"METHODS FOR PRODUCING RECOMBINANT FACTOR VIII CHAINS

FROM NON-FILAMENTOUS FUNGI, THEIR FUNCTIONAL RECONSTITUTION AND APPLICATIONS THEREOF"

TECHNICAL FIELD

The present disclosure is in the field of haemophilia therapeutics, particularly recombinant Factor VIII protein products. The present disclosure relates specifically to a process of producing heavy chain peptide and/or light chain peptide of recombinant Factor VIII protein using non-filamentous fungi, particularly Pichia pastoris. The disclosure further relates to a process of producing a functional recombinant Factor VIII protein by reconstituting the Heavy chain and Light chain produced using said Pichia pastoris expression system. The said functional recombinant Factor VIII protein shows improved activity and therefore is used in the management of haemophilia.

BACKGROUND AND PRIOR ART OF THE DISCLOSURE Factor VIII: C (FVIII: C) is an essential blood coagulation factor, whose absence or loss of activity results in the clotting disorder Haemophilia A. Activated factor VIII: C acts as a cofactor to activated factor IX which together activate factor X in the coagulation cascade.

Factor VIII: C (FVIII: C) is a plasma protein essential for blood coagulation whose deficiency or defective formation results in the blood clotting disorder known as Haemophilia A (Lenting et.al, 1998). FVIII: C is synthesized as a 300-kd precursor protein comprising of six domains: Al, A2, B, A3, CI and C2. In the plasma, upon limited proteolysis by thrombin, it circulates as a heterodimer consisting of the heavy chain (A1-A2-B domains) and light chain (A3-C1-C2 domains) linked by a Calcium (II) ion through the Al and A3 domains. This FVIII: C heterodimer circulates in the plasma as a non-covalent complex with von Willerbrand Factor (vWF), a large ~220kDa multimeric protein (Sadler, 1998). The association of FVIII: C with vWF results in its increased circulatory half-life, by avoiding premature proteolytic activation of factor VIII: C (Saenko et. al., 1999). While still in circulation, the heavy chain is further proteolysed where the B-domain is deleted. FVIII: C is activated by further proteolysis of the heavy chain resulting in a heterotrimer consisting of Al, A2 and A3-C1-C2 subunits (Shen et.al, 2008). Active FVIII: C (FVIII: Ca) associates with activated Factor IX (FIXa) to form the "X-ase" (ten-as ) complex which activates Factor X (FXa). FXa along with activated Factor V (FVa) activates the prothrombinase complex that converts prothrombin to thrombin resulting in a blood clot (Wang et.al., 2003). However, FVIII: Ca quickly loses its activity through one of the following mechanisms: (i) by spontaneous dissociation of the A2 subunit from the Al— A3C1C2 complex (Fay and Smudzin, 1992), or (ii) by proteolytic degradation by activated protein C, thrombin, FXa, FIXa, etc. (Fay, 2004). FVIII: Ca is thus quickly cleared from the system.

The light chain of factor VIII: C has sites for phospholipid binding and vWF binding in the C2 domain (Nogami et. al., 2007), while the heavy chain is primarily responsible for the correct orientation of the factor VIII: C light chain-heavy chain complex and also for binding to factor IXa through the Al domain at residues in the region between amino acids 558-565 and residues near amino acid 712 (Ngo et. al, 2008), which is essential to provide coagulation activity.

Haemophilia A is caused by either absence or the loss of factor VIII: C activity, which could be due to a number of reasons, including genetic defects resulting in the improper folding/secretion of factor VIII: C (White and Shoemaker, 1989) or development of autoantibodies against factor VIII: C (Shima, 2006). To counter the deficiency or the loss of factor VIII: C activity observed in haemophilia patients, FVIII: C is administered as plasma concentrates (Marchesi et.al., 1972), or as recombinant factor VIII: C expressed using mammalian cells (Wood et.al., 1984; Kaufman et.al., 1988). The purification of factor VIII: C from plasma-derived sources is limited by two major bottlenecks: the scarcity in obtaining sufficient amounts of plasma from healthy donors to purify factor VIII: C; and the risk of viral contamination, though methods to reduce the risk of viral contamination have evolved through solvent/detergent extraction methods (Mannucci, 2010). These considerations made recombinant factor VIII: C an alternate option for the treatment of Haemophilia A. Recombinant factor VIII: C preparations were first made in 1980s (Wood et. al., 1984). Furthermore, it has been shown that the B-domain of FVIII: C is dispensable for its coagulation activity (Eaton et.al., 1986). A number of B-domain deleted factor VIII: C products like ReFacto®/Xyntha™ (Wyeth Pharma) are currently available in the market. However, this B-domain deleted factor VIII: C (BDD-FVIII: C) is still a large molecule of five domains thus making its expression difficult. Conventional Haemophilia A therapy involves the infusion of either plasma-derived Factor VIII: C or recombinant Factor VIII: C expressed in mammalian expression systems. The scarcity and risk in obtaining plasma-derived Factor VIII: C, the difficulty in expressing full length recombinant Factor VIII: C demands newer methods and or alternate strategies for producing functional Factor VIIIC therapeutic molecule.

The present disclosure aims at overcoming the drawbacks of the prior art by making use of Pichia pastoris expression system to generate functional factor VIII chains.

STATEMENT OF THE DISCLOSURE

Accordingly, the present disclosure relates to a DNA construct comprising polynucleotide sequence having at least 95% sequence identity to sequence as set forth in SEQ ID NO.l; A DNA construct comprising polynucleotide sequence having at least 95% sequence identity to sequence as set forth in SEQ ID NO. 3; A vector comprising polynucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO.3 or a combination thereof; A host cell comprising polynucleotide sequence of SEQ ID NO. 1, SEQ ID NO.3 or a combination thereof; A host cell comprising the vector comprising polynucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO.3 or a combination thereof; A process for obtaining heavy chain peptide or light chain peptide of recombinant Factor VIII protein or a combination thereof, said method comprising act of culturing cells of non-filamentous fungi comprising nucleotide sequence corresponding to the peptide to obtain said peptide; A process for obtaining recombinant factor VIII protein, said process comprising acts of: (a) introducing the polynucleotide sequence of claim 1 or the polynucleotide sequence of claim 3 or a combination thereof into a host cell to obtain corresponding polypeptides individually or in combination; or (b) introducing the vector as claimed in claim 5 into a host cell to obtain corresponding polypeptides individually or in combination; and (c) reconstituting the polypeptides produced by step (a) or (b) to obtain the recombinant Factor VIII protein; and a recombinant factor VIII protein obtained by said process.

