METHODS FOR PRODUCING SECRETED POLYPEPTIDES HAVtESfG BiOLQGICAL

ACTIVITY

Background of the Invention

Field of the invention

The present invention relates to methods for producing secreted polypeptides.

The present invention also relates to variant signa! peptides or variant prepropeptides and nucleic acid constructs, vectors, and host cells comprising the variant signal peptide or variant prepropeptidβ coding sequences operably linked to polynucleotides encoding polypeptides.

Description of the Related Art A signal peptide is an amino acid sequence linked in frame to the amino terminus of a polypeptide having bioiogical activity and directs the encoded polypeptide into the cell ^' s secretory pathway. A propeptide is an amino acid sequence positioned at the amino terminus of a polypeptide, wherein the resultant poiypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propoiypeptide is generaiiy inactive and can be converted to a mature active poiypeptide by catalytic or autocataiytic cleavage of the propeptide from the propolypeptide. Where both signal peptide and propeptide regions are present at the amino terminus of a poiypeptide. the propeptide region is linked in frame to the amino terminus of a polypeptide &nά the signal peptide region is linked in frame to the amino terminus of the propeptide region. The secretion of a recombinant polypeptide of interest in a particular host cell may require the replacement of its native signal peptide with a new signal peptide that is compatible with the host ceil of choice. In addition, a propeptide sequence of a poiypeptide may also need to be replaced with a different propeptide sequence or deleted because the propeptide sequence is not processed or is processed improperly by the host ceil to secrete an active polypeptide, in other cases, a signa! peptide and/or propeptide may be absent. it may be possible to improve the secretion of a polypeptide of interest by modifying the native signal peptide or native prepropeptide naturaliy associated with the poiypeptide through mutation. Beiin et a/. , 2004, Journal of Molecular Biology 335: 437-453, describe mutations that improve the functiona! activity of the plasminogen activator inhibitor 2 (PAI-2) signal sequence, TsuchSya e( a/., 2003. Nucleic Adds Research Supplement No. 3, pp. 262-

262, describe mutation of a signal sequence for effective secretion of human lysozyme in yeast. Nothwehr and Gordon, 1990. The Journal of Biological Chemistry 265: 17202- 17208, describe structural features in the amino terminal region of the human pre(λpro)apo!ipoprotein A-Il signal peptide that infiuences the site of its cleavage by signal peptidase, Ngsee and Smith, 1990, Gene 86: 2S1-255, describe changes in the bovine prolactin signal peptide required for efficient secretion in yeasts.

U.S. Patent No. 5.766,912 discloses the cloning and sequence of a full-length wild-type lipase from Thermomyces lanuginosus containing a prepropeptfde sequence. U.S. Patent No. 5,869.438 discloses vaήants of a full-length wild-type lipase from Therrnotnyces ianugmosus.

There is a need in the art for improved signal peptide and propeptide sequences for the secretion of active polypeptides in various host ceils. it is an object of the present invention to provide improved methods for producing a polypeptide in a fungal host cell using variant signal peptides or variant prepropeptides.

Summary of the Jnvention

The present invention relates to methods for producing a secreted polypeptide having biological activity, comprising:

(a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the fungal host cell comprises a first polynucleotide encoding the polypeptide operabiy linked to a second polynucleotide encoding a variant signal peptide or a variant prepropeptide selected from the group consisting of: (i) a variant of a parent signal peptide comprising a substitution at a position corresponding to position 2 of amino acids 1 to 17 of SEQ ID NO: 2. wherein the variant signal peptide is linked in frame to the amino terminus of the polypeptide;

(ii) a variant of a parent prepropeptide comprising a deletion at one or more (several) positions corresponding to positions 18, 19. 20, 21 and 22 of amino acids 1 to 22 of SEQ ID NO ^' 2, wherein the variant peptide is linked in frame to the amino terminus of the polypeptide;

(iii) a variant of a parent prepropeptide comprising a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2. wherein the variant prepropeptide is linked in frame to the amino terminus of the polypeptide; &nά

(iv) a variant of a parent prepropeptide comprising a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2 and a deletion at one or more (several) positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ SD NO: 2; and (b) isolating the secreted polypeptide having bioiogicai activity from the cuitivation medium.

The present invention also relates to isolated polynucieotides encoding variant signal peptides and variant prepropeptides and to constructs, vectors, and fungal host ceils comprising the polynucleotides encoding the variant signal peptides and variant prepropeptides operably linked to polynucleotides encoding polypeptides.

Brief Description of the Figures

Figure 1 shows a restriction map of pBM128a, Figure 2 shows a restriction map of pMB1537.

Figure 3 shows a restriction map of pSlv?126a,

Figure 4 shows a restriction map of pMB1539.

Figure 5 shows a restriction map of pJLin168,

Figure 6 shows a restriction map of pBM142c. Figure 7 shows a restriction map of p8IV!143b.

Figure S shows the average relative Sipase activities for pJLin168 transformants.

Figure 9 shows the average relative iipase activities for pBM143b transformants.

Figure 10 shows a restriction map of pMB16S2,

Figure 11 shows a restriction map of pJLin195, Figure 12 shows the average relative iipase activities for pBIV5143b and pJLin195 transformants.

Figure 13 shows the average relative iipase activities for pBM143b transformants in shake flasks.

Figure 14 shows a restriction map of pJLin187. Figure 15 shows a restriction map of pBM121b.

Figure 16 shows a restriction map of pBM120a.

Figure 17 shows a restriction map of pJMS7.

Figure 18 shows a restriction map of pJMSδ.

Figure 19 shows the reiative Iipase activities for day 3 culture broths of transformants of pJMSδ and pJMS7.

Figure 20 shows the reiative Iipase activities for day 3 culture broths of

transformants of pJMS6, pJMS7, and plasmid T85,

Figure 21 shows the relative lipase activities for day 4 culture broths of transformants of pJMS ^β and plasmid TB6.

Definitions

FuiMength polypeptide: The term "fuii-iength polypeptide" is defined herein as a precursor form of a poSypeptide having biological activity, wherein the precursor contains a signal peptide and alternatively also a propeptide, wherein upon secretion from a ceϋ, the signal peptide is cleaved and alternatively also the propeptide is cleaved yielding a poiypeptide with biological activity.

Signal peptide: The term "signal peptide" is defined herein as a peptide linked

(fused) in frame to the amino terminus of a poiypeptide having biological activity and directs the poiypeptide into the cell's secretory pathway. A propeptide may be present between the signal peptide and the amino terminus of the poiypeptide (see prepropeptide deftnition below).

Propeptide: The term "propeptide" is an amino acid sequence linked (fused) in frame to the amino terminus of a polypeptide, wherein the resultant poiypeptide is known as a proenzyme or propoiypeptide (or a zymogen in some cases). A propoiypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytSc cleavage of the propeptide from the propoiypeptide.

Prepropeptide; The term "prepropeptide' is defined herein as a signal peptide and propeptide present at the amino terminus of a polypeptide, where the propeptide is linked (or fused) in frame to the amino terminus of a poiypeptide &nά the signal peptide region is linked in frame (or fused) to the amino terminus of the propeptide region.

Signal peptide coding sequence: The term "signal peptide coding sequence" is defined herein as a poiynucleootide that encodes a signal peptide.

Propeptide coding sequence: The term "propeptide coding sequence" is defined herein as a polynucieootide that encodes a propeptide. Prepropeptide coding sequence: The term "prepropeptide coding sequence" is defined herein as a polynucieootide that encodes a prepropeptide.

WiJd-type signal peptide: The term "wild-type signal peptide" denotes a signal peptide expressed by a naturally occurring microorganism, such as a yeast or filamentous fungus found in nature. Parent signal peptide: The term "parent signai peptide" as used herein means a signal peptide to which modifications, e.g. , substitution(s), insertion(s) _; deletion(s) _s

and/or truncation(s), are made to produce a signa! peptide variant of the present invention. This term aiso refers to the signal peptide with which a variant is compared and aiigned. The parent may be a naturaiiy occurring (wild-type) signal peptide, or it may even be a variant thereof, prepared by any suitable means. For instance, the parent signal peptide may be a variant of a naturaiiy occurring signal peptide which has been modified or aitered in the amino acid sequence. A parent signal peptide may also be an allelic variant which is a signai peptide encoded by any of two or more aiternative forms of a poiynucleotide sequence occupying the same chromosomal iocus.

Wϋd-type prepropeptide: The term "wild-type prepropeptide" denotes a prepropeptide expressed by a naturally occurring microorganism, such as a yeast or fiiamβntous fungus found in nature.

Parent prepropeptide; The term "parent prepropeptide" as used herein means a prepropeptSde to which modifications, e.g., substitutions), insertions), deletιon(s), and/or truncation^}, are made to produce a prepropeptide variant of the present invention. This term also refers to the prepropeptide with which a variant is compared and aiigned. The parent may be a naturally occurring (wild-type) prepropeptide, or it may even be a variant thereof, prepared by any suitable means. For instance, the parent prepropeptide may be a variant of a naturaiiy occurring prepropeptide which has been modified or altered in the amino acid sequence. A parent prepropeptide may also be an allelic variant which is a prepropeptide encoded by any of two or more aiternative forms of a poiynucieotide sequence occupying the same chromosomal iocus.

Variant: The term "variant ^* is defined herein as a peptide or polypeptide comprising one or more (severai) alterations, such as substitutions, insertions, deletions, and/or truncations of one or more (several) specific amino acid residues at one or more (severa!) specific positions in the peptide or polypeptide.

Variant signal peptide: The term "variant signal peptide" is defined herein as a signal peptide of a parent signal peptide, wherein the variant signal peptide comprises one or more (several) alterations, such as substitutions, insertions, deletions, and/or truncations of one or more (several) specific amino acid residues at one or more (several) specific positions in the signal peptide.

Variant prepropeptide: The term "variant prepropeptide" is defined herein as a prepropeptide of a parent prepropeptide, wherein the variant prepropeptide comprises one or more (several) alterations, such as substitutions, insertions, deletions, and/or truncations of one or more (several) specific amino acid residues at one or more (severa!) specific positions in the prepropeptide.

OperabJy linked: The term "opβrably linked" denotes herein a configuration in

which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the coding sequence of a polypeptide.

Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to. transcription, post-transcriptioπal modification, transiation, post-translationa! modification, and secretion.

Coding sequence; The term "coding sequence" is defined herein as a polynucleotide sequence that is transcribed into mRNA which is translated into a poiypeptide when placed under the controi of the appropriate control sequences. The boundaries of the coding sequence are generally determined by the start codon iocated at the beginning of the open reading frame of the 5' end of the mRNA and a stop codon located at the 3' end of the open reading frame of the mRNA. A coding sequence can include, but is not iimited to, genomic DNA. cDNA. semisynthetic, synthetic, and recombinant nucleotide sequences. The 5' end of the poiypeptide coding sequence may contain a native signal peptide coding region or a native prepropeptide coding region naturally linked in transiation reading frame with the segment of the coding region which encodes the poiypeptide. Alternatively, the 5' end of the poiypeptide coding sequence may Sack a native signai peptide coding region or a native prepropeptide coding region. Mature polypeptide; The term "mature polypeptide" is defined herein as a polypeptide having biological activity that is in its final form following translation &nά any post-translational modifications, such as N-terminal processing, C-termina! truncation, giycosyiation. phosphorylation, etc.

Mature polypeptide coding sequence; The term "mature polypeptide coding sequence" is defined herein as a polynucleotide sequence that encodes a mature poiypeptide having biologicai activity.

Detailed Description of the Invention

The present invention relates to methods for producing a polypeptide having bioiogica! activity, comprising: (a) cultivating a fungal host cei! in a medium conducive for the production of the poiypeptide, wherein the fungal host cell comprises a first poiynucleotide encoding the poiypeptide operably linked to a second polynucleotide encoding a variant signal peptide or a variant prepropeptide selected from the group consisting of: (i) a variant of a parent signal peptide comprising a substitution at a position corresponding to position 2 of amino acids 1 to 17 of SEQ SD NO: 2, wherein

the variant signal peptide is iinked in frame to the amino terminus of the polypeptide: (if) a variant of a parent prepropeptide comprising a deletion at one or more (several) positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ !D NO; 2, wherein the vanant peptide is iinked in frame to the amino terminus of the polypeptide; (iii) a variant of a parent prepropeptide comprising a substitution at a position corresponding to position 2 of amino acids 1 to 12 of SEQ SD NO; 2. wherein the variant prepropeptide is iinked in frame to the amino terminus of the poiypeptide; and (iv) a variant of a parent prepropeptide comprising a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2 and a deietion at one or more (several) positions corresponding to positions 18, 19, 20. 21 , and 22 of amino acids 1 to 22 of SEQ iD NO: 2; and <b) isoiating the secreted polypeptide having bioiogica! activity from the cultivation medium. in the production methods of the present invention, the fυngai host celis are cuitivated in a nutrient medium suitable for production of the poiypeptide using methods known in the art. For exampSe, the ceiis may be cultivated by shake flask cultivation, or smail-scaie or iarge-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions ailowing the poiypeptide to be expressed and/or isolated. The cuitivation takes piace in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are avaiiabie from commercial suppliers or may be prepared according to pubiishβd compositions (e g. , in catalogues of the American Type Culture Coilection).

