, reptile, amphibian, fish or bird.

40. The cell or organism of claim 37 wherein the genetically modified non-human animal is a mouse.

41. The cell or non-human animal of claim 37 derived from an animal comprising a modification in the TPO or c-mpl gene.

42. The cell or non-human animal of claim 37 derived from an animal that is an animal model of a disease or condition.

43. The cell of claim 37 wherein the cell is a human or bacterial cell.

44. The cell of claim 37 wherein the cell is a stem cell, embryonic cell, hematopoietic cell, bone marrow cell, skin cell, heart cell, bone cell, cartilage cell, liver cell, lung cell, kidney cell, spleen cell, thymus cell or brain cell.

45. The cell of claim 37 wherein the cell is a proliferating cell or a terminally differentiated cell.

46. The cell of claim 37 wherein the cell is an autologous or syngeneic cell suitable for transplantation.

47. The cell or organism of claim 37 wherein the modification is in an exon of a Suzl2 gene.

48. The cell or organism of claim 37 wherein the modification is generated by gene silencing or other method of inhibiting expression.

49. The cell or organism of claim 37 wherein the cell or organism is further modified with a modification in the TPO or c-mpl gene.

50. The cell or organism of claim 49 comprising a MpT 1' mutation.

51. The isolated cell of any one of claims 37 to 50 when used in vitro or in vivo.

52. A method of testing or monitoring the effect of an epigenetic modifier agent in a subject, said method comprising administering the agent and monitoring the

number and/or activity of platelets in the subject wherein a change in the number and/or activity of platelets as a result of said administration is a measure of the effect of the agent on the subject.

53. The method of claim 52 wherein the epigenetic modifier modulates the level or activity of a polycomb polypeptide or gene.

54. The method of claim 52 wherein the agent is an inhibitor of the level or activity of Suz 12 or Sηz/2.

55. The method of claim 52 wherein the subject is human.

56. The method of claim 52 wherein the subject is a human.

57. The method of claim 52 wherein the subject is a genetically modified animal model.

58. The method of claim 57 wherein the animal is MpI deficient.

59. The method of claim 57 wherein the animal is Suzl2 deficient.

60. The method of claim 57 wherein the animal is MpI deficient and Suzl2 deficient.

Description:

METHODS OF MODULATING CELLULAR ACTIVITY AND COMPOSITIONS THEREFOR

FIELD

The present specification relates to the regulation of endogenous gene expression and the identification of epigenetic modulators thereof. In particular, the present invention provides methods for enhancing the number and/or activity of hematopoietic cells and/or their progenitor cells such as hematopoietic stem cells. In some aspects, the invention pertains to the treatment or prevention of conditions associated with insufficient or insufficiently active hematopoietic cells, hematopoietic stem cells, or myeloid- or lymphoid-restricted progenitor cells.

BACKGROUND

Bibliographic details of the publications referred to by author in this specification are collected at the end of the description.

The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Hematopoietic stem cells (HSC) are characterised by multipotency, which is the developmental capacity to form all types of blood cell, self renewal, which is the capacity to generate daughter HSCs, and relative quiescence. HSCs have three alternative fates: self-renewal, differentiation or programmed cell death. In a "symmetric" cell division, both daughter cells adopt the same fate, while in an "asymmetric" cell division they adopt different fates. Before adopting a particular fate, HSCs undergo "commitment," which is a stable change in internal state. "Lineage commitment" results in an internal change that

restricts the number of lineages into which a cell's progeny can differentiate. The process of "differentiation" involves cells becoming structurally and functionally distinct. HSC are important cellular precursors and they are recognised by the medical and allied health fields as a high priority area for research and development of new treatment and prophylactic strategies.

Mature blood cells have a diverse morphology and function. They are generally unable to proliferate and their numbers are replenished from a small population of HSC. Hematopoiesis proceeds through a series of lineage commitment steps, in which HSC progeny become progressively more restricted in their differentiation and proliferative potential. This model of hematopoiesis arose in the late 1960s, when colony forming unit (CFU) assays led to the identification of progenitor cells with differing developmental, proliferative and self-renewal potential (Bradley et al, Nature, 2/4(87):511, 1967). More recently, use of fluorescence activated cell sorters (FACS) has identified cell populations enriched for lymphoid progenitors (the common lymphoid progenitor, CLP (Kondo et al, Cell, P7(5):661-672, 1997)) and myeloid progenitors (common myeloid progenitor, CMP; granulocyte/macrophage progenitor, GMP; megakaryocyte/erythroid progenitor, MEP (Akashi et al, Nature, 404(6774):\93-l97, 2000)). While the precise details of lineage commitment are being debated, this model for hematopoiesis is generally accepted.

Genes and proteins that regulate hematopoiesis have been extensively studied however, the mechanisms that govern HSC behaviour, their proliferation and differentiation into multipotent progenitors and ultimately terminal differentiation into mature blood cells is poorly understood. Relative quiescence is maintained, in part, by the action of cyclin- dependent kinase inhibitors such as p21 , which inhibits cell cycle progression (Cheng et al, Science, 287 (5459): 1804- 1808, 2000). Self-renewal by HSC is influenced by hematopoietic cytokines and involves complex interactions between positive and negative regulators. Positive regulators of HSC include IL-6, IL-I l, Flt3L, stem cell factor (SCF) and thrombopoietin (Tpo). These cytokines act synergistically in vitro to promote proliferation of HSC. However, the role of cytokines in directing lineage commitment, if any, has not been clarified. Members of the Homeobox (Hox) gene family have been

implicated in the control of HSC expansion in vitro (Amsellem et al, Nat, Med., 9(11):1423-1427, 2003). The polycomb group gene Bmi-1 has been shown to be essential for sustained hematopoiesis. However, the role of these genes, if any, in lineage commitment is uncertain. Certain transcription factors have been shown to regulate hematopoietic lineage commitment. For example, PU.1 is an Ets family member that plays a critical role in both myeloid and lymphoid differentiation (McKercher et al, EMBO. J., /5(20):5647-5658, 1996; Scott et al, Science, 2<J5(5178):1573-1577, 1994). Another transcription factor, GATA-I is required for erythroid and megakaryocyte development (Pevny et al, Nature, J4P(6306):257-260, 1991). Mutual antagonism between PU.1 and GATA-I regulates lineage choice by common myeloid progenitors (CMP) (Zhu et al, Oncogene, 2/(21):3295-3313, 2002). Cells expressing high levels of GATA-I undergo megakaryocyte and erythroid differentiation, while GATA-I antagonism of PU.1 ensures that myeloid genes are switched off. Conversely, PU.1 prevents megakaryocyte and erythroid differentiation by antagonising GATA-I and instead facilitates differentiation along myeloid pathways.

Platelets are small, anuclear fragments of megakaryocytes that circulate in the blood and make essential contributions to functions such as blood clotting and wound healing. Like all lineages of blood cells, regulatory mechanisms in the body ensure that precise numbers of platelets are generated at steady-state to replace those that are functionally expended or removed from the circulation, as well as allowing rapid responses to emergency requirements such as haemorrhage. Platelets are shed by megakaryocytes: large, polyploid cells in hematopoietic tissues produced by specific progenitor cells. In normal individuals, precise control of proliferation, differentiation, survival and clearance of these cells ensures maintenance of homeostasis, and reduces the likelihood of haemorrhage should platelet counts fall or thrombosis resulting from excess platelet production.

Thrombopoietin plays a key role in platelet homeostasis, by regulating the level of platelet production to maintain optimal circulating levels. If this delicate balance is perturbed, thrombocytopenia, or low platelet count, can ensue. Thrombocytopenia is a common problem in the clinic, particularly in hematological and oncological practice. It can occur

congenitally, with a number of inherited disorders having been defined (Drachman, Blood, 703:390-398, 2004), but the majority of thrombocytopenias seen in the clinic are the result of other causes. It can be a major problem for patients undergoing cancer chemotherapy. Acute episodes of cytotoxic drug-related thrombocytopenia, in addition to putting the patient at immediate risk, can force dose modifications or treatment withdrawal, thus blunting treatment efficacy. Thrombocytopenia is also frequently encountered in myelodysplastic syndromes (MDS), idiopathic thrombocytopenia purpura (ITP) and chronic liver disease, and is associated with viral infections, particularly AIDS (Kuter et al, Blood, 700:3457-3469, 2002). In these more chronic contexts, thrombocytopenia may result from defective platelet production or elevated platelet destruction, often as the result of autoimmune reactions.

Deficiencies in platelet levels or function can lead to haemorrhagic episodes and this condition can be the result of congenital or acquired syndromes such as von Willebrand disease, Bernard-Soulier syndrome, Glanzmann's thrombasthenia, asprin-like defects, myeloproliferative disorders, liver disease and uremia. Treatment for low platelet numbers includes platelet transfusion and, potentially, administration of thrombopoietin (TPO).

Platelet-mediated thrombosis is a major mechanism leading to vascular diseases such as cardiovascular disease, cerebrovascular disease and peripheral vascular disease. Control of platelet levels or activity is an essential component of anti-thrombosis treatments. Pro- thrombotic states are seen in subjects with conditions such as myeloproliferative disorders, chronic pulmonary obstructive disease and essential thrombocytosis.

There is a need in the art to identify molecules that have a key role in hematopoiesis in order to devise therapeutic strategies for use when this function is impaired or where enhanced levels of HSC or their particular progeny would be beneficial.

SUMMARY

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

As used in this specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to a "polycomb protein" includes a single polycomb protein, as well as two or more polycomb proteins; and so forth.

Each embodiment in this specification is to be applied mutatis mutandis to every other embodiment unless expressly stated otherwise.

Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>l (SEQ ID NO:1), <400>2 (SEQ ID NO:2), etc. A summary of sequence identifiers is provided in Table 1. A sequence listing is provided after the claims.

Genes and other genetic material (eg mRNA, constructs etc) are represented in italics and their proteinaceous expression products are represented in non-italicised form. Thus, Suzl2 is an expression product of Suzl2. The term "Suzl2" or "Suzl2" or "Ezh2" or "Ezh2" or "Eed" or "Eed" is used to encompass all functionally analogous homologs, including orthologs and paralogs, isoforms and variants in any species.

As disclosed herein, a genetic screen for mutations that suppress thrombocytopenia in mice has led to the identification of a polycomb protein Suzl2 or the Suzl2 gene as a target for pharmacological or physiological agents useful in modulating the number and/or activity of hematopoietic cells and/or their progenitor cells. When Suzl2 is functionally compromised, the number and/or activity of hematopoietic cells or their progenitor cells is

enhanced. The Examples set out herein describe, inter alia, the isolation and characterisation of a mutation in Suzl2, termed Plt8, identified in a mutagenesis screen performed on sensitized mice that lack the thrombopoietin receptor (c-mpf ' ). As shown in Figure 8, after transplantation of Suzl2 pm/Jr stem cells into lethally irradiated mice these cells show an enhanced ability to repopulate the hematopoietic compartment relative to controls. Total leukocyte and B cell numbers were enhanced over the time period of the study.

The Suppressor of Zeste 12 (Su(Z)] 2) locus was first identified in a genetic screen performed in Drosophila melanogaster to discover factors that repress gene transcription. Flies that lack functional Su(Z) 12 show loss of segment identity, consistent with miss- expression of homeobox (Hox) genes during development (Birve et al, Development, /25:3371-3379, 2001). The spatial and temporal control of Hox gene expression is mediated by Polycomb group (PcG) proteins which act as negative regulators and Trithorax group proteins that promote transcription (Lund et al, Curr. Opin. Cell. Biol., 75:239-246, 2004). Both Polycomb and Trithorax group proteins regulate gene expression through epigenetic modification of DNA and chromatin (Jenuwein et al, Science, 293: 1074- 1080, 2001). Transcriptional repression is typically associated with methylation of cytosine residues in DNA and lysine residues of histone proteins, particularly Lysine 27 and Lysine 9 of Histone-3. Biochemical studies have identified Suzl2 in a multi-protein complex termed Polycomb Repressive Complex 2 (PRC2) that is responsible for methylation of Histone 3 at Lysine 27 (Cao et al, Science, 298: 1039- 1043, 2002; Kuzmichev et al, Genes Dev. 76:2893-2905, 2002). The components of PRC2 are broadly conserved between Drosophila and vertebrates, and include Suzl2, the methyl-transferase Enhancer of Zeste 2 (Ezh2) and various forms of the embryonic ectoderm development protein (Eed) (Cao et al, Curr. Opin. Genet. Dev., 74:155-164, 2004). Reference herein to a polycomb repressive complex polypeptide includes reference to a polycomb protein (PcG).

The human homolog of Su(Z) 12 was identified by two independent groups; first, as a gene disrupted in a translocation common in endometrial stromal tumours (Koontz et al, Proc.

Natl. Acad. Sci. U.S.A., 95:6348-6353, 2001), and second, as a target gene of the E2F family of transcription factors (Weinmann et al, Methods, 26:31 '-47, 2002). Both studies implicate deregulation of PRC2 function in tumorigenesis. Over-expression of both Suzl2 and Ezh2 has been reported in breast, colon and bladder malignancy (Collett et al, Clin. Cancer Res. 72:1168-1174, 2006; Kirmizis et al, MoI. Cancer Then, 2:113-121, 2003; Kleer et al, Proc. Natl. Acad. Sci. U.S.A., 700:11606-11611, 2003; Matsukawa et al, Cancer Sci., 97:484-491, 2006; Saramaki et al, Genes Chromosomes Cancer, ¥5:639-645, 2006; Varambally et al, Nature, ¥79:624-629, 2002).

Murine models of PRC2-defϊciency have demonstrated an absolute requirement for all three components (Suzl2, Ezh2 and Eed) for proper development during embryogenesis (O'Carroll et al, MoI. Cell. Biol., 27:4330-4336, 2001; Pasini et al, Embo. J., 23:4061- 4071, 2004; Shumacher et al, Nature, 353:250-253, 1996). Further investigation of PRC2 function in the adult mouse has therefore been restricted to the use of conditional targeted alleles, which have been generated for Ezh2 (Su et al, Nat. Immunol., 4: 124-131, 2003), and viable hypomorphic alleles that include Eed 1989 (Shumacher et al, 1996 {supra)).

Within the nucleus DNA is packaged around a supportive framework of histones and other proteins collectively referred to as chromatin. Histone proteins carry extensive post- translational modifications that influence the packaging of DNA and the accessibility of DNA sequence to transcription factors (Jenuwein et al, Science, 2001 (supra)). Acetylation of histone proteins is generally associated with regions that are being actively transcribed. Acetylation acts to neutralize the positive charge of lysine residues, thereby reducing the affinity between histone proteins and the phosphate residues in the DNA backbone that carry a negative charge.

The acetylation status of histones is regulated by the opposing activity of Histone Acetyl- Transferases (HATs) and Histone De-Acetylases (HDACs). HDAC-inhibitors (HDACi) represent a diverse group of chemicals that directly inhibit the enzymatic activity of HDACs, resulting in the accumulation of acetylated histones and the general activation of gene transcription (Johnstone, Nat. Rev. Drug Discov., 7:287-299, 2002; Johnstone et al,

Cancer Cell, 4:13-18, 2003; Marks et al, J. Natl. Cancer Inst, P2:1210-1216, 2000). Inhibition of HDACs has been shown to have clinical relevance in the treatment of various forms of leukaemia and also in solid tumours. The administration of HDACi is thought to affect a small subset of genes, rather than causing wholesale changes to gene expression, which may be due to the inability of HDACi to counteract higher-order silencing regulated by additional processes such as DNA-methylation (Peart et al., Proc. Natl. Acad. Sci. U.S.A., 702:3697-3702, 2005).

Suzl2 is a polycomb protein (PcG) that forms an important part of polycomb repressive complexes (PRCs) that repress transcription by modifying chromatin. Accordingly, in a broad aspect, the present invention relates to the discovery that agents that de-repress or enhance gene expression and particularly transcription of genes in HSC and/or their descendants are useful for enhancing the number of HSC and hematopoietic lineage cells derived therefrom. . In some embodiments, the number of myeloid and/or myeloid progenitor cells is enhanced. In other embodiment, the number of lymphoid and/or lymphoid progenitor cells is enhanced. In other embodiments, the number of B-cell progenitor cells and/or B-cells is enhanced. As shown in the present Tables and Examples, levels of myeloid and lymphoid cells and their precursors are elevated in Suzl2 deficient PU8/+ mice. This observation was made primarily in mice that were c-mpV 1' which exhibit thrombocytopenia and which therefore provide a sensitised system for detecting agents which modulate platelet number. In some embodiments, the number of myeloid and/or myeloid progenitor cells is enhanced. In other embodiment, the number of lymphoid and/or lymphoid progenitor cells is enhanced. In other embodiments, the number of B-cell progenitor cells and/or B-cells is enhanced.

In one aspect therefore the specification describes a method of identifying agents that modulate the level or activity of Suzl2 or a complex comprising Suzl2 in vivo wherein the method comprises administering the agent to a genetically modified animal model of thrombocytopenia and monitoring the number and/or activity of platelets in the animal wherein a change in the number and/or activity of platelets in the presence of the agent indicates that the agent is effective in vivo. In some embodiments, the animal is c-mpΫ ' .

In another embodiment, a method of testing or monitoring the effect of an epigenetic modifier agent in a subject is provided, said method comprising administering the agent and monitoring the number and/or activity of platelets in the subject wherein a change in the number and/or activity of platelets as a result of said administration is a measure of the effect of the agent on the subject. In some embodiments the subject is a human or mammalian subject. In other embodiments, the epigenetic modifier modulates the level or activity of a polycomb polypeptide or gene. In some further embodiments, the agent is an inhibitor of the level or activity of Suzl2 or Suzl2. These methods may be especially useful in clinical trials where the efficacy of an agent is under scrutiny and/or where a large number of subjects is monitored.

In some embodiments, the agent is a demethylating agent, a histone de-acetylase inhibitor or a histone acetyl-transferase mimic. Without being bound to any particular theory or mode of action, it appears that the Suzl2 mutation or modification provides de-repressed transcription through reducing chromatin methylation. Demethylating agents are also expected to facilitate de-repression of transcription. Similarly, acetylation of chromatin, for example by histone acetyl transferases mimics, or by inhibition of histone de-acetylases by histone de-acetylase inhibitors is expected to de-repress transcription.

In other embodiments, down regulation of the level or activity of one of more PRCs or other members of the network of interacting molecules to which Suzl2 belongs is useful in modulating, and particularly enhancing, the number or activity of hematopoietic cells and/or their progenitor cells. In still further embodiments, the agents described herein modulate the level or activity of PRC2 target genes or their expression products.

The present invention provides, therefore, in some embodiments, methods of modulating the number and/or activity of hematopoietic cells and/or their progenitor cells. In some embodiments, the methods comprise down regulating the level or activity of one or more PRC polypeptides, PcG or other members of the network of interacting molecules to which Suzl2 belongs. In other embodiments, the level or activity of a target of a PRC is modulated. In some embodiments, the PRC complex is PRCl. In other embodiments, the PRC complex is PRC2/3. In other embodiments, the number of myeloid progenitor cells is

enhanced. In further embodiments, the number of lymphoid progenitor cells is enhanced. In other embodiments, the number of leukocytes is enhanced.

In some embodiments, the agent down regulates the level or activity of Suzl2 polypeptide or the Suzl2 gene. The Plt8 mutation is a dominant mutation that shows its phenotypic effect in heterozygous form. Accordingly, Suzl2 or Suzl2 is a particularly attractive target for the development of pharmaceutical compositions that inhibit Suzl2 function or activity. Specifically, such agents are useful in the manufacture of medicaments that effectively down modulate gene expression within hematopoietic progenitor cells.

Without being bound to any particular mode of action or theory, PcGs effect transcriptional repression by modifying histone proteins. In the present invention, reduced Suzl2 levels or activity leads to de-repression of transcription in hematopoietic cells or their precursors and enhanced activity and/or proliferation of these cells. This is unexpected in view of the teachings of the prior art which indicate that down regulation of Suzl2 is useful in the treatment of cancer by inhibition of proliferation. Reference to "enhancing the activity of hematopoietic cells and/or their precursors" encompasses enhancing lineage commitment and/or differentiation into a particular blood cell type.