BRIEF DESCRIPTION OF ACCOMPANYING FIGURES

In order that the invention may be readily understood and put into practical effect, reference will now be made to exemplary embodiments as illustrated with reference to the accompanying figures. The figures together with a detailed description below, are incorporated in and form part of the specification, and serve to further illustrate the various embodiments, principles and advantages, in accordance with the present disclosure where:

Figure 1 depicts the heavy chain (A) and light chain (B) constructs of Factor VIII: C in Pichia expression vector pPICZaA. Figure 2 depicts western blot analysis of expression of heavy chain of factor VIII: C in Pichia pastoris GS115. Lanes 1-3 correspond to uninduced cultures: cell control, vector control, heavy chain clone HC1. Lanes 5-7 correspond to cultures induced for 90hrs: cell control, vector control and heavy chain clone HC 1 respectively.

Figure 3 depicts (A) SDS-PAGE and (B) western blot analysis of expression of light chain of factor VIII: C in Pichia pastoris GS115. Lane 1- plasma cryoprecipitate; Lanes 2-4 correspond to uninduced cultures: heavy chain clone HC1 and two light chain clones LCI & LC2 respectively. Lanes 5-7 correspond to cultures induced for 90hrs: heavy chain clone HC1 and two light chain clones LCI & LC2 respectively.

Figure 4 depicts the purification results of heavy chain FVIII: C. The figure showcases chromatogram (A) and SDS-PAGE (B) and western blot (C) analysis under non-reducing conditions and SDS-PAGE under reducing conditions (D). Further, the lanes correspond to control Pichia broth which doesn't express heavy chain (-), medium range protein marker (M), vector control broth (C), load (L), unbound fractions (F, F'), bound fractions eluted at pH 6.0/5.0/4.0 (6,5,4) and EDTA-eluted fraction (E). Figure 5 depicts the purification results of light chain FVIII: C. The figure showcases (A) chromatogram, (B) 10% SDS-PAGE analysis under non-reducing conditions and (C) ELISA analysis of various fractions. The Load (L), Unbound fractions (1, 2) and Eluted fraction (3, 4) are analyzed, in addition to blank (-), commercially purified Factor VIII: C (+, used as positive control) and a control Pichia broth (Co-) not expressing the light chain protein. DETAILED DESCRIPTION OF THE DISCLOSURE

The present disclosure relates to a DNA construct comprising polynucleotide sequence having at least 95% sequence identity to sequence as set forth in SEQ ID NO.1.

In an embodiment of the present disclosure, said sequence encodes a polypeptide corresponding to Factor VIII heavy chain. The present invention relates to a DNA construct comprising polynucleotide sequence having at least 95% sequence identity to sequence as set forth in SEQ ID NO. 3.

In an embodiment of the present disclosure, said sequence encodes a polypeptide corresponding to Factor VIII light chain. The present invention relates to a vector comprising polynucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO.3 or a combination thereof.

The present invention relates to a vector comprising polynucleotide sequence as set forth in SEQ ID NO. 1.

In an embodiment of the present disclosure, the vector comprising SEQ ID NO. 1 has been deposited under accession number MTCC 5854.

The present invention relates to a vector comprising polynucleotide sequence as set forth in SEQ ID NO.3.

In an embodiment of the present disclosure, the vector comprising SEQ ID NO. 3 has been deposited under accession number MTCC 5853. The present invention relates to a vector comprising polynucleotide sequence as set forth in SEQ ID NO. 1 and SEQ ID NO.3.

The present invention relates to a host cell comprising polynucleotide sequence of SEQ ID NO. 1, SEQ ID NO. 3 or a combination thereof

The present invention relates to a host cell comprising the vector comprising polynucleotide sequence as set forth in SEQ ID NO. 1.

The present invention relates to a host cell comprising the vector comprising polynucleotide sequence as set forth in SEQ ID NO. 3.

The present invention relates to a host cell comprising the vector comprising polynucleotide sequence as set forth in SEQ ID NO. 1 and SEQ ID NO. 3. The present invention relates to a process for obtaining heavy chain peptide or light chain peptide of recombinant Factor VIII protein or a combination thereof, said method comprising act of culturing cells of non-filamentous fungi comprising nucleotide sequence corresponding to the peptide to obtain said peptide.

The present invention relates to a process for obtaining heavy chain peptide of recombinant Factor VIII protein, said method comprising act of culturing cells of non-filamentous fungi comprising nucleotide sequence corresponding to the heavy chain peptide.

The present invention relates to a process for obtaining light chain peptide of recombinant Factor VIII protein, said method comprising act of culturing cells of non-filamentous fungi comprising nucleotide sequence corresponding to the light chain peptide.

In an embodiment of the present invention, the heavy chain peptide corresponds to polynucleotide sequence of SEQ ID NO. 1, the light chain peptide corresponds to the polynucleotide sequence of SEQ ID NO. 3 and the non- filamentous fungi is selected from a group comprising, but not limiting to, Pichia pastoris, Saccharomyces cerevisiae and Hansenula polymorpha, preferably Pichia pastoris.

The present invention relates to a process for obtaining recombinant factor VIII protein, said process comprising acts of:

a. introducing the polynucleotide sequence of SEQ ID NO. 1 or the polynucleotide sequence of SEQ ID NO. 1 or a combination thereof into a host cell to obtain corresponding polypeptides individually or in combination; or

b. introducing the vector comprising polynucleotide sequence of SEQ ID NO. 1, SEQ ID NO. 3 or a combination thereof into a host cell to obtain corresponding polypeptides individually or in combination; and

c. reconstituting the polypeptides produced by step (a) or (b) to obtain the recombinant Factor VIII protein.

In an embodiment of the present invention, the host cell is a non-filamentous fungi.

In an embodiment of the present invention, the non-filamentous fungi is selected from a group comprising, but not limiting to, Pichia pastoris, Saccharomyces cerevisiae and Hansenula polymorpha, preferably Pichia pastoris.

In an embodiment of the present invention, the reconstitution is carried out in the presence of divalent metal ions. In an embodiment of the present invention, the reconstitution is carried out in the presence of Ca ⁺⁺ or Cu ⁺⁺ ions or a combination thereof.

In an embodiment of the present invention, the process further comprise purification of said polypeptides.

In an embodiment of the present disclosure, the purification of said polypeptides is carried out individually or in combination.

In an embodiment of the present invention, the purification of said polypeptides is carried out by chromatographic techniques.

In an embodiment of the present invention, the purification of said polypeptides is carried out by IMAC (immobilized metal ion affinity chromatography) and HLAC (Histidine Ligand Affinity Chromatography.

In an embodiment of the present invention, the purification of heavy chain peptide is carried out by IMAC.

In an embodiment of the present invention, the purification of heavy chain peptide involves elution at a pH ranging from 4.5 to 5.8, preferably 5.0.