The polypeptides having bioiogica I activity may be detected using methods known in the art that are specific for the poiypeptides. These detection methods may include use of specific antibodies, high performance liquid chromatography, capillary chromatography, formation of an enzyme product, disappearance of an enzyme substrate, or SDS-PAGE. For exampie, where the poiypeptide is an enzyme, an enzyme assay may be used to determine the activity of the enzyme. Procedures for determining enzyme activity are known Sn the art for many enzymes (see, for example, D. Schomburg and M. Salzmann (eds.), Enzyme Handbook, Springer- Veriag. New York, 1990). in the methods of the present invention, the fungal cell preferably produces at ieast about 25% more, more preferabiy at least about 50% more, more preferabiy at ieast about 75% more, more preferably at least about 100% more, even more preferably at least about 200% more, most preferably at ieast about 300% more, and even most preferably at least about 400% more polypeptide relative to a fungal cell containing a

native signal peptide coding sequence or a native prepropepfide coding sequence operabiy linked to a polynucleotide sequence encoding the polypeptide when cultured under identical production conditions.

The resulting secreted and activated polypeptide can be recovered directly from the medium by methods known in the art. For example, the poiypeptide may be recovered from the nutrient medium by conventioπa! procedures including, but not iimited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

The polypeptides having biological activity can be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g. , ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g, ₅ preparative isoelectric focusing), differential solubility (e.g. , ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Conventions for Designation of Variants in the present invention, a specific numbering of amino acid residue positions is employed in the signal peptide variants anά prepropeptide variants. For example, by aligning the amino acid sequences of known signal peptide or prepropeptide sequences, it is possible to designate an amino acid position number to any amino acid residue in any signal peptide or prepropeptide sequence.

For example, using the numbering system originating from the amino acid sequence of the lipase disclosed Sn SEQ SD NO: 2, aligned with the amino acid sequence of a number of other lipases or other enzymes, it is possible to indicate the position of an amino acid residue in regions of structural homology in the signal peptide or prepropeptide region.

Multiple alignments of protein sequences may be made, for example, using "ClustalW (Thompson, J.D., Higgins, D.G. and Gibson, T.J., 1994, CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice, Nucleic Acids Research 22; 4673-4680). Multiple alignments of DNA sequences may be done using the protein alignment as a template, replacing the amino acids with the corresponding codon from the DNA sequence.

Pairwise sequence comparison aigorithms in common use are adequate to detect similarities between protein sequences that have not diverged beyond the point of approximately 20-30% sequence identity (DoolittSe, 1992, Protein Sci. 1 : 191-200; Brenner et a/. , 1998, Proc. Natl, Acad ScL USA 95, 6073-6078). However, truly

- S -

homologous proteins with the same fold and similar biological function have often diverged to the point where traditiona! sequence-based comparisons fail to detect their relationship {ϋndahl and Eiofsson, 2000, J. Mo/, Biol. 295: 613-615). Greater sensitivity in sequence-based searching can be attained using search programs that utiiize probabiiistic representations of protein families (profiles) to search databases. For example, the PSi-BLAST program generates profiSes through an iterative database search process and is capable of defecting remote homologs (Atschui et aL , 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the protein of interest has one or more representatives in the protein structure databases. Programs such as GenTHREADER (Jones 1999. J. Mo/. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) utilize information from a variety of sources {PSi-BLAST, secondary structure prediction, structure! alignment profties, and soivation potentiais) as input to a neural network that predicts the structural fold for a query sequence. Similarly, the method of Gough et ah, 2000, J, MoI. BhL 313: 903-919, can be used to align a sequence of unknown structure with the superfamiiy models present in the SCOP database. These alignments can in turn be used to generate homology models for the protein of interest, and such models can be assessed for accuracy using a variety of tools developed for that purpose.

For proteins of known structure, several tools and resources are available for retrieving and generating structural aiignments. For exampie the SCOP superfamiiies of proteins have been structurally aligned, anύ those aiignments are accessible and downloadable. These alignments can be used to predict the structurally and functionally corresponding amino acid residues in proteins within the same structural superfamiiy. This information, along with information derived from homology modeling and profile searches, can be used to predict which residues to mutate when moving mutations of interest from one protein to a close or remote homoiog.

In describing the various signal peptide variants or prepropeptide variants of the present invention, the nomenclature described below is adapted for ease of reference. In ail cases, the accepted IUPAC single Setter or triple letter amino acid abbreviation is empSoyed.

Substitutions. For an amino acid substitution, the following nomenclature is used: Original amino acid, position, substituted amino acid. Accordingly, the substitution of arginine with lysine at position 2 is designated as "Arg2Lys ^K or "R2K",

Deietions. For an amino acid deletion, the following nomencSature is used: Original amino acid, position*. Accordingly, the deletion of serine at position 18 is designated as "Ser18 ^* " or ^* S18 ^*>r .

insertions. For an amino acid insertion, the foiiowing nomenclature is used: Original amino acid, position, original amino acid, new inserted amino acid. Accordingly the insertion of lysine after giycine at position 17 is designated "Gly17GiyLys" or "G17GK".

Parent Signal Peptides and Prepropeptides in the present invention, the parent signai peptide or prepropeptide can be any signal peptide or prepropeptide that has at least 70% identity to amino acids 1 to 17 of SEQ SD NO; 2 or amino acids 1 to 22 of SEQ ID NO; 2; respectively; is encoded by a polynucleotide comprising or consisting of a polynucleotide comprising a nucleotide sequence that has at ieast 70% identity to nucleotides 1 to 51 of SEQ SD NO: 1 or nucleotides 1 to 66 of SEQ ID NO: 1 , respectively, or their complementary strands; or is encoded by a poiynucieotide comprising or consisting of a nucieotide sequence that hybridizes under stringency conditions with nucleotides 1 to 51 of SEQ ID NO: 1 or nucSeotides 1 to 66 of SEQ SD NO: 1 , respectively, or their complementary strands. in a first aspect, the parent signal peptide or prepropeptide has a degree of identity to amino acids 1 to 17 of SEQ !D NO: 2 or amino acids 1 to 22 of SEQ SD NO; 2, respectively, of at ieast about 70%, preferably at least about 75%. more preferabiy at Seast about 80%, more preferably at least about 85%, even more preferably at least about 90%, most preferabiy at least about 95%, and even most preferably at least about 96%, 97%, 98%,or 99%, which have the ability to direct a polypeptide into a εeSi's secretory pathway to secrete a poiypeptide with biologicai activity (hereinafter "homologous peptides"). in another preferred aspect, the homologous parent signal peptides, propeptides, or prepropeptides have amino acid sequences which differ by five amino acids, preferably by four amino acids, more preferabiy by three amino acids, even more preferably by two amino acids, and most preferably by one amino acid from amino acids 1 to 17 of SEQ SD NO: 2 or amino acids 1 to 22 of SEQ iD NO: 2; respectively. For purposes of the present invention, the degree of identity between two amino acid sequences is determined by the Clustal method {Higgins, 1θ8θ, CABlOS 5: 151-153) using the LASERGENE™ MEGALIGN™ software (DNASTAR, Inc., Madison, Wi) with an identity tabie and the foiiowing multipie aiignment parameters: Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters are Ktuple=1 , gap penaity=3, wιndows=5, and diagonais=5. in another preferred aspect, the parent signal peptide or prepropeptide comprises amino acids 1 to 17 of SEQ ID NO; 2 or amino acids 1 to 22 of SEQ SD NO;

2, respectively, or fragments thereof which have the ability to direct the polypeptide info a cell's secretory pathway to secrete a polypeptide with biological activity, in a more preferred aspect, the parent signal peptide or prepropeptide comprises amino acids 1 to 17 of SEQ ID NO; 2 or amino acids 1 to 22 of SEQ ID NO; 2, respectively. In another preferred aspect, the parent signal peptide or prepropeptide consists of amino acids 1 to 17 of SEQ ID NQ: 2 or amino acids 1 to 22 of SEQ ID NO; 2, respectively, or fragments thereof, which have the ability to direct a polypeptide into a cell's secretory pathway to secrete a polypeptide with biological activity. In another more preferred aspect, the parent signal peptide or prepropepfide consists of amino acids 1 to 17 of SEQ ID NO; 2 or amino acids 1 to 22 of SEQ SD NO; 2, respectively.

The present invention aiso encompasses polynucleotides comprising or consisting of nucleotide sequences which encode a parent signai peptide or prepropeptide having the amino acid sequence of amino acids 1 to 17 of SEQ ID NO; 2 or amino acids 1 to 22 of SEQ ID NO. 2. respectively, which differ from nucleotides 1 to 51 of SEQ ID NO: 1 or nucleotides 1 to 66 of SEQ ID NO: 1 , respectively, by virtue of the degeneracy of the genetic code. The present invention also relates to subsequences of nucleotides 1 to 51 of SEQ ID NO: 1 or nucleotides 1 to 66 of SEQ ID NO: 1 which encode fragments of amino acids 1 to 17 of SEQ ID NO: 2 or amino acids 1 to 22 of SEQ ID NO: 2, respectively, which have the ability to direct a polypeptide into a cell's secretory pathway to secrete a polypeptide with biological activity.

A subsequence of nucleotides 1 to 51 of SEQ ID NO; 1 or nucleotides 1 to 66 of SEQ ID NO: 1 is a nucleic acid sequence encompassed by nucleotides 1 to 51 of SEQ ID NO: 1 or nucleotides 1 to 66 of SEQ ID NO: 1 , except that one or more (several) nucleotides have been deleted from the 5' and/or 3' end. A fragment of amino acids 1 to 17 of SEQ ID NO: 2 or amino acids 1 to 22 of SEQ ID NO: 2, is a peptide having one or more (several) amino acids deleted from the amino and/or carboxy terminus of this amino acid sequence. in a second aspect, the parent signal peptide or prepropeptide is encoded by a polynucleotide comprising a nucleotide sequence that has a degree of identity to nucleotides 1 to 51 of SEQ ID NO' 1 or nucleotides 1 to 66 of SEQ ID NO: 1 , respectively, of at least about 70%, preferably at least about 75%, more preferably at ieast about 80%, more preferably at least about 85%, even more preferably at least about 90%, most preferably at least about 95%. and even most preferably at least about 96%, 97%, 98%,or 99%; or alleSic variants and subsequences of nucleotides 1 to 51 of SEQ ID NO; 1 or nucleotides 1 to 66 of SEQ ID NO: 1 , which encode fragments of a signal peptide or prepropeptide. which have the ability to direct a polypeptide into a

cell's secretory pathway to secrete a polypeptide with biological activity. For purposes of the present invention, the degree of identity between two nucleic acid sequences is determined by the Wtlbur-ϋpman method (Wilbur and ϋpman, 1983, Proceedings of the National Academy of Science USA 80: 726-730) using the LASERGENE™ MEGALlGN ™ software (DNASTAFL inc., Madison, W!) with art identify table artel the following multiple alignment parameters; Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters are Ktuple=3, gap penalty=3, and windαws=2ø.

Sn a third aspect, the parent signal peptide or prepropeptide is encoded by a polynucleotide comprising or consisting of a nucleotide sequence which hybridizes under stringency conditions with nucleotides 1 to 51 of SEQ ID NO: 1 or nucleotides 1 to 66 of SEQ ID NO: 1 , respectively, or their complementary strands (J. Sambrook, E.F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).

Nucleotides 1 to 66 of SEQ ID NO: 1 or a subsequence thereof, as well as amino acids 1 to 22 of SEQ ID NO: 2, or a fragment thereof, may be used to design a nucieic acid probe to identify and clone DNA encoding signal peptides, propeptides, or pre propeptides from strains of different genera or species according to methods well known in the art, In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 15, preferably at least 30, and more preferably at least 45 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with ⁱ² P, ³ H, ^3S S, biotin, or avidin). Such probes are encompassed by the present invention.

Thus, a genomic DNA or cDNA library prepared from such other organisms may be screened for DNA which hybridizes with the probes described above and which encodes a signal peptide or prepropeptide. Genomic or other DNA from such other organisms may be separated by agarose or poiyacryiamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier materia!. In order to identify a clone or DNA which is homologous with nucleotides 1 to 51 of SEQ ID NO: 1 or nucleotides 1 to 66 of SEQ SD NO; 1 , or subsequences thereof, the carrier material is used in a Southern blot. For purposes of the present invention, hybridization indicates that the nucleic acid sequence hybridizes to a labeled nucieic acid probe corresponding to nucleotides 1 to 51 of SEQ ID NQ: 1 or nucleotides 1 to 66 of SEQ ID NO: 1 , or their

complementary strands, or a subsequence thereof, under stringency conditions defined herein. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for exampSe, X-ray film.

Sn a preferred aspect, the nucleic acid probe is a polynucleotide comprising a nucleotide sequence which encodes fhe signal peptide or prepropeptide of amino acids

1 to 17 of SEQ !D NO; 2 or amino acids 1 to 22 of SEQ ID NO; 2, respectively, or a subsequence thereof, In another preferred aspect, fhe nucSeic acid probe is nucleotides

1 to 51 of SEQ SD NO: 1 or nucleotides 1 to 88 of SEQ ID NO: 1.