Reference to the "activity of PRC or PcG proteins" means the functional activity of one or more PRC proteins or PcG in modulating gene expression via a cascade of reactions encompassing one or more modes of action such as, without limitation: methylation, demethylation, acetylation, deacetylation, ubiquitylation, phosphorylation, dephosphorylation, methyltransferase activity, protein-, nucleic acid- and nucleosome- binding. Further, the activity of PRC proteins or PcG proteins may be reduced by modulating the level or activity of nucleic acid molecules encoding one or more PRC proteins using strategies known in the art and/or described further herein.

In some embodiments, the methods comprise administering to a mammalian subject, or contacting cells therefrom, with an agent that down regulates the level or activity of one or more polycomb group proteins (PcG) or polycomb repressive complexes (PRC) or other

members of the network of interacting molecules to which Suzl2 belongs, or their encoding nucleic acid molecules. PcG and PRC polypeptides include Suzl2, Ezh2 and Eed and functional homologs thereof.

In another aspect, the present invention is to be understood to encompass methods of modulating the level or activity of hematopoietic progenitor cells comprising contacting cells with an effective amount of an agent that up-regulates the level or activity of a gene to which PRCl or PRC2/3 binds. In some embodiment, the gene activity is transcriptional or translational activity. In other embodiments, the agent is provided together with an agent that down regulates the level or activity of PRCl and/or PRC2/3. In other embodiments, small molecules are determined that interact with the expression product/s of genes to which PRC polypeptides bind.

A number of agents including cytokines and pharmacological agents such as antisense molecules or small peptide or non-peptide inhibitors may be envisaged by the skilled artisan that are capable of down regulating the level or activity of PRC or up-regulating the level or activity of PRC target genes.

In another form, the present invention provides for the use of PRC inhibitors in the treatment or prevention of conditions associated with thrombocytopenia. In another embodiment, the invention provides for the use of these agents in the preparation of a medicament for the treatment or prophylaxis of thrombocytopenia. In other embodiments, the condition is associated with leukopenia or pancytopenia. In other embodiment, the methods are used to up-regulate the number or activity of progenitor cells. These methods and medicaments may be applied, for example, to enhance HSC function prior to bone marrow transplantation.

In another embodiment, the agent enhances gene expression by modulating the level or activity of components in the PRC pathway, which culminates in chromatin modification and transcriptional repression.

The agents are conveniently in a composition comprising the agent and one or more pharmaceutically acceptable carriers, diluents and/or excipients. The agents may also be used in conjunction with further modulators of the number or activity of hematopoietic stem cells. Consequently, the present invention provides compositions or two- or multi- part pharmaceutical compositions comprising in one embodiment at least one inhibitor of transcriptional repression and one modulator of a transcription factor. In some embodiments, the transcription factor is Myb. In other embodiments, the agent is an inhibitor that reduces the level or activity of Myb transcription factor.

The present invention provides antagonists and agonists of the target molecules identified in accordance with the present invention. In various embodiments, antagonists and agonists may comprise all or part of the target molecules themselves, in genetic or proteinaceous form, or their complementary sequences, chemical analogs, mimetics, sense or antisense molecules including inhibitory RNA-type agents, antibodies, or other molecules in the genetic network to which the target molecules identified by the instant methods belong or their derivatives.

Alternatively, the antagonists or agonists may be synthetic chemicals or natural products identified by screens known in the art. Once a target molecule identified as described herein, a wide range of screening strategies known in the art are available for the identification, production, design and development of antagonists or agonists. The rational design of molecules which interact with an active or binding site of a proteinaceous target molecule may be achieved using the solution or crystal structures of the target and/or target-ligand complexes. Spectroscopic and computer modelling techniques are generally used to determine a solution structure and subsequently the three dimensional structure can be displayed and manipulated using computer enhanced algorithms for the design of agonists or antagonists. In some embodiments, endogenous PRC binding molecules are identified and employed in the present invention. These may be modified from their native form such that one or more binding functions/sites are retained and one or more functional activities are destroyed. Biologically active portions of the subject polypeptides (including peptides, proteins etc) are also characterised by having one or more binding functions/sites

of a reference full length molecule and one or more functional activities thereof or by not having one or more functional/binding activities of the full length reference molecule. As shown herein, a single basis pair deletion in the splice acceptor site of the sixteenth exon of Suzl2 of the Plt8/+ mutant mouse profoundly alters its ability to be active in vivo.

In another aspect, the present invention provides methods of screening or testing for agents useful in modulating the number or activity of hematopoietic cells and/or their progenitor cells. Modified non-human animals and isolated cells comprising a mutation or modification one or more polycomb protein family genes are also provided.

The invention also provides methods of screening or testing subjects for mutations in the Suzl2 gene or one or more genes encoding PRC molecules or their associated regulatory molecules indicative of a particular genetic basis for defects in hematopoiesis such as, without limitation, thrombocytosis, myelofibrosis, thrombocytopenia, leukopenia, progenitor or stem cell defects in the subject.

Any agent that affects the targets identified in the present invention may be employed to modulate the number or activity of hematopoietic cells and/or their progenitors.

The agents and compositions of the present invention include, for example, small or large chemical molecules, peptides, polypeptides including antibodies, modified peptides such as constrained peptides, foldamers, peptidomimetics, cyclic peptidomimetics, proteins, lipids, carbohydrates or nucleic acid molecules including antisense or other gene silencing molecules. Agents may comprise naturally occurring molecules, variants (including analogs) thereof as defined herein or non-naturally occurring molecules or variants thereof.

The above summary is not and should not be seen in any way as an exhaustive recitiation of all embodiemtns of the present invention.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is a graphical representation showing the isolation of two dominant mutations that suppress thrombocytopenia. Platelet counts of Gi progeny are shown for two ENU- treated males 2019 and 2026, and for control c-mpl 'A mice that were not treated with ENU. Offspring with platelet counts above 300 x lOVml (marked by arrows) were thought to carry a mutation that suppressed thrombocytopenia and were selected for progeny testing.

Figure 2 is a graphical representation of data showing the results of F 2 -mapping. The PU8 mutation is located on mouse chromosome 11. (A) Mice that carried C57BL/6 DNA on chromosome 11 (designated 'PU8/+ ', grey bar) were found to have a higher mean platelet count than a control F 2 population, or mice homozygous 129/Sv ('+/+', black bar). (B)

Mendelian inheritance suggests that one quarter of F 2 offspring (frequency of 0.25) should be homozygous C57BL/6 at any given SSLP marker. No mice were homozygous C57BL/6 at a number of markers on chromosome 11 indicating that the PU8 mutation is homozygous lethal.

Figure 3 is a graphical representation of the fine mapping strategy undertaken to localize the PU8 mutation and to further reduce the candidate interval. Specifically, F 2 mice were genotyped with additional polymorphic microsatellite markers on chromosome 11. In all 531 F 2 mice were used in this study. Progeny testing confirmed that mice which carry C57BL/6 at this point in the genome carry a mutation which results in high platelet counts. Furthermore, no mice were found to be homozygous C57BL/6 over the interval between CAR28 and CAR48, suggesting the presence of a mutation that is homozygous lethal.

Figure 4 is a representation of data showing that the PU8 mutation is a single base pair deletion in Suzl2. A schematic representation of the Suzl2 locus is shown; an arrow marks the position of the mutation. The mutation is a single base pair deletion upstream of the last coding exon of Suzl '2, which disrupts the splice acceptor site of exon 16. The loss of a single guanine nucleotide (g) is evident when sequence was analysed from mice that were heterozygous for the Plt8 mutation.

Figure 5 is a representation of data showing that the Plt8 mutation alters splicing ofSuzl2. (A) is a schematic representation of the Suzl2 locus showing intron and exon structure. Below is a representation of the RT-PCR strategy to the expected product sizes. (B) Primers were designed to flank the site of the mutation (indicated with a vertical arrow) and to amplify a region upstream of sites of the mutations as a control. RT-PCR was performed on cDNA prepared from bone marrow and spleen. An aberrantly spliced product was identified in mice carrying the Plt8 mutation (top arrow) that was not identified in wildtypes. Products of the expected size (bottom two arrows) were obtained when an amplicon was targeted at exon 13 and exon 14, suggesting that processing of the message was not affected upstream of the mutation. (C) Protein lysates were prepared from embryos at E12.5. Western blotting demonstrated reduced protein expression of Suzl2 in heterozygous mice. Akt and histone 3 (H3) were used as loading controls.

Figure 6 is a graphical representation (A) and photographic representation (B) showing enhanced progenitor cell formation in Suzl2 p " 8/+ mice. Bone marrow was injected into irradiated recipients and CFU-spleen colonies were enumerated after twelve days. Suzl2 p " 8/+ mice (open bar) had significantly more colonies (p<0.005) compared to wildtype littermates. A representative photograph of recipient spleens is shown (at B). (n = 4, 5 recipients were tested for each donor).

Figure 7 is a photographic representation (A) showing protein expression and a graphical representation (B) showing gene expression in GlME hematopoietic cells (Stachura et al Blood, 107 (l):87-97, 2006). GlME cells were infected with retroviral constructs that direct expression of short hairpin RNAs (shRNAs) that have been designed to reduce expression of PRC components. The megakaryocy e cell line GlME was used as a model system to study changes in gene expression that are associated with reduced PRC2 function in hematopoietic cells. GlME cells were infected with various retroviral constructs that direct expression of short hairpin RNAs (shRNAs) that have been designed to reduce expression of a target gene (Suzl2, Ezh2 or Eed). A scrambled sequence (NONS) and the empty vector (LMP) were used as controls. Cells were maintained in puromycin, a

drug that will selectively kill cells that have not been infected with the retrovirus. A western blot (A) was performed to monitor protein expression in transfected GlME cells, specific primary antibodies were used to measure the level of Suzl2, Ezh2, ERK 1/2, Histone 3 Lysine 27 tri-methylation (H3-K27-3Me) and total Histone 3 (H3-total). Quantitative real-time PCR was performed using primers specific for Suzl2, Ezh2 and Eed, and expression of these genes was measured relative to Hprtl (B). In each case expression was compared to the NONS control and significant differences in expression are highlighted (* = p<0.05, ** = pO.Ol, *** = PO.001).

Figure 8 is a graphical representation showing the results of competitive transplantation studies performed to test the ability of Suzl2 Plt8/+ stem cells to repopulate the hematopoietic compartment of lethally irradiated recipients. Irradiated recipient mice (Ly5.1 + ) were transplanted with an equal number of bone marrow cells from a test marrow (Ly5.2 + ) and competitor marrow (Ly5.1 + ). In total 2 xlO 6 cells were injected into each recipient. In each case the competitor marrow shared the same MpI genotype as the test marrow. Data shown represent the ratio of Ly5.2/Ly5.1 in total leukocytes, B cells, T cells and myeloid cells (GrlMacl). If the test marrow and competitor marrow show equivalent contribution, the ratio should equal 1. Here, the mutant cells show a greater contribution (ratios above 1), and the difference between MpI ' ' " Suzl2 plt8/+ and Mpl ~;' Suzl2 +/+ marrow is significant in both total cells and in the B-cell lineage. The same trend is evident in MpI+/+ samples. Each column is representative of 3-4 individual test marrows, that had been transplanted into ~5 recipients each. * denotes significance (pO.Ol).

Figure 9 is a graphical representation of sequence data. DNA was extracted from PLT8 mice with elevated platelet counts for sequence analysis. A single base pair deletion was identified in heterozygous mice (Suzl2 Plt8/+ ) and in homozygous tissue obtained from embryos (Suzl2 p " 8/Plt8 ) (large arrow). The deletion disrupts the splice acceptor site upstream of exon 16.

Figure 10 is a photographic representation of Western blotting data showing protein expression levels in lysates prepared from sex-matched mouse embryos (E12.5). Suzl2

and Ezh2 protein levels were reduced in Suzl^ h8/Jr embryos. Suzl2 protein levels were equivalent in Suzl2 P t8 + embryos and embryos heterozygous for the genetrap allele (Suzl2 502gt/+ ). Equivalent amounts of protein were run in each lane, Histone H3 was used to verify equal loading. Western blot signal intensity was quantified using a densitometer; results represent the average of two independent experiments (at right).

Figure 11 is a graphical representation showing enhanced CFU-S frequency in bone marrow derived from Suzl2 Pll8/+ mice compared to wildtype littermates. Irradiated recipients received 1.5 xlO 5 nucleated bone marrow cells from c-mpV 1' donors or 7.5 x 10 4 cells from c-mpl +/+ donors. Data represent the mean of 4-6 mice of each genotype and error bars show the standard error of the mean. Statistical significance was assessed using an unpaired t-test.

Figure 12 is a graphical representation of data showing that Suzl2 deficiency enhances progenitory activity. (A) Irradiated recipients (Ly 5.1 + ) were transplanted with an equal number of bone marrow cells from a test animal (Ly5.2 + ) and a wildtype competitor

(Ly5.1 + ). Peripheral blood and other tissues were collected and stained with antibodies to

Ly5.1 + , Ly5.2 + and various lineage markers (e.g. B220, Macl and CD4) to measure the contribution of the test marrow to hematopoiesis. Equal contribution from test and competitor would result in 50% of cells being positive for the Ly5.2 + marker. Suzl2 p " 8/+ cells made a greater contribution than wildtype on both a c-Mpl +/+ and a c-Mpl' ' background. (B) Secondary recipients were analysed three months after transplantation.

Each column is the average of 3-4 test marrows that have been transplanted into 5 recipients. An asterisk denotes statistical significance (p<0.004) corrected for multiple testing.

Figure 13 is a photographic representation showing inhibition of Suzl2 expression by shRNA-mediated silencing in vivo. Bone marrow extracted from 5-FU treated mice was infected with either the LMS-Nons or the LMS-Suzl2 virus and transplanted into recipient mice. Thymocytes were isolated 12 weeks after transplantation and fractionated based upon expression of GFP (+ or -); low or intermediate populations were detected in some

mice (low). Protein lysates were prepared from sorted cells and Western blotting was performed to detect expression of Suzl2, Ezh2 or histone H3. Non-specific bands have been marked (*) and an arrow used to denote residual Suzl2 signal that persisted after the membrane was stripped.

Figure 14 is a graphical representation of data showing that inhibition of Suzl2 by shRNA-mediated silencing elevates HSC contribution to hematopoiesis. (A) Bone marrow extracted from 5-FU treated mice was infected with either the LMS-Nons or the LMS- Suzl2 virus and transplanted into recipient mice. Three independent infections were performed and in each case infected cells were transplanted into five recipient animals. A selection of primary recipients (9-11) were used as donors for secondary transplants, in each case cells were transplanted into 3-5 recipient mice. The frequency of cells that carried the virus (GFP+) was monitored prior to transplantation (input) and 8-12 weeks after transplantation in primary or secondary recipients. (B) To determine the ability of infected cells to contribute to hematopoiesis, the representation of GFP+ cells was compared between donor and recipient populations and a ratio calculated (Recipient GFP%/Donor GFP%). Equal representation in recipient and donor populations would result in a ratio of 1.0. The representation of cells infected with LMS-Suzl2 continued to increase over the course of the experiment, whereas the representation of LMS-Nons cells remained constant. Unpaired t-tests were performed to determine statistical significance.

BRIEF DESCRIPTION OF THE TABLES

Table 1 provides a summary of sequence identifiers.

Table 2 provides an amino acid sub-classification.

Table 3 provides a list of exemplary and preferred amino substitutions.

Table 4 provides a list of non-convention amino acids.

Table 5 provides hematological data for Suzl2 deficient mice on a c-mpl "7" background. Means ± standard deviations are shown. For blood cell data, values were transformed to log ! o, before analysis by student t-test. The threshold of significance (* = p<0.002) was established using the Bonferroni correction for multiple testing. * determined from histological sections with a minimum of 10 high power fields (hpf) counted per mouse.

Table 6 provides hematological data for Suzl2 deficient mice on a c-mpl +/+ background. Means ± standard deviations are shown. For blood cell data, values were transformed to log ! o, before analysis by student t-test. The threshold of significance (* = p<0.002) was established using the Bonferroni correction for multiple testing. " determined from histological sections with a minimum of 10 high power fields (hpf) counted per mouse.

Table 7 provides hematological profile of compound mutants. Means ± standard deviations are shown. For blood cell data, values were transformed to log 10 , before analysis by student t-test. The threshold of significance (* = p<0.0016) was established using the Bonferroni correction for multiple testing.

Table 8 provides the peripheral blood profile of Suzl2 plt8/+ mice. Means ± standard deviations are shown (n=18-30 mice per group). Two-tailed t-tests were performed to determine statistical significance. Comparisons were made between Suzl2 +/+ and

Suzl2 PM/+ genotypes on c-mpV' ' and c-mpl +/+ backgrounds with correction for multiple testing (* p < 0.002).

Table 9 provides peripheral blood profile of Suzl2 plt8/+ and Suzl2 502gt/+ mice. Means ± standard deviations are shown (n=33-55 mice per group). Two-tailed t-tests were performed to determine statistical significance with a correction for multiple testing (* p <

0.002). Comparisons were made between Suzl2 +/+ and Suzl2 502gt/+ mice on a c-mpϊ' ' background. Suzl2 plt8/+ and Suzl2 502gt/+ mice on a c-mpl +/+ background were compared with wildtype littermates. As there is greater variability in blood cell parameters in mice with a mixed genetic background, significance below 0.009 was shown to indicate trends in the data ( λ p < 0.009).

Table 10 provides results of analyses to determine the cytokine responsiveness of progenitors in Suzl2 plt8/+ bone marrow. Data represent the mean and standard deviation of colony numbers in cultures of bone marrow cells, 2.5 xlO 5 cells were plated in each dish (n=3). GM, granulocyte-macrophage colonies; G, granulocyte colonies; M, macrophage colonies, Eo, eosinophil colonies; Meg, megakaryocyte colonies.

Table 11 provides the megakaryocyte progenitor number in c-mpl^ " mice with mutations in both Suzl2 and c-Myb. Data represent the mean and standard deviation of megakaryocyte colony number in cultures of bone marrow, 2.5 xlO 5 cells were plated in each dish. Cultures were prepared from three c-mpT 1' mice of each genotype (except for c- myb plt4/+ Suzl2 +/+ for which two mice were cultured) and were stimulated with SCF/IL- 3/Epo or with IL-3 alone.

Table 12 provides the genes that are up-regulated in GlME cells that express shRNA- Sul2. To identify genes that are regulated by Suzl2 a global analysis of gene expression was performed with GlME cells that expressed shRNA-Suzl2. A large number of genes showed altered expression in Suzl2 knockdown cells when compared to the non-specific control (shRNA-Nons) (194 genes with an adjusted p-value below 0.05). Genes elevated in expression with a fold change >1.8 are listed above.

Table 13 provides the genes that are down-regulated in GlME cells that express shRNA- Sul2. To identify genes that are regulated by Suzl2 a global analysis of gene expression was performed with GlME cells that expressed shRNA-Suzl2. A small number of genes showed reduced expression in Suzl2 knockdown cells when compared to the non-specific control (shRNA-Nons) (14 genes with an adjusted p-value below 0.05). As expected, Suzl2 was identified as one of the transcripts under-represented in the Suzl2 knockdown cells.

Table 14 provides the confirmation of gene expression changes in GlME cells that express shRNA-Sul2. Quantitative real-time PCR (QPCR) was performed on cDNA samples prepared from GlME cells infected with either the LMP-Suzl2 or the LMP-Nons retrovirus. Gene specific primers and probe sets were acquired from Applied Biosystems.

The expression level of Hprtl was used to normalise for sample abundance, and the relative quantification (δδC t ) method was used to compare gene expression between LMS- Suzl2 and the LMS-Nons control.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

Polycomb proteins and complexes comprising them have a role in modifying chromatin to repress gene expression. Disruption of PRC function has been associated with tumorgenesis. Similarly, inhibition of protein deacetylases, which deacetylate histones and represses transcription, is being used as a method for inhibiting cancer cell proliferation.

The present invention is predicated, in part, on the discovery that the number and/or activity of hematopoietic progenitor cells and/or their descendants can be enhanced using physiological or pharmacological agents that de-repress (or enhance) gene expression in these cells.