In an embodiment of the present invention, the purification of light chain peptide is carried out by HLAC.

In an embodiment of the present invention, the purification of light chain peptide involves elution at a pH ranging from 6.5 to 7.5, preferably 7.0.

In an embodiment of the present invention, the recombinant factor VIII obtained by the process shows better or improved activity.

In an embodiment of the present invention, the process of the present disclosure avoids the difficulty in expressing full length recombinant Factor VIII.

The present invention relates to a process for obtaining recombinant factor VIII protein, said process comprising acts of:

a. introducing the polynucleotide sequence of SEQ ID NO. 1 into a first host cell to obtain corresponding polypeptide of SEQ ID NO.2. b introducing the polynucleotide sequence of SEQ ID NO. 3 into a second host cell to obtain corresponding polypeptide of SEQ ID NO.4.

c optionally introducing the vector comprising polynucleotide sequence of SEQ ID NO. 1 into a first host cell to obtain corresponding polypeptide of SEQ ID

NO.2.

d, optionally introducing the vector comprising polynucleotide sequence of SEQ ID NO. 3 into a second host cell to obtain corresponding polypeptide of SEQ

ID NO.4.

e. reconstituting the polypeptides produced by step (a) and (b) or (c) and (d) to obtain the recombinant Factor VIII protein.

In an embodiment of the present invention, the host cell is a non-filamentous fungi.

In an embodiment of the present invention, the non-filamentous fungi is selected from a group comprising, but not limiting to, Pichia pastoris, Saccharomyces cerevisiae and Hansenula polymorpha, preferably Pichia pastoris. In an embodiment of the present invention, the reconstitution is carried out in the presence of divalent metal ions.

In an embodiment of the present invention, the reconstitution is carried out in the presence of Ca ⁺⁺ or Cu ⁺⁺ ions or a combination thereof.

In an embodiment of the present invention, the process further comprise purification of said polypeptides.

In an embodiment of the present disclosure, the purification of said polypeptides is carried out individually or in combination.

In an embodiment of the present invention, the purification of said polypeptides is carried out by chromatographic techniques. In an embodiment of the present invention, the purification of said polypeptides is carried out by IMAC (immobilized metal ion affinity chromatography) and HLAC (Histidine Ligand Affinity Chromatography. In an embodiment of the present invention, the purification of heavy chain peptide is carried out by IMAC.

In an embodiment of the present invention, the purification of heavy chain peptide involves elution at a pH ranging from 4.5 to 5.8, preferably 5.0. In an embodiment of the present invention, the purification of light chain peptide is carried out by HLAC.

In an embodiment of the present invention, the purification of light chain peptide involves elution at a pH ranging from 6.5 to 7.5, preferably 7.0.

In an embodiment of the present invention, the recombinant factor VIII obtained by the process shows better or improved activity.

In an embodiment of the present invention, the process of the present disclosure avoids the difficulty in expressing full length recombinant Factor VIII.

The present invention relates to a process for enhancing activity of recombinant factor VIII protein, said process comprising acts of: a. introducing the polynucleotide sequence of SEQ ID NO. 1 or the polynucleotide sequence of SEQ ID NO. 3 or a combination thereof into a host cell to obtain corresponding polypeptides individually or in combination; or

b. introducing the vector comprising polynucleotide sequence of SEQ ID NO. 1 or the polynucleotide sequence of SEQ ID NO. 3 or a combination thereof into a host cell to obtain corresponding polypeptides individually or in combination; and c. reconstituting the polypeptides produced by step (a) or (b) to obtain the recombinant Factor VIII protein showing enhanced activity.

As used herein, the following sequences are set forth and followed in the present disclosure-

SEQ ID NO. 1 : Polynucleotide Sequence coding for the Heavy chain of BDD-Factor VIII. SEQ ID NO. 2: Amino acid sequence of the Heavy chain of BDD-Factor VIII encoded by polynucleotide sequence of SEQ ID NO: 1.

SEQ ID NO. 3: Polynucleotide Sequence coding for the Light chain of BDD-Factor VIII. SEQ ID NO. 4: Amino acid sequence of the Light chain of BDD-F actor VIII encoded by polynucleotide sequence of SEQ ID NO:3.

In an embodiment, the present disclosure relates to polynucleotide sequences having atleast 95% sequence identity to the sequence as set forth in SEQ ID NO.l . In an embodiment, the present disclosure relates to polynucleotide sequences having atleast 95% sequence identity to the sequence as set forth in SEQ ID NO.3.

Throughout the disclosure, the heavy chain is referred interchangeably as "HC", "heavy chain" and "heavy chain peptide", the light chain is referred interchangeably as "LC", "light chain" and "light chain peptide" and the recombinant factor VIII is referred interchangeably as "BDD-factor VIII", "recombinant factor VIII", "Factor VIILC" and "Factor VIII"

The vector pPICZaA-FVIII- HC comprising heavy chain (SEQ ID No: l) of BDD-Factor VIII has been deposited with the International Depository "The Microbial Type Culture Collection and Gene Bank (MTCC)" and has been accorded the accession number MTCC 5854.

The vector pPICZaA-FVIII- LC comprising light chain (SEQ ID No:3) of BDD-Factor VIII has been deposited with the International Depository "The Microbial Type Culture Collection and Gene Bank (MTCC)" and has been accorded the accession number MTCC 5853.

In an embodiment, the present disclosure describes the production of recombinant Factor VIII using non- filamentous methylotropic yeast, particularly Pichia pastoris. In this method, the heavy and light chains of Factor VIII have been independently expressed using respective constructs in Pichia pastoris strain GS115. Subsequently, the expressed heavy and light chains are purified to near-homogenity using Immobilized Metal-ion Affinity Chromatography [IMAC] and Histidine Ligand Affinity Chromatography [HLAC], respectively. Functional Factor VIII: C is reconstituted from the recombinantly expressed individual chains in vitro, assayed for its specific activity by one-stage clotting assay and chromogenic assay and the reconstituted Factor VIII: C is shown to be functional and highly active. The method also avoids the difficulty in expressing full length recombinant Factor VIII. Additional embodiments and features of the present disclosure will be apparent to one of ordinary skill in art based upon description provided herein. However, the examples and the figures should not be construed to limit the scope of the present disclosure.

Example 1

Materials Used

The vector pcDNA3.1 containing the B-domain deleted factor VIII gene is obtained. All primers for PCR amplification are synthesised by Sigma- Aldrich Ltd. (Bangalore, India). The expression vector pPICZaA and Pichia pastoris strain GS115 are obtained from commercially available kits. Rabbit anti-Al and anti-C2 antisera for the detection of heavy and light chains respectively were generated in-house.