For short probes that are about 15 nucleotides to about 60 nucleotides in length, stringency conditions are defined as prehybridization, hybridization, and washing post- hybridization at 5"C to WC below the calculated T _m using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48; 1390) in 0.9 M NaCI ₁ 0.09 M Tris-HCS pH 7.6, 6 mM EDTA, 0.5% NP-40 _; 1X Denhardt's solution, 1 mM sodium pyrophosphate. 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0,2 mg of yeast RNA per ml foilowing standard Southern blotting procedures for 12 to 24 hours optimally.

For short probes that are about 15 nucleotides to about 80 nucleotides in length, the carrier material is washed once in 6X SCC plus 0.1 % SDS for 15 minutes and twice each for 15 minutes using 8X SSC at 5"C to 10X below the calcuSated T _m .

Variant SignaJ Peptides or Preprøpeptides

Variants of a parent signaS peptide or parent prepropeptide can be prepared according to site-directed mutagenesis procedures well known in the art. Site-directed mutagenesis is a technique in which one or severai mutations are created at a defined site in a polynucleotide molecule encoding the parent signal peptide or parent prepropeptide. The technique can be performed in vitro or in vivo.

Site-directed mutagenesis can be accompSished in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving the cleavage by a restriction enzyme at a site Sn the plasmid comprising a polynucleotide encoding the a parent signal peptide or parent prepropeptide and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Usually the restriction enzyme that digests the plasmid and the oligonucleotide is the same, permitting sticky ends of the plasmid and insert to iigate to one another. See, for example, Scherer and Davis, 1979, Proc. Natl. Acad. Sd. USA 76: 4949-4955; and Barton et at., 1990, Nucleic Acids Research 18: 7349-4966.

Site-directed mutagenesis can be accomplished in vivo by methods known in the art. See, for example, U.S. Patent Application Pubϋcation 2004/0171154; Stories et ah, 2001 , Nature Biotechnology 19: 773-776; Kren ef a/., 1998, Nat. Med 4: 285-290; and Calissano and Macino, 1998, Fungal Genet Newslett. 43: 15-16. Any site-directed mutagenesis procedure can be used in the present invention.

There are many commercial kits available that can be used to prepare variants of a parent signal peptide or parent pre propeptide.

Sn the present invention, variants of a parent signal peptide or parent prepropeptide comprise a substitution at a position corresponding to position 2 of amino acids 1 to 17 of SEQ ID NO: 2 and/or one or more (severa!) deletions at positions corresponding to positions 18, 19, 2O ₁ 21 , and/or 22 of amino acids 18 to 22 of SEQ SD NO: 2, wherein the variant signal peptides or variant prepropeptides when operably Jinked (fused) in frame to a polypeptide direct the poiy peptide into a cell's secretory pathway. Sn a preferred aspect, the variant signa! peptides or variant prepropeptides comprise amino acid sequences which have a degree of identity of at least 70%, preferably at least 75%, more preferably at Seast 80%, more preferably at least 85%, even more preferabSy at least 90%, most preferably at Seast 95%, and even most preferably at least 96%, 97%, 98% _s or 99% to amino acids 1 to 17 of SEQ SD NO; 2 or amino acids 1 to 22 of SEQ SD NO: 2, respectiveiy. For purposes of the present invention, the degree of identity between two amino acid sequences is determined by the Clusta! method (Higgins, 1989, CABlOS 5: 151-153) using the LASERGENE™ MEGALiGN ™ software (DNASTAR, !nc, Madison, W!) with an identity table and the foiSowing muStiple aSignment parameters; Gap penaity of 10 and gap length penaSty of 10. Pairwise alignment parameters were KtUpIe=I , gap penafty=3, windows=5, and diagonai$=5, in a preferred aspect, the number of amino acid substitutions in the variants of the present invention comprise preferabSy 1 substitution, In another preferred aspect, the number of amino acid deletions in the variants of the present invention comprise preferably 1 , more preferably 2, even more preferabSy 3, most preferabSy 4, and even most preferabiy 5 deletions. In another preferred aspect, the number of amino acid substitutions in the variants of the present invention comprise preferabiy 1 substitution and the number of amino acid deletions in the variants of the present invention comprise preferably 1 , more preferably 2, even more preferabSy 3, most preferabSy 4, and even most preferabiy 5 deletions. Sn a preferred aspect, a variant signa! peptide comprises a substitution at a position corresponding to position 2 of amino acids 1 to 17 of SEQ !D NO; 2.

in a more preferred aspect a variant signal peptide comprises a substitution with Ala, Arg, Asn, Asp, Cys, Gin, G!u, Giy _s His, lie, Leu, Lys, Mel Phe, Pro, Ser, Thr, Trp, Tyr, or Va! at a position corresponding to position 2 of amino acids 1 to 17 of SEQ SD NO: 2. in an even more preferred aspect, a variant signal peptide comprises Lys as a substitution at a position corresponding to position 2 of amino acids 1 to 17 of SEQ SD NO: 2.

Sn a most preferred aspect, a variant signal peptide comprises substitution R2K at a position corresponding to position 2 of amino acids 1 to 17 of SEQ SD NO: 2. in an even most preferred aspect, a variant signal peptide comprises or consists of substitution R2K of amino acids 1 to 17 of SEQ ID NO: 2,

Sn another preferred aspect, a variant prepropeptide comprises a deietion at one or more (severaS) positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 Of SEQ ID NO; 2. in another preferred aspect, a variant prepropeptide comprises a deietion of Ala,

Arg, Asn, Asp, Cys, GIn, GSu ₁ Giy, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at one or more (several) positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ iD NO: 2.

Sn another preferred aspect, a variant prepropeptide comprises deletions at positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ SD NO: 2. in another preferred aspect, a variant prepropeptide comprises deletions of Ala, Arg, Asn, Asp, Cys, GIn, GSu, GSy, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ SD NO: 2. in another more preferred aspect, a variant prepropeptide comprises one or more (several) deletions of Ser, Pro, lie, Arg, and Arg at positions corresponding to positions 18, 19, 20, 21 , and 22, respectiveiy, of amino acids 1 to 22 of SEQ ID NO: 2. in another even more preferred aspect, a variant prepropeptide comprises deietions Ser, Pro, ile, Arg, and Arg at positions corresponding to positions 18, 19, 20, 21 , and 22, respectiveiy, of amino acids 1 to 22 of SEQ ID NO: 2. in another most preferred aspect, a variant prepropeptide comprises one or more {severai) deietions of S18\ P19*, S20 ^* , R21 ^* . and R22* of amino acids 1 to 22 of SEQ ID NO: 2. Sn another even most preferred aspect, a variant prepropeptide comprises or consists of deietions S18\ P19 ^* _r !20*, R21*, and R22 ^* of SEQ ID NO: 2,

in another preferred aspect, a variant prepropeptide comprises a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ !D NO; 2. in another more preferred aspect, a variant prepropeptide comprises a substitution with Ala, Arg, Asn, Asp, Cys, Gin, GIu ₁ GIy, His, !Ie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at a position corresponding to position 2 of amino acids 1 to 22 of SEQ iD NO; 2. in another even more preferred aspect, a variant prepropeptide comprises Lys as a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2. in another most preferred aspect, a variant prepropeptide comprises substitution

R2K at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2,

Sn another even most preferred aspect, a variant prepropeptide comprises or consists of substitution R2K of amino acids 1 to 22 of SEQ ID NO: 2. in another preferred aspect, a variant prepropeptide comprises a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO; 2 &nά a deietion at one or more (severai) positions corresponding to positions 18, 19, 20, 21 and 22 of amino acids 1 to 22 of SEQ ID NO: 2. in another more preferred aspect, a variant prepropeptide comprises a substitution with Ala, Arg, Asn, Asp, Cys, Gin, GIu, GIy, His, ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2 and a deletion of Ala, Arg, Asn, Asp, Cys, GIn, GIu, GSy, His, ile. Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at one or more (severa!) positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ ID NO: 2. in another even more preferred aspect, a variant prepropeptide comprises a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ SD NO; 2 and deletions at positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ !D NO: 2, in another even more preferred aspect, a variant prepropeptide comprises a substitution with Ala, Arg, Asn, Asp, Cys, Gin, GIu, GIy, His, ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2 and deietions of Aia, Arg, Asn, Asp, Cys, GIn, GIu, GIy, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at positions corresponding to positions 18, 19, 20, 21 , snd 22 of amino acids 1 to 22 of SEQ ID NO: 2. in another even more preferred aspect, a variant prepropeptide comprises Lys as a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ

ID NO: 2 and one or more {several) deletions of Ser, Pro, !Ie, Arg, and Arg at positions corresponding to positions 18, 19, 20, 21 , and 22. respectively, of amino acids 1 to 22 of SEQ SD NO: 2,

Sn another even more preferred aspect, a variant prepropeptide comprises substitution Lys at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2 and deletions of Ser, Pro, ISe. Arg. and Arg at positions corresponding to positions 18, 19, 20, 21 , and 22, respectiveiy, of amino acids 1 to 22 of SEQ ID NO: 2,

Sn another even more preferred aspect, a variant prepropeptide comprises substitution R2K at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO; 2 and deletions S18 ^* , P19 ^* , I20 ^* . R21 ^* _s and R22* at positions corresponding to positions 18, 19, 20, 21 , and 22, respectiveiy, of amino acids 1 to 22 of SEQ ID NO: 2,

Sn another most preferred aspect, a variant prepropeptide comprises or consists of substitution R2K of amino acids 1 to 22 of SEQ ID NO: 2 and one or more (several) deletions of S18 ^* , P19 ^* ₍ S2G*, R21*, and R22* of amino acids 1 to 22 of SEQ ID NO; 2. in another even most preferred aspect, a variant prepropeptide comprises or consists of substitution R2K of amino acids 1 to 22 of SEQ ID NO: 2 and deletions S18 ^* _r P1θ*, I2O\ R21\ anύ R22* of amino acids 1 to 22 of SEQ ID NO: 2. in another even most preferred aspect, the variant signai peptide is SEQ SD NO:

4. In another even most preferred aspect, the variant signai peptide coding sequence is SEQ SD NO: 3. in another even most preferred aspect, the variant prepropeptide is SEQ

ID NO: 8. In another even most preferred aspect, the variant prepropeptide coding sequence is SEQ SD NO: 5.

The variants of the present invention may further comprise one or more (several) additional substitutions, deletions, and/or insertions of the amino acid sequence.

Polynucleotides

The present invention also reiates to isolated polynucleotides that encode variant signal peptides and variant prepropeptides of a parent signai peptide &nά parent prepropeptide, respectively, wherein the variant signal peptides and variant prepropeptides comprise a substitution at a position corresponding to position 2 of amino acids 1 to 17 of SEQ ID NO: 2 and/or one or more (several) deletions at positions corresponding to positions 18, 19, 20, 21 , and/or 22 of amino acids 18 to 22 of SEQ SD

NO: 2, wherein the variant signal peptides or variant prepropeptides when operably

Sinked (fused) Sn frame to a polypeptide direct the polypeptide into a cell's secretory pathway.

The parent signa! peptide or prepropeptide can be any signal peptide or

pre propeptide that has at least 70% identity to amino acids 1 to 1 ? of SEQ !D NO: 2 or amino acids 1 to 22 of SEQ ID NO: 2; respectively; is encoded by a polynucleotide comprising or consisting of a nucleotide sequence that has at least 70% identity to nυcieotides 1 to 51 of SEQ ID NO. 1 or nucleotides 1 to 66 of SEQ ID NO: 1 , respectively, or their complementary strands; or is encoded by a polynucleotide comprising or consisting of a nucieotide sequence that hybridizes uMer stringency conditions with nucieotides 1 to 51 of SEQ SD NO: 1 or nucSeotides 1 to 66 of SEQ SD NO: 1 , respectively, or their compSementary strands, as described herein. in a preferred aspect, the isolated poSynucSeotides encode variant signal peptides or variant prepropeptides comprising amino acid sequences which have a degree of identity of at least 70%, preferably at Seast 75%, more preferably at least 80%, more preferabiy at Seast 85%, even more preferabiy at Seast 90%, most preferably at Seast 95%, and even most preferably at Seast 96%, 97%, 98%, or 99% to amino acids 1 to 17 of SEQ SD NO; 2 or amino acids 1 to 22 of SEQ !D NO: 2, respectively, in a preferred aspect, an isolated poiynucieotide encodes a variant signal peptide comprising a substitution at a position corresponding to position 2 of amino acids ! to 17 of SEQ !D NO: 2. in a more preferred aspect, an isolated poiynucieotide encodes a variant signal peptide comprising a substitution with Ala, Arg, Asn, Asp, Cys, Gin, GSu, Giy, His, SIe, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at a position corresponding to position 2 of amino acids 1 to 17 of SEQ !D NO: 2. in an even more preferred aspect, an isolated poiynucieotide encodes a variant signal peptide comprising Lys as a substitution at a position corresponding to position 2 of amino acids 1 to 17 of SEQ ID NO: 2, in a most preferred aspect, an isoiated poiynucieotide encodes a variant signal peptide comprising substitution R2K at a position corresponding to position 2 of amino acids 1 to 17 Of SEQ SD NO: 2. in an even most preferred aspect, an isolated poiynucieotide encodes a variant signal peptide comprising or consisting of substitution R2K of amino acids 1 to 17 of SEQ !D NO: 2, in another preferred aspect, a variant prepropeptide comprising a deletion at one or more (severai) positions corresponding to positions 18, 19, 20, 21 and 22 of amino acids 1 to 22 of SEQ ID NO: 2. in another preferred aspect, an isolated poiynucieotide encodes a variant prepropeptide comprising a deietion of Aia, Arg, Asn, Asp, Cys, Gin, GIu, Giy, His, SIe, Leu, Lys, Met, Phe, Pro, Ser Thr, Trp, Tyr or VaI at one or more (several) positions

corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ ID NO: 2. in another preferred aspect, an isolated poiynucSeotide encodes a variant prepropeptide comprising deletions at positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ ID NO: 2. in another preferred aspect, an isolated poiynucSeotide encodes a variant prepropeptide comprising deletions of AIa ₁ Arg, Asn, Asp, Cys, GIn, GIu ₁ GIy, His, !Ie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaS at positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ ID NO: 2. in another more preferred aspect, an isoiated poiyπucieotide encodes a variant prepropeptide comprising one or more (several) deietions of Ser, Pro, lie, Arg, and Arg at positions corresponding to positions 18, 19, 20, 21 , and 22, respectiveiy, of amino acids 1 to 22 of SEQ SD NO: 2. in another even more preferred aspect, an isolated poiynucleotide encodes a variant prepropeptide comprising deietions Ser, Pro, ile, Arg, and Arg at positions corresponding to positions 18, 19, 20, 21 , and 22, respectiveiy, of amino acids 1 to 22 of SEQ ID NO: 2. in another most preferred aspect, an isoiated poiynucleotide encodes a variant prepropeptide comprising one or more (several) deletions of S18*, P19*, I20 ^* , R21 ^* , and R22* of amino acids 1 to 22 of SEQ ID NQ: 2. in another even most preferred aspect, an isoiated poiynucSeotide encodes a variant prepropeptide comprising or consisting of deietions S18 ^* , P19*, i20*, R21*, and R22 ^* of amino acids 1 to 22 of SEQ ID NO: 2. in another preferred aspect, an isolated poiynucieotide encodes a variant prepropeptide comprising a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2.

Sn another more preferred aspect, an isoiated poiynucieotide encodes a variant prepropeptide comprising a substitution with AIa ₁ Arg, Asn, Asp, Cys, Gin, GSu, Giy, His, lie, Leu, Lys, Met, Pti&, Pro, Ser, Thr, Trp, Tyr, or VaI at a position corresponding to position 2 of amino acids 1 to 22 of SEQ !D NO: 2,

Sn another even more preferred aspect, an isolated poSynucleotide encodes a variant prepropeptide comprising Lys as a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ !D NO: 2. in another most preferred aspect, an isoiated poSynucleotide encodes a variant prepropeptide comprising substitution R2K at a position corresponding to position 2 of amino acids 1 to 22 of SEQ !D NO: 2,

in another even most preferred aspect, an isolated polynucleotide encodes a variant prepropeptide comprising or consisting of substitution R2K of amino acids 1 to 22 of SEQ !D NO: 2.

Sn another preferred aspect, an isolated poiynucieoiide encodes a variant prepropeptide comprising a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ SD NO; 2 and a deletion at one or more (severa!) positions corresponding to positions 18, 19, 20, 21 , and 22 of amino acids 1 to 22 of SEQ ID NO:

2. in another more preferred aspect, an isoiated poiynucieotide encodes a variant prepropeptide comprising a substitution with Ala, Arg. Asn, Asp, Cys, Gin, Giu, Giy, His. lie, Leu, Lys, Met, Phe, Pro, Ser\ Thr, Trp, Tyr, or VaI at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO; 2 and a deietion of Ala, Arg, Asn, Asp, Cys, Gin, GIu, Giy, His, lie, Leu, Lys, Met, Phe, Pro _; Ser, Thr _; Trp, Tyr, or Vai at one or more (severa!) positions corresponding to positions 18, 19. 20, 21 , and 22 of amino acids 1 to 22 of SEQ SD NO: 2. in another even more preferred aspect, an isolated poiynucieotide encodes a variant prepropeptide comprising a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2 and deletions at positions corresponding to positions 18, 19, 20, 21 , anά 22 of amino acids 1 to 22 of SEQ SD NO: 2. in another even more preferred aspect, an isolated poiynucieotide encodes a variant prepropeptide comprising a substitution with Ala, Arg, Asn, Asp, Cys, Gin, GIu, Giy, His, !Ie, Leu, Lys, Met. Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2 and deietions of Ala, Arg, Asn, Asp, Cys, GIn, Giu, Giy, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or VaI at positions corresponding to positions 18. 19, 20, 21 , and 22 of amino acids 1 to 22 Of SEQ !D NO: 2, in another even more preferred aspect, an isolated poiynucieotide encodes a variant prepropeptide comprising Lys as a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ SD NO: 2 and one or more (several) deietions of Ser, Pro, lie, Arg, anά Arg at positions corresponding to positions 18, 19, 20, 21 , and 22, respectiveiy, of amino acids 1 to 22 of SEQ ID NO: 2. in another even more preferred aspect, an isolated poiynucieotide encodes a variant prepropeptide comprising substitution R2K at a position corresponding to position 2 of amino acids 1 to 22 of SEQ !D NO: 2 and one or more (severa!) deietions of S18 ^* , P19 ^* , I20 ^* , R21*. and R22* at positions corresponding to positions 18, 19, 20, 21 , and 22, respectiveiy, of amino acids 1 to 22 of SEQ ID NO: 2.

in another even more preferred aspect, an isolated polynucleotide encodes a variant prepropeptide comprising substitution R2K at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2 and deletions S18 ^* _; P19*, I20*, R21* _s and R22 ^* at positions corresponding to positions 18, 19, 20, 21 , and 22, respectiveiy, of amino acids 1 to 22 of SEQ ID NO: 2. in another most preferred aspect, an isoiated polynucleotide encodes a variant prepropeptide comprising or consisting of substitution R2K of amino acids 1 to 22 of SEQ ID NO; 2 and one or more (several) deletions of S18 ^* . P19 ^* . !20\ R21 ^* . and R22 ^* of amino acids 1 to 22 of SEQ ID NO: 2. in another even most preferred aspect, an isoiated polynucleotide encodes a variant prepropeptide comprising or consisting of substitution R2K of amino acids 1 to 22 of SEQ ID NO; 2 and deiβtions S18 ^* , P19 ^* , !20\ R21 ^* . and R22 ^* of amino acids 1 to 22 of SEQ SD NO: 2. in another even most preferred aspect, an isoiated polynucleotide encodes the variant signai peptide of SEQ ID NO; 4. in another even most preferred aspect, an isolated poiynucieotide encoding the variant signal peptide of SEQ ID NO: 4 is SEQ !D NO: 3. In another even most preferred aspect, an isolated poiynucieotide encodes the variant prepropeptide of SEQ ID NO: 6. In another even most preferred aspect, an isolated poiynucieotide encoding the variant prepropeptide of SEQ ID NO; 6 is SEQ iD NO: 5.

The term isolated poiynucieotide" as used herein refers to a poiynucieotide which is essentiaily free of other polynucleotides, e.g., at least 20% pure, preferabiy at Seast 40% pure, more preferably at least 60% pure, even more preferably at ieast 80% pure, and most preferabiy at least 90% pure as determined by agarose electrophoresis. The present invention aiso relates to methods for obtaining a polynucleotide encoding a variant signal peptide or variant prepropeptide, comprising: (a) introducing into a parent signal peptide coding sequence or a parent prepropeptide coding sequence a substitution at a position corresponding to position 2 of amino acids 1 to 22 of SEQ ID NO: 2 and/or a deletion at one or more (several) positions corresponding to positions 18, 19, 20, 21 , and/or 22 of amino acids 1 to 22 of SEQ SD NO: 2, wherein the variant signal peptide or variant prepropeptide when operabiy linked in frame to a polypeptide having biological activity directs the polypeptide into a cell's secretory pathway; and (b) recovering the polynucleotide.

Polypeptides

The polypeptide may be native or heterologous (foreign) to the fungal host cell of

interest. The term "heterologous polypeptide" is defined herein as a polypeptide which is not native to the host cell; or a native polypeptide in which structural modifications have been made to alter the native poSypepticJe.

The poiypeptide may be any polypeptide having a biological activity of interest. The term "polypeptide" is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins. The term "polypeptide" also encompasses hybrid poiypeptides, which comprise a combination of partiai or complete polypeptide sequences obtained from at ieast two different poiypeptides wherein one or more (several) may be heterologous to the fungal cell. Polypeptides further include naturaiiy occurring aSleiic and engineered variations of a poiypeptide,

Sn a preferred aspect, the poiypeptide is an antibody, antigen, antimicrobial peptide, enzyme, growth factor, hormone, immυnodilator, neurotransmitter, receptor, reporter protein, structural protein, and transcription factor. in a more preferred aspect, the polypeptide is an oxidoreductase, transferase, hydroiase, iyase, isomerase, or ligase. In a most preferred aspect, the polypeptide is an aipha-giucosidase, aminopeptidase, amylase, carbohydrase, carboxypeptidase, cataiase, εeiiuiase, chitinase, cutinase, cyεiodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-gaiactosidase, glucoamylase, giucocerebrosidase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectSnolytic enzyme, peroxidase, phosphoiipase, phytase, polyphenoioxidase, proteolytic enzyme, rifaonuciease, transglutaminase, urokinase, or xylanase. in another preferred aspect, the poiypeptide is an aibumin, collagen, tropoelastin, elastin, or geiatin. in a preferred aspect, the polypeptide is a Sipase. in a more preferred aspect, the poiypeptide is a lipase obtained from Thermomyces. In an even more preferred aspect, the poiypeptide is a wild-type lipase obtained from Thermomyces lanuginosus. In a most preferred aspect, the polypeptide is a wiid-type Thermomyces ianuginosus lipase comprising or consisting of the mature poiypeptide of SEQ ID NO: 8. in an even most preferred aspect, the mature poiypeptide of SEQ ID NO: 8 is encoded by the mature polypeptide coding sequence of SEQ ID NO: 7. in another even more preferred aspect, the poiypeptide is a variant lipase obtained from a Thermomyces ianuginosus lipase. In another most preferred aspect, the polypeptide is a Thermomyces ianuginαsus variant iipase comprising or consisting of the mature polypeptide of SEQ iD NO: 10. In another even most preferred aspect, the mature polypeptide of SEQ ID NO:

10 is encoded by the mature polypeptide coding sequence of SEQ !D NO: 9, in a preferred aspect, the mature poiypeptide is amino acids 23 to 291 of SEQ ID

NO: 8. In another preferred aspect, the mature poiypeptide coding sequence is nucleotides 67 to 918 of SEQ ID NO: 7. In another preferred aspect, the mature polypeptide is amino acids 23 to 291 of SEQ ID NO: 10. Sn another preferred aspect, the mature polypeptide coding sequence is nucleotides 67 to 873 of SEQ ID NO: 9,

A polynucleotide encoding a poiypeptide may be obtained from any prokaryotic, eukaryotic, or other source. For purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the poiypeptide is produced by the source or by a ceiS in which a gene from the source has been inserted.

The techniques used to isoiate or cione a nucieic acid sequence encoding a polypeptide are known in the art and inciude isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cioning of the nucieic acid sequence from such genomic DNA can be effected, e.g., by using the well known poiymerase chain reaction (PCR). See, for example, lnnis βt a/. , 1990, PCR Protocols: A Guide to Methods and Application, Academic Press, New York, The cloning procedures may involve excision anά isoiation of a desired nucieic acid fragment comprising the nucleic acid sequence encoding the polypeptide, insertion of the fragment into a vector moiecule, and incorporation of the recombinant vector into the mutant fungal cei! where muitiple copies or clones of the nucleic acid sequence will be replicated. The nucieic acid sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.

NucJeic Acid Constructs

The present invention aiso relates to nucleic acid constructs comprising a poiynucleotide encoding a poiypeptide operably iinked to a variant signai peptide coding sequence or variant prepropeptide coding sequence of the present invention and one or more control sequences which direct the expression of the coding sequence in a suitable host ceii under conditions compatible with the contro! sequences. Expression will be understood to inciude any step invoived in the production of the poiypeptide including, but not iimited to, transcription, post-transcriptional modification, translation, post-transiational modification, and secretion.

"Nucleic acid construct" is defined herein as a nucleotide molecule, either single- or doubie-stranded, which is isoiated from a naturaliy occurring gene or which has been modified to contain segments of nucleic acids combined and juxtaposed in a manner

that would not otherwise exist in nature. The term nucleic acid construct is synonymous with the term expression cassette when the nucleic acid construct contains a coding sequence and all the eontroi sequences required for expression of the coding sequence.

An isolated polynucleotide encoding a poiypeptide may be further manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the nucieotide sequence of the polynucleotide prior to its insertion into a vector may be desirabie or necessary depending on the expression vector. The techniques for modifying nucleotide sequences utilizing recombinant DNA methods are weif known in the art. in the methods of the present invention, the poiynucSeottde may comprise one or more native control sequences or one or more of the native eontroi sequences may be replaced with one or more eontroi sequences foreign to the polynucleotide for improving expression of the coding sequence in a host cell.