The term "PRC polypeptide" or "PRC protein" is a polypeptide or protein that binds to and forms part of a PRC. The term also encompasses the expression products (polypeptide) of PRC-target genes. That is, those polypeptides whose level or activity is specifically regulated by the activity of PRC polypeptide in hematopoietic cells, such as GIME cells. Exemplary PRC members include the PcG proteins Suzl2, Ezh2 and Eed. These proteins are mammalian homologs of Drosophilia proteins Su(Z) 12, E(Z) and Esc, respectively

Before describing the present invention detail, it is to be understood that unless otherwise indicated, the subject invention is not limited to specific formulations of components, manufacturing methods, dosage regimens, or the like, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

The terms "compound", "active agent", "pharmacological agent" or "physiological agent", "medicament", "agent" and "drug" are used to refer to a chemical compound that induces a desired pharmacological and/or physiological effect. The terms also encompass pharmaceutically acceptable and pharmacologically active ingredients of those active agents specifically mentioned herein including but not limited to salts, esters, amides, prodrugs, active metabolites, analogs and the like. When the terms "compound", "active agent", "pharmacologically active agent", "medicament", "active" and "drug" are used,

then it is to be understood that this includes the active agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, enantiomers, metabolites, analogs, etc. The term "agent" is not to be construed as a chemical compound only but extends to peptides, polypeptides and proteins as well as genetic molecules such as RNA, DNA and chemical analogs thereof. The term "modulator" is an example of an "agent, pharmacologically active agent, medicament, active and drug which modulates the number or activity of hematopoietic cells and/or their progenitors. The term "prodrug" includes variants that are converted in vivo into the agents of the invention. The term prodrug also encompasses the use of fusion or attached proteins or peptides comprising cell-permeant proteins or peptides. These agents enhance transport or agents across cellular membranes and include membrane permeable sequence, the tat peptide and antennapedia (penetratin).

An "effective amount" means an amount necessary to at least partially attain the desired response. An effective amount for a human subject lies in the range of about 0.1 ng/kg body weight/dose to lg/kg body weight/dose. In some embodiments, the range is about lμ to Ig, about lmg to Ig, lmg to 500mg, lmg to 250mg, lmg to 50mg, or lμ to lmg/kg body weight/dose. Dosage regimes are adjusted to suit the exigencies of the situation and may be adjusted to produce the optimum therapeutic dose. For example, several doses may be provided daily, weekly, monthly or other appropriate time intervals. The subject agents may be used neat however, typically, subject agents are formulated as pharmaceutical compositions at a concentration of about 0.1mg/m to 100mg/ml, such as 1 to 10mg/ml. Formulations comprising lOmg of active ingredient or more broadly O.lmg to 200mg per tablet are suitable representative dosage forms.

The term "gene" is used in its broadest sense and includes cDNA corresponding to the exons of a gene. Reference herein to a "gene" is also taken to include:- (i) a classical genomic gene consisting of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. introns, 5'- and 3'- untranslated sequences); or

(ii) mRNA or cDNA corresponding to the coding regions (i.e. exons) and 5'- and 3'- untranslated sequences of the gene.

Reference herein to the term "progenitor cell" or "precursors" and the like encompass undifferentiated hematopoietic stem cell and any one or more of the blood cell types which arise from HSC. The term refers to multipotent cells as well as the various different forms of myeloid- or lymphoid-restricted cells that ultimately give rise to fully differentiated mature blood cells. In adults, HSC reside in the bone marrow, peripheral blood, lung, liver, spleen and other organs. HSC are the first in a hierarchy of progenitor cells. They are capable of long-term self renewal (long term (LT)-HSCs). LT-HSCs differentiate into short-term multipotent HSCs, (ST-HSCs) that retain the ability to produce all blood types but only proliferate for a relatively short time. Next, lymphoid progenitors arise that ultimately produce immune cells, and myeloid progenitors arise that ultimately produce mainly red blood cells and platelets and some innate immune cells. These progenitor cells have various abilities to proliferate and differentiate and from these cells ultimately arise terminally differentiated cells. Accordingly, reference to HSC and hematopoietic progenitors include all the above mentioned progenitor cells and reference to hematopoietic or blood cells include any of their terminally differentiated descendants. These include without limitation: HSC, hematopoietic stem cell; CLP, common lymphoid precursor; CMP, common myeloid precursor; GMP, granulocyte-macrophage precursor; MEP, megakaryocyte-erythroid precursor; CFU-GM, colony forming unit- granulocytic/macrophage; CFU-G, colony forming unit-granulocytic; CFU-M, colony forming unit-macrophage; CFU-Mk, colony forming unit-megakaryocytic; BFU-e, Burst- forming unit erythroid; and CFU-E, colony forming unit-erythroid cells.

Reference to "modulating", "modulated" or "modulator" and the like includes down modulating, inhibiting antagonising, decreasing or reducing and up modulating, increasing, potentiating, agonising, prolonging, stimulating or enhancing as well as agents that have this effect.

Any subject who could benefit from the present methods or compositions is encompassed. The term "subject" includes, without limitation, humans and non-human primates, livestock animals, companion animals, laboratory test animals, captive wild animals, reptiles and amphibians, fish, birds and any other organism. The most preferred subject of the present invention is a human subject. A subject, regardless of whether it is a human or non-human organism may be referred to as a patient, individual, subject, animal, host or recipient.

In one embodiment, the present invention provides a method of modulating the number and/or activity of hematopoietic cells or their progenitors in a subject, the method comprising administering to the subject an effective amount of an agent that inhibits the activity of histone deacetylases. In some embodiments, histone deacetylase inhibitors are used in conjunction with further additional agents described herein such as, for example, demethylating agents.

Protein deacetylase inhibitors may be selected from the group comprising; short chain fatty acids such as butyric acid, valproic acid, and sodium acid phenybutyrate; hydroxamic acids such as SAHA, oxamflatin and TSA; cyclic tetrapeptides such as depipeptide and apicidin; benzamides such as MS-275; ketones such as trifluoromethyl kentone and miscellaneous agents such as depudecin.

Any subject or animal that could benefit from the present methods or compositions is encompassed. The term "subject" includes, without limitation, humans and non-human primates, animals, livestock animals, companion animals, laboratory test animals, captive wild animals, reptiles and amphibians, fish, birds etc. The most preferred subject of the present invention is a human subject. A subject, regardless of whether it is a human or non- human organism may be referred to as a patient, individual, subject, animal, host or recipient.

Reference to modulating the "activity" of a target (including for example, a peptide, polypeptide, nucleic acid or cell) includes reference to the level or number of

molecules/cells or the concentration of the target or the functional activity of the target or cell.

The activity of a polypeptide may be enhanced by increasing the level of transcription or translation of an encoding DNA or RNA. The activity of a polypeptide may also be decreased by reducing the level of transcription or translation such as by inhibiting promoter or enhancer activity or by the use of antisense/iRNA strategies now routine in the art. Accordingly, in some embodiments, the level of one or more PRC polypeptides in hematopoietic cells may be modulated by administering agents from which the polypeptide or its regulators are producible, such as a genetic construct encoding a functional form of the polypeptide. In another embodiment, the genetic construct encodes a regulator of expression of the target polypeptide such as an antisense molecule, iRNA, shRNA promoter or repressor or enhancer. Those skilled in the art to which the present invention pertains will appreciate that a large number of strategies are available for delivering genetic constructs or polypeptide/peptide constructs to within a cell for modulating the activity of a polypeptides or of a portion of nucleic acid in a cell.

The terms "genetic material", "genetic construct" "genetic forms", "nucleic acids", "nucleotide" and "polynucleotide" include RNA, cDNA, genomic DNA, synthetic forms and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog (such as the morpholine ring), internucleotide modifications such as uncharged linkages (e.g. methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g. phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g. polypeptides), intercalators (e.g. acridine, psoralen, etc.), chelators, alkylators and modified linkages (e.g. α-anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen binding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.

The present invention further contemplates recombinant nucleic acids including a recombinant construct comprising all or part of a gene encoding a PRC polypeptide or a functional variant thereof. The recombinant construct may be capable of replicating autonomously in a host cell. Alternatively, the recombinant construct may become integrated into the chromosomal DNA of the host cell. Such a recombinant polynucleotide comprises a polynucleotide of genomic, cDNA, semi-synthetic or synthetic origin which, by virtue of its origin or manipulation: (i) is not associated with all or a portion of a polynucleotide with which it is associated in nature; (ii) is linked to a polynucleotide other than that to which it is linked in nature; or (iii) does not occur in nature. Where nucleic acids according to the invention include RNA, reference to the sequence shown should be construed as reference to the RNA equivalent with U substituted for T. Such constructs are useful to elevate PRC levels or to down-regulate the level of one or more PRC polypeptides such as via antisense means or RNAi-mediated gene silencing. As will be well known to those of skill in the art, such constructs are also useful in generating animal models and cells carrying modified alleles of genes encoding PRC polypeptides. Such animals and cells and compositions comprising them are discussed briefly towards the end of the description. Other recombinant constructs include sequences comprising PRC-target gene sequence i.e. comprising all or part of a gene encoding the expression products of a PRC-target gene. In some embodiments such targets encode transcriptional repressors or enhancers.

As known to those of skill in the art, antisense polynucleotide sequences are useful agents in preventing or reducing the expression of RNAs. Alternatively, morpholines may be used as described by Summerton et al. (Antisense and Nucleic acid Drug Development, 7: 187- 195, 1997). Antisense molecules may interfere with any function of a nucleic acid molecule. The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site

of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. One preferred result of such interference with target nucleic acid function is modulation of the expression of a PRC gene or a PRC -target gene.

While one form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded short hairpin RNA (dsRNA) molecules such as stem-loop RNAs and microRNA-30 based shRNAs have been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. See, for example, Chen et al (2007) and Dickins et al, Nature Genetic 37(11): 1289-1295, 2005 which also describes genome wide libraries of rationally designed shRNAs.

In the context of the subject invention, the term "oligomeric compound" refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases. Typically, nuclease-resistant phosphorothioates that hybridise to nucleotides within the open reading frame of a PcG or a PRC mRNA will induce RNAseH-mediated degradation. As exemplified herein, antisense RNA selected to inhibit one or more of Suzl2, Ezh2 and Eed effectively down regulates the production of the encoded polypeptide in hematopoietic cells.

The genetic agents or compositions in accordance with this aspect of the invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80

linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.

The agents of the present invention in some embodiments comprise Suzl2 or a functional fragment or functional variant thereof, or in genetic form a Suzl2 gene or a functional part or functional variant thereof or complementary forms of these. In other embodiments, the agents comprise Ezh2 or Eed or function fragments or functional variants thereof or complementary forms thereof.

The present invention provides a composition comprising Suzl2 or Suzl2 (ie the molecule in genetic or proteinaceous form) or a functional variant thereof which substantially reduces the activity of Suz 12 or Suzl2 for use in enhancing the number and/or activity of hematopoietic cells and/or their precursors. Compositions may be designed for ex vivo or in vivo applications. In other embodiments, the compositions comprise Ezh2 or Eed or Ezh2 or Eed or a functional variant of either of these, which substantially reduces the activity of Ezh2 or Eed polypeptides or Ezh2 or Eed genes for use in enhancing the number and/or activity of hematopoietic cells and/or their precursors.

The modulatory agents of the present invention may be chemical agents such as a synthetic or recombinant molecules, polypeptides, peptides, modified peptides or proteins, lipids, glycoproteins or other naturally or non-naturally occurring molecules, variants, derivatives or analogs thereof. Alternatively, genetic agents such as DNA (gDNA, cDNA, PNA), RNA (sense RNAs, antisense RNAs, mRNAs, tRNAs, rRNAs, small interfering RNAs (siRNAs), ShRNAs, micro RNAs (miRNAs), small nucleolar RNAs (SnoRNAs, small nuclear (SnRNAs)) ribozymes, aptamers, DNAzymes or other ribonuclease-type complexes may be employed.

Agents in accordance with this aspect of the invention may directly interact with Suzl2. Here, for example, antibodies or antigen binding fragments, peptides, modified peptides, oligosaccharides, foldamers, peptidomimetics or analogs, synthetic or naturally occurring small or intermediate molecules and other such molecules may be conveniently employed. Alternatively, as mentioned above genetic mechanisms are used to indirectly modulate the activity of hematopoietic progenitor cells. Genetic mechanisms include gene silencing approaches as well as gene expression approaches to endogenously produce the present agents such as peptides, polypeptides and nucleic acid molecules.

Aptamers are also contemplated as exogenous agents. RNA and DNA aptamers can substitute for monoclonal antibodies in various applications (Jayasena, Clin. Chem., 45(9):1628-1650, 1999; Morris et al, Proc. Natl. Acad. ScL, USA, P5(6):2902-2907, 1998). Aptamers are nucleic acid molecules having specific binding affinity to non-nucleic acid or nucleic acid molecules through interactions other than classic Watson-Crick base pairing. Aptamers are described, for example, in U.S. Pat. Nos. 5,475,096; 5,270,163; 5,589,332; 5,589,332; and 5,741,679. An increasing number of DNA and RNA aptamers that recognize their non-nucleic acid targets have been developed using a SELEX (Synthetic Evolution of Ligands by Experimental enrichment) and have been characterized (Gold et al, Annu. Rev. Biochem., 64:763-797.1995; Bacher et al, Drug Discovery Today, J(6):265-273, 1998).

In some embodiments, as discussed above, agents which modulate the level or activity of Suzl2 genes or Suzl2 polypeptides may be derived from Suzl2 or Suzl2 or be variants of Suzl2. Alternatively, they may be identified in in vitro or in vivo screens. Natural products, combinatorial synthetic organic or inorganic compounds, peptide/polypeptide/protein, nucleic acid molecules and libraries or phage or other display technology comprising these are all available to screen or test for suitable agents. Natural products include those from coral, soil, plant, or the ocean or antarctic environments.

Various domains of PRC family members may be specifically targeted or screened, such as the VEFS box required for interaction between at least Suzl2 and Ezh2, or a zinc-finger binding motif.

In some embodiments, the agent to be tested is contacted with a system comprising a PcG or PRC protein genetic sequence. Then, the following may be assayed for: the presence of a complex between the agent and the target, a change in the activity of the target, or a change in the level of activity of an indicator of the activity of the target. Competitive binding assays and other high throughput screening methods are well known in the art and are described for example in International Publication Nos. WO 84/03564 and WO 97/02048.

In some embodiments, the present agents inhibit enzymes required for PRC or Suzl2 function or activity. As shown by Tan et al (2007) chemical inhibition of the methyl donor required for PRC2 function or activity is an effective method of reducing PRC2 function. In some embodiment, the agents inhibit s-adenosylhomocysteine hydrolase. In other embodiments, the agent is 3-Deazaneplanocin A (DZNep, NSC 617989).

High-throughput screening protocols are now routinely used to identify agents such as those contemplated herein and include those described in Geysen (International

Publication No. WO 84/03564). Briefly, large numbers of, for example, small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface.

Bound polypeptide is detected by various methods. A similar method involving peptide synthesis on beads, which forms a peptide library in which each bead is an individual library member, is described in U.S. Patent No. 4,631,211 and a related method is described in International Publication No. WO 92/00091. A significant improvement of the bead-based methods involves tagging each bead with a unique identifier tag, such as an oligonucleotide or electrophoretic tag, so as to facilitate identification of the amino acid sequence of each library member. These improved bead-based methods are described in International Publication No. WO 93/06121.

Another chemical synthesis screening method involves the synthesis of arrays of peptides (or peptidomimetics) on a surface wherein each unique peptide sequence is at a discrete, predefined location in the array. The identity of each library member is determined by its spatial location in the array. The locations in the array where binding interactions between a predetermined molecule and reactive library members occur is determined, thereby identifying the sequences of the reactive library members on the basis of spatial location. These methods are described in U.S. Patent No. 5,143,854; International Publication Nos WO 90/15070 and WO 92/10092; Fodor et al, Science, 257:767, 1991. Of particular use are display systems, which enable a nucleic acid to be linked to the polypeptide it expresses. Selection protocols for isolating desired members of large libraries are known in the art, as typified by phage display techniques. Such systems, in which diverse peptide sequences are displayed on the surface of filamentous bacteriophage, are useful for creating libraries of antibody fragments (and the nucleotide sequences that encoding them) for the in vitro selection and amplification of specific antibody fragments that bind a target antigen. The nucleotide sequences encoding the V H and V L regions are linked to gene fragments which encode leader signals that direct them to the periplasmic space of E. coli and the resultant antibody fragments are displayed on the surface of the bacteriophage, typically as fusions to bacteriophage coat proteins (e.g., pill or pVIII). Alternatively, antibody fragments are displayed externally on lambda phage capsids (phage bodies). An advantage of phage-based display systems is that selected library members can be amplified simply by growing the phage containing the selected library member in bacterial cells. Furthermore, since the nucleotide sequence that encode the polypeptide library member is contained on a phage or phagemid vector, sequencing, expression and subsequent genetic manipulation is relatively straightforward. Corresponding technologies are applied to combinatorial libraries of small organic molecules.

Antibodies including anti-idiotypic antibodies, chaemeric antibodies and humanised antibodies and antigen binding fragments thereof are useful agents for down regulating specific targets in a cell. Antibodies that down regulate histone methylation or acetylation are contempled. Antibodies that down regulate the level or activity Suzl2 or a PRC complex comprising Suzl2 are also contemplated in some embodiments. PRC function

may be down regulated by interfering with PRC-histone interactions, such as the ability of PRC components to methylate histone proteins. In some embodiments variant histone proteins that lack K(lysine)27 will bind to PRC2 but are not able to be methylated by PRC- mediated reactions and will therefore competivively inhibit PRC function. In other embodiments, agents such as antibodies that interfere with PRC2-histone binding as specific epitopes provide specific inhibition of PRC function. In this regard antibodies and other agents are particularly preferred which are capable of traversing biological membranes to gain access to intracellular and intravesicular portions of the cell. The term "antibody" is used in the broadest sense and specifically covers single monoclonal antibodies and antibody compositions with polyepitopic specificity. The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The monoclonal antibodies herein include hybrid and recombinant antibodies produced by splicing a variable (including hypervariable) domain of an antibody, such as an anti-Suzl2 or anti-PRC2 antibody with a constant domain (e.g. "humanized" antibodies), or a light chain with a heavy chain, or a chain from one species with a chain from another species, or fusions with heterologous proteins, regardless of species of origin or immunoglobulin class or subclass designation, as well as antibody fragments (e.g., Fab, F(ab').sub.2, and Fv), so long as they exhibit the desired biological activity. See, e.g. U.S. Pat. No. 4,816,567 and Mage and Lamoyi, in Monoclonal Antibody Production Techniques and Applications, pp. 79-97 (Marcel Dekker, Inc.: New York, 1987). Thus, the modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler and Milstein, Nature, 256:495 (1975), or may

be made by recombinant DNA methods. U.S. Pat. No. 4,816,567. The "monoclonal antibodies" may also be isolated from phage libraries generated using the techniques described in McCafferty et al, Nature, 348:552-554 (1990), for example.

"Humanized" forms of non-human (e.g. murine) antibodies are specific chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, the humanized antibody may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.

The three-dimensional structure of Suzl2 or a PRC polypeptide or a PRC binding molecule or an expression product of a PRC-target gene facilitates the design of binding agents that de-repress transcription to enhance the number or activity of hematopoietic cells and/or their progenitor cells. Three-dimensional representations of the structure of one or more binding sites of, for example, Suzl2, Eed or Ezh2 or a variant, derivative or analog of either or these molecules to identify interacting molecules that, as a result of their shape, reactivity, charge potential etc. favourably interacts or associate. In a preferred aspect, the skilled person can screen three-dimensional structure databases of compounds

to identify those compounds having functional groups that will fit into one or more of the binding sites. Combinational chemical libraries can be generated around such structures to identify those with high affinity binding to PRC binding sites. Agents identified from screening compound databases or libraries are then fitted to three-dimensional representations of PRC binding sites in fitting operations, for example, using docking software programs.

A potential modulator may be evaluated "in silico" for its ability to bind to a PRC active site prior to its actual synthesis and testing. The quality of the fit of such entities to binding sites may be assessed by, for example, shape complementarity by estimating the energy of the interaction. (Meng et al., J. Comp. Chem., 75:505-524, 1992).