Growth media, buffers for chromatographic runs, and reagents are prepared using chemicals of analytical grade either from Sigma-Aldrich (Bangalore, India) or HiMedia (Bangalore, India).

Preparation of expression constructs for Heavy & Light chains of Factor VIII: C

The region corresponding to the heavy chain of factor VIII: C molecule (2220bp long comprising of the Al and A2 domains) are amplified using the forward primer (5 'GTGGCCCAGCCGGCCAGCCACCAGAAGATAC3 ') incorporating Sffl site and reverse primer (5 'AATGCGGCCGCTCATCTTGGTTCAAT3 ') incorporating Notl site. The amplified cDNA fragment is restriction digested and cloned into the yeast expression vector pPICZaA and transformed into the host E. coli strains. The E. coli transformants are screened with Zeocin.

The 2055bp Light chain gene is amplified by PCR using the forward primer (5'AAGGTACCGAAATAACTCGTACTACTCTTC3') incorporating Kpnl restriction site and reverse primer (5'AAG CGGCCGCAGTAGAGGTCCTGTGCC-3 ') incorporating Not I restriction site. The amplified gene is cloned into pPICZaA, transformed into E. coli and screened with Zeocin resistance.

Results

The cDNA corresponding to the Heavy chain and Light chain of Factor VIII: C are independently cloned into the yeast expression vector pPICZaA, and the respective constructs are confirmed to have proper integration of the insert in the correct reading frame by DNA sequencing of the termini using AOX1 -specific primers. The expression constructs are depicted in Figure 1.

Example 2

Transformation of expression constructs in Pichia pasioris GS115

Competent Pichia pastoris cells are prepared as per the condensed protocol by Lin-Cereghino et.al. (2005). Transformation of 5-10μg of Pmel linearised plasmid pPICZaA-FVIII-HC/ pPICZaA-FVIII-LC into competent P. pastoris GS115 is carried out by electroporation using

Eppendorf Multiporator (Eppendorf AG, Germany) under the 'bacteria and yeast' module as per manufacturer's instructions. Electroporation is carried out in 2mm electroporation cuvettes at 1,500V for 5 minutes with 600Ω resistance and 10μΡ capacitance. Screening for transformants is achieved using antibiotic Zeocin™ at concentrations upto lmg/ml.

Results

Competent Pichia pastoris GS115 cells are transformed with the construct containing the appropriate insert. After 3-4 days of incubation on Yeast Extract Peptone Dextrose (YPD) plates, the cells growing on plates with zeocin concentrations up to lmg/ml are selected, screened for their methanol utilization phenotype and confirmed for the genomic integration of DNA by PCR analysis.

Example 3

Protein expression

Expression of individual chains of Factor VIII: C is carried out as described in the Pichia Expression Kit manual version E (Invitrogen, USA). The transformed cells are grown in buffered minimal complex glycerol media (BMGY, lOOmM potassium phosphate buffer at pH 6.0, 13.4g/L YNB, 4xlO ^"4 g/L biotin, lOg/L glycerol) for 24 hours after which they are transferred to buffered minimal complex methanol media (BMMY, lOOmM potassium phosphate buffer at pH 6.0, 13.4g/L YNB, 4xlO ^"4 g/L biotin, 0.5% methanol) and induced for a period of 90 -120 hours with methanol being added at 0.5%-l% every 24 hours. In order to analyse the expression levels, samples are drawn from each culture at various time points and concentrated by Trichloro Acetic Acid (TCA) precipitation, after which they are subjected to 10%) SDS-PAGE under reducing conditions followed by western blotting on to nitrocellulose membrane.

SDS-PAGE and Western Blotting analysis Western blotting is performed on expressed samples to confirm the presence of factor VIII heavy/light chain. About 5μg of protein sample is loaded on each well of a 10% polyacrylamide gel, and SDS-PAGE is performed to separate them. After electrophoresis, the proteins from the polyacrylamide gel are transferred to a nitrocellulose membrane using Mini Trans-Blot Cell (BIO-RAD, India). Towbin transfer buffer (25mM Tris, 200mM glycine, 0.01% SDS, 20% methanol, pH 8.3) is used to carry out the transfer from the polyacrylamide gel to the nitrocellulose membrane (Towbin et al, 1979), at 90V for 90 mins at 4°C. The membrane is washed with PBST (Phosphate Buffered Saline with 0.1% Tween-20), blocked with a blocking buffer (PBST with 5% skimmed milk powder) overnight at 4°C. After blocking, the membrane is incubated with primary antibody (rabbit anti-Ai or anti-C ₂ antiserum) at room temperature for one hour. The membrane is washed 3 times with PBST solution after which it is incubated with secondary antibody (goat anti-rabbit IgG, HRP conjugated) at room temperature for 1 hour. The membrane is then washed thrice with PBST. The membrane is developed by enhanced chemiluminescence (ECL) using Super Signal West Pico Chemiluminescent Substrate (Pierce, India) on to an X-ray film (Kodak India Ltd., Chennai).

Results

Expression of FVIII: C heavy chain is achieved by induction of heavy chain containing Pichia pastoris GS 1 15 clones with 0.5%>-l%> methanol as explained above. The FVIII: C heavy chain expression construct has an alpha-mating factor signal peptide which helps to secrete the heterologous protein into the culture medium. The recombinantly expressed FVIII: C heavy chain protein is observed in the culture medium. The cultures are harvested after 90 hours of induction with intermittent replenishment of methanol at 0.5% every 24 hrs. In order to analyse the expression levels, samples are drawn from each culture at various time points and concentrated by Trichloro Acetic Acid (TCA) precipitation, after which they are subjected to 10%> SDS-PAGE under reducing conditions followed by western blotting on to nitrocellulose membrane. The rabbit anti-Ai antiserum is used as primary antibody in the blot, following which the membrane is probed with goat anti-rabbit IgG (HRP-conjugated) as secondary antibody. The membrane is then developed by enhanced chemiluminescence. From Figure 2, it is observed that a distinct band at ~180kDa is present only in the heavy chain clone HCi (indicated by an arrow), whereas other bands are observed in all lanes including the vector control suggestive of non-specific nature of anti-HC antibody. Despite this non-specificity, the fact that the antibody is able to recognize this 180 KDa protein in case of heavy chain clone HCi distinguishes this clone from the others.