The term "eontroi sequences" is defined herein to inciude al! components which are necessary or advantageous for the expression of a polypeptide of interest. Each eontroi sequence may be native or foreign to the polynucleotide encoding the poiypeptide. Such control sequences include, but are not limited to, a leader, poiyadenylation sequence, propeptide sequence, variant signai peptide coding sequence or variant prepropeptide coding sequence of the present invention, and transcription terminator. At a minimum, the contro! sequences include a variant signal peptide coding sequence or variant prepropeptide coding sequence of the present invention, and transcriptional and translationai stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites faciiitating iigation of the contro! sequences with the coding region of the polynucieotide sequence encoding a polypeptide.

The contro! sequence may be an appropriate promoter sequence, which is recognized by a host cell for expression of a poiynucieotide. The promoter sequence contains transcriptiona! eontroi sequences which mediate the expression of the poiypeptide. The promoter may be any sequence which shows transcriptional activity in the host cell of choice inciuding mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extraceiiular or intraceiiular polypeptides either homologous or heterologous to the host cell.

Examples of suitable promoters for directing the transcription of the nucieic acid constructs of the present invention in a filamentous fungal host ceSi are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus nlger neutrai alpha-amylase. Aspergillus niger acid

sfabie alpha-amyiase, Aspergillus niger or Aspergillus awamori glucoamySase (glaA), Rhizomucor miehei iipase. Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus mutilans acetamidase, Fusariurn venenatum amyioglucosidasβ (WO 00/56900), Fusaiium venenatum Daria (WO 00/56900), Fusaiium v&n&natum Guinri (WO 00/58900), Fusarium oxysporum trypsin-like protease (WO 96/00787). Trichoderma reesei beta-glucosidase, Trichoderma reesei eeilobiohydroiase I, Trichoderma reesei ceSiobiohydrolase IL Trichoderma reesei endogiucanase !, Tnchodβrma reesei endogiucanase ii, Tnchodβrma reesei endogSucanase !!!, Trichoderma reesei endoglucanase IV, Trichoderma r&&sei endogiucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase Si. Trichoderma reesei beta-xyiosidase _; as weii as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral aipha-amylase and Aspergillus oryzae triose phosphate isomerase); and mutant, truncated, and hybrid promoters thereof. in a yeast host, useful promoters are obtained from the genes for

Saccharomyces cerevisiae enoiase (ENO- 1), Saccharomyces cerevisiae galactokinase (GALt), Saccharomyces cerevisiae alcohoi dehydrogenase/glyceraldehyde-3- pnosphate dehydrogenase (ADH1 , ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metailothionein (CUPI), and Saccharomyces cerevisiae 3-phospnogiyceratβ kinase. Other useful promoters for yeast host ceiis are described by Romanos et a?,, 1992, Yeast 8: 423-488,

The contro! sequence may be a suitable transcription terminator sequence, which is recognized by a host cell to terminate transcription. The terminator sequence is operabiy linked to the 3' terminus of the polynucleotide sequence encoding the polypeptide. Any terminator whien is functional Sn the host cell of choice may be used in the present invention.

Preferred terminators for filamentous fungal host ceiis are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosSdase, and Fusarium oxysporum trypsin-like protease.

Preferred terminators for yeast host ceils are obtained from the genes for Saccharomyces cerevisiae enoiase, Saccharomyces cerevisiae cytochrome C (CYC I) ₁ and Saccharomyces cerevisiae gSycβraldβnyde-3-phosρhate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos e? a/. , 1992, supra. The control sequence may also be a suitabie leader sequence, a nontranslated region of an rπRNA which is important for translation by the host ceil. The leader

sequence is operabiy linked to the 5' terminus of the polynucleotide sequence encoding the poiypeptide. Any ieader sequence that is functional in the host ceii of choice may be used in the present invention.

Preferred leaders for filamentous funga! host celis are obtained from the genes for Aspergillus oryzae TAKA amyiase and Aspergillus nidulans triose phosphate isomerase.

Suitable Seaders for yeast host ceiis are obtained from the genes for

Saccharomyces cerevisiae enolase (ENO- 1), Saccharomyces cβrevisiaβ 3- phosphαgiycerate kinase, SaccharomycBS cerevisiae alpha-factor, and Saccharomyces cerevisiae alcoho! dehydrogenasβ/glyceraidehyde-3-phosphate dehydrogenase

(ADH2/GAP),

The controi sequence may also be a potyadenyfation sequence, which is operabiy linked to the 3 ¹ terminus of the poiynucleotide sequence and which, when transcribed, is recognized by the host ceii as a signal to add polyadenostne residues to transcribed rriRNA. Any poiyadenylation sequence which is functional in the host ceii of choice may be used in the present invention.

Preferred poiyadenylation sequences for fiiamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amyiase, Aspergillus niger gSucoamylase, Aspergillus nidulans anthraniiate synthase, Fusarium oxysporum trypsin- iike protease, and Aspergillus niger aipha-giucosidase.

Usefu! poiyadenylation sequences for yeast host ceils are described by Guo and Sherman. 1995. Molecular Cellular Biology 15' 5983-5990.

The controi sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant poiypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases),

A propoiy peptide is genera ISy inactive and can be converted to a mature active poiypeptide by catalytic or autocatalytic cieavage of the propeptide from the propoiypeptide. The propeptide coding region may be obtained from the genes for

Saccharomyces cer&visiae aipha-factor, Rhizomucor rniehei aspartic proteinase, Thermomyαes lanuginosus iipase, anά Myceliophthora thermophila laccase (WO

95/33836).

Where both signa! peptide and propeptide regions are present at the amino terminus of a poiypeptide. the propeptide region Ss iinked in frame to the amino terminus of a polypeptide and the signai peptide region is linked in frame to the amino terminus of the propeptide region. it may also be desirabie to add regulatory sequences which aiiow the regulation

of the expression of the polypeptide relative to the growth of the host eel!. Examples of regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Sn yeast, the ADH2 system or GAL 1 system may be used. Sn fiSamentous fungi, the TAKA alpha-amyiase promoter, Aspergillus niger glucoamyiase promoter, and Aspergillus oryzae giucoamyiase promoter may be used as regulatory sequences. Other exampSes of regulatory sequences are those which aSSow for gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene which is ampSified in the presence of methotrexate, and the metaliothionein genes which are amplified with heavy metals. Sn these cases, the polynucleotide comprising a nucleotide sequence encoding the polypeptide would be operabiy linked with the regulatory sequence.

Expression Vectors

The present invention also relates to recombinant expression vectors comprising a variant signal peptide coding sequence or variant prepropeptide coding sequence of the present invention, a polynucleotide sequence encoding a polypeptide of interest, and transcriptional anά transiational stop signaSs. The various nucleotide anά contro! sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to aiSow for insertion or substitution of the promoter and/or polynucSeotide sequence encoding the polypeptide at such sites. Aiternatsvely, the poSynucieoticSe sequence may be expressed by inserting the poSynucieotide sequence or a nucleic acid construct comprising the variant signal peptide coding sequence or variant prepropeptide coding sequence and poSynucieotide sequence encoding the polypeptide into an appropriate vector for expression. In creating the expression vector, the coding sequence is Socated Sn the vector so that the coding sequence is operably iinked to a variant signaS peptide coding sequence or variant prepropeptide coding sequence of the present invention and one or more appropriate controS sequences for expression.

The recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be convenientiy subjected to recombinant DNA procedures and can bring about the expression of the poiynucieotide sequence. The choice of the vector will typicalSy depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular piasmids.

The vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells. A seSectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy

metaSs, prototrophy to auxotrophs, and the like. Suitable markers for yeast host ceils include, but are not limited to, ADE2, HiS3 ₍ LEU2, LYS2, MET3, TRP1 , and URA3, Selectabie markers for use in a fiiamentoυs fungai host celi include, but are not iimited to, amclS (acetamidase), argB (ornithine carbamoyliransferase), bar (phosphinothricin aceiyltraπsferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-S'-phosphate decarboxylase). sC (suifate adenyitransfβrase), trpC (anthraniiate synthase), as weii as equivaients thereof. Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus niduians or Aspergillus oryzae and the bar gene of Strepiomyces hygmscopicus. The vector may be an autonomousiy repiicating vector, λθ. , a vector which exists as an extraehromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomaf element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring seif-repSication. Alternatively, the vector may be one which, when introduced into the host ceil, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or piasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.

The vectors of the present invention preferably contain an e!ement{s) that permits stabie integration of the vector into the host celi's genome or autonomous replication of the vector in the cell independent of the genome.

For integration into the host cei! genome, the vector may rely on the polynucleotide sequence encoding the poiypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination. Alternatively, the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell. The additional nucleotide sequences enable the vector to be integrated into the host cell genome at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the SntegratSona! elements should preferably contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably 800 to 10,000 base pairs, which have a high degree of identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell Furthermore, the integrationai elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may be integrated into the genome of the host celi by non-

homologous recombination.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host ceil in question. The origin of repiication may be any plasmid replicator mediating autonomous replication which functions in a cell. The term "origin of repiication" or ^' 'piasmid replicator" is defined herein as a nucleotide sequence that enables a piasmid or vector to replicate in vivo.

Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1 , ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN8. The origin of repiication may be one having a mutation which makes its functioning temperature-sensitive in the host ceSi (see, e.g.,

Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75: 1433).

Examples of origins of repiication useful in a filamentous fungal cell are AMA 1 and ANSI (Gems et a/,, 1991 , Gene 98:81-67; Cullen et a/., 1987, Nucleic Adds Research 15: 9183-9175; WO 00/24883). Isolation of the AMA 1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.

More than one copy of a poSynucieotide encoding a polypeptide may be inserted into the host ceii to increase production of the gene product. An increase in the copy number of the poiynucleotide can be obtained by integrating at ieast one additional copy of the nucleotide sequence into the host eel! genome or by inciuding an ampiifiable seieεtable marker gene with the nucleotide sequence where ceISs containing amplified copies of the seiectable marker gene, and thereby additional copies of the poiynucleotide, can be selected for by cultivating the ceiis in the presence of the appropriate seiectable agent.

The procedures used to iigate the elements described above to construct the recombinant expression vectors of the present invention are weii known to one skiiled in the art (see, e g. , Sambrook et a!., 1989, supra).

Host Cells

The present invention aiso relates to recombinant host cells, comprising a variant signal peptide coding sequence or variant prepropeptide coding sequence of the present invention operabiy linked to a polynucleotide encoding a polypeptide, which are advantageously used Sn the recombinant production of the polypeptide. A vector comprising a variant signal peptide coding sequence or variant prepropeptide coding sequence of the present invention operabiy linked to a polynucleotide encoding a

polypeptide is introduced info a host ceii so that the vector is maintained as a chromosomal integrant or as a self-rβplicattng βxtra-chromosornai vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent celi due to mutations that occur during replication. The choice of a host celi wiii to a iarge extent depend upon the gene encoding the poiypeptide and its source.

The host ceii may be any fungal cell useful in the methods of the present invention. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota. Chytridiomycota, and Zygomycota (as defined by Hawksworih ei a/. , In, Ainsworth and Bssby's Dictionary of The Fungi 8th edition. 1995. CAB international, University Press, Cambridge, UK) as weli as the Oomycota (as cited in Hawksworth et al , 1995, supra, page 171} and a!! mitosporic fungi (Hawksworth &t a!., 1995, supra). in a preferred aspect, the fungai host ceii is a yeast ceii. "Yeast ^" as used herein includes ascosporogenous yeast (Eπdomycetaies), basidiosporogenous yeast, and yeast belonging to the Fungi imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore. SM,, and Davenport. R. R., eds, Soc App. Bacteήol. Symposium Series No. 9, 1980). in a more preferred aspect, the yeast host ceil is a Candida, Hansenula, Ktuyvemmyces. Pichia, Saccharomyces. Schizosaccharomyces, or Yarrowia celi. in a most preferred aspect, the yeast host cell is a Saccharomyces carlsbergensis. Saccharomyces cerevisiae, Saccharomyces ύiastaticus, Saccharomyces douglasii, Saccharomyces ktuyveri, Saccharomyces norbensis or Saccharomyces oviformis ceii in another most preferred aspect, the yeast host cell is a Kluyveromyces lactis ceii. In another most preferred aspect, the yeast host celi is a Yairowia lipoidica cell. in an even most preferred aspect, the yeast host cell is Saccharomyces cerevistae JG 169 {MAT-α, ura3-52. ieu2-3 _f pep4- 1137, Ns3δ2 _f prb t :ieu2 δpre 1.:hιs3) {U.S. Patent No. 5,770,406). in another preferred aspect, the fungai host ceil is a filamentous fungal cell.