The design of chemical entities that associate with components of PRC generally involves consideration of two factors. The compound must be capable of physically and structurally associating with PRC members. Non-covalent molecular interactions important in the association of PRC members with their interacting partners include hydrogen bonding, van der Waal's and hydrophobic interactions. Second, the compound must be able to assume a conformation that allows it to associate with a PRC polypeptide. Although certain portions of the compound will not directly participate in this association with PRC, those portions may still influence the overall conformation of the molecule. Such conformation requirements include the overall three-dimensional structure and orientation of the chemical entity or compound in relation to all or a portion of the active site, or the spacing between functional groups of a compound comprising several chemical entities that directly interact with a PRC member. Similar considerations apply to design of agents that interact with the expression products of PRC-target genes.

Once a binding compound has been optimally selected or designed, as described above, substitutions may then be made in some of its atoms or side groups in order to improve or modify its binding properties. Generally, initial substitutions are conservative, i.e. the replacement group will have approximately the same, size, shape, hydrophobicity and

charge as the original group. It should of course, be understood that components known in the art to alter conformation should be avoided.

Putative binding agents may be computationally evaluated and designed by means of a series of steps in which chemical entities or fragments are screened and selected for their ability to associate with the one or more binding sites. Selected fragments or chemical entities may then be positioned in a variety of orientations, or "docked," to target binding sites. Docking may be accomplished using software, such as QUANTA and SYBYL, followed by energy minimization and molecular dynamics with standard molecular mechanics force fields, such as CHARMM or AMBER. Specialised computer programs may be of use for selecting interesting fragments or chemical entities. These programs include, e.g., GRID (Oxford University, Oxford, UK) 5 MCSS (Molecular Simulations, USA) AUTODOCK (Scripps Research Institute, USA) DOCK (University of California, USA) and XSITE (University College of London, UK) and CATALYST (Accelrys).

Useful programs to aid the skilled addressee in connecting chemical entities or fragments include CAVEAT (University of California, USA), 3D database systems and HOOK (Molecular Simulations, USA) De-novo ligand design methods include those described in LUDI (Molecular Simulations, USA), LEGEND (Molecular Simulations, USA), LeapFrog (Tripos Inc.,) SPROUT (University of Leeds, UK) and the like.

Structure based ligand design is well known in the art and various strategies are available that can build on structural information to determine ligands which effectively modulate the components of PRC. Molecular modelling techniques include those described by Cohen et al, J. Med. Chem., 33:883-894, 1990, and Navia et ah, Current Opinions in Structural Biology, 2:202-210, 1992.

Standard homology modelling techniques may be employed in order to determine the unknown three-dimensional structure or molecular complex. Homology modelling involves constructing a model of an unknown structure using structural coordinates of one or more related protein molecules, molecular complexes or parts thereof. Homology

modelling may be conducted by fitting common or homologous portions of the protein whose three-dimensional structure is to be solved to the three-dimensional structure of homologous structural elements in the known molecule. Homology may be determined using amino acid sequence identity, homologous secondary structure elements and/ or homologous tertiary folds. Homology modelling can include rebuilding part or all of a three-dimensional structure with replacement of amino acid residues (or other components) by those of the related structure to be solved.

Using such a three-dimensional structure, researchers identify putative binding sites and then identify or design agents to interact with these binding sites. These agents are then screened for a modulatory effect upon the target molecule.

In some embodiments, binding agents are designed with a deformation energy of binding of not greater than about 10 kcal/mole, more preferably not greater than 7kcal/mole. Computer software is available to evaluate compound deformation energy and ectrostatic interactions. For example, Gaussian 98, AMBER, QUANTA, CHARMM, INSIGHT II, DISCOVER, AMSOL and DelPhi.

Libraries of small organic molecules can be generated and screened preferably using high- throughput technologies known to those of skill in this area. See for example US Patent No. 5,763,263 and US Application No. 20060167237. Combinatorial synthesis provides a very useful approach wherein a great many related compounds are synthesised having different substitutions of a common or subset of parent structures. Such compounds are usually non-oligomeric and may be similar in terms of their basic structure and function,- varying in for example chain length, ring size or number or pattern of substitutions. Virtual libraries may also, as mentioned above, be constructed and compounds tested in silico (see for example, US Application No. 20060040322) or in vitro or in vivo assays known in the art.

In another aspect, agents are derived from genetic sequences encoding PRC, PcG or PRC- target gene products or their complementary forms. In relation to nucleotide sequences of

PRC genes or PRC -target genes, the terms functional form or variant, functionally equivalent derivative or homolog include molecules that selectively hybridize to PRC genes or PRC -target genes or a complementary form thereof over all or part of the genetic molecule under conditions of medium or high stringency at a defined temperature or range of conditions, or which have about 60% to 80% sequence identity to the nucleotide sequence defining PRC genes or PRC-target genes.

Illustrative PRC nucleotide sequences include those comprising nucleotide sequences set forth in SEQ ID NO: 1 or 3 (mouse or human Suzl2 mRNA). For the avoidance of doubt however, it should be noted that the term "Suzl2 gene" expressly encompass all forms of the gene including regulatory regions such as those required for expression of the coding sequence and genomic forms or specific fragments including probes and primers, antisense molecules and constructs comprising same or parts thereof as well as cDNA or RNA and parts thereof.

Further illustrative PRC nucleotide sequences include those comprising nucleotide sequences set forth in SEQ ID NO: 5 or 7 (mouse or human Ezh2 mRNA). For the avoidance of doubt however, it should be noted that the term "Ezh2 gene" expressly encompass all forms of the gene including regulatory regions such as those required for expression of the coding sequence and genomic forms or specific fragments including probes and primers, antisense molecules and constructs comprising same or parts thereof as well as cDNA or RNA and parts thereof.

Still further illustrative PRC nucleotide sequences include those comprising nucleotide sequences set forth in SEQ ID NO: 9 or 11 (mouse or human Eed mRNA). For the avoidance of doubt however, it should be noted that the term "Eed gene" expressly encompass all forms of the gene including regulatory regions such as those required for expression of the coding sequence and genomic forms or specific fragments including probes and primers, antisense molecules and constructs comprising same or parts thereof as well as cDNA or RNA and parts thereof.

Reference herein to "medium stringency", includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing conditions. In general, washing is carried out T m = 69.3 + 0.41 (G+C)% (Marmur et al, J. MoI. Biol., .5:109, 1962). However, the T n , of a duplex DNA decreases by 1°C with every increase of 1% in the number of mismatch base pairs (Bonner et al, Eur. J. Biochem., 46:%2>, 1974). Formamide is optional in these hybridization conditions. Accordingly, particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1% w/v SDS at 25-42°C; a moderate stringency is 2 x SSC buffer, 0.1% w/v SDS at a temperature in the range 2O 0 C to 65°C; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 65°C. In some embodiments, the nucleic acid molecule encoding a PRC polypeptide comprise a sequence of nucleotides as set forth in SEQ ID NOs: 1, 3, 5, or 7 or which hybridises thereto or to a complementary form thereof under medium or high stringency hybridisation conditions. Preferably the hybridisation region is about 12 to about 80 nucleobases or greater in length.

More preferably, the precent identity between a particular nucleotide sequence and a reference sequence is about 30%, or 65% or about 70% or about 80% or about 85% or more preferably about 90% similarity or greater as about 95%, 96%, 97%, 98%, 99% or greater. Percent identities between 60 and 100% are encompassed.

A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise (1) a sequence (i.e. only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local

regions of sequence similarity. A "comparison window" refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e. resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as, for example, disclosed by Altschul et al, Nucl. Acids Res. 25:3389, 1997. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al, Current Protocols in Molecular Biology John Wiley & Sons Inc, 1994-1998, Chapter 15).

A percentage of sequence identity between nucleotide sequences, for example, is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, "sequence identity" will be understood to mean the "match percentage" calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity for amino acid sequences.

In some embodiments, the present invention contemplates the use of a full-length PRC polypeptide or variants comprising biologically active portions of those polypeptides. In some embodiments, variants are inhibitors that bind to other PRC members of their targets

and inhibit PRC function. Typically, a biologically active portion comprises one or more binding domains or motifs or structures. A biologically active portion of a full-length polypeptide can be a polypeptide which is, for example, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150, 300, or more amino acid residues in length. The PRC polypeptides of the present invention include all biologically active or functional naturally occurring forms of PRC as well as variants comprising biologically active portions thereof and derivatives of these. For example, a PRC polypeptide or variants thereof including agonists or antagonists may be delivered to hematopoietic cells in proteinaceous forms as part of a delivery construct designed to allow appropriate intracellular targeting.

The terms "functional form" or "variant", "functionally equivalent derivatives" or "homologs" include polypeptides comprising a sequence of amino acids having about 60% sequence identity to a PRC polypeptide or proteinaceous product of a PRC target gene. Illustrative Suzl2 polypeptides comprise a sequence of amino acids substantially as set out in SEQ ID NO: 2 or 4 or are encoded by a sequence of nucleotides as set out in SEQ ID NOs: 1 or 3. Illustrative PRC polypeptides comprise all or part of amino acid sequences set forth in SEQ ID NO: 6, 8, 10 or 12, or are encoded by a contiguous sequence of nucleotides as set out in SEQ ID NO: 5, 7, 9 or 11.

As used herein, the term "amino acid" refers to compounds having an amino group and a carboxylic acid group. An amino acid may be a naturally occurring amino acid or non- naturally occurring amino acid and may be a proteogenic amino acid or a non-proteogenic amino acid. The amino acids incorporated into the amino acid sequences of the present invention may be L-amino acids, D-amino acids, α-amino acid, β-amino acids, sugar amino acids and/or mixtures thereof.

The present invention contemplates variant forms of the interacting molecules. "Variant" polypeptides include proteins derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites

in the native protein; or substitution of one or more amino acids at one or more sites in the native protein. Variant proteins encompassed by the present invention are biologically active, that is, they continue to possess at least one biological activity or binding domain of the native protein. Such variants may result from, for example, genetic polymorphism or from human manipulation. Biologically active variants of a native PRC polypeptide will have at least 40%, 50%, 60%, 70%, generally at least 75%, 80%, 85%, preferably about 90% to 95% or more, and more preferably about 98% or more sequence similarity with the amino acid sequence for the native protein as determined by sequence alignment programs described elsewhere herein using default parameters. A biologically active variant of a PRC polypeptide may differ from that polypeptide or parts thereof generally by as much as 100, 50 or 20 amino acid residues or suitably by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.

A PRC polypeptide/peptide may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of a PRC polypeptide can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations are well known in the art. See, for example, Kunkel (Proc. Natl. Acad. Sci. USA, 52:488-492, 1985), Kunkel et al, (Methods in Enzymol., 154:367- 382, 1987), U.S. Pat. No. 4,873,192, Watson et al ("Molecular Biology of the Gene", Fourth Edition, Benjamin/Cummings, Menlo Park, Calif, 1987) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al, (Natl. Biomed. Res. Found, 5:345-358,1978). Methods for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property are known in the art. Such methods are adaptable for rapid screening of the gene libraries generated by combinatorial mutagenesis of polypeptides. Recursive ensemble mutagenesis (REM), a technique that enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify useful polypeptide variants (Arkin et al., Proc. Natl. Acad. Sci. USA, 59:7811-7815, 1992; Delgrave et al, Protein Engineering, <5:327-331,

1993). Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be desirable as discussed in more detail below.

Variant PRC polypeptides may contain conservative amino acid substitutions at various locations along their sequence, as compared to a reference amino acid sequence. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, which can be generally sub- classified as follows: Acidic: The residue has a negative charge due to loss of H ion at physiological pH and the residue is attracted by aqueous solution so as to seek the surface positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium at physiological pH. Amino acids having an acidic side chain include glutamic acid and aspartic acid. Basic: The residue has a positive charge due to association with H ion at physiological pH or within one or two pH units thereof (e.g., histidine) and the residue is attracted by aqueous solution so as to seek the surface positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium at physiological pH. Amino acids having a basic side chain include arginine, lysine and histidine. Charged: The residues are charged at physiological pH and, therefore, include amino acids having acidic or basic side chains (i.e., glutamic acid, aspartic acid, arginine, lysine and histidine).

Hydrophobic: The residues are not charged at physiological pH and the residue is repelled by aqueous solution so as to seek the inner positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium. Amino acids having a hydrophobic side chain include tyrosine, valine, isoleucine, leucine, methionine, phenylalanine and tryptophan.

Neutral/polar: The residues are not charged at physiological pH, but the residue is not sufficiently repelled by aqueous solutions so that it would seek inner positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium.

Amino acids having a neutral/polar side chain include asparagine, glutamine, cysteine, histidine, serine and threonine.

This description also characterises certain amino acids as "small" since their side chains are not sufficiently large, even if polar groups are lacking, to confer hydrophobicity. With the exception of proline, "small" amino acids are those with four carbons or less when at least one polar group is on the side chain and three carbons or less when not. Amino acids having a small side chain include glycine, serine, alanine and threonine. The gene-encoded secondary amino acid proline is a special case due to its known effects on the secondary conformation of peptide chains. The structure of proline differs from all the other naturally-occurring amino acids in that its side chain is bonded to the nitrogen of the α- amino group, as well as the α-carbon. Several amino acid similarity matrices (e.g., PAM120 matrix and PAM250 matrix as disclosed for example by Dayhoff et al, 1978 {supra); and by Gonnet et al, Science, 255(5062): 1443-1445, 1992), however, include proline in the same group as glycine, serine, alanine and threonine. Accordingly, for the purposes of the present invention, proline is classified as a "small" amino acid.

Amino acid residues can be further sub-classified as cyclic or noncyclic, and aromatic or nonaromatic, self-explanatory classifications with respect to the side-chain substituent groups of the residues, and as small or large. The residue is considered small if it contains a total of four carbon atoms or less, inclusive of the carboxyl carbon, provided an additional polar substituent is present; three or less if not. Small residues are, of course, always nonaromatic. Dependent on their structural properties, amino acid residues may fall in two or more classes. For the naturally-occurring protein amino acids, sub-classification according to this scheme is presented in the Table 2.

Conservative amino acid substitution also includes groupings based on side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is

phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. For example, it is reasonable to expect that replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid will not have a major effect on the properties of the resulting variant polypeptide. Whether an amino acid change results in a functional PRC polypeptide can readily be determined by assaying its activity. Activities that can readily be assessed are known to those of skill and include assays to determine binding or dimerization, enzyme activity, methylation, transcription repression detected by, for example, Biocore, kinetic, affinity chromatography and pull-down and receptor analyses. The structural impact of modifying a polypeptide may also be analysed in silico. Conservative substitutions are shown in Table 3 below under the heading of exemplary substitutions. More preferred conservation substitutions are shown under the heading of preferred substitutions. Amino acid substitutions falling within the scope of the invention, are, in general, accomplished by selecting substitutions that do not differ significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. After the substitutions are introduced, the variants are screened for biological activity.

Alternatively, similar amino acids for making conservative substitutions can be grouped into three categories based on the identity of the side chains. The first group includes glutamic acid, aspartic acid, arginine, lysine, histidine, which all have charged side chains; the second group includes glycine, serine, threonine, cysteine, tyrosine, glutamine, asparagine; and the third group includes leucine, isoleucine, valine, alanine, proline, phenylalanine, tryptophan, methionine, as described in Zubay, G., Biochemistry, third edition, Wm.C. Brown Publishers (1993).

Thus, a predicted non-essential amino acid residue in a PRC polypeptide is typically replaced with another amino acid residue from the same side chain family. Alternatively, mutations can be introduced randomly along all or part of the polynucleotide coding

sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for an activity of the parent polypeptide to identify mutants which retain that activity. Following mutagenesis of the coding sequences, the encoded peptide can be expressed recombinantly and the activity of the peptide can be determined.

Accordingly, the present invention also contemplates variants of the naturally-occurring PRC polypeptide sequences or their biologically-active fragments, wherein the variants are distinguished from the naturally-occurring sequence by the addition, deletion, or substitution of one or more amino acid residues. In general, variants will display at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 % identity to a reference PRC polypeptide sequence as, for example, set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10 or 12. Moreover, sequences differing from the native or parent sequences by the addition, deletion, or substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 or more amino acids but which retain certain properties of the reference PRC polypeptide are contemplated. The present variant PRC polypeptides also include polypeptides that are encoded by polynucleotides that hybridize under stringency conditions as defined herein, especially high stringency conditions, to PRC polynucleotide sequences, or the non-coding strand thereof.

In some embodiments, variant polypeptides differ from an PRC polypeptide sequence by at least one but by less than 50, 40, 30, 20, 15, 10, 8, 6, 5, 4, 3 or 2 amino acid residue(s). In another, variant polypeptides differ from the corresponding sequence in any one of SEQ ID NOs: 2, 4, 6, 8, 10 or 12 by at least 1% but less than 20%, 15%, 10% or 5% of the residues. If this comparison requires alignment the sequences should be aligned for maximum similarity. ("Looped" out sequences from deletions or insertions, or mismatches, are considered differences.) The differences are, suitably, differences or changes at a nonessential residue or a conservative substitution. A sequence alignment for PRC proteins from a range of mammalian species is used to demonstrate conserved residues.

A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of an embodiment polypeptide without abolishing or substantially altering one or

more of its activities. Suitably, the alteration does not substantially alter one of these activities, for example, the activity is at least 20%, 40%, 60%, 70% or 80% of wild-type. An "essential" amino acid residue is a residue that, when altered from the wild-type sequence of an polypeptide agent of the invention, results in abolition of an activity of the parent molecule such that less than 20% of the wild-type activity is present.

In other embodiments, a variant polypeptide includes an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98% or more similarity to a corresponding sequence of a PRC polypeptide as, for example, set forth in SEQ ID NOs: 2, 4, 6, 8, 10 or 12, and has at least one activity of that PRC polypeptide.

Polypeptide agents may be prepared by any suitable procedure known to those of skill in the art. For example, the polypeptides may be prepared by a procedure including the steps of: (a) preparing a chimeric construct comprising a nucleotide sequence that encodes at least a portion of a PRC polypeptide or a functional variant thereof and that is operably linked to one or more regulatory elements; (b) introducing the chimeric construct into a host cell; (c) culturing the host cell to express the PRC polypeptide or variant thereof; and (d) isolating the PRC polypeptide or variant of either of these polypeptides from the host cell. In illustrative examples, the nucleotide sequence encodes at least a portion of the sequence set forth in SEQ ID NOs: 2, 4, 6, 8, 10 or 12, or a variant thereof. Recombinant polypeptides can be conveniently prepared using standard protocols as described for example in Sambrook, et ah, (1989, supra), in particular Sections 16 and 17; Ausubel et ah, (1994, supra), in particular Chapters 10 and 16; and Coligan et ah, CURRENT PROTOCOLS IN PROTEIN SCIENCE (John Wiley & Sons, Inc. 1995-1997), in particular Chapters 1, 5 and 6. Alternatively, polypeptides agents may be synthesised by chemical synthesis, e.g., using solution synthesis or solid phase synthesis as described, for example, in Chapter 9 of Atherton and Shephard (supra) and in Roberge et al, (Science, 269:202, 1995). The synthesis of conformational^ constrained peptides is described for example in International Publication No. WO 2004106366.

The terms "derivative" or the plural "derivatives" and "variant" or "variants" are used interchangeable and, whether in relation to genetic or proteinaceous molecules, include as appropriate parts, mutants, fragments, and analogues as well as hybrid, chimeric or fusion molecules and glycosylation variants. Particularly useful derivatives retain the functional activity of the parent molecule and comprise single or multiple amino acid substitutions, deletions and/or additions to a PRC amino acid sequence. Preferably, the variants have functional activity or alternatively, modulate a PRC functional activity.

As used herein reference to a part, portion or fragment of a PRC gene is defined as having a minimal size of at least about 10 nucleotides or preferably about 13 nucleotides or more preferably at least about 20 nucleotides and may have a minimal size of at least about 35 nucleotides. This definition includes all sizes in the range of 10 to 35 as well as greater than 35 nucleotides. Thus, this definition includes nucleic acids of 12,15, 20, 25, 40, 60,

100, 200, 500 nucleotides of nucleic acid molecules having any number of nucleotides between 500 and the number shown in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 14 or 15 or a complementary form thereof. The same considerations apply mutatis mutandis to any reference herein to a part, portion or fragment of a PRC polypeptide.

Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein and may be designed to modulate one or more properties of the polypeptide such as stability against proteolytic cleavage without the loss of other functions or properties. Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues involved. Preferred substitutions are those which are conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and tyrosine, phenylalanine.

Certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example,

antigen-binding regions of antibodies or binding sites on substrate molecules or binding sites on proteins interacting with the polypeptide. Since it is the interactive capacity and nature of a protein which defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence and its underlying DNA coding sequence and nevertheless obtain a protein with like properties. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydrophobic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte et al, J. MoI. Biol, 757. 105-132, 1982). Alternatively, the substitution of like amino acids can be made effectively on the basis of hydrophilicity. The importance of hydrophilicity in conferring interactive biological function of a protein is generally understood in the art (U.S. Patent No. 4,554,101). The use of the hydrophobic index or hydrophilicity in designing polypeptides is further discussed in U.S. Patent No. 5,691,198.

The term "homolog" or "homologs" refers herein broadly to functionally or structurally related molecules including those from other species.

Reference herein to "mimetics" includes carbohydrate, nucleic acid or polypeptide mimetics and it intended to refer to a substance which has conformational features allowing the substance to perform as a functional analog of at least one biological activity of the reference molecule. A peptide mimetic may be a peptide containing molecule that mimic elements of protein secondary structure (Johnson et al, "Peptide Turn Mimetics" in Biotechnology and Pharmacy, Pezzuto et al, eds Chapman and Hall, New York, 1993). Peptide mimetics may be identified by screening random peptides libraries such as phage display or combinatorial libraries for peptide molecules which mimic a functional activity of a PRC polypeptide. Alternatively, mimetic design, synthesis and testing is employed. The recognition of carbohydrates and lipids by proteins is an important event in many biological systems and the development of chemotherapeutics based on carbohydrate and/or lipid -mimics which can disrupt specific recognition processes is a rapidly emerging field. Nucleic acid mimetics include, for example, RNA analogs containing N3'~P5' phosphoramidate internucleotide linkages which replace the naturally occurring RNA 03'—

P5' phosphodiester groups. Enzyme or transcription factor mimetics include catalytic antibodies or their encoding sequences, which may also be humanised.

Peptide or non-peptide mimetics can be developed as functional analogues of a PRC polypeptide or the expression products of a PRC target gene by identifying those residues of the target molecule which are important for function. Modelling can be used to design molecules which interact with the target molecule and which have improved pharmacological properties. Rational drug design permits the production of structural analogs of biologically active polypeptides of interest or of small molecules with which they interact (e.g. agonists, antagonists, inhibitors or enhancers) in order to fashion drugs which are, for example, more active or stable forms of the polypeptide, or which, e.g. enhance or interfere with the function of a polypeptide in vivo. See, e.g. Hodgson (Bio/Technology, 9: 19-21, 1991). In one approach, one first determines the three- dimensional structure of a PRC protein or PRC-target protein by NMR spectroscopy, x-ray crystallography, by computer modelling or most typically, by a combination of approaches. Useful information regarding the structure of a polypeptide may also be gained by modelling based on the structure of homologous proteins. In addition, putative peptide or polypeptide agents may be analyzed by an alanine scan (Wells, Methods Enzymol., 202:2699-2705, 1991). In this technique, an amino acid residue is replaced by Ala and its effect on the peptide's activity is determined. Each of the amino acid residues of the peptide is analyzed in this manner to determine the important regions of the peptide.

It is also possible to isolate a target-specific antibody, selected by a functional assay and then to solve its crystal structure. In principle, this approach yields a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crystallography altogether by generating anti-idiotypic antibodies (anti-ids) to a functional, pharmacologically active antibody. As a mirror image of a mirror image, the binding site of the anti-ids would be expected to be an analog of the original receptor. The anti-id could then be used to identify and isolate peptides from banks of chemically or biologically produced banks of peptides. Selected peptides would then act as the pharmacore. As

briefly described, it is possible to design or screen for mimetics which have enhanced activity or stability or are more readily and/or more economically obtained.

In some embodiments, analogs have enhanced stability and activity or reduced unfavourable pharmacological properties. They may also be designed in order to have an enhanced ability to cross biological membranes or to interact with only specific substrates. Thus, analogs may retain some functional attributes of the parent molecule but may posses a modified specificity or be able to perform new functions useful in the present context i.e., for administration to a subject.

In another aspect, analogs of agonist or antagonist agents are contemplated. Analogs of peptide or polypeptide agents contemplated herein include but are not limited to modification to side chains, incorporating of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the proteinaceous molecule or their analogs.

Suitable non-proteogenic or non-naturally occurring amino acids may be prepared by side chain modification or by total synthesis. Examples of side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH 4 ; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6- trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH 4 .

The guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.

The carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitization, for example, to a corresponding amide.

Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4- chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2- chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.

Tryptophan residues may be modified by, for example, oxidation with N- bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides. Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.

Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate .

Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3- hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers of amino acids. Examples of non-proteogenic (non-naturally occurring or unnatural) amino acids contemplated herein are shown in Table 4.

Suitable β-amino acids include, but are not limited to, L-β-homoalanine, L-β- homoarginine, L-β-homoasparagine, L-β-homoaspartic acid, L-β-homoglutamic acid, L-β- homoglutamine, L-β-homoisoleucine, L-β-homoleucine, L-β-homolysine, L-β- homomethionine, L-β-homophenylalanine, L-β-homoproline, L-β-homoserine, L-β-

homothreonine, L-β-homotryptophan, L-β-homotyrosine, L-β-homovaline, 3-amino- phenylpropionic acid, 3-amino-chlorophenylbutyric acid, 3-amino-fluorophenylbutyric acid, 3-amino-bromopheynyl butyric acid, 3-amino-nitrophenylbutyric acid, 3-amino- methylphenylbutyric acid, 3-amino-pentanoic acid, 2-amino-tetrahydroisoquinoline acetic acid, 3-amino-naphthyl-butyric acid, 3-amino-pentafluorophenyl-butyric acid, 3-amino- benzothienyl-butyric acid, 3-amino-dichlorophenyl-butyric acid, 3-amino-difluorophenyl- butyric acid, 3-amino-iodophenyl-butyric acid, 3-amino-trifluoromethylphenyl-butyric acid, 3-amino-cyanophenyl-butyric acid, 3-amino-thienyl-butyric acid, 3-amino-5- hexanoic acid, 3-amino-furyl-butyric acid, 3-amino-diphenyl-butyric acid, 3-amino-6- phenyl-5-hexanoic acid and 3-amino-hexynoic acid.

Sugar amino acids are sugar moieties containing at least one amino group as well as at least one carboxyl group. Sugar amino acids may be based on pyranose sugars or furanose sugars. Suitable sugar amino acids may have the amino and carboxylic acid groups attached to the same carbon atom, α-sugar amino acids, or attached to adjacent carbon atoms, β-sugar amino acids. Suitable sugar amino acids include but are not limited to

Sugar amino acids may be synthesized starting from commercially available monosaccharides, for example, glucose, glucosamine and galactose. The amino group may be introduced as an azide, cyanide or nitromethane group with subsequent reduction. The carboxylic acid group may be introduced directly as CO 2 , by Wittig reaction with subsequent oxidation or by selective oxidation of a primary alcohol.

Crosslinkers can be used, for example, to stabilize 3D conformations, using homo- bifunctional crosslinkers such as the bifunctional imido esters having (CH 2 ),, spacer groups with n=l to n=6, glutaraldehyde, N-hydroxysuccinimide esters and hetero-bifunctional reagents which usually contain an amino-reactive moiety such as N-hydroxysuccinimide and another group specific-reactive moiety such as maleimido or dithio moiety (SH) or carbodiimide (COOH). In addition, peptides can be conformationally constrained by, for example, incorporation of C α and N α -methylamino acids and the introduction of double bonds between C n and Cβ atoms of amino acids.

Conformationally constrained peptides are contemplated that modulate the level or activity of a PRC polypeptide or a polypeptide product of a PRC-target gene. Here, the conformation of molecules that bind to a binding site of a PRC protein is stabilized by means of a linker covalently bound between two amino acid residues in the sequence.

Agents for use in the present invention, such as peptides or small organic or inorganic molecules, carbohydrates, lipids or nucleic acid molecules can readily be conjugated to targeting compounds to allow direct delivery of agents to hematopoietic cells such as in the bone marrow, liver, spleen or lungs. Suitable targeting agents are known to those of skill in the art and include antibodies or antigen-binding fragments thereof. Antibodies and their generation and treatment are well known to those in the art. Exemplary protocols for their production are provided in Coligan et al "Current Protocols in Immunology" (John Wiley & Sons, 1991) and Ausubel et al "Current Protocols in Molecular Biology" (1994-1998). Antibodies may be polyclonal or monoclonal antibodies, fragments include Fv, Fab, Fab 1 and F(ab') 2 portions of immunoglobulin molecules. Synthetic Fv fragments are conveniently employed including synthetic single chain Fv fragments prepared, for example, as described in US Patent No. 5,091,513. Other binding molecules include single variable region domains (referred to as dAbs), or minibodies comprising a single chain comprising the essential elements of a complete antibody as disclosed in US Patent No. 5,837,821. In further embodiments, the antigen binding molecule comprises multiple

binding sites for one or more antigens (eg multi-scFvs). In other embodiments, the antigen binding molecule is a non-immunoglobulin derived protein framework having complementary determining regions selected for a particular antigen such as a platelet surface protein moiety.

The small or large chemicals, polypeptides, nucleic acids, antibodies, peptides, modified peptides, chemical analogs, or mimetics of the present invention can be formulated in pharmaceutic compositions which are prepared according to conventional pharmaceutical compounding techniques. See, for example, Remington's Pharmaceutical Sciences, 18 th Ed. (1990, Mack Publishing, Company, Easton, PA, U.S.A.). The composition may contain the active agent or pharmaceutically acceptable salts of the active agent. These compositions may comprise, in addition to one of the active substances, a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g. intravenous, oral, intrathecal, epineural or parenteral.

The present agents may be used to diagnose, treat, prevent, and/or ameliorate a disease or disorder selected from the group consisting of: anemia, pancytopenia, leukopenia, thrombocytopenia, leukemias, Hodgkin's disease, non-Hodgkin's lymphoma, acute lymphocytic anemia (ALL), plasmacytomas, multiple myeloma, Burkitt's lymphoma, arthritis, asthma, AIDS, autoimmune disease, rheumatoid arthritis, granulomatous disease, immune deficiency, inflammatory bowel disease, sepsis, neutropenia, neutrophilia, psoriasis, immune reactions to transplanted organs and tissues, systemic lupus erythematosis, hemophilia, hypercoagulation, diabetes mellitus, endocarditis, meningitis,

Lyme Disease, and allergies.

The agents may promote lymphopoiesis and may be useful in treating or preventing immune disorders such as infection (such as by bacteria, viruses, parasites) inflammation, allergy, autoimmunity, and immunodeficiency including humoral immunodeficiencies. In

addition, the agents may have commercial utility in the expansion of stem cells and committed progenitors of various blood lineages, and in the differentiation and/or proliferation of various cell types. Furthermore, the subject agents may also be used to determine biological activity, to raise antibodies, as tissue markers, to isolate ligands or receptors, to identify further agents that modulate their interactions, in addition to a use as a nutritional supplement.

For oral administration, the compounds can be formulated into solid or liquid preparations such as capsules, pills, tablets, lozenges, powders, suspensions or emulsions. In preparing the compositions in oral dosage form, any of the usual pharmaceutical media may be employed, such as, for example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents, suspending agents, and the like in the case of oral liquid preparations (such as, for example, suspensions, elixirs and solutions); or carriers such as starches, sugars, diluents, granulating agents, lubricants, binders, disintegrating agents and the like in the case of oral solid preparations (such as, for example, powders, capsules and tablets). Because of their ease in administration, tablets and capsules represent the most advantageous oral dosage unit form, in which case solid pharmaceutical carriers are obviously employed. If desired, tablets may be sugar-coated or enteric-coated by standard techniques. The active agent can be encapsulated to make it stable to passage through the gastrointestinal tract while at the same time allowing for passage across the blood brain barrier. See for example, International Patent Publication No. WO 96/11698. For parenteral administration, the compound may dissolved in a pharmaceutical carrier and administered as either a solution or a suspension. Illustrative of suitable carriers are water, saline, dextrose solutions, fructose solutions, ethanol, or oils of animal, vegetative or synthetic origin. The carrier may also contain other ingredients, for example, preservatives, suspending agents, solubilizing agents, buffers and the like.

The active agent is preferably administered in a therapeutically effective amount. The actual amount administered and the rate and time-course of administration will depend on the nature and severity of the condition being treated. Prescription of treatment, e.g. decisions on dosage, timing, etc. is within the responsibility of general practitioners or

specialists and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of techniques and protocols can be found in Remington's Pharmaceutical Sciences, (supra).

Alternatively, targeting therapies may be used to deliver the active agent more specifically to tissues producing or accumulating platelets such as the bone marrow, lung, spleen, vascular system by the use of targeting systems such as antibodies or cell specific ligands or, vectors. Targeting may be desirable for a variety of reasons, e.g. to avoid targeting other areas of the body, if the agent is unacceptably toxic or if it would otherwise require too high a dosage or if it would not otherwise be able to enter the target cells.

Instead of administering these agents directly, they could be produced in the target cell, e.g. in a viral vector such as those described above or in a cell based delivery system such as described in U.S. Patent No. 5,550,050 and International Patent Publication Nos. WO 92/19195, WO 94/25503, WO 95/01203, WO 95/05452, WO 96/02286, WO 96/02646, WO 96/40871, WO 96/40959 and WO 97/12635. The vector could be targeted to the target cells or expression of expression products could be limited to specific cells, stages of development or cell cycle stages. The cell based delivery system is designed to be implanted in a patient's body at the desired target site and contains a coding sequence for the target agent. Alternatively, the agent could be administered in a precursor form for conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated. See, for example, European Patent Application No. 0 425 73 IA and International Patent Publication No. WO 90/07936.

In accordance with another aspect of the present invention, the cells of a subject exhibiting a modified PRC genetic sequence may be treated with a genetic composition comprising PRC. The provision of wild type or enhanced PRC function to a cell that carries a mutant or altered form of the gene should in this situation complement the deficiency. The wild type allele may be introduced into a cell in a vector such that the gene remains

extrachromosomally. Alternatively, artificial chromosomes may be used. Typically, the vector may combine with the host genome and be expressed therefrom.

Gene therapy would be carried out according to generally accepted methods, for example, as described by Friedman (In: Therapy for Genetic Disease, T. Friedman, Ed., Oxford University Press, pp. 105-121, 1991) or Culver {Gene Therapy: A Primer for Physicians, 2 nd Ed., Mary Ann Liebert, 1996). Suitable vectors are known, such as disclosed in U.S. Patent No. 5,252,479, International Patent Publication No. WO 93/07282 and U.S. Patent No. 5,691,198. Gene transfer systems known in the art may be useful in the practice of the gene therapy methods of the present invention. These include viral and non-viral transfer methods. Non-viral gene transfer methods are known in the art such as chemical techniques including calcium phosphate co-precipitation, mechanical techniques, for example, microinjection, membrane fusion-mediated transfer via liposomes and direct DNA uptake and receptor-mediated DNA transfer. Viral-mediated gene transfer can be combined with direct in vivo gene transfer using liposome delivery.

Expression vectors in the context of gene therapy are meant to include those constructs containing sequences sufficient to express a polynucleotide that has been cloned therein. In viral expression vectors, the construct contains viral sequences sufficient to support packaging of the construct. If the polynucleotide encodes PRC, for example, expression will produce PRC. If the polynucleotide encodes a sense or antisense polynucleotide or a ribozyme or DNAzyme, expression will produce the sense or antisense polynucleotide or ribozyme or DNAzyme. Thus, in this context, expression does not require that a protein product be synthesized. In addition to the polynucleotide cloned into the expression vector, the vector also contains a promoter functional in eukaryotic cells. The cloned polynucleotide sequence is under control of this promoter. Suitable eukaryotic promoters are routinely determined.

Receptor-mediated gene transfer may be achieved by conjugation of DNA to a protein ligand via polylysine. Ligands are chosen on the basis of the presence of the corresponding ligand receptors on the cell surface of the target cell/tissue type. Receptors on the surface

of liver cells may be advantageously targeted. These ligand-DNA conjugates can be injected directly into the blood if desired and are directed to the target tissue where receptor binding and internalization of the DNA-protein complex occurs. To overcome the problem of intracellular destruction of DNA, co-infection with adenovirus can be included to disrupt endosome function.

In a further related aspect of the present invention it has been determined that alternations in the level or activity of one or more PRC polypeptides has a profound effect on hematopoietic cell number or activity. Accordingly, susceptibility to conditions associated with subnormal hematopoietic cell numbers can now be diagnosed by monitoring subjects for modification in the level or activity of a PRC polypeptide or specific mutations or aberrations (such a methylation events) in one or more PRC genes. In some embodiments, the hematopoietic cells is a HSC. hi other embodiments, the hematopoietic cells is a progenitor cell such as a myeloid or lymphoma committed progenitor cell. In other embodiments, the PRC gene is Suzl2 comprises the nucleotide sequence set forth in SEQ ID NO: 3 (human Suzl2).

Mutations or other modifications to the gene may cause total or partial gain or loss of PRC function. In some embodiments, modification in the gene affects transcription, translation or post-translational processing and so affects the level or activity of a PRC polypeptide. In some embodiments, mutation in a PRC gene is in the splice-effector site.

A wide range of mutation detection screening methods are available as would be known to those skilled in the art. Any method which allows an accurate comparison between a test and control nucleic acid sequence may be employed. Scanning methods include sequencing, denaturing gradient gel electrophoresis (DGGE), single-stranded conformational polymorphism (SSCP and rSSCP, REF-SSCP), chemical cleavage methods such as CCM, ECM, DHPLC and MALDI-TOF MS and DNA chip technology. Specific methods to screen for pre-determined mutations include allele specific oligonucleotides (ASO), allele specific amplification, competitive oligonucleotide priming, oligonucleotide ligation assay, base-specific primer extension, dot blot assays and RFLP-PCR. The

strengths and weaknesses of these and further approaches are reviewed in Sambrook, Chapter 13, Molecular Cloning, 2001. Methylation detection assays are also known in the art with methods for the detection of 5-methylcytosines being the most advanced, as reviewed by Rein et al, Nucleic Acids Research, 2<J(10):2255-2264, 1998. Detection of cytosine methylation is also described in International Publication Nos. WO 00/70090 and WO 03/000926.

The present invention provides methods of diagnosis of conditions associated with thrombocytopenia, leukopenia or HSC defects in a subject and further provides genetic or protein based methods of determining the susceptibility of a subject to develop these conditions.

The diagnostic and prognostic methods of the present invention detect or assess an aberration in a wild-type PRC gene or locus to determine if a modified polypeptide will be produced or if it will be over-produced or under-produced. The term "aberration" in the gene or locus encompasses all forms of mutations including deletions, insertions, point mutations and substitutions in the coding and non-coding regions. It also includes changes in methylation patterns of the gene. Point mutations may result in stop codons, frameshift mutations or amino acid substitutions. Somatic mutations are those which occur only in certain tissues, e.g. in the tumor tissue and are not inherited in the germline. Germline mutations can be found in any of a body's tissues and are inherited.

Predisposition to conditions associated with thrombocytopenia or leukopenia or HSC defects can be ascertained by testing any tissue of a human or other mammal for loss of function mutations in a PRC gene. The mutation can be determined by testing DNA from any tissue of a subject's body. In addition, pre-natal diagnosis can be accomplished by testing fetal cells, placental cells or amniotic fluid for mutations of a PRC gene. Alteration of a wild-type allele whether, for example, by point mutation or by deletion or by methylation, can be detected by any number of means.