Expression of light chain of Factor VIII: C is carried out similar to the heavy chain expression of Pichia pastoris GS115. The cultures are harvested after 90 hours- 120 hours of induction. For analyzing expression levels, lmL samples drawn at various time points are concentrated by precipitating the proteins using TCA. They are then subjected to 10% SDS- PAGE under reducing conditions followed by western blotting on to nitrocellulose membrane. Antisera (prepared using E. coli expressed C2 domain of F VIII: C as antigen) is used as primary antibody in the western blot analysis. As seen in Figure 3, both clones (LCi and LC ₂ in lanes 6 and 7) exhibited around 97kDa, which is the expected band, higher than the predicted 80kDa (owing to the two glycosylation sites) with slight difference in intensity upon induction. The heavy chain expressing clone HCi is taken as a negative control where signal corresponding to the expected molecular weight of the light chain (lane 5) is not observed. Also, the lanes corresponding to uninduced samples (lanes 2, 3 and 4) do not show any signal. This data indicates the successful expression of light chain of FVIII: C in Pichia pastoris.

Example 4

Purification of FVIII: C Heavy Chain and Light Chain expressed in Pichia pastoris broth

Purification of heavy chain of factor VIII: C from the heavy chain expressing Pichia pastoris clone is carried out using immobilized metal ion affinity chromatography (IMAC).The results are provided in Figure 4.

For the purification of the Pichia expressed recombinant light chain of Factor VIII: C, Histidine Ligand Affinity Chromatography (HLAC) is employed. The results are provided in Figure 5.

Results

Immobilized metal-ion affinity chromatography (IMAC) is employed to purify the expressed heavy chain of FVIII: C in Pichia pastoris clone HCi. The integrity of the purified protein is analysed over SDS-PAGE and western blotting. While sharp peaks are observed during each elution step (Figure 4A), it is observed that the heavy chain protein is obtained to near homogeneity upon elution at pH 5.0. When analysed by SDS-PAGE and western blotting under non-reducing conditions (Figure 4B & 4C), the heavy chain protein is observed to aggregate as a dimer, which breaks down upon reduction with DTT showing a clear band at the expected 90kDa molecular weight (Figure. 4D). Although the lanes corresponding to elution at pH 4 and pH 6 shows a band (Figure 4D), it is not as prominent and hence it is desirable to elute the heavy chain at a pH ranging from 4.5 to 5.8, preferably 5.

Histidine Ligand Affinity Chromatography (HLAC) is employed to purify the expressed light chain of FVIII: C in Pichia pastoris. It is observed that the light chain protein is obtained to near homogeneity upon elution at pH 7.0. The load, flow through and eluted fractions of the chromatography experiment (Figure 5 A) are analyzed over 10% SDS-PAGE under non- reducing conditions. Upon SDS-PAGE under non-reducing conditions, a band corresponding to the light chain protein (Figure 5B) is observed in the eluted fraction. The eluted fraction shows a band above the expected 80kDa, more specifically around 97kDa, as in the case of the expression study (Figure 3), but the same is confirmed by western and ELISA (Figure 5C) analysis using anti-C2 antibody. This increase in the theoretically predicted molecular weight is attributed to glycosylation on the light chain residues.

Example 5

Reconstitution of Factor VIII: C from individual chains expressed in Pichia pastoris GS115 and Activity Results

Full length B-domain deleted Factor VIII: C is regenerated from individual heavy & light chains expressed in Pichia pastoris expression system. Equimolar concentrations of heavy and light chains are reconstituted in 20mM HEPES, pH 7.0-7.4 containing 0.3M KC1, 0.01% Tween-20, 0.01% BSA, 25mM CaCl ₂ and 0.5μΜ Cu ⁺⁺ and incubated at 20°C-23°C for 4 hours-6 hours. Following this, their specific activity is determined by one-stage clotting assay using FVIII-depleted plasma (Siemens Healthcare Diagnostics, USA) over IL ACL 10000 coagulation analyser (Instrumentation Laboratory, Italy). The One stage clotting assay is performed as follows-

Factor VHI-depleted plasma is dissolved in distilled or deionized water. Before use, it is allowed to stand for at least 15 minutes at 15 to 25°C, and then mixed carefully without foam formation. The reconstituted recombinant Factor VIII: C sample are added to FVIII deficient plasma. APTT reagents are used according to the manufacturer's instructions. 0.025M of CaCl ₂ is added to the mixture. The mixture is incubated at 37°C for 2 minutes and the reading is taken in an automated coagulation analyzer. Normal clotting time is 30-40 seconds. Results

Reconstitution of Pichia expressed Heavy Chain & Light Chain is performed as described above. The activity results and a comparative study with the prior art results are provided in Table 1.

Table 1 : One stage clotting assay results

Table 2: Chromogenic assay results

Conclusion

The present disclosure discloses successful independent expression of heavy and light chains of Factor VIII: C by the Pichia pastoris expression system. The expressed heavy chain and the light chain is purified, reconstituted in presence of Calcium ions to obtain the full-length recombinant Factor VIII: C and the activity of the full-length recombinant Factor VIII: C is studied. The activity exhibited by the reconstituted Factor VIII molecule of the present disclosure show a significant improvement when compared to the reconstituted Factor VIII molecules of prior art, thus proving Pichia pastoris expression system to be an effective expression system for the production of potential recombinant Factor VIII: C protein by making use of the process of the present disclosure.

ADVANTAGES:

The recombinant factor VIII expressed in Pichia is more important when compared to the plasma-derived factor VIII due to the following reasons:

• Its ease in handling, and its GRAS (Generally Regarded As Safe) microbe status,

• The ability to grow to high cell densities and enhance the production levels when scaled-up to a bioreactor.

• The strain of Pichia pastoris GS115 used in the present disclosure, has a glycosylation mechanism closely resembling higher eukaryotes thereby reducing the risk of immune rejection,

• The possibility of glyco-engineering this strain to generate more "human like" glycosylation poses a huge advantage,

• The secretion of protein into the media by Pichia pastoris facilitates purification, which is a major advantage when we take this product to industrial levels of production,

• The Pichia pastoris expression system secretes low amounts of host proteins, making purification of target protein easier.

More so, expressing heavy chain and light chain of Recombinant factor VIII individually and reconstituting according to the present disclosure avoids the difficulty in expressing full length recombinant Factor VIII.