"Filamentous fungi" inciude aii fiiamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et a! , 1995. supra). The fiiamentous fungi are characterized by a mycelial wall composed of chitin, celluiose, giucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphai elongation and carbon catabolism is obSigately aerobic, in contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a uniceiiuiar thallus and carbon

catabolism may be fermentative. in a more preferred aspect, the filamentous fungal host eel! is a eel! of a species of, but not limited to, Acretnonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Crypiococcus, Filibasidium, Fusarium, Humicoia, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neumspora, Paecilomyces, Peniciliium, Phanerochaete, Phtebia, Pirotnyces, Pleurotus, Schizophyilum, Taiaromyces, Thermoascus, Thielavia, Tolypociadium, Trametes, or Tήchαd&rma. in an even more preferred aspect, the fiiamentoυs fungal host eel! is an Aspergillus awamori, Aspergillus fumsgatus, Aspergillus foeύdus, Aspergillus japomcus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae ceii. in another most preferred aspect, the ffSamentous fungal host eel! is a Fusaπum bactridioides, Fusanum ζ^erealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusaαum graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseurn, Fusarium sarnbuαnum. Fusanum sarcQCtvoum, Fusanum sporotrichioides, Fusarium sulphurθum, Fusanum iorulosum, Fusarium irichothecioides, or Fusanum venenatum ceil, in another most preferred aspect, the fiiamentous fungal host ceii is a Bjerkandera adusta, Cersporsopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea. Ceriporiopsis gilvescens, Ceriporiopsss pannocinta. Ceriporiopsis nvulosa, Cenpoήopsis subrufa, Cenporiopsis subvermispora. Chrysosporium keratinophilum, Chrysosporium Sυcknowense, Chrysosporium tropϊcum, Cbrysosporium merdaήum, Chrysosporium mops, Chrysosporium pannicola, Chrysosporium queensiandicum, Chrysosporium zonatυm, Coprinus cinereus, Corioius hirsutus, Humicota /πsotens, Humicoia lanuginosa, Mucor miehei _> Myceliopnthora ϋwrmophila, Neumspora crassa, Penicilliuiv puφurogenum, Phaneroctiaeie chrysosporium, Pblebia radiata, Pleurotus eryngii, Thielavia ierrestris, Trametes villosa _t Trametes versicolor, Trichodβrma harzianum, Tήchoderma koningit, Trichoderma iongibrachiatum, Tnchoderma reesei. or Trichoderma vmde ceii.

Fungal ceSSs may be transformed by a process involving protoplast formation, transformation of the protopiasts, and regeneration of the eel! wall in a manner known per se, Suitabie procedures for transformation of Aspergillus host cells are described in EP 238 023 and Yelton et al , 1984, Proceedings of the National Academy of Sciences USA 81 : 1470-1474. Suitabie procedures for transformation of Trichoderma reesei host ceils is descnbed in Penttiia et a/., 1987, Gene 61: 155-164, anά Gruber e£ al. , 1990, Curr Genet 18<i):71-6. Suitabie methods for transforming Fusanum species are described by Maiardier et al., 1989, Gene 78. 147-156 and WO 96/00787. Yeast may

he transformed using the procedures described by Becker and Guarenie, In Abeison, J.N. and Simon. M. I., editors. Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; ito et a/, ₅ 1983, Journal of Bacteriology 153: 163; and Hinnen et a/. , 1978, Proceedings of the National Academy of Sciences USA 75: 1920.

The present invention is further described by the following examples which should not be construed as iirniting trie scope of the invention.

Examples

Chemicals used as buffers and substrates were commercial products of at least reagent grade.

DMA Sequencing DNA sequencing was performed using an Appiied Biosystems Mode! 3130X

Genetic Analyzer (Appiied Biosystems, Foster City, CA, USA) using dye terminator chemistry (Giesecke et aL, 1992, Journal of ViroL Methods 38: 47-60). Sequences were assembled using phred/phrap/consed (University of Washington, Seattle, WA, USA) with sequence specific primers.

Strains

Saccharomyces cerevisiae JG 169 (MAT-α, ura3-52, leu2-3, pep4-1137, Ms3δ2, prb1::leu2, δpre1.:his3) (U.S. Patent No. 5,770,406} and Aspergillus oryzae BECh2 {help, &amy.. CPA-, KA-, &np1) (WO 00/39322) were used as host strains in the Examples herein.

Media and Solutions

YPD medium was composed per liter of 10 g of yeast extract, 20 g of Bacto peptone, and 2% giucose. CUP minus ura medium (pH 7.0) {" original" medium) was composed per Siter of 1 mi of 100 mM CUSCV SHJO, 1.7 g of yeast nitrogen base (YNB) without amino acids and ammonium sulfate (BIO101 , Carlsbad, CA, USA), 0.8 g of CSM-ura with 40 mg of adenine (BiOIO L Carlsbad. CA, USA). 5 g of CasamSno acids (Becton, Dickenson and Company, Sparks, MD, USA), 100 ml of 50% glucose, 50 ml of 0,5 M K ₂ HPO^ and 1 ml of 100 mg/m! arnpiciin.

Yeast ura minus seiection medium was composed per liter of 6.7 g of yeast

nitrogen base (YNB) with ammonium sulfate, 5 g of Casamino acids, 100 ml of 0.5 M succinic acid pH 5, 40 ml of 50% glucose, and 2 mi of 10 mg/ml chloramphenicol.

Yeast ura minus selection plates were composed of yeast ura minus seiection medium supplemented with 20 g of Noble agar per liter, MY2S medium was composed per iiter of 25 g of maitodextriπ, 2 g of

WgS<_V7H;0, 10 g of KH ₂ PO, _! , 2 g of citric acid, 2 g of K ₂ SO^ 2 g of urea, 10 g of yeast extract, and 1 ,5 ml of AMG trace metais solution, adjusted to pH 8.

AMG trace metals solution was composed per liter of 14.3 g of ZnSO^-TH ₂ O, 2.5 g of CUSOU-SH ₂ O, 0.5 g of NiCi _n 6HA 13.8 g of FeSO ₄ JH ₂ O ₁ 8.5 g of MnSOu-H ₂ O, and 3 g of citric acid,

SC ura minus medium was composed per liter of 7.5 g of yeast nitrogen base without amino acids (FIuKa, Buchs, Switzerland), 11.3 g of succinic acid, 6,8 g of sodium hydroxide, 5.6 g of Casamino acids, and 0.1 g of L-tryptophan, and 100 ml of a sterile solution of 50% fructose and 400 μ! of a sterile solution of 250 mg/ml of ampiciin, both added after autoeiaving.

SC ura minus plates were composed of SC ura minus medium, except 100 ml of steriie 20% fructose Ss used, and 20 g of agar (Sigma Chemical Co., St. Louis, MO, USA).

SDMUA medium was composed per liter of 1.7 g yeast nitrogen base without amino acids, 5.0 g of Casamino acids, 0.8 g of CMS-Ura with 40mg/l ADE (MP

Biomedicals, irvine, CA, USA), 10 ml of 10 mM CuSO*- 5H ₃ O. and 10 ml of 1 M K ₂ HPO.,, anά 100 ml of sterile 50% fructose and 400 μi of sterile 250 mg/m! of ampiεiiiin, both added after autoeiaving.

SOC medium was composed of 2% tryptone, 0.5% yeast extract, 10 mM NaCL 2.5 mM KCi, 10 ml/I MgC!?, and 10 mM MgSO*, sterilized by autooiaving and then fiiter- steriiized glucose was added to 20 mM.

2X YT plates were composed per liter of 16 g of tryptone, 10 g of yeast extract, 5 g of NaCI, and 15 g of bacto agar.

COVE plates were composed per iiter of 342 g of sucrose, 10 mi of COVE salts solution, 10 ml of 1 M acetamide, 10 mi of 1.5 M CsCL and 25 g of Noble agar,

COVE salts solution was composed per liter of 26 g of KCI, 26 g of MgSO ₄ , 76 g of KHj POA, and 50 ml of COVE trace metals solution.

COVE trace metals solution was composed per liter of 0.04 g of 0.4 g of CuSO ₄ -SH ₂ O, 1 ,2 g of FeSO ₄ -7H ₂ O, 0,7 g of MnSO ₄ -H ₂ O, 0.8 g of Na ₂ MoO ₂ H ₂ O, and 10 g of ZnSO ₄ TH ₂ O.

VNO ₃ RLMT agar was composed per liter of 20 ml of 5OX Vogeis with 25 mM

NaNO^, 273.33 g of sucrose, and 15 g of low melting point agarose.

5OX Vogeis with 25 mM NaNO ₃ was composed per iiter of 125 g of sodium citrate dihydrate, 250 g of KH ₂ PO ₄ , 106.25 g of NaNO,, 10 g of MgSO ₄ -TK-O ₁ 5 g of CaCS ₂ -2H ₂ θ, 2.5 ml of biotin solution, and 5 mi of Vogeis trace elements solution. Biotin solution was composed of 5 mg of biotin in 100 ml of 50% ethanol.

Vogeis trace elements solution was composed of 5 g of citric acid monohydrate, 5 g of ZnSO ₄ TH ₃ O, 1 g of Fe{NH ₄ );(SO^)r6H,O, 0,25 g of CUSO ₄ -SH ₃ O, 0,05 g of MnSO ₄ - H ₂ O, 0.05 g of H ₃ BO ₃ , and 0.05 g of Na ₂ MoO^H ₂ O.

Example 1: PCR amplification of a copper-inducϊble promoter {CUP1 promoter)

PCR primers 997247 and 997248, shown below, were designed to amplify the Sacchammyε&s cerevisiae copper- inducibie promoter (CUP1 promoter) from piasmid pCu426 (Labbe and ThieSe, 1999, Methods in Enzymoiogy 306; 145-153). Restriction enzyme sites, Age i and Eco Ri, were incorporated into the primer design for cioning into the Saccharomycøs cβrevisiaβ expression piasmid ρMB1537 (see Example 2). Primer 997247: S'-CACCGGTGCATGCCTGCAGGAGCTCCTAGTTAGAAA-S' (SEQ ID NO; 11)

Age i Primer 997248: S'-AACTATTCTTGAATGGAATTCTAGTCGATGACTTCT-S' (SEQ SD NO: 12)

Eco Rl

The CUP promoter fragment was ampiified by PCR using an EXPAND® High Fideiity PCR System (Roche, indianapoiis, IN, USA). The PCR amplification reaction mixture contained approximateiy 50 ng of pCu42δ piasmid DNA, 1 μi of primer 997247 (50 pmoi/μi), 1 μl of primer 997248 (50 pmol/μl), 5 μi of 1OX PCR buffer (Roche, Indianapolis, IN, USA) with 15 mM MgCI ₂ , 1 μl of dNTP mix {10 mM each), 40.25 μ! of water, and 0.75 μl (3.5 ϋ/μl) of DNA poiymerase mix (Roche, Indianapolis, IN, USA). An EPPENDORF® MASTERCYCLER® 5333 (Eppendorf, Westbury, NY, USA) was used to amplify the fragment programmed for 1 cycie at 94 ⁰ C for 2 minutes: 10 cycles each at 94 ⁰ C for 15 seconds, 55 ⁰ C for 30 seconds, and 72 ⁰ C for 15 seconds; 15 cycies each at 94 ⁰ C for 15 seconds, 55 ⁰ C for 30 seconds, and 72 ⁰ C for 15 seconds plus a 5 second eiongation at each successive cycie; 1 cycie at 72 ⁰ C for 7 minutes; and a 1O ⁰ C rrøid.

A PCR product of 246 bp was purified by 1.5% agarose gel eiectrophoresis using TAE buffer (4.S4 g of Tris Base, 1 ,14 ml of giacial acetic acid, and 2 ml of 0.5 M EDTA pH 8.0 per liter) and further purified using a GjAQUiCK® Ge! Extraction Kit (QIAGEN Inc., Valencia, CA, USA), The 246 bp PCR product was iigated with pCR2.1-

TOPG® (invstrogen Corporation, Carlsbad, CA, USA) according to the manufacturer's instructions. After the incubation, 2 μ! of the mixture was used to transform ONE SHOT® TOP10 chemically competent E coli cells (Invitrogen Corporation, Carisbad, CA, USA). A 2 μl volume of the ligation mixture was added to the E coii cells and incubated on ice for 5 minutes. Subsequently, the cells were heat shocked for 30 seconds at 42 ^a C. and then placed on ice for 2 minutes, A 250 μ! volume of SOC medium was added to the cells and the mixture was incubated for 1 hour at 37°C and 250 rpm. After the incubation the coSonies were spread on 2X YT plates supplemented with 100 μg of ampicϋn per ml and incubated at 37*C overnight for selection of the piasmid. Eight colonies that grew on the plates were picked with sterile toothpicks and grown overnight at 37"C, 250 rpm in a 15 ml FALCON® tube containing 3 mi of LB medium supplemented with 100 μg of ampiciilin per ml. The plasmids were isolated using a BiøRobot 9600 (QIAGEN Inc., Valencia, CA, USA).

Four μ! volumes of the resuiting piasmid miniprβps were digested with Eco Ri, The digestion reactions were analyzed by agarose gel chromatography &nά UV analysis as previously described for the PCR reaction. Isolated plasmids containing an insert were sequenced using 1 μi of plasmid template, 16 ng of M13 primer (forward or reverse) (MWG Biotech, High Point, NC, USA), and water to 6 μl. The resulting piasmid with the correct sequence was designated pBM128a (Figure 1).

Example 2; Construction of expression vector pMB1537

Expression vector pMB1537 contains the yeast TP! promoter driving expression of a wild-type gene encoding a Thermomyces lanuginosus lipase (SEQ ID NO: 7 is the DNA sequence and SEQ ID NO; 8 is the deduced amino acid sequence; U.S. Patent No. 5,869,438), the CYC1 terminator, and the URA3 gene as a selectable marker.