Useful diagnostic techniques to detect aberrations in one or more PRC genes include but are not limited to fluorescent in situ hybridization (FISH), PFGE analysis, Southern blot analysis, dot blot analysis and PCR-SSCP. Also useful is DNA microchip technology. Direct DNA sequencing, either manual sequencing or automated fluorescent sequencing, can detect sequence variation. Another approach is the single-stranded conformation polymorphism assay (SSCP) (Orita et al, Proc. Nat. Acad. Sci. USA, 86:2116-2110, 1989). This method can be optimized to detect most DNA sequence variation. The increased throughput possible with SSCP makes it an attractive, viable alternative to direct sequencing for mutation detection on a research basis. The fragments which have shifted mobility on SSCP gels are then sequenced to determine the exact nature of the DNA sequence variation. Other approaches based on the detection of mismatches between the two complementary DNA strands include clamped denaturing gel electrophoresis (CDGE) (Sheffield et al, Am. J. Hum. Genet., 49:699-106, 1991), heteroduplex analysis (HA) (White et al, Genomics, 72:301-306, 1992) and chemical mismatch cleavage (CMC) (Grompe et al, Proc. Natl. Acad. Sci. USA, 55:5855-5892, 1989). Other methods which might detect mutations in regulatory regions or which might comprise large deletions, duplications or insertions include the protein truncation assay or the asymmetric assay. A review of methods of detecting DNA sequence variation can be found in Grompe (Proc. Natl. Acad. Sci. USA, 55:5855-5892, 1993).

Other tests for confirming the presence or absence of a wild-type or mutant PRC alleles; denaturing gradient gel electrophoresis (DGGE) (Wartell et al, Nucl. Acids Res., 75:2699- 2705, 1990; Sheffield et al, Proc. Natl. Acad. Sci. USA, 56:232-236, 1989); RNase protection assays (Finkelstein et al, Genomics, 7:167-172, 1990; Kinszler et al, Science, 251. 1366- 1370, 1991); denaturing HPLC; allele-specific oligonucleotide (ASO hybridization) (Conner et al, Proc. Natl. Acad. Sci. USA, 50:278-282, 1983); the use of proteins which recognize nucleotide mismatches such as the E. coli mutS protein (Modrich, Ann. Rev. Genet., 25:229-253, 1991) and allele-specific PCR (Ruano et al, Nucl. Acids. Res. 77:8392, 1989). For allele-specific PCR, primers are used which hybridize at their 3' ends to a particular. If the particular mutation is not present, an amplification product is not observed. Amplification Refractory Mutation System (ARMS)

can also be used, as disclosed in European Patent Publication No. 0 332 435 and in Newtown et al. (Nucl. Acids. Res. /7:2503-2516, 1989).

Nucleic acid sequences of a PRC gene which have been amplified by use of PCR or other amplification reactions may also be screened using allele-specific probes. These probes are nucleic acid oligomers, each of which contains a region of the gene sequence harbouring a known mutation. By use of a battery of allele-specific probes, PCR amplification products can be screened to identify the presence of a previously identified mutation in a PRC gene.

Hybridization of allele-specific probes with amplified PRC gene sequences can be performed, for example, on a nylon filter. Hybridization to a particular probe under stringent hybridization conditions indicates the presence of the same mutation in the tissue as in the allele-specific probe.

Microchip technology is also applicable to the present invention. In this technique, thousands of distinct oligonucleotide or cDNA probes are built up in an array on a silicon chip or other solid support such as polymer films and glass slides. Nucleic acid to be analyzed is labelled with a reporter molecule (e.g. fluorescent label) and hybridized to the probes on the chip. It is also possible to study nucleic acid-protein interactions using these nucleic acid microchips. Using this technique, one can determine the presence of mutations or sequence the nucleic acid being analyzed or one can measure expression levels of a gene of interest or multiple genes of interest such as genes encoding products in a biochemical pathway. The technique is described in a range of publications including Hacia et al. (Nature Genetics, 74:441-447, 1996) and Shoemaker et al. (Nature Genetics, 74:450-456, 1996).

Alteration of a wild-type PRC gene can also be detected by screening for alteration in the wild-type PRC protein. For example, monoclonal antibodies immunoreactive with a PRC polypeptide can be used to screen sample from a subject. Alteration in the level, size or lack of cognate antigen would indicate a mutation. Antibodies specific for products of mutant alleles could also be used to detect mutant gene product. Such immunological

assays can be done in any convenient format known in the art. These include Western blots, immunohistochemical assays and ELISA and RAPID assays.

The use of monoclonal antibodies in an immunoassay is particularly preferred because of the ability to produce them in large quantities and the homogeneity of the product. The preparation of hybridoma cell lines for monoclonal antibody production is derived by fusing an immortal cell line and lymphocytes sensitized against the immunogenic preparation (i.e. comprising a PRC polypeptide) or can be done by techniques which are well known to those who are skilled in the art. (See, for example, Douillard et al, Basic Facts about Hybridomas, in Compendium of Immunology Vol. II, ed. by Schwartz, 1981;

Kohler et al, Nature, 255:495-499, 1975; Kohler et al, European Journal of Immunology,

6:511-519, 1976).

In another aspect the present invention provides modified animals or cells for use inter alia in the development or testing of agents as described herein.

The genetically modified animals such as Myb, and PRC mutants such as Suzl2 mutants described herein and cells therefrom provide a sensitized system in which to study the effects of a range of agents.

In some embodiments, the specification provides a genetically modified cell or non-human animal comprising such cells wherein a Suzl2 gene or transcript is modified and the cell or animal produces a substantially reduced level or activity of Suzl2 polypeptide compared to a non-modified cell or animal of the same species. In some embodiments, the modification is in one allele of the Suzl2 gene. The cell or organism is, in some embodiments a mammal, a non- human primate, live stock animal, companion animal, laboratory test animal, captive wild animal, reptile, amphibian, fish or bird. The Suzl2 modification may be applied to different genetic backgrounds such as to a genome comprising a modification in the TPO or c-mpl gene. The MpI negative background is particularly useful for sensitising cells to the loss of Suzl2 or other polycomb proteins. Other genetic backgrounds include those of an animal model of a disease or condition. In accordance with the present invention, if disease of condition symptoms are reduced in the presence of the Suzl2 modification, then agents that down

regulate Suzl2 level or activity, or the activity of complexes comprising Suzl2, such as PRC2, will have efficacy in treating these diseases or conditions in humans.

The term "gene" or "polynucleotide" is used in its broadest sense and includes cDNA corresponding to the exons of a gene. Reference herein to a "gene" or "polynucleotide" is also taken to include :-

(i) a classical genomic gene consisting of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. introns, 5'- and 3'- untranslated sequences); or (ii) mRNA or cDNA corresponding to the coding regions (i.e. exons) and 5'- and 3'- untranslated sequences of the gene.

In other embodiments, the genetically modified cell is a prokaryotic, for example a bacterial cell, or a eukaryotic cell such as a human or mammalian, insect or yeast cell. In other embodiments, where transplantation is considered, the cell is a stem cell, embryonic cell, hematopoietic cell, bone marrow cell, skin cell, heart cell, bone cell, cartilage cell, liver cell, lung cell, kidney cell, spleen cell, thymus cell or brain cell. In some embodiments, the cell is a proliferating cell or a terminally differentiated cell. In other embodiments, the cell is an autologous or syngeneic cell suitable for transplantation. In other embodiments, the modification is in an exon of a Suzl2 gene, in other embodiemtns, the modification is generated by antisense, co-suppression, gene silencing, induction of RNAi or other such method known to those of skill in the art. There are many such techniques known to workers in the art, and new techniques are continually becoming known. The particular choice of modification method is not a limitation of the invention provided that is results in an acceptable level of gene or polypeptide modification.

In some embodiments, the cell or organism contemplated in accordance with this aspect of the invention is further modified with a modification in the TPO or c-mpl gene. In an illustrative embodiment, the modification comprises a MpV 1' mutation. Such cells may be used in vitro or in vivo.

Cells or constructs may be stored frozen and sold with instructions for use. In some embodiments, the modified animals are genetically modified, comprising mutations in one or more PRC genes. The term "genetically modified" refers to changes at the genome or RNA level and refers herein to a cell or animal that contains within its genome one or more specific gene which have been altered, or a gene or transcript which has been modified by the introduction of an anisense, gene silencing, co-suppression iRNA molecule. Alternations may be single base changes such as a point mutation or may comprise deletion of the entire portions of the gene by techniques such as those using homologous recombination. Genetic modifications include alterations to regulatory regions, insertions of further copies of endogenous or heterologous genes, insertions or substitutions with heterologous genes or genetic regions etc. Alterations include, therefore, single or multiple nucleic acid insertions, deletions, substitutions or combinations thereof resulting in partial loss of function of the gene.

Cells and animals which carry one or more modified allele/s can be used as model systems to study the effects of the gene products and/or to test for substances which have potential as therapeutic agents when these function are impaired. Animals for testing therapeutic agents can be selected after mutagenesis of whole animals or after treatment of germline cells or zygotes. After a test substance is applied to the cells, the phenotype of the cell is determined. Any trait of the cells can be assessed. In one embodiment, platlet levels are conveniently moitored. Thus a genetically modified animal or cell includes animals or cells from a transgenic animal, a "knock in" or knock out" animal, conditional variants or other mutants or cells or animals susceptible to co-suppression, gene silencing or induction of RNAi.

Conveniently, targeting genetic constructs are initially used to generate the modified genetic sequences in the cell or organism. Targeting constructs generally but not exclusively modify a target sequence by homologous recombination. Alternatively, a modified genetic sequence may be introduced using artificial chromosomes. Targeting or other constructs are produced and introduced into target cells using methods well known in the art which are described in molecular biology laboratory manuals such as, for example,

in Sambrook, Molecular Cloning: A Laboratory Manual, 3 rd Edition, CSHLP, CSH, NY, 2001; Ausubel (Ed) Current Protocols in Molecular Biology, 5 th Edition, John Wiley & Sons, Inc, NY, 2002.

Genetically modified organisms are generated using techniques well known in the art such as described in Hogan et ah, Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbour Laboratory Press, CSH NY, 1986; Mansour et al, Nature, 556:348- 352, 1988; Pickert, Transgenic Animal Technology: A Laboratory Handbook, Academic Press, San Diego, CA, 1994.

The present invention is further described by the following non-limiting Examples.

EXAMPLE 1

Mpt* ' mice as a model for Thrombocytopenia

Thrombopoietin (Tpo) is the main cytokine responsible for the stimulation of platelet production in mouse and in humans. Tpo binds to the cell surface receptor MpI and stimulates signalling that enables the expansion of immature hematopoietic progenitors and also cells within the megakaryocyte lineage that are responsible for the generation of platelets. Mice that lack the MpI gene (MpI^ ' ) have reduced levels (5 to 10% of the normal number) of circulating platelets (1.2x10 5 +/- 5x10 4 /μl n=1120 compared with 1.2x10 6 +/- 2.04x10 5 /μl, n=55). This is an excellent model of human thrombocytopenia since families with mutations in the MpI gene have also been found (van den Oudenrijn S., et al, British

Journal of Haematology, 2000).

EXAMPLE 2 ENU Treatment and Generation of Mutant Mice

Male MpV 1' mice were treated with N-Ethyl-N-Nitrosourea (ENU) according to the method of Bode (Bode, 1984). Briefly, ENU (N3385, Sigma Chemical Company) was dissolved in 5 ml of ethanol and diluted with 50 mM sodium citrate pH 5.0 and was used within four hours. The concentration of the ENU was determined spectrophotometrically at 395 nm. Male mice were then injected intraperitoneally with one dose of 200 mg/kg, 250 mg/kg, 300 mg/kg, 350 mg/kg or 400 mg/kg, two weekly doses of 100 mg/kg, 125 mg/kg, 150 mg/kg, 175 mg/kg or 200 mg/kg or three weekly doses of 66 mg/kg, 83 mg/kg, 100 mg/kg, 116 mg/kg or 133 mg/kg. Four weeks after the final injection, ENU-treated mice were mated with one or two female MpT 1' mice. Following a period of sterility, the length of which increases as the total dose of ENU increases, first-generation (Gl) progeny were produced. At 7 weeks of age, blood from the retro-orbital plexus using a capillary tube was collected into tubes containing potassium EDTA (Sarstedt, Nϋmbrecht, Germany) and the number of platelets in the peripheral blood was determined using the Advia 120 automated haematological analyser (Bayer, Tarrytown, NY).

MpV' ' mice were treated with the ENU as described above, which results in random mutations being introduced into the DNA of the spermatogonial stem cells and ultimately the sperm (Ranchik Trends in Genetics 7:15-21, 1991). These mice were mated to untreated female MpT' ' mice to produce first generation (G 1 ) progeny, which are heterozygous for a set of ENU-induced mutations inherited from their father. At 7 weeks of age Gl mice were bled and their peripheral blood platelet count was determined. Gl mice were examined for their platelet levels and those that exhibited platelet counts of more than 3x10 8 /ml, that is they had platelet counts of more than 3 standard deviations from the mean of untreated MpV 1' mice and were hence candidates which might carry an ENU-induced mutation that ameliorated thrombocytopenia (Figure 1). Indeed, the elevation in platelet count was found to be due to a heritable genetic change and the pedigree was designated Platelet 8 (Plt8).

EXAMPLE 3 Mapping of the genomic interval containing the PU8 mutation

The mutant gene responsible for the suppression of thrombocytopenia in PU8/+ mice was identified by a process of genetic mapping and sequencing.

Progeny tested mice, with inferred genotype C57BL/6 Mpl' ' PU8/+, were crossed with 129/Sv MpT 1' +/+ mice to produce an Fi population. It was assumed that Fj mice with high platelet counts (>1.5 x 10 8 /ml) carried the PU8 mutation, these animals were intercrossed to generate F 2 mice for mapping. Peripheral blood cell analysis was performed at 7 weeks of age, mice were then sacrificed and their livers were removed for isolation of genomic DNA. DNA was isolated from 90 F 2 mice and a genome wide scan was performed with polymorphic microsatellite markers (simply sequence length polymorphisms) spread throughout the genome. For each F 2 mouse it was determined whether a marker was homozygous C57BL/6, heterozygous C57BL/6-129/Sv or homozygous 129/Sv. For markers not linked to the PU8 mutation one would expect no correlation between genotype and phenotype, whereas for markers very closely linked to the mutation, one would expect animals with high platelet counts to carry C57BL/6 DNA, and animals with normal platelet

counts to be homozygous 129/Sv. Mice that carried C57BL/6 DNA on chromosome 11, as heterozygotes, had higher platelet counts than mice that were 129/Sv homozygotes (Figure 2A). Furthermore, it became apparent that there were no F 2 mice that were homozygous C57BL/6 across an interval on chromosome 11, suggesting the presence of a mutation that was homozygous lethal (Figure 2B). A candidate interval for PU8 was identified between Dl lMit245 and Dl lMitl20 on chromosome 11 (from base pair 77045359 to 83660314). Additional markers were designed using PRIMER3 software available through the Whitehead Institute for Biomedical Research (http://frodo.wi.mit.edu/). A further 531 F 2 mice were genotyped and the candidate interval was refined to 1.4 Mbp between CAR28 and CAR48 (from base pair 79314902 to 80704402) (Figure 3).

EXAMPLE 4 The PU8 mutation is a single base pair deletion ofSuzl2

Genetic mapping indicated that the mutation causing the PLT8 phenotype was located in a defined region of about 1.4 Mb on chromosome 11. This region contained a number of putative and known genes, six genes were selected for sequencing: Suppressor ofZeste 12 protein homolog, Cytokine receptor-like factor 3, Ring finger protein 135, Rhomboid veinlet-like protein 4, Zinc finger protein 207 and Cyclin-dependent kinase 5 activator 1 precursor. To determine if any of these genes were mutated in PU8/+ mice, genomic DNA was extracted from tail and/or liver of PU8/+ and wild-type mice. Primers were designed to amplify exonic regions that covered the protein coding sequence of each of the six candidate genes and these regions were sequenced using standard methods. Where sequence could not be obtained from genomic DNA, cDNA from bone marrow was used as a template to amplify exon regions. The coding regions of all candidate genes were sequenced from both PU8/+ and wild-type-derived DNA, except for Rhomboid veinlet-like protein 4 for which only part of the coding region was sequenced. The genomic sequence derived from PH8/+ mice was identical with those from wild-type mice with the exception of Suppressor of Zeste 12 protein homolog. In this case, a single base pair deletion was identified in the splice acceptor site of the sixteenth exon of Suzl 2, leading to mis-splicing

of the mRNA (Figures 4 and 5). This mutation was not detected in stock C57BL/6 MpV 1' mice, and was absent in other inbred mouse strains including Balb/c and 129/Sv.

A single base pair deletion was also identified in homozygous tissue obtained from embryos (Suzl2 p " 8/m ) (large arrow Figure 9).

EXAMPLE 5 Impairment ofSuzl2 results in elevated platelet number and white blood cell counts

The results of analyses of peripheral blood from mice with different Suzl2 mutations on different backgrounds are shown in Tables 3, 4, 8 and 9.

Peripheral blood was analysed in mice that carry a genetrap allele {Suzl2 502gt ) to verify that the increase in platelet count amongst c-mpV 1' mice was due to impaired Suzl2 function. Similar changes were evident in the peripheral blood of Suzl2 502gl/+ mice (Table 9). Differences in the genetic background of Suzl2 5028t/+ and Suzl2 pltS/+ mice may explain the variation in the magnitude of the increase in platelet and white blood cell counts.

EXAMPLE 6 Suzl 2 protein expression is reduced in mice that carry the Plt8 mutation (Suzl2 PU8/ *) or a gene trap insertion in the Suzl 2 locus (Suzl2 502gl/+ )

Primers were designed to flank the site of the mutation, and RT-PCR was performed on cDNA prepared from bone marrow and spleen. As shown in Figure 5, an aberrantly spliced product was identified in mice carrying the PU8 mutation (Figure 5b, top arrow). Products of the expected size were obtained when an amplicon was targeted at exon 13 and exon 14 showing that processing of the message was not affected upstream of the mutation (see Figure 5A, Figure 5B, bottom two arrows). Protein lysates were prepared from embryos at E12.5. Western blotting demonstrated (see Figure 5C and D) reduced protein expression of Suzl 2 in heterozygous mice. Akt and histone 3 (H3) were used as loading controls.

An additional mouse model of Suzl2 deficiency was made by generating mice that carry a gene trap insertion in the Suzl2 locus. An embryonic stem cell line was obtained that carries a gene trap vector insertion within the Suzl2 genomic locus. A gene trap vector contains a splice acceptor site which enables the construct to be incorporated into the mature Suzl2 mRNA. The gene trap sequence disrupts the Suzl2 open reading frame, resulting in premature termination of the Suzl2 protein during translation. The loss of function allele is referred to as 502gt which reflects the name given to the original cell line. The embryonic stem cells that carry the Suzl2 gene trap were injected into a developing blastocyst to generate a mouse. These techniques are described in the International Gene Trap Consortium Website: http://www.genetrap.org/tutorials/overview.html and also Pasini et al., 2004 (supra). The mice serve as a control for a mouse that has a 50% reduction in Suzl2 protein. Protein lysates were prepared from sex-matched E 12.5 embyros for analysis by western blotting. As shown in Figure 10 Suzl2 and Ezh2 protein levels were reduced in Suzl2 plt8/+ embryos. Suzl2 protein levels were equivalent in Suzl2 plt8/+ embryos and embryos heterozygous for the gene trap allele.

EXAMPLE 7

Suzl2? lt8/ * mice display enhanced CFU-spleen formation.

Early hematopoietic progenitor cells can be quantified using their propensity to form colonies in the spleen of lethally irradiated mice, these colonies are referred to as colony- forming units spleen (CFU-S) (Till et al, Radiat. Res., /4:213-222, 1961).

Bone marrow was injected into irradiated recipients and CFU-S colonies were enumerated after twelve days. As shown in Figure 6A, Suzl2 plt8/+ mice (open bar) had significantly more colonies (p<0.005) compared to wildtype littermates. A representative photograph of recipient spleens is shown (at B). (n = 4, 5 recipients were tested for each donor). Together with the transplantation data described below these results show that stem cell function can be significantly enhanced by reducing Suzl2 level or activity.