SEQUENCE LISTING

<110> Centre for Bio-Separation Technology

<120> METHODS FOR PRODUCING RECOMBINANT PEPTIDES AND PROTEIN FROM

NON-FILAMENTOUS FUNGI AND RECOMBINANT HOST CELL THEREOF

<130> IP20617/VJ/as

<160> 4

<170> Patentin version 3.5

<210> 1

<211> 2247

<212> DNA

<213> Homo sapiens

<220>

<221> gene

<222> (1)..(2247)

<400> 1

gaattcacgt ggcccagccg gccagccacc agaagatact acctgggtgc agtggaactg 60 tcatgggact atatgcaaag tgatctcggt gagctgcctg tggacgcaag atttcctcct 120 agagtgccaa aatcttttcc attcaacacc tcagtcgtgt acaaaaagac tctgtttgta 180 gaattcacgg atcacctttt caacatcgct aagccaaggc caccctggat gggtctgcta 240 ggtcctacca tccaggctga ggtttatgat acagtggtca ttacacttaa gaacatggct 300 tcccatcctg tcagtcttca tgctgttggt gtatcctact ggaaagcttc tgagggagct 360 gaatatgatg atcagaccag tcaaagggag aaagaagatg ataaagtctt ccctggtgga 420 agccatacat atgtctggca ggtcctgaaa gagaatggtc caatggcctc tgacccactg 480 tgccttacct actcatatct ttctcatgtg gacctggtaa aagacttgaa ttcaggcctc 540 attggagccc tactagtatg tagagaaggg agtctggcca aggaaaagac acagaccttg 600 cacaaattta tactactttt tgctgtattt gatgaaggga aaagttggca ctcagaaaca 660 aagaactcct tgatgcagga tagggatgct gcatctgctc gggcctggcc taaaatgcac 720 acagtcaatg gttatgtaaa caggtctctg ccaggtctga ttggatgcca caggaaatca 780 gtctattggc atgtgattgg aatgggcacc actcctgaag tgcactcaat attcctcgaa 840 ggtcacacat ttcttgtgag gaaccatcgc caggcgtcct tggaaatctc gccaataact 900 ttccttactg ctcaaacact cttgatggac cttggacagt ttctactgtt ttgtcatatc 960 tcttcccacc aacatgatgg catggaagct tatgtcaaag tagacagctg tccagaggaa 1020 ccccaactac gaatgaaaaa taatgaagaa gcggaagact atgatgatga tcttactgat 1080 tctgaaatgg atgtggtcag gtttgatgat gacaactctc cttcctttat ccaaattcgc 1140 tcagttgcca agaagcatcc taaaacttgg gtacattaca ttgctgctga agaggaggac 1200 tgggactatg ctcccttagt cctcgccccc gatgacagaa gttataaaag tcaatatttg 1260 aacaatggcc ctcagcggat tggtaggaag tacaaaaaag tccgatttat ggcatacaca 1320 gatgaaacct ttaagactcg tgaagctatt cagcatgaat caggaatctt gggaccttta 1380 ctttatgggg aagttggaga cacactgttg attatattta agaatcaagc aagcagacca 1440 tataacatct accctcacgg aatcactgat gtccgtcctt tgtattcaag gagattacca 1500 aaaggtgtaa aacatttgaa ggattttcca attctgccag gagaaatatt caaatataaa 1560 tggacagtga ctgtagaaga tgggccaact aaatcagatc ctcggtgcct gacccgctat 1620 tactctagtt tcgttaatat ggagagagat ctagcttcag gactcattgg ccctctcctc 1680 atctgctaca aagaatctgt agatcaaaga ggaaaccaga taatgtcaga caagaggaat 1740 gtcatcctgt tttctgtatt tgatgagaac cgaagctggt acctcacaga gaatatacaa 1800 cgctttctcc ccaatccagc tggagtgcag cttgaggatc cagagttcca agcctccaac 1860 atcatgcaca gcatcaatgg ctatgttttt gatagtttgc agttgtcagt ttgtttgcat 1920 gaggtggcat actggtacat tctaagcatt ggagcacaga ctgacttcct ttctgtcttc 1980 ttctctggat ataccttcaa acacaaaatg gtctatgaag acacactcac cctattccca 2040 ttctcaggag aaactgtctt catgtcgatg gaaaacccag gtctatggat tctggggtgc 2100 cacaactcag actttcggaa cagaggcatg accgccttac tgaaggtttc tagttgtgac 2160 aagaacactg gtgattatta cgaggacagt tatgaagata tttcagcata cttgctgagt 2220 aaaaacaatg ccattgaacc aagatga 2247

<210> 2

<211> 748

<212> PRT

<213> Homo sapiens

<220>

<221> PEPTIDE

<222> (1) . . (748)

<400> 2

Glu Phe Thr Trp Pro Ser Arg Pro Ala Thr Arg Arg Tyr Tyr Leu Gly

1 5 10 15 Ala val Glu Leu Ser Trp Asp Tyr Met Gin Ser Asp Leu Gly Glu Leu

20 25 30

Pro val Asp Ala Arg Phe Pro Pro Arg val Pro Lys Ser Phe Pro Phe

35 40 45

Asn Thr Ser val val Tyr Lys Lys Thr Leu Phe val Glu Phe Thr Asp

50 55 60

His Leu Phe Asn lie Ala Lys Pro Arg Pro Pro Trp Met Gly Leu Leu

65 70 75 80

Gly Pro Thr lie Gin Ala Glu val Tyr Asp Thr val val lie Thr Leu

85 90 95 Lys Asn Met Ala Ser His Pro val Ser Leu His Ala val Gly val Ser 100 105 110 Tyr Trp Lys Ala Ser Glu Gly Ala Glu Tyr Asp Asp Gin Thr Ser Gin

115 120 125

Arg Glu Lys Glu Asp Asp Lys val Phe Pro Gly Gly Ser His Thr Tyr 130 135 140 val Trp Gin val Leu Lys Glu Asn Gly Pro Met Ala Ser Asp Pro Leu 145 150 155 160

Cys Leu Thr Tyr Ser Tyr Leu Ser His val Asp Leu val Lys Asp Leu

165 170 175

Asn Ser Gly Leu lie Gly Ala Leu Leu val Cys Arg Glu Gly Ser Leu

180 185 190 Ala Lys Glu Lys Thr Gin Thr Leu His Lys Phe lie Leu Leu Phe Ala

195 200 205 val Phe Asp Glu Gly Lys Ser Trp His Ser Glu Thr Lys Asn Ser Leu 210 215 220