Yeast expression piasmid pSTED226 (WO 05/045018) was PCR amplified using an EXPAND® Long Tempiate PCR System (Roche, Germany) with pSTED226 as template and the following two primers. Primer 319137: S'-TCTAGAGGGCCGCATCATGTAATTAG-S' (SEQ SD NO: 13} Primer 19138: S'-GACGCCATGGTG AAGCTTTCTTTTAATCGT-S' (SEQ ID NO: 14)

The PCR amplification reaction mixture contained approximately 50 ng of pSTED226 piasmid DNA, 1 μl of primer 319137 (50 pmol/μi), 1 μ! of primer 19138 (50 pmo!/μi), 5 μi of 1OX PCR buffer (Roche, Indianapolis, IN, USA) with 15 mM MgCh, 1 μl of dNTP mix (10 mHH each), 40.25 μi of water, and 0.75 μl (3.5 U/μl) of DNA polymerase

mix (Roche, Indianapolis. IN ₁ USA). A PTC Peltier Thermal Cycler (Bio-Rad Laboratories. Hercuies, CA, USA) was used to amplify the fragment programmed for 1 cycle at 94 ⁰ C for 2 minutes: 10 cycles each at 94 ⁰ C for 15 seconds, 55 ⁰ C for 30 seconds, and 72 ⁰ C for 15 seconds; 15 cycles each at 94 ⁰ C for 15 seconds, 55 ⁰ C for 30 seconds, and 72 ⁰ C for 15 seconds plus a 5 second elongation at each successive cycle; 1 cycle at 72 ⁰ C for 7 minutes; and a 10 ⁰ C hold. After termination of the PCR procedure a PCR fragment of 5826 bp was purified and elufed with a GFXφ PCR DNA and Gel Band Purification Kit according to the manufacturer ^' s instructions (Amersham Siosciences, United Kingdom). A gene fragment containing the Thennomyces ianuginostis wtSd-typβ lipase gene was PCR amplified using an EXPAND® High Fidelity PCR System with pENH298 (WO 00/24883} as template and the following two primers; Primer 349699: 5'-CAAGAAGATTACAAACTATCAATTTCATACACAATATAAACGATTAAAAGAAAGCT TCACCATGAGGAGCTCCCTTGTGCTGTTCTTTGTCTCTG-S ^" (SEQ ID NO: 15) Primer 353031 :

5'-GAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGAT TATCAAAGACATGTCCCAATTAACCCGAAGTAC-S' (SEQ SD NO: 18}

The PCR amplification reaction mixture contained approximately 50 ng of pENI1298 plasmid DNA, 1 μ! of primer 349699 (50 pmol/μl), 1 μl of pnmer 353031 (50 pmoi/μi), 5 μi of 1OX PCR buffer (Roche, Indianapolis, IN, USA) with 15 mM MgC5 _: , 1 μl of dNTP mix (10 mM each). 40.25 μi of water, and 0.75 μl (3.5 ϋ/μl) of DNA polymerase mix (Roche, Indianapolis, IN, USA}, A PTC Peltier Thermal Cycler was used to amplify the fragment programmed for 1 cycle at 94 ⁰ C for 2 minutes; 10 cycles each at 94 ⁰ C for 15 seconds, 55 ⁰ C for 30 seconds, and 72 ⁰ C for 15 seconds; 15 cycles each at 94 ⁰ C for 15 seconds. 55 ⁰ C for 30 seconds, and 72 ^1% C for 15 seconds plus a 5 second elongation at each successive cycle; 1 cycle at 72 ⁰ C for 7 minutes; and a 1O ⁰ C hold. After termination of the PCR procedure a PCR fragment of 927 bp was purified and eluted with a GFX€> PCR DNA and Gel Band Purification Kit according to the manufacturer's instructions.

The resulting two fragments, 5828 bp and 927 bp were transformed into Saccharomyces cerevisiae JG169 by electroporation using a GENE PULSER® and Pulse Controller (Bio-Rad, Hercules, CA, USA) at 1.5 kvoits with a 2 mm gap cuvette according to the manufacturer's procedure. Transformation reactions contained 100 ng of PCR amplified vector DNA mixed with 100 ng of the PCR product containing the iipase gene. Transformation reactions were plated onto yeast ura minus selection

plates and incubated for 5 days at 30 ⁰ C.

One yeast clone from the procedure above was restreaked on SC ura minus piates and one single yeast colony was inøcυSated into 10 mi of SC υra minus medium in a 50 ml shake flask and incubated overnight at 30 ⁰ C, 250 rpm. Two mi of culture broth was used in a piasmid preparation using a QIAPREP® Spin Miniprep Kit (QIAGEN Inc., Germany) for yeast pSasmid preparation. The piasmid was later sequeπced and the expected DNA sequence was verified. The piasmid was designated pM81537 (Figure 2),

Example s: Construction of expression vector pBM126a

Piasmid pB!vl128a was digested with Age I and Eco Ri, and piasmid pMB1537 was digested with Eco Rl and λ/cfe I, and the fragments, 265 bp and 661 bp _r respectively, were purified by 1 ,8% and 0,7% agarose ge! eiectrophoresis using TAE buffer in conjunction with a QiAQUICK® Ge! Extraction Kit, To create the vector fragment, ρMB1537 was digested with Age i and /Vefe I. The resυiting 5148 hp fragment was purified by 0.7% agarose gel eiectrophoresis using TAE buffer in conjunction with a QIAQUiCK® Ge! Extraction Kit,

Ai! three fragments were subsequently iigated using a Rapid DNA Ligation Kit {Roche Diagnostics Corporation, Indianapolis, IN ₁ USA). Two μ! of the reaction were used to transform E coli XL10-GOLD® Uϊtracompetent Ceils (Stratagene, La JoIIa, CA, USA) according to manufacturers instructions. Piasmid DNA was prepared from E. coli transformants using a BioRobot 9600. Isolated plasmsds containing an insert were sequenced using 1 μl of piasmid tenrφiate, 1 ,6 ng of M13 pnmer (forward or reverse), and water to 6 μi. The resuiting piasmid identified as having the correct sequence was designated pBM126a (Figure 3).

Example 4: Construction of expression vector pSV!B1539

Piasmid pMB1539 was constructed to contain a gene encoding a Thermomyces ianuginosiis lipase variant (SEQ !D NO; 9 is the DNA sequence and SEQ ID NO; 10 is the deduced amino acid sequence) under control of the TPI promoter.

A gene fragment containing the Thermomyces (anuginosυs lipase variant gene was prepared by PCR using pENi1298 (WO 00/24883) containing the Thermomyces ianuginosiis wild-type lipase gene (SEQ ID NO; 7) as template using an EXPAND® High FideStty PCR System, and primers 349699 and 353031 , shown beiow. Primer 349699;

5'-CAAGAAGATTACAAACTATCAATTTCATACACAATATAAACGATTAAAAGAAAG CT

TCACCATGAGGAGCTCCCTTGTGCTGTTCTTTGTCTCTG-S ¹ (SEQ ID NO: 17} Primer 353031 ;

5'-GAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGATT ATCAAAGACATGTCCCAATTAACCCGAAGTAC-S ¹ (SEQ ID NO: 18) The PCR amplification reaction mixture contained approximately 50 ng of pENi1298 plasmid DNA, 1 μl of primer 349699 (50 pmol/μl). 1 μi of primer 353031 (50 pmoS/μi), 5 μl of 10X PCR buffer (Roche, Sndianapolis, SN. USA) with 15 mM MgC! _? , 1 μl of dNTP mix {10 mM each), 40.25 μ! of water, and 0.75 μl (3.5 U/μl) of DNA poiymerasβ mix (Roche, Sndianapoiis, IN ₁ USA). An PTC Peltier Thermal Cycler was used to ampiify the fragment programmed for 1 cycle at 94 ⁰ C for 2 minutes; 10 cycles each at 94 ⁰ C for 15 seconds. 55 ⁰ C for 30 seconds, and 72 ⁰ C for 15 seconds; 15 cycies each at 94 ⁰ C for 15 seconds, 55 ⁰ C for 30 seconds, and 72°C for 15 seconds plus a 5 second elongation at each successive cycle; 1 cycle at 72 ⁰ C for 7 minutes; and a 10 ^θ C hold.

After PCR amplification, a DNA fragment of 993 bp was purified using a GFX® PCR DNA and Gel Band Purification Kit. The resulting fragment (100 ng) was mixed with the pSTED226 vector fragment (100 ng) described in Exampie 2 and transformed into eiectrocompetent Saccharomyces cerevisiae JG 169 cells by electroporation using a GENE PULSER® and PuSse Controlier at 1.5 kvolts with a 2 mm gap cuvette according to the manufacturer's procedure. Transformed ceils were then piated onto yeast urn minus selection plates and incubated for 5 days at 3O ⁰ C.

One yeast clone from the procedure above was rβstrβaked on SC ura minus piates and one single yeast colony was used to inoculate 10 ml of SC ura minus medium in a 50 ml shake fiask and incubated overnight at 30 ⁰ C, 250 rpm. From this culture 2 ml of culture broth were used in a plasmid preparation using a QiAPREP® Spin Miniprep Kit for yeast plasmid preparation. The plasmid was later sequenced and the expected DNA sequence was verified. The piasmid was designated pMB1539 (Figure 4).

Example S; Construction of expression vector pJLϊn168 Construction of a Thermomyces tanugϊnosus iipase variant expression vector utilizing the CUP1 promoter was accomplished by swapping the Thermomyces lanuginosυs wild-type iipase gene in pBM126a (containing the Thermomyces lanuginosus wiid-fype Iipase gene under control of CUPf promoter) with the Thermomyces lanuginosus lipase variant gene from pM81539, First, both pBM12βa and pMB1539 were digested with Hind III and Miu i, and a 5 kb fragment from pBM126a and a 1.1 kb fragment from pMB1539 were gel-purified using a QIAGUSCK® Gel

Extraction Kit, Both fragments were subsequently ligated using a Rapid DNA Ligation Kit in molar ratios of vectorinsert at 1 ;2. 1 :3, and 1 :4 with the vector amount set at 50 ng. The resuiting piasmid, designated pJLin168 (Figure 5), contained the Thermomycβs lanuginosus lipase variant gene under control of the CUPf promoter.

Example 6: Construction of expression vectors pBM142c and pBM143b

The foiiowing primers were designed to remove the last five codons encoding amino acids SPIRR from the propeptide sequence of the Therrnomyces lanuginosus variant lipase in pJLiniδδ using a QUiKCHANGE© Site-Directed Mutagenesis Kit (Strafagene, La JoIIa ₁ CA, USA): Primer 998570;

5 ^t -CTCTGCGTGGACGGCCTTGGCCGAGGTCTCGCAGGATCTGTTTAAC-3 ¹ (SEQ ID NO: 19) Primer 998571 : 5 -TTAAACAGATCCTGCGAGACCTCGGCCAAGGCCGTCCACGCAGAG-3 ^■ (SEQ ID NO: 20)

One hundred picornoles of each primer were used in a PCR reaction containing 73 ng of pJϋn168, 1X QUIKCHANGE® reaction buffer (Stratagene, La Jolia. CA ₁ USA), 4 μJ of QU I KSO LUT I ON® (Stratagene, La Joiia, CA, U SA), 1 μl of XL dNTP mix {Stratagene, La JoIIa ₁ CA, USA), &nά 1 μJ of 2.5 U/μ! PfuUltra ^!M DNA poiymerase {Stratagene, La Joiia, CA, USA), in a final volume of 50 μl. An EPPENDORF© MASTERCYCLER® was programmed for one cycle at 95''C for 1 minute; 18 cycles each at 95 ¹⁵ C for 50 seconds, 60"C for 50 seconds, and 68"C for 6 minutes; and a 10 ⁰ C hoid. One microliter of Dpn I was added directly to the amplification reaction and incubated at 37 ⁰ C for 1 hour. A 2 μi volume of the Dpn i digestion reaction was used to transform E, coli XL10-GOLD® Uitracompefent Cells {Stratagene, La Jolia, CA, USA) according to the manufacturer's instructions. One of the clones without 15 bp corresponding to the SPiRR-coding region was confirmed by DNA sequencing and was designated pBM142c (Figure 6). To avoid additionai mutations being generated in pBM142c, the 5 ^' region of

Thermomyces lanuginosus variant lipase gene from pBM 142c was cioned back into pJLin168. Piasmid ρBM142c was digested with Hind III anά Nde I, and the 0.6 kb fragment was purified by 1.5% agarose gel electrophoresis using TAE buffer in conjunction with a QiAQUICK® Ge! Extraction Kit, Piasmid pJLin168 was digested with Hind III and Nde i, and the resuiting 5.5 kb fragment was purified by 0.7% agarose gel electrophoresis using TAE buffer in conjunction with a QiAQUiCK® Ge! Extraction Kit.

The two fragments were subsequently ligated using a Rapid DNA Ligation Kit. The resulting expression piasmid. designated pBM143b (Figure 7), contained the CUP1 promoter driving expression of Thertnornyces lanuginosυs variant iipase gene. Thus, the 22 amino acid signai/propeptide sequence was changed to 17 amino acids by removing the last five amino acids (SPiRR).