In agreement with previous studies, c-mpl-/- mice show a dramatic reduction in CFU-S compared with c-mpl+/+ mice (Kimura et al., Proc. Natl. Acad. Sci. U.S.A., 95:1195- 1200, 1998). c-mpl-/- mice that carry the Plt8 mutation had a significantly increased number of CFU-S when compared to wildtype littermates; however, this increase was not observed on a c-mpl+/+ background. The difference in CFU-S may be more apparent in c- mpl-/- mice due to their underlying stem cell deficiency (Kimura et al., 1998 (supra)).

Although the CFU-S numbers were not different on the c-mpl+/+ background, transplantation of bone marrow cells demonstrated a competitive advantage for cells that carry the Plt8 mutation irrespective of their c-mpl genotype (see Example 11).

CFU-S number has also been quantified on a C-MpI+/+ background (see Figure 11 and Brief Description of the Figures).

EXAMPLE 8

Hematological profiles ofSuzl2 deficient mice on c-mpt' backgrounds, wild-type backgrounds and in compound mutants

The results of hematological analysis are tabulated in Tables 5 to 11.

Mature megakaryocyte numbers were determined by microscopic examination of hematoxylin and eosin-stained histological sections of sternal bone marrow and spleen. Megakaryocytes were readily recognisable by their large size and distinctive morphology. Numbers of megakaryocyte progenitor cells are also determined in clonal cultures. 2.5xlO 4 bone marrow or 10 5 spleen cells are plated in 0.3% agar in Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% batch-selected fetal or newborn calf serum, and stimulated with a final concentration of 100ng/ml murine SCF, 10ng/ml murine IL-3 (PeproTech, Rocky Hill, NJ) and 4 units/ml human erythropoietin (EPO, Amgen, Thousand Oaks, CA) and incubated for 7 days at 37 0 C in a fully humidified atmosphere of 5% CO2 in air. Cytokines may be obtained from the commercial sources as indicated. Agar cultures are fixed in 2.5% glutaraldehyde, sequentially stained for

acetylcholinesterase, Luxol fast Blue and hematoxylin, and the cellular composition of each colony determined by microscopic examination at 100 to 400-fold magnification. These conditions allowed optimal stimulation of neutrophil, neutrophil-macrophage, macrophage, eosinophil, megakaryocyte, erythroid, multilineage and blast cell colony- forming cells (CFC).

Analysis of general effects on hematopoiesis were conducted by measurements of hematocrits as well as total peripheral blood white cell counts, the latter by performing manual counts using hemocytometer chambers and/or via automated analysis. The relative numbers of morphologically recognisable precursor cells in hematopoietic organs were assessed by manual 100 to 400 cell leukocyte differential counts of peripheral blood, bone marrow, and spleen following preparation of smears or cytocentrifuge preparations stained with May-Grunwald-Giemsa. In addition, the relative numbers of hematopoietic cells expressing lineage-specific cell-surface markers is measured. Single cell suspensions of bone marrow, spleen, peritoneal cells and thymus from adult mice of each genotype are incubated with saturating amounts of 2.4G2 anti-Fc8 receptor antibody to reduce background staining, then with specific monoclonal antibodies to murine cell surface antigens: anti CD4 and CD8, IgM, Ly5-B220, Mac-1, F4/80, Gr-I, Ter-119, and Thyl.2 (Pharmingen, Torrey Pines, CA). Other cell lineage markers are detected, including without limitation, CD34, CD19, CDlO, c-kit, Seal, GrI, Macl, CD19, CD41, CD3, CD4, CD8, CD9, CD42b and CD61. Antibodies may be directly coupled to fluorescein isothiocyanate (FITC) or biotin, the latter being visualised with R-phycoerythrin- streptavidin. Flow cytometric analyses were performed on a FACScan analyser (Becton- Dickinson, Franklin Lakes, NJ) with dead cells and erythrocytes excluded by propidium iodide (lmg/ml) staining and gating of forward angle and side scatter of light.

Histological sections of all major organs are prepared by standard techniques, stained with hematoxylin and eosin and examined by light microscopy for evidence of abnormality.

CFU-s are enumerated by intravenous injection of bone marrow cells into recipient mice that have been irradiated with 11Gy of gamma-irradiation given in two equal doses given

three hours apart from a 137Cs source (Atomic Energy, Ottawa, Canada). Transplanted mice are maintained on oral antibiotic (1.1 g/L neomycin sulfate; Sigma, St. Louis, MO). Spleens are removed after 12 days, fixed in Carnoy's solution (60% ethanol, 30% chloroform, 10% acetic acid), and the numbers of macroscopic colonies were counted.

Clonal cultures of hematopoietic cells are performed, for example, as described by Alexander et al. (Alexander et al, Blood 87: 2162-2170, 1996). Cultures of 2.5xlO 4 adult bone marrow cells or 5x10 4 spleen cells in 1 ml of 0.3% agar in DMEM supplemented with newborn calf serum (20%) are stimulated with a cocktail of 100 ng/ml murine SCF, 10 ng/ml murine IL-3 and 4 U/ml human EPO and incubated for 7 days at 37°C in a fully humidified atmosphere of 10% (v/v) CO 2 in air. Agar cultures are fixed, sequentially stained for acetylcholinesterase, Luxol Fast Blue and hematoxylin, and the cellular composition of each colony determined at 100 to 400-fold magnification. CFU-E and BFU-E are enumerated using methylcellulose cultures. Spleen (5x10 4 ) or bone marrow (2.5x10 4 ) cells are suspended in 1.5% methylcellulose (Fluka) in IMDM supplemented with 20% fetal calf serum. BFU-E are stimulated with 1 μg/ml SCF, 2.5 x 103 U/ml IL-3 and 20 U/ml EPO; CFU-E are stimulated with 10 U/ml EPO. Cultures are incubated at 37°C in a fully humidified atmosphere of 5% (v/v) CO 2 in air for 2 days (CFU-E) or 7 days (BFU-E). Colonies are scored as erythroid, myeloid or mixed-erythroid at 35-fold magnification and colonies appearing to contain erythroid cells are verified by staining with diaminofiuorozine.

For flow cytometry, single-cell suspensions of spleen and bone marrow cells are depleted of erythrocytes by lysis with 156mM ammonium chloride (pH 7.3). Cells are stained with a saturating concentration of IgM-FITC and B220-PE, or Terl 19-PE and CD71-FITC (BD Pharmingen, San Diego, CA). Other cell lineage markers are detected, including without limitation, CD34, CD19, CDlO, c-kit, Seal, GrI, Macl, CD19, CD41, CD3, CD4, CD8, CD9, CD42b and CD61. Dead cells are excluded based on propidium iodide (PI) staining.

To further characterize the hematopoietic progenitor compartment in vitro colony assays were performed with a variety of hematopoietic growth factors. Progenitor cell numbers

and cytokine responsiveness appear normal in Suzl2 Pll8/+ mice (Table 10). Total colony formation in the presence of GM-CSF appeared to be increased in Suzl2 plt8/+ mice independent of the c-mpl genotype. Megakaryocyte progenitor numbers were slightly elevated in cultures from Suzl^" 8 ^ c-mpl +/+ mice, in both the bone marrow and spleen; however, this difference was not statistically significant (see Table 10). These findings reflect some of the changes evident in the peripheral blood.

The PU4 mutation in c-myb was previously shown to elevate platelet count and megakaryocyte progenitor number in c-mpV' ' mice (Carpinelli et ah, Proc. Natl. Acad. Sci. U.S.A., 707:6553-6558, 2004). A substantial increase in platelet count was evident in c-mpV 1' mice that carry both the Pit 4 and the Plt8 mutations (Table 7). The presence of the PU8 mutation resulted in an approximate two-fold increase in platelet count irrespective of the c-myb genotype (i.e. c-myb +/+ , c-myb p!l4/+ or c-myb PU4/PM ). In Plt4 homozygotes this resulted in an increase from 3854 ± 421 x 10 "6 AnI to 5786 ± 1031 x 10 '6 /ml, which represents a platelet count five times greater than a c-mpl +/+ mouse. In this context the presence of the Plt8 mutation was associated with a substantial increase in megakaryocyte progenitor number in the bone marrow (Table 11).

The hematological analysis of compound mutants bearing mutation in Suzl2 and Myb (Plt4 or Plt3) indicate that administration of agents that down regulate the level or activity of Suzl2 and Myb will have a synergistic effect in enhancing the number and/or activity of HSC, hematopoietic progenitor cells and/or mature blood cells (see Table 7).

EXAMPLE 9 Identification of additional proteins that interact with PRC components

Knowledge of additional PRC components, and an understanding of their role in regulating PRC function, will facilitate the design of agents that impair PRC function. This technique is also used to identify novel binding partners for c-myb as inhibitors of these factors and, in some embodiments, these agents are co-administered with inhibitors of transcriptional repressors as described herein.

The biochemical analysis of hematopoietic progenitor cells is restricted by the scarcity of progenitor cells and difficulty associated with isolating a pure population of these cells. The GlME cell line was derived from murine embryonic stem cells that lack the transcription factor Gata-1 (Stachura et al. Blood /07(l):87-97, 2006). The cell line became immortalized after extended culture in thrombopoietin, a cytokine known to enhance commitment to the megakaryocyte lineage. The cells have an immature appearance, however, upon re-introduction of Gata-1 GlME cells mature and form megakaryocytes and to a lesser extent mature erythroid cells. This property is reminiscent of the situation in vivo, where megakaryocytes and erythroid cells share a common progenitor.

To identify additional proteins that are involved in the PRC2 complex in GlME cells monoclonal antibodies directed at Suzl2 and Ezh2 are used to isolate the PRC2 complex, together with binding partners, from nuclear lysates prepared from GlME cells. The bound complex is then dissociated using SDS-PAGE and stained with Coomassie-blue dye to visualize protein bands, individual bands are isolated and proteins are identified. In some embodiments, the proteins are conveniently detected by mass spectrometry. In other embodiments, target proteins are epitope tagged or expressed with binding moieties that are used to identify the protein using other antibodies determined by the epitope or binding moiety, or other binding partners.

EXAMPLE 10

Identification of PRC target genes

Both PRC and c-myb influence lineage specification by regulating the expression of target genes within hematopoietic progenitor cells. To identify PRC2 target genes, the expression of specific PRC2 components in GlME cells has been disrupted by RNA-mediated silencing (see for example Dickins et al. 2005) gene expression in these cells subsequently analysed, for example by microarray. Genes that show altered expression in cells that are deficient in Suzl2, Ezh2 or Eed are candidate target genes of PRC.

The megakaryocyte cell line GlME was used as a model system to study changes in gene expression that are associated with reduced PRC2 function in hematopoietic cells. GlME cells were infected with various retroviral constructs that direct expression of short hairpin RNAs (shRNAs) that have been designed to reduce expression of a target gene (Suzl2, Ezh2 or Eed). Exemplary shRNA for Eed are produced using the following sequence CCGCCCGGACACGCCCACAAAT (SEQ ID NO: 15); for Ezh2 CGCTCTTACTGCTGAGCGTATA (SEQ ID NO: 14); and Suzl2 CCCAAGCACTGTGGTTGAATAA (SEQ ID NO: 13). A scrambled sequence (NONS) and the empty vector (LMP) were used as controls. Cells were maintained in puromycin, a drug that will selectively kill cells that have not been infected with the retrovirus. A western blot (see Figure 7A) was performed to monitor protein expression in transfected GlME cells, specific primary antibodies were used to measure the level of Suzl2, Ezh2, ERK1/2, Histone 3 Lysine 27 tri-methylation (H3-K27-3Me) and total Histone 3 (H3- total). Quantitative real-time PCR (see Figure 7B) was performed using primers specific for Suzl2, Ezh2 and Eed, and expression of these genes was measured relative to Hprtl. In each case, expression was compared to the NONS control and significant differences in expression are highlighted (* = p<0.05, ** = p<0.01, *** = P<0.001)

In order to reduce expression of target genes in human subjects the sequences of the human genes (SEQ ID NO: 3, 5, 7, 9 and 11) are assessed for suitable target sites for inhibitory RNAs. A wide range of web-based shRNA design programs are available to facilitate the design of suitable agents.

To identify genes that are regulated by Suzl2 a global analysis of gene expression was performed with GlME cells that expressed shRNA-Suzl2 as a gene silencing agent.

A global analysis of gene expression was performed with GlME cells that expressed shRNA-Suzl2 as a gene silencing agent to determine the effect of depletion of Suzl2. A large number of genes were up-regulated in Suzl2 knockdown cells when compared to the non-specific control (shRNA-Nons) (83 genes with an adjusted p-value below 0.05 and a

fold change >1.8) (Table 12), and a small proportion of genes were down regulated (14 genes with an adjusted p-value below 0.05 and a fold change >1.5) which included the Suzl2 mRNA (Table 13). Genes that demonstrate altered expression upon inhibition of Suzl2 represent potential transcriptional targets of the PRC2 complex.

GlME cells represent a model system for the study of hematopoietic progenitor cells, it is quite possible that target genes identified in GlME cells are similarly effected in hematopoietic progenitors in Plt8/+ mice. Manipulation of PRC2 function, either through direct inhibition or by modulation of downstream targets, may be an effective way to enhance hematopoietic progenitor activity. As an example, Bmil was identified as a potential target of the PRC2 complex (Table 12) and it has been suggested that forced expression of Bmil in hematopoietic progenitors enhances self-renewal activity, as a result these HSC make a greater contribution to mature blood cell lineages upon transplantation (Iwama et ah, Immunity, 27:843-851, 2004). Accordingly, upregulation of Bmil is excluded from the present invention as a means for enhancing self-renewal activity and enhancing transplantation efficiency.

Very few genes identified in the microarray analysis demonstrated large changes in expression. The majority of differentially expressed targets increased by less than two-fold and only eleven genes demonstrated a fold change greater than ten. A subset of genes was selected for analysis using quantitative real-time PCR (QPCR) to better quantify the magnitude of the change in gene expression (see Table 14).

To verify that these changes were specific to inhibition of Suzl2 an additional shRNA was designed to target the Suzl2 message. It was confirmed that the two shRNA constructs have a similar effect.

EXAMPLE 11

Suzl2 deficiency enhances progenitor activity in competitive transplantation assays

For myeloablative transplants, irradiated C57BL6/Ly5.1 + mice were intravenously injected with approximately 1x10 bone marrow cells from Suzl^ t8/+ mice or compound mutants described herein. In the reciprocal experiment, 1x10 6 bone marrow cells from C57BL6/Ly5.1 + mice were injected into irradiated Suzl2 Pll8/+ or compound mutant mice. All recipient mice were maintained on oral antibiotics and analysed at least 16 weeks after transplantation by flow cytometry and automated blood cell analysis. Other transplant experiments are carried out to determine the in vivo effects of modified cells. For example, competitive transplant experiments are performed wherein mice (Ly 5.1 + ) are transplanted with test donor cells, either wild type or mutant (both Ly5.2 + ) or with wild type competitor cells (Ly5.1 + ). In each case, the competitor marrow shares the same MpI genotypes as the test marrow. In one example, see Figure 8, competitive transplantation studies were performed to test the ability of Suzl2 p " 8/+ stem cells to repopulate the hematopoietic compartment of lethally irradiated recipients. Irradiated recipient mice (Ly 5.1 + ) were transplanted with an equal number of bone marrow cells from a test marrow (LyS^ + ) and competitor marrow (Ly5.1 + ). In total, 2 xlO cells were injected into each recipient. In each case the competitor marrow shared the same MpI genotype as the test marrow. Data shown represent the ratio of Ly5.2/Ly5.1 in total leukocytes, B cells, T cells and myeloid cells (GrI Mac 1). If the test marrow and competitor marrow show equivalent contribution, the ratio should equal 1. Here, the mutant cells show a greater contribution (ratios above 1), and the difference between MpV 1' Suzl2 p " 8/+ and MpV 1' Suzl2 +/+ marrow is significant in both total cells and in the B-cell lineage. The same trend is evident in Mpl +/+ samples.

Further transplant experiments have been performed with primary and secondary recipients of cells with down regulated Suzl2 showing enhanced progenitor activity in B cells, T cells and myeloid cells (see Figure 12 and Brief Description of the Figures).

EXAMPLE 12 Inhibition ofSuzl2 by shRNA-mediated silencing in vivo

Gene silencing constructs (shRNA) were used to disrupt Suzl2 gene expression in the GlME cell line (see Example 10). The studies described in this Example show that other

hematopoietic tissues are similarly affected, and demonstrate that the shRNA constructs work effectively in vivo.

Bone marrow extracted from 5-FU treated mice was infected with either the LMS-Nons or the LMS-Suzl2 virus and transplanted into recipient mice. Thymocytes were isolated 12 weeks after transplantation and fractionated based upon expression of GFP (+ or -); low or intermediate populations were detected in some mice (low). Protein lysates were prepared from sorted cells and Western blotting was performed to detect expression of Suzl2, Ezh2 or histone H3. The results (see Figure 13 and Brief Description of the Figures) show that Suzl2 and Ezh2 protein levels are reduced in cells that are infected with the LMS-Suzl2 virus.

EXAMPLE 13

Hematopoietic tissue infected with Suzl2-shRNA contributes more to haematopoiesis than cells infected with a control virus

Bone marrow extracted from 5-FU treated mice was infected with either the LMS-Nons or the LMS-Suzl2 virus and transplanted into recipient mice. Three independent infections were performed and in each case infected cells were transplanted into five recipient animals. A selection of primary recipients (9-11) were used as donors for secondary transplants, in each case these cells were transplanted into 3-5 recipient mice. The frequency of cells that carried the virus (GFP+) was monitored prior to transplantation (Input) and at 8-12 weeks after transplantation in primary or secondary recipients. To determine the ability of infected cells to contribute to hematopoiesis, the representation of GFP+ cells was compared between donor and recipient populations and a ratio calculated (Recipient GFP%/Donor GFP%). Equal representation in recipient and donor populations would result in a ratio of 1.0. The representation of cells infected with LMS-Suzl2 continued to increase over the course of the experiment, whereas the representation of LMS-Nons cells remained constant.

These results (see Figure 14) demonstrate that inhibition of Suzl2 by shRNA-mediated silencing enhances contribution to hematopoiesis, and further support the results obtained with mice that carry the Suzl2 PI ' 8 mutation.

A recent study performed by Chen et al. (2007) demonstrated that lentivirus-mediated delivery of shRNAs that target Ezh2 reduced tumour burden in an animal model of heptocellular carcinoma. This work demonstrates the feasibility of using shRNA constructs that target PRC2 in vivo. As shown herein inhibition of the PRC2 complex, either through delivery of shRNA constructs or small molecules that impair PRC2 or Suzl2 activity, may be an effective way to enhance hematopoietic stem cell function.

EXAMPLE 13

The use of the Plt8 mouse as a calibrator for in vivo work with PRC2 inhibitors

The Suzl2 gene is haploinsufficient, such that two functional copies of the Suzl2 gene are required for production of the appropriate level of Suzl2 protein to maintain PRC2 function. Plt8 mice have a reduced amount of Suzl2 protein which results in functional impairment of the PRC2 complex. Many PRC components are over-expressed in human cancers, particularly in aggressive metastatic disease (Sparmann et al., Nat. Rev. Cancer, 5:846-856, 2006). This finding has lead to the hypothesis that inhibitors of the PRC2 complex may be useful in treating cancer.

The generation of mice that carry a mutation in Plt8 will allow researchers to determine the effect of reduced PRC2 function in different animal disease models. If disease symptoms are reduced in the presence of the Plt8 mutation then it is likely that inhibition of the PRC2 complex would have efficacy in treating disease in humans.

Similarly the identification of raised platelet count in Plt8 mice provides researchers the opportunity to calibrate the effective concentration of PRC2 inhibitors in vivo. In that, injection of these compounds into MpT' ' animals would likely result in elevation in platelet

count. This assay would allow for batch testing of drug compounds to ensure consistency in the delivery of active drug in vivo.