Met Gin Asp Arg Asp Ala Ala Ser Ala Arg Ala Trp Pro Lys Met His 225 230 235 240

Thr val Asn Gly Tyr val Asn Arg Ser Leu Pro Gly Leu lie Gly Cys

245 250 255

His Arg Lys Ser val Tyr Trp His val lie Gly Met Gly Thr Thr Pro

260 265 270 Glu val His Ser lie Phe Leu Glu Gly His Thr Phe Leu val Arg Asn

275 280 285

His Arg Gin Ala Ser Leu Glu lie Ser Pro lie Thr Phe Leu Thr Ala 290 295 300

Gin Thr Leu Leu Met Asp Leu Gly Gin Phe Leu Leu Phe Cys His lie 305 310 315 320

Ser Ser His Gin His Asp Gly Met Glu Ala Tyr val Lys val Asp Ser

325 330 335

Cys Pro Glu Glu Pro Gin Leu Arg Met Lys Asn Asn Glu Glu Ala Glu

340 345 350 Asp Tyr Asp Asp Asp Leu Thr Asp Ser Glu Met Asp val val Arg Phe

355 360 365

Asp Asp Asp Asn Ser Pro Ser Phe lie Gin lie Arg Ser val Ala Lys 370 375 380

Lys His Pro Lys Thr Trp val His Tyr lie Ala Ala Glu Glu Glu Asp 385 390 395 400

Trp Asp Tyr Ala Pro Leu val Leu Ala Pro Asp Asp Arg Ser Tyr Lys

405 410 415

Ser Gin Tyr Leu Asn Asn Gly Pro Gin Arg lie Gly Arg Lys Tyr Lys

420 425 430

Lys val Arg Phe Met Ala Tyr Thr Asp Glu Thr Phe Lys Thr Arg Glu

435 440 445 Ala lie Gin His Glu Ser Gly lie Leu Gly Pro Leu Leu Tyr Gly Glu

450 455 460 val Gly Asp Thr Leu Leu lie lie Phe Lys Asn Gin Ala Ser Arg Pro 465 470 475 480

Tyr Asn lie Tyr Pro His Gly lie Thr Asp val Arg Pro Leu Tyr Ser

485 490 495

Arg Arg Leu Pro Lys Gly val Lys His Leu Lys Asp Phe Pro lie Leu

500 505 510

Pro Gly Glu lie Phe Lys Tyr Lys Trp Thr val Thr val Glu Asp Gly

515 520 525 Pro Thr Lys Ser Asp Pro Arg Cys Leu Thr Arg Tyr Tyr Ser Ser Phe

530 535 540 val Asn Met Glu Arg Asp Leu Ala Ser Gly Leu lie Gly Pro Leu Leu 545 550 555 560 lie Cys Tyr Lys Glu Ser val Asp Gin Arg Gly Asn Gin lie Met Ser

565 570 575

Asp Lys Arg Asn val lie Leu Phe Ser val Phe Asp Glu Asn Arg Ser

580 585 590

Trp Tyr Leu Thr Glu Asn lie Gin Arg Phe Leu Pro Asn Pro Ala Gly

595 600 605 val Gin Leu Glu Asp Pro Glu Phe Gin Ala Ser Asn lie Met His Ser

610 615 620 lie Asn Gly Tyr val Phe Asp Ser Leu Gin Leu Ser val Cys Leu His 625 630 635 640

Glu val Ala Tyr Trp Tyr lie Leu Ser lie Gly Ala Gin Thr Asp Phe

645 650 655 Leu Ser val Phe Phe Ser Gly Tyr Thr Phe Lys His Lys Met val Tyr 660 665 670

Glu Asp Thr Leu Thr Leu Phe Pro Phe Ser Gly Glu Thr val Phe Met

675 680 685

Ser Met Glu Asn Pro Gly Leu Trp lie Leu Gly Cys His Asn Ser Asp

690 695 700 Phe Arg Asn Arg Gly Met Thr Ala Leu Leu Lys val Ser Ser Cys Asp

705 710 715 720

Lys Asn Thr Gly Asp Tyr Tyr Glu Asp Ser Tyr Glu Asp lie Ser Ala

725 730 735

Tyr Leu Leu Ser Lys Asn Asn Ala lie Glu Pro Arg

740 745

<210> 3

<211> 2145

<212> DNA

<213> Homo sapiens

<220>

<221> gene

<222> (1) . . (2145)

<400> 3

gaattcacgt ggcccagccg gccgtctcgg atcggtaccg aaataactcg tactactctt 60 cagtcagatc aagaggaaat tgactatgat gataccatat cagttgaaat gaagaaggaa 120 gattttgaca tttatgatga ggatgaaaat cagagccccc gcagctttca aaagaaaaca 180 cgacactatt ttattgctgc agtggagagg ctctgggatt atgggatgag tagctcccca 240 catgttctaa gaaacagggc tcagagtggc agtgtccctc agttcaagaa agttgttttc 300 caggaattta ctgatggctc ctttactcag cccttatacc gtggagaact aaatgaacat 360 ttgggactcc tggggccata tataagagca gaagttgaag ataatatcat ggtaactttc 420 agaaatcagg cctctcgtcc ctattccttc tattctagcc ttatttctta tgaggaagat 480 cagaggcaag gagcagaacc tagaaaaaac tttgtcaagc ctaatgaaac caaaacttac 540 ttttggaaag tgcaacatca tatggcaccc actaaagatg agtttgactg caaagcctgg 600 gcttatttct ctgatgttga cctggaaaaa gatgtgcact caggcctgat tggacccctt 660 ctggtctgcc acactaacac actgaaccct gctcatggga gacaagtgac agtacaggaa 720 tttgctctgt ttttcaccat ctttgatgag accaaaagct ggtacttcac tgaaaatatg 780 gaaagaaact gcagggctcc ctgcaatatc cagatggaag atcccacttt taaagagaat 840 tatcgcttcc atgcaatcaa tggctacata atggatacac tacctggctt agtaatggct 900 caggatcaaa ggattcgatg gtatctgctc agcatgggca gcaatgaaaa catccattct 960 attcatttca gtggacatgt gttcactgta cgaaaaaaag aggagtataa aatggcactg 1020 tacaatctct atccaggtgt ttttgagaca gtggaaatgt taccatccaa agctggaatt 1080 tggcgggtgg aatgccttat tggcgagcat ctacatgctg ggatgagcac actttttctg 1140 gtgtacagca ataagtgtca gactcccctg ggaatggctt ctggacacat tagagatttt 1200 cagattacag cttcaggaca atatggacag tgggccccaa agctggccag acttcattat 1260 tccggatcaa tcaatgcctg gagcaccaag gagccctttt cttggatcaa ggtggatctg 1320 ttggcaccaa tgattattca cggcatcaag acccagggtg cccgtcagaa gttctccagc 1380 ctctacatct ctcagtttat catcatgtat agtcttgatg ggaagaagtg gcagacttat 1440 cgaggaaatt ccactggaac cttaatggtc ttctttggca atgtggattc atctgggata 1500 aaacacaata tttttaaccc tccaattatt gctcgataca tccgtttgca cccaactcat 1560 tatagcattc gcagcactct tcgcatggag ttgatgggct gtgatttaaa tagttgcagc 1620 atgccattgg gaatggagag taaagcaata tcagatgcac agattactgc ttcatcctac 1680 tttaccaata tgtttgccac ctggtctcct tcaaaagctc gacttcacct ccaagggagg 1740 agtaatgcct ggagacctca ggtgaataat ccaaaagagt ggctgcaagt ggacttccag 1800 aagacaatga aagtcacagg agtaactact cagggagtaa aatctctgct taccagcatg 1860 tatgtgaagg agttcctcat ctccagcagt caagatggcc atcagtggac tctctttttt 1920 cagaatggca aagtaaaggt ttttcaggga aatcaagact ccttcacacc tgtggtgaac 1980 tctctagacc caccgttact gactcgctac cttcgaattc acccccagag ttgggtgcac 2040 cagattgccc tgaggatgga ggttctgggc tgcgaggcac aggacctcta ctgcggccgc 2100 cagctttcta gaacaaaaac tcatctcaga agaggatctg aatag 2145