Example 7: Transformation of Saccharomycβs eβrβws/aβ with pJLin168 and ρBM143b

Piasmids pJLin168 and p8M143b were transformed into Saccharomyces cer&visiae strain JG169 using a YEASTiVlAKER ^{l v)} Yeast Transformation System (CSonetech, Palo Aito, CA, USA) according to the manufacturer's instructions. Briefly, one coiony of Saccharomyces cerevisiae JG 169 was inoculated into 50 mi of YPD medium and incubated at 30 ⁰ C overnight on an orbital shaker at 250 rpm. When the ceils reached an absorbance of 0.4 to 0.5 at 600 nm, the ceils were centrifuged at 700 x g for 5 minutes, the supernatant was discarded, and the peiiet was resuspended in 30 mi of deionized water. After centnfugation at 700 x g for 5 minutes, the ceil peiiet was resuspended in 1 ,5 ml of UX TE/iithium acetate soiution (110 mM lithium acetate, 11 mM Tris, pH 8, 1.1 mM EDTA). After centrifugation at 12,000 x g in a microcentrifuge for 15 seconds, the eel! peiiet was resuspended in 600 μ! of 1 ,1 X TE/lithium acetate soiution. After addition of approximately 0.5 μg of vector DNA. 250 μl of PEG/iithium acetate soiution (40% PEG 4000, 0.1 IvI lithium acetate, 10 mM Tris-HCS, pH 8, 1 mU EDTA), and 5 μl of 10 mg/ml denatured Herring Testes Carrier DMA to 50 μl of competent ceils, the mixtures were shaken at 550 rpm at 3O ⁰ C for 30 minutes, and cells were mixed by inversion every 10 minutes. A total volume of 20 μl of DMSO was added to each transformation mixture, and incubated at 42 ⁰ C for 15 minutes, and the mixture was inverted every 5 minutes. The transformation mixtures were cenfrifuged for 15 seconds at 12,000 x g in a microcentrifuge, and the cells were resuspended in 1 ml of YPD PLUS™ Liquid Medium (YEASTMAKER™ Yeast Transformation System, Clonetech, Palo Alto, CA, USA) and shaken at 550 rpm and 3O ⁰ C for 90 minutes. After centrifugation at 13,000 x g, the ceils were washed with 1 ml of 0.9% NaCi soiution and resuspended in 1 mi of yeast ura minus selection medium in the presence of 15% giycerol Fifty microliters of each transformation reaction were piated in duplicate onto yeast ura minus seiection plates and incubated at 30 ⁰ C until coionies appeared,

Example 8: EvaSuation of expression of the Thermomyces fanuginosus Stpase variant with piasmids pJLir»168 and p8M143b

Expression of the Thermomyces lanuginosus lipase variant from pJUn168 and pBM143b was evaluated in shake flasks. Five representative Sacdmrotnyces cerevisiae JG 169 transformants, containing pJLin168 or pBMi43b, from Example 7 _S were grown in duplicate shake flask cultures containing 25 mi of "originai" medium. Shake flask samples were harvested 4, 5, and 7 days. Lipase activities of culture supernatants were measured using p-nitrophenyl butyrate as a substrate in the following assay. Culture supernatants were initiaϋy diluted 1/15-fold in 0.1 M MOPS, 4 mM CaCi; 0.01 % Triton X-1Q0 buffer, pH 7.5 (sample buffer), foiiowed by seria! dilution from 0-fold to 1/3-fold to 1/9-fold of the diluted sampie. A LiPGLASE™ standard (Novozymes A/S, Bagsvaerd, Denmark) was diluted using two-fold steps starting with a 1.0 LU/rnl concentration and ending with a 0.125 LU/mi concentration in the sample buffer, A total of 20 μl of each dilution, including the standard, were transferred to a 96-welS flat bottom plate. Two hundred microiiters of a p-nitrophenyl butyrate substrate solution (the ratio of p-nitrophenyϊ butyrate to DMSO to 0.1 M MOPS pH 7.5 was 1 ;99;400) was added to each weli, and then incubated at 25°C for 15 minutes. Upon completion of the incubation, the absorbance at 405 nm was measured for the 96-welS piate. Sample concentrations were determined by extrapolation from the generated standard curve.

The average relative lipase activities for pJϋn168 transformants were 14, 26, and 22, for samples taken from day 4, day 5, and day 7, respectiveiy (Figure 8). The average relative lipase activities for pBM143b transformants were 69, 100, and 92, for samples taken from day 4, day 5, and day 6, respectiveiy (Figure 9).

To confirm the lipase activity assay results, SDS-PAGE was performed on supernatants from the samples. Twenty microliters of culture supernatant from two shake flask sampies taken on day 5 were mixed with Laemmli Sampie buffer (Bio-Rad Laboratories, Inc., Hercules, CA, USA) in a 1 :2 ratio. After boiling for 2 minutes, sampies were loaded onto a 10-20% SDS-PAGE gel (Bio-Rad Laboratories, inc., Hercules, CA, USA) along with 15 μl of PRECiSiON PLUS PROTEIN™ standards (Bio- Rad Laboratories, inc., Hercules, CA ₅ USA). Gels were run in 1X Tris-glycine-SDS running buffer (Bio-Rad Laboratories, Inc., Hercules. CA. USA) at 200 V for 1 hour. The gels were then rinsed 3 times with water for 5 minutes each, and stained with BiO- SAFE™ Coomassie Stain (Bio-Rad Laboratories, inc., Hercules, CA, USA) for 1 hour followed by destaining with water for at least 30 minutes.

The SDS-PAGE results showed that the increased lipase activity observed for the pBM143b transformants corresponded to increased protein levels.

Example 9: Mutagenesis of Thermomyces lanuginosus lipase variant signal

sequence

Piasmid pMB1537 containing the Thetmomyces lanuginosus wild-type lipase gene was used to construct a random mutagenized library of the Thβrmomycβs lanuginosus lipase signal peptide. A random mutagenized PCR fragment of the signal peptide coding sequence and fSankiπg DNA regions was amplified by PCR using an EXPAND® High Fidelity PCR System and the primers (DNA-Technology, Aarhus, Denmark) shown below. Primer 309787: 5 ^I -CTAGGAACCCATCAGGTTGGTGGAAG-3 ^■ (SEQ ID NO; 21) Primer 373172:

5-CTGTGCAAAGAGATTGAACTGGTTAAACAGATCCTGCGANNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGTGAAGCTTTCT

TTTAA-3' (SEQ ID NO: 22) where N at positions 41 , 50, 51 , 60, 64, 66, 68, 70, 71 , 72, 74, 75, 77, 80, 82, 83, and 87 of SEQ SD NO; 22 is 99% A and 1 % G, C or T;

N at positions 4O ₁ 46, 47, 52, 53, 56 _; 62, 65, 67, 73, 78 , 84, 85, 86, and 88 of SEQ ID NO: 22 is 99% G and 1% A, C, or T;

N at positions 42, 43, 45, 48, 49, 54, 55, 58, 59, 61 63, 69, 76 _; 79 _; 81 , 89, 91 , and 92 of SEQ SD NO; 22 is 99% C and 1% A ₁ G, or T; and N at positions 44, 57, 90, and 93 of SEQ ID NO: 22 is 99% T and 1% A, C, or G.

The primer introducing the diversity was designed after the following rules: The wild-type base at the randomized positions was always present at 99% and the other three bases were present at 1% and ail three were equally represented.

The mutagenized fragment of the signal peptide coding sequence was amplified by PCR using an EXPAND® High Fidelity PCR System. The PCR amplification reaction mixture contained approximately 50 ng of pM81537, 1 μS of primer 309787 (50 pmoi/μl), 1 μ! of primer 373172 (50 pmol/μS), 5 μi of 10X PCR buffer (Roche, indianapoiis, SN ₁ USA) with 15 mM MgC!;., 1 μ! of ClNTP mix (10 mM each), 40.25 μ! of water, and 0.75 μl (3.5 U/μi) of DNA polymerase mix (Roche, Indianapolis, SN, USA). A PTC Peltier Thermal Cycler was used to amplify the fragment programmed for 1 cycSe at 94 ⁰ C for 2 minutes; 10 cycles each at 94°C for 15 seconds, 55 ⁰ C for 30 seconds, and 72 ⁰ C for 15 seconds; 15 cycles each at 94 ⁰ C for 15 seconds, 55 ⁰ C for 30 seconds, and 72 ⁰ C for 15 seconds pius a 5 second elongation at each successive cycle; 1 cycSe at 72 ⁰ C for 7 minutes; and a 1O ⁰ C hold. A gene fragment of the Thermomyces lanuginosus wild-type lipase gene was prepared by PCR using pMB1537 as template in a PCR reaction using an EXPAND®

High Fidelity PCR System. The primers used in the PCR were primers 30978? and 373172 described above.

After PCR ampiificatαn, a PCR fragment of 600 bp was purified using a GFX® PCR DNA and Ge! Band Purification Kit according to the manufacturer's protoco! and eiuted in 50 μi of 10 mM Tris-HCI pH 8.0.

Piasrnid pMB1537 was linearized by digestion with Sac ! at a DNA position within the signal peptide coding sequence. The iinearized vector was used as the recipient DNA in a transformation of Saccharomycβs cerevisiae JG189 using a PCR fragment of the signal peptide coding sequence with flanking DMA regions (100% homologous to the recipient DNA of the recipient plasmid) as the donor DNA.

SpeeificaSly, approximately 3 μg of Sac I digested pMB1537 together with approximately 1 μg of the 600 bp PCR fragment were electroporated into 100 μl of eiectrocompetent Saccharomyces cerevisiae JG 169 ceiis using a GENE PULSE R® and Pulse Controller at 1.5 kvolts with a 2 mm gap cuvette. After eiectroporatton the transformed celis were supplied with 1 mi of 1 M sorbitol, and incubated for 1 hour at 3O ⁰ C after which 1.1 ml were piated onto SC ura minus piates supplemented with 100 μg of ampicillin per ml.

A total of 8400 coionies from the SC ura minus plates supplemented with 100 μg of ampicilSin per mi were picked and transferred to 96-weli polystyrene microweSS plates, applying the picked clones to the wells in rows B-H and coiumns 1-12 leaving row A free, which was inoculated with the wild-type plasmid construct in Saccharomyces cerevisiae JG 169 as the wild-type reference. Ail weils contained SD Medium-URA with 40 mg of adenine added per liter (called SDMUA) (following recommendations from the manufacturer, Qbiogene, inc., BlO 101® System, supplied by AH Diagnostics, Aarhus. Denmark). The plates were incubated at 3O ⁰ C and 250 rpm for 5 days. After 5 days the piates were kept at 4 ⁰ C before measuring lipase activity using a p-nifrophenyS valerate assay described below.

Lipase activities of culture supernatants were measured using p-πitrophenyl valerate as a substrate in the following assay. Culture supernatants were diluted in 50 mM Iris pH 7, 10 mM CaCh 0.4% Triton X- 100 buffer (diiution buffer). A L! POLASE ™ standard (Novozymes A/S, Bagsvasrd, Denmark) was diluted using two-fold steps starting with a 1.0 LU/m! concentration and ending with a 0.125 LU/m! concentration in the sample buffer. Sn polystyrene microweSl plates, 10 μl of supernatant were mixed with 90 μl of the diiution buffer. One hundred microiiters of a p-nitrophenyi valerate substrate solution (117 μl of p-nitropheny! valerate dissolved in 10 ml of isopropanol) was added to each well, briefly mixed, and then the absorbance at 405 πm was measured for 3

minutes every 12 seconds. The assay data was evaluated to identify all samples having higher activity than the plV3B1533 construct in Saccharomyces cerevisiae JG169 (in the A-row weils).

A!! clones with higher activity than the reference were collected as positive hits, which were reanalyzed in the same set-up and all clones still having higher activity than the reference were used as inocuiation materia! with fresh SDMUA medium in microwell piates. The A-row was again used for the reference strain. The plates were incubated as above, and analyzed as described above.

Ai! clones with higher activity than the reference were removed from their weils and restreaked on SC-agar plates. Single colonies of all clones were collected for regrowth in microweSI piates in 200 μl of SDMUA medium and 50 ml tubes containing 10 mi of SDMUA medium and incubated at 3O ⁰ C for 5 days after which yields were compared to that of the reference strain using the p-nitrophenyi valerate assay described above, Each clone was grown in three adjacent microweiis and 3 individual 50 ml tubes.

Mean values of the three growth experiments were used for the comparison of activity levels.

Finally the clones with the highest lipase activity in both microwei! plates and 50 mi tubes were inocuiated in shake flasks (250 ml conical baffled shake flasks with two baffies) containing 10 ml of SDMUA medium and incubated at 250 rpm for 5 days at 3O ⁰ C. Supematants were assayed for lipase activity using the p-nitrophenyl valerate assay described above. CSones with the highest lipase activity were DNA sequenced.

The clone showing the highest activity was designated MB1885, which had a R2K substitution in the signal peptide of the iipase (second codon of the signal peptide was altered from AGG to AAG).

By using the same principle as described in Example 4, DNA encoding this signal peptide was transferred to the pMB1539 construct encoding the Theiwomyces lanuginosus Iipase variant. In this case the smalier PCR fragment was made using the same procedure as described in Example 4. However, the larger fragment was made also according to Example 4 but using piasmid DMA from MB1539 as the template. GAP-repair anά transformation of the Saccharomyces cerevisiae JG 189 was performed as described above. This cloning