As illustrated herein, MpI 1' mice provide a method for identifying epigenetic modulators and/or modulators of Suzl2 or a PcG in genetic or proteinaceous form.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

Table 1 Summary of sequence identifiers

Table 2 Amino acid sub-classification

Table 3 Exemplary and Preferred Amino Acid Substitutions

Table 4 Codes for non-conventional amino acids

Non-conventional Code Non-conventional Code amino acid amino acid

α-aminobutyric acid Abu L-N-methylalanine Nmala α-amino-α-methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N-methylaspartic acid Nmasp aminoisobutyric acid Aib L-N-methylcysteine Nmcys aminonorbornyl- Norb L-N-methylglutamine Nmgln carboxylate L-N-methylglutamic acid Nmglu cyclohexylalanine Chexa L-Nmethylhistidine Nmhis cyclopentylalanine Cpen L-N-methylisolleucine Nmile

D-alanine Dal L-N-methylleucine Nmleu

D-arginine Darg L-N-methyllysine Nmlys

D-aspartic acid Dasp L-N-methylmethionine Nmmet

D-cysteine Dcys L-N-methylnorleucine Nmnle

D-glutamine DgIn L-N-methylnorvaline Nmnva

D-glutamic acid DgIu L-N-methylornithine Nmorn

D-histidine Dhis L-N-methylphenylalanine Nmphe

D-isoleucine DiIe L-N-methylproline Nmpro

D-leucine Dleu L-N-methylserine Nmser

D-lysine Dlys L-N-methylthreonine Nmthr

D-methionine Dmet L-N-methyltryptophan Nmtrp

D-ornithine Dorn L-N-methyltyrosine Nmtyr

D-phenylalanine Dphe L-N-methylvaline Nmval

D-proline Dpro L-N-methylethylglycine Nmetg

D-serine Dser L-N-methyl-t-butylglycine Nmtbug

D-threonine Dthr L-norleucine NIe

D-tryptophan Dtrp L-norvaline Nva

D-tyrosine Dtyr α-methyl-aminoisobutyrate Maib

D-valine Dval α-methyl-γ-aminobutyrate Mgabu

D-α-methylalanine Dmala α-methylcyclohexylalanine Mchexa

D-α-methylarginine Dmarg α-methylcylcopentylalanine Mcpen

D-α-methylasparagine Dmasn α-methyl-α-napthylalanine Manap

D-α-methylaspartate Dmasp α-methylpenicillamine Mpen

D-α-methylcysteine Dmcys N-(4-aminobutyl)glycine NgIu

D-α-methylglutamine Dmgln N-(2-aminoethyl)glycine Naeg

D-α-methylhistidine Dmhis N-(3 -aminopropyl)glycine Norn

D-α-methylisoleucine Dmile N-amino-α-methylbutyrate Nmaabu

D-α-methylleucine Dmleu α-napthylalanine Anap

D-α-methyllysine Dmlys N-benzylglycine Nphe

D-α-methylmethionine Dmmet N-(2-carbamylethyl)glycine NgIn

D-α-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn

D-α-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine NgIu

D-α-methylproline Dmpro N-(carboxymethyl)glycine Nasp

D-α-methylserine Dmser N-cyclobutylglycine Ncbut

D-α-methylthreonine Dmthr N-cycloheptylglycine Nchep

D-α-methyltryptophan Dmtrp N-cyclohexylglycine Nchex

D-α-methyltyrosine Dmty N-cyclodecylglycine Ncdec

D-α-methylvaline Dmval N-cylcododecylglycine Ncdod

D-N-methylalanine Dnmala N-cyclooctylglycine Ncoct

D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro

D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund

D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm

D-N-methylcysteine Dnmcys N-(3,3-diphenylpropyl)glycine Nbhe

D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg

D-N-methylglutamate Dnmglu N-( 1 -hydroxyethyl)glycine Nthr

D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser

D-N-methylisoleucine Dnmile N-(imidazolylethyl))glycine Nhis

D-N-methylleucine Dnmleu N-(3-indolylyethyl)glycine Nhtrp

D-N-methyllysine Dnmlys N-methyl-γ-aminobutyrate Nmgabu

N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet D-N-methylornithine Dnmorn N-methylcyclopentylalanine Nmcpen

N-methylglycine NaIa D-N-methylphenylalanine Dnmphe

N-methylaminoisobutyrate Nmaib D-N-methylproline Dnmpro

N-(I -methylpropyl)glycine Nile D-N-methylserine Dnmser

N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr D-N-methyltryptophan Dnmtrp N-(l-methylethyl)glycine Nval

D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap

D-N-methylvaline Dnmval N-methylpenicillamine Nmpen γ-aminobutyric acid Gabu N-(/?-hydroxyphenyl)glycine Nhtyr

L-t-butylglycine Tbug N-(thiomethyl)glycine Ncys L-ethylglycine Etg penicillamine Pen

L-homophenylalanine Hphe L-α-methylalanine Mala

L-α-methylarginine Marg L-α-methylasparagine Masn

L-α-methylaspartate Masp L-α-methyl-f-butylglycine Mtbug

L-α-methylcysteine Mcys L-methylethylglycine Metg L-α-methylglutamine MgIn L-α-methylglutamate MgIu

L-α-methylhistidine Mhis L-α-methylhomophenylalanine Mhphe

L-α-methylisoleucine Mile N-(2-methylthioethyl)glycine Nmet

L-α-methylleucine Mleu L-α-methyllysine Mlys

L-α-methylmethionine Mmet L-α-methylnorleucine MnIe L-α-methylnorvaline Mnva L-α-methylornithine Morn

L-α-methylphenylalanine Mphe L-α-methylproline Mpro

L-α-methylserine Mser L-α-methylthreonine Mthr

L-α-methyltryptophan Mtrp L-α-methyltyrosine Mtyr

L-α-methylvaline Mval L-N-methylhomophenylalanine Nmhphe N-(N-(2,2-diphenylethyl) Nnbhm N-(N-(3,3-diphenylpropyl) Nnbhe

carbamylmethyl)glycine carbamylmethyl)glycine l-carboxy-l-(2,2-diphenyl- Nmbc ethylamino)cyclopropane

Table 5. Hematological profile ofSuzH deficient mice on a c-mpf ' background

Genotype

Suzl2 +/+ Suzlf" 8/+ Suzl2 S02/+

Peripheral Blood n = 29 n = 24 n =

Platelet Count (xlO- 6 /ml) 107.4 ± 44.8 252.1 ± 54.0* ±

Mean Platelet Volume (fl) 8.47 ± 1.45 7.54 ± 0.63 ±

Hematocrit (%) 53.1 ± 1.66 53.0 ± 2.78 ±

White Cell Count (xlθ' 3 /ml) 8.33 ± 1.62 10.5 ± 1.53* ±

Neutrophils 0.63 ± 0.26 0.66 ± 0.25 ±

Lymphocytes 7.31 ± 1.50 9.30 ± 1.46* ±

Monocytes 0.02 ± 0.01 0.03 ± 0.01 ±

Eosinophils 0.08 ± 0.03 0.11 ± 0.03 ±

Bone Marrow n = ll n = 7 n=

Cellularity (xlO-fyfemur) ± ± ±

Blasts (%) ± ± ±

Promyelocytes/Myelocytes (%) ± ± ±

Metamyelocytes/Neutrophils (%) ± ± ±

Lymphocytes (%) ± ± ±

Monocytes (%) ± ± ±

Eosinophils (%) ± ± ±

Nucleated erythroid cells (%) ± ± ±

Genotype

Suzl2 ,+/+ Suzl? lt8/+ Suzl2 m/+

Megakaryocytes (per 10 hpf) # 8.24 ± 2.03 16.0 ± 4.13* ±

Spleen n = 6 n = 6 n =

Weight (mg) 72.8 ± 5.68 74.5 ± 11.7 ±

Blasts (%) ± ± ±

Promyelocytes/Myelocytes (%) ± ± ±

Metamyelocytes/Neutrophils (%) ± ± ±

Lymphocytes (%) ± ± ±

Monocytes (%) ± ± ±

Eosinophils (%) ± ± ±

Nucleated erythroid cells (%) ± ± ±

Megakaryocytes (per 10 hpfr ± ± ± Peritoneal Cells

Cellularity (xlO- 6 ) ± ± ±

Metamyelocytes/Neutrophils (%) ± ± ±

Lymphocytes (%) ± ± ±

Monocytes (%) ± ± ±

Eosinophils (%) ± ± ±

Mast Cells ± ± ±

Table 6. Hematological profile ofSuzl2 deficient mice on a c-mpt /+ background

Genotype

Suzl2 +/+ Suzlf 1 ' 8 * Suzl2 502/+

Peripheral Blood n=18 n=18 n=5

Platelet Count (xlO- 6 /ml) 1122± 121 1285 ±167 1256 ±184

Mean Platelet Volume (fl) 6.17 ±0.66 6.48 ± 0.73 6.54 ± 0.94

Hematocrit (%) 53.9 ±2.51 53.8 ±1.71 59.44 ±3.13

White Cell Count (xlθ" 3 /ml) 9.06 ±1.48 12.4 ±1.70* 10.2 ±1.91

Neutrophils 0.81 ±0.22 0.90 ±0.18 1.00 ±0.23

Lymphocytes 7.77 ±1.40 10.8 ±1.51* 8.72 ±1.80

Monocytes 0.09 ± 0.03 0.14 ±0.04 0.11 ±0.04

Eosinophils 0.17 ±0.04 0.23 ± 0.08 0.17 ±0.09

Bone Marrow n=ll n=3 n=

Cellularity (xlO- 6 /femur) ± ± ±

Blasts (%) ± ± ±

Promyelocytes/Myelocytes (%) ± ± ±

Metamyelocytes/Neutrophils (%) ± ± ±

Lymphocytes (%) ± ± ±

Monocytes (%) ± ± ±

Eosinophils (%) ± ± ±

Nucleated erythroid cells (%) ± ± ±

Megakaryocytes (per 10 hpf)# 58.0 ± 7.43 62.4 ± 8.76 ±

Spleen n=6 n=6 n=6

Weight (mg) ± ± ±

Blasts (%) ± ± ±

Promyelocytes/Myelocytes (%) ± ± ±

Metamyelocytes/Neutrophils (%) ± ± ±

Genotype

Suzl2 +/+ Suzlf^ Suzl2 m «

Lymphocytes (%) ± ± ±

Monocytes (%) ± ± ±

Eosinophils (%) ± ± ±

Nucleated erythroid cells (%) ± ± ±

Megakaryocytes (per 10 hpf)# ± ± ±

Peritoneal Cells

Cellularity(xlO- 6 ) ± ± ±

Metamyelocytes/Neutrophils (%) ± ± ±

Lymphocytes (%) ± ± ±

Monocytes (%) ± ± ±

Eosinophils (%) ± ± ±

Mast Cells ± ± ±

Table 7 Hematological profile of compound mutants

Genotype

Myb PM/+ Myb .P r U4/+ Myb PM/PU4 Myb PU4/PU4 Suzl2 ,+/+ Suzlf U8/+ Suzl2 +/+ Suzl2 PU8/+

Peripheral Blood n = 44 n = 38 n = 17 n = 15

Platelet Count (xlθ" 6 /ml) 422 ±136 749 ± 182* 3854 ± 421 5786 ±1031*

Mean Platelet Volume (fl) 7.3 ±1.08 7.55 ± 0.93 7.58 ± 1 .46 9.05 ± 2.07

Hematocrit (%) 53.5 ±3.23 54.1 ± 4.09 48.9 ± 5 .46 42.1 ±9.55

White Cell Count (xl 0-3/ml) 7.76 ±1.85 9.27 ±1.86* 2.87 ±0.68 2.72 ±1.17 Neutrophils 0.76 ±0.24 0.76 ±0.23 0.43 ±0.15 0.32 ± 0.24

Lymphocytes 6.64 ±1.64 8.04 ±1.61* 2.02 ±0.53 2.00 ± 0.73

Monocytes 0.06 ±0.03 0.08 ±0.03 0.03 ±0.01 0.03 ± 0.02

Eosinophils 0.16 ±0.06 0.18 ±0.06 0.02 ±0.02 0.04 ± 0.02

TABLE 8 Peripheral blood profile ofSuzlf m/Jr mice

TABLE 9

Peripheral blood profile ofSuzl?™* andSuzlf 02 ^ mice

TABLE 10

Cytokine responsiveness of progenitors in Suzl^ m/ ^ bone marrow

TABLE 11

Megakaryocyte progenitor number in c-mpf ' mice with mutations in both Suzl2 and c-Myb

TABLE 12

Genes that are up-regulated in GlME cells that express shRNλ-Sul2.

TABLE 13

Genes that are down-regulated in GlME cells that express shRNA-Sul2

TABLE 14 Confirmation of gene expression changes in GlME cells that express shRNA-Sul2

1

kinase 3

BIBLIOGRAPHY

Akashi et al, Nature, 404(6774): 193-197, 2000.

Alexander et al, Blood 87: 2162-2170, 1996 Altschul et al, Nucl. Acids Res. 25:3389, 1997.

Amsellem et al, Nat, Med., P(l l):1423-1427, 2003.

Arkin et al, Proc. Natl. Acad. Sci. USA, 59:7811-7815, 1992.

Ausubel et al, Current Protocols in Molecular Biology John Wiley & Sons Inc, 1994-

1998, Chapter 15. Bacher et al, Drug Discovery Today, J(6):265-273, 1998.

Birve et al, Development, 128:3371-3379, 2001.

Bonner et al, Eur. J. Biochem., 4(5:83, 1974.

Bradley et al, Nature, 274(87):511, 1967.

Cao et al, Science, 298: 1039-1043, 2002. Cao et al, Curr. Opin. Genet. Dev., 74:155-164, 2004.

Carpinelli et al, Proc. Natl. Acad. Sci. U.S.A., 707:6553-6558, 2004

Chen et al, Hepatology 4J(l):200-208, 2007.

Cheng et al, Science, 287 (5459); 1804- 1808, 2000.

Cohen et al, J. Med. Chem., 33:883-894, 1990. Coligan et al, CURRENT PROTOCOLS IN PROTEIN SCIENCE (John Wiley & Sons,

Inc. 1995-1997.

Collett et al, Clin. Cancer Res. 72:1168-1174, 2006.

Conner et al, Proc. Natl. Acad. Sci. USA, £0:278-282, 1983.

Culver (Gene Therapy: A Primer for Physicians, 2 nd Ed., Mary Ann Liebert, 1996. Dayhoff et al, Natl. Biomed. Res. Found, 5:345-358,1978.

Delgrave et al, Protein Engineering, 5:327-331, 1993.

Dickins et al, Nature Genetic 37(11):1289-1295, 2005.

Douillard et al, Basic Facts about Hybridomas, in Compendium of Immunology Vol. II, ed. by Schwartz, 1981. Finkelstein et al, Genomics, 7: 167-172, 1990.

Fodor et α/., Science, 257:767, 1991.

Friedman, In: Therapy for Genetic Disease, T. Friedman, Ed., Oxford University Press, pp.

105-121, 1991.

Gold et al, Annu. Rev. Biochem., 54:763-797.1995.

Gonnet et α/., Science, 256(5062): 1443-1445, 1992. Grompe et al, Proc. Natl. Acad. Sci. USA, £6:5855-5892, 1989.

Grompe, Proc. Natl. Acad. Sci. USA, 5(5:5855-5892, 1993.

Hacia et al, Nature Genetics, 14:441-441, 1996.

Hodgson, Bio/Technology, 9:19-21, 1991.

Hogan et al, Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbour Laboratory Press, CSH NY, 1986.

Iwama et al, Immunity, 27:843-851, 2004.

Jayasena, Clin. Chem., 45(9):1628-1650, 1999.

Jenuwein et al, Science, 293: 1074-1080, 2001.

Johnson et al, "Peptide Turn Mimetics" in Biotechnology and Pharmacy, Pezzuto et al, eds Chapman and Hall, New York, 1993.

Johnstone, Nat. Rev. Drug Discov., 7:287-299, 2002.

Johnstone et al, Cancer Cell, 4:13-18, 2003.

Kimura et al, Proc. Natl. Acad. Sci. U.S.A., 95:1195-1200, 1998.

Kinszler et al, Science, 257:1366-1370, 1991. Kirmizis et al, MoI. Cancer Ther., 2:113-121, 2003.

Kleer et al, Proc. Natl. Acad. Sci. U.S.A., 700:11606-11611, 2003.

Kohler et al, Nature, 256:495-499, 1975.

Kohler et al, European Journal of Immunology, (5:511-519, 1976.

Kondo et al, Cell, 97(5):661-672, 1997. Koontz et al, Proc. Natl. Acad. Sci. U.S.A., 95:6348-6353, 2001.

Kunkel, Proc. Natl. Acad. Sci. USA, 52:488-492, 1985.

Kunkel et al, Methods in Enzymol., 754:367-382, 1987.

Kuzmichev et al, Genes Dev. 7(5:2893-2905, 2002.

Kyte et al, J. MoI. Biol., 757:105-132, 1982. Lund et al, Curr. Opin. Cell. Biol, 7(5:239-246, 2004.

MacDonald et al, Molecular Cell, 20:199-211, 2005.

McKercher et al, EMBO. J., 75(20):5647-5658, 1996.

Mansour et al, Nature, 33(5:348-352, 1988.

Marks et al, J. Natl. Cancer Inst., 92:1210-1216, 2000.

Marmur et al, J. MoI. Biol., 5:109, 1962. Matsukawa et al, Cancer Sci., 97:484-491, 2006.

Meng et al, J. Comp. Chem., 75:505-524, 1992.

Modrich, Ann. Rev. Genet., 25:229-253, 1991.

Morris et al, Proc. Natl. Acad. Sci., USA, 95(6):2902-2907, 1998.

Navia et al, Current Opinions in Structural Biology, 2:202-210, 1992. Newtown et al, Nucl. Acids. Res. 77:2503-2516, 1989.

O'Carroll et al, MoI. Cell. Biol., 27:4330-4336, 2001.

Orita et al, Proc. Nat. Acad. Sci. USA, 55:2776-2770, 1989.

Pasini et al, Embo. J., 23:4061-4071, 2004.

Peart et al, Proc. Natl. Acad. Sci. U.S.A., 702:3697-3702, 2005. Pevny et al, Nature, 349(6306):257-260, 1991.

Pickert, Transgenic Animal Technology: A Laboratory Handbook, Academic Press, San

Diago, CA, 1994.

Remington's Pharmaceutical Sciences, 18 th Ed. (1990, Mack Publishing, Company,

Easton, PA, U.S.A. Rein et al, Nucleic Acids Research, 25(10):2255-2264, 1998.

Roberge et al, Science, 269:202, 1995.

Ruano et al, Nucl. Acids. Res. 77:8392, 1989.

Saramaki et al, Genes Chromosomes Cancer, 45:639-645, 2006.

Saurin et al, Nature, 472:655-660, 2001. Scott et al, Science, 255(5178):1573-1577, 1994.

Sheffield et al, Proc. Natl. Acad. Sci. USA, S<5:232-236, 1989.

Sheffield et al, Am. J. Hum. Genet., 49:699-706, 1991.

Shoemaker et al, Nature Genetics, 74:450-456, 1996.

Shumacher et al, Nature, 553:250-253, 1996. Sparmann et al, Nat. Rev. Cancer, 6:846-856, 2006.

Stachura et al, Blood, 707(l):87-97, 2006.

Su et al, Nat. Immunol., 4: 124-131, 2003.

Summerton et al, Antisense and Nucleic acid Drug Development, 7:187-195, 1997.

Tan et al, Genes and Development, 27(9):1050-1063, 2007.

Till et al, Radiat. Res., 74:213-222, 1961. van den Oudenrijn, et al, British Journal of Haematology, 2000.

Varambally et al, Nature, 479:624-629, 2002.

Vasilescu et al, Proteomics, 4:3845-3854, 2004.

Wartell et al, Nucl. Acids Res., 75:2699-2705, 1990.

Watson et al, "Molecular Biology of the Gene", Fourth Edition, Benjamin/Cummings, Menlo Park, Calif., 1987.

Wells, Methods Enzymol., 202:2699-2705, 1991.

Weinmann et al, Methods, 25:37-47, 2002.

White et al, Genomics, 72:301-306, 1992.

White, Cell Death and Differentiation, 73:1371-1377, 2006. Yamamoto et al, The Journal of Biological Chemistry, 27P(l):401-406, 2004.

Yin, J. Am. Chem. Soc, 727(15):5463-5468, 2005.

Zhu et al, Oncogene, 27(21):3295-3313, 2002.

Zubay, Biochemistry, third edition, Wm.C. Brown Publishers, 1993.




 
Previous Patent: SYNTHESIS OF FATTY ACIDS

Next Patent: SHEAR PLATE