<210> 4

<211> 714

<212> PRT

<213> Homo sapiens

<220>

<221> PEPTIDE

<222> (1) . . (714)

<400> 4

Glu Phe Thr Trp Pro Ser Arg Pro Ser Arg lie Gly Thr Glu lie Thr

1 5 10 15

Arg Thr Thr Leu Gin Ser Asp Gin Glu Glu lie Asp Tyr Asp Asp Thr

20 25 30 lie Ser val Glu Met Lys Lys Glu Asp Phe Asp lie Tyr Asp Glu Asp

35 40 45

Glu Asn Gin Ser Pro Arg Ser Phe Gin Lys Lys Thr Arg His Tyr Phe

50 55 60 lie Ala Ala val Glu Arg Leu Trp Asp Tyr Gly Met Ser Ser Ser Pro 65 70 75 80 His val Leu Arg Asn Arg Ala Gin Ser Gly Ser val Pro Gin Phe Lys

85 90 95

Lys val val Phe Gin Glu Phe Thr Asp Gly Ser Phe Thr Gin Pro Leu

100 105 110

Tyr Arg Gly Glu Leu Asn Glu His Leu Gly Leu Leu Gly Pro Tyr lie

115 120 125

Arg Ala Glu val Glu Asp Asn lie Met val Thr Phe Arg Asn Gin Ala 130 135 140

Ser Arg Pro Tyr Ser Phe Tyr Ser Ser Leu lie Ser Tyr Glu Glu Asp 145 150 155 160 Gin Arg Gin Gly Ala Glu Pro Arg Lys Asn Phe val Lys Pro Asn Glu

165 170 175

Thr Lys Thr Tyr Phe Trp Lys val Gin His His Met Ala Pro Thr Lys

180 185 190

Asp Glu Phe Asp Cys Lys Ala Trp Ala Tyr Phe Ser Asp val Asp Leu

195 200 205

Glu Lys Asp val His Ser Gly Leu lie Gly Pro Leu Leu val Cys His 210 215 220

Thr Asn Thr Leu Asn Pro Ala His Gly Arg Gin val Thr val Gin Glu 225 230 235 240 Phe Ala Leu Phe Phe Thr lie Phe Asp Glu Thr Lys Ser Trp Tyr Phe

245 250 255

Thr Glu Asn Met Glu Arg Asn Cys Arg Ala Pro Cys Asn lie Gin Met

260 265 270

Glu Asp Pro Thr Phe Lys Glu Asn Tyr Arg Phe His Ala lie Asn Gly

275 280 285

Tyr lie Met Asp Thr Leu Pro Gly Leu val Met Ala Gin Asp Gin Arg 290 295 300 lie Arg Trp Tyr Leu Leu Ser Met Gly Ser Asn Glu Asn lie His Ser 305 310 315 320 lie His Phe Ser Gly His val Phe Thr val Arg Lys Lys Glu Glu Tyr

325 330 335

Lys Met Ala Leu Tyr Asn Leu Tyr Pro Gly val Phe Glu Thr val Glu 340 345 350

Met Leu Pro Ser Lys Ala Gly lie Trp Arg val Glu Cys Leu lie Gly

355 360 365

Glu His Leu His Ala Gly Met Ser Thr Leu Phe Leu val Tyr Ser Asn

370 375 380

Lys Cys Gin Thr Pro Leu Gly Met Ala Ser Gly His lie Arg Asp Phe 385 390 395 400

Gin lie Thr Ala Ser Gly Gin Tyr Gly Gin Trp Ala Pro Lys Leu Ala

405 410 415 Arg Leu His Tyr Ser Gly Ser lie Asn Ala Trp Ser Thr Lys Glu Pro

420 425 430

Phe Ser Trp lie Lys val Asp Leu Leu Ala Pro Met lie lie His Gly

435 440 445 lie Lys Thr Gin Gly Ala Arg Gin Lys Phe Ser Ser Leu Tyr lie Ser

450 455 460

Gin Phe lie lie Met Tyr Ser Leu Asp Gly Lys Lys Trp Gin Thr Tyr 465 470 475 480

Arg Gly Asn Ser Thr Gly Thr Leu Met val Phe Phe Gly Asn val Asp

485 490 495 Ser Ser Gly lie Lys His Asn lie Phe Asn Pro Pro lie lie Ala Arg

500 505 510

Tyr lie Arg Leu His Pro Thr His Tyr Ser lie Arg Ser Thr Leu Arg

515 520 525

Met Glu Leu Met Gly Cys Asp Leu Asn ser Cys Ser Met Pro Leu Gly

530 535 540

Met Glu Ser Lys Ala lie Ser Asp Ala Gin lie Thr Ala Ser Ser Tyr 545 550 555 560

Phe Thr Asn Met Phe Ala Thr Trp Ser Pro Ser Lys Ala Arg Leu His

565 570 575 Leu Gin Gly Arg Ser Asn Ala Trp Arg Pro Gin val Asn Asn Pro Lys

580 585 590

Glu Trp Leu Gin val Asp Phe Gin Lys Thr Met Lys val Thr Gly val

595 600 605

Thr Thr Gin Gly val Lys Ser Leu Leu Thr Ser Met Tyr val Lys Glu

610 615 620 Phe Leu lie Ser ser ser Gin Asp Gly His Gin Trp Thr Leu Phe Phe 625 630 635 640

Gin Asn Gly Lys val Lys val Phe Gin Gly Asn Gin Asp Ser Phe Thr

645 650 655

Pro val val Asn Ser Leu Asp Pro Pro Leu Leu Thr Arg Tyr Leu Arg

660 665 670 lie His Pro Gin Ser Trp val His Gin lie Ala Leu Arg Met Glu val

675 680 685

Leu Gly Cys Glu Ala Gin Asp Leu Tyr Cys Gly Arg Gin Leu Ser Arg

690 695 700

Thr Lys Thr His Leu Arg Arg Gly Ser Glu

705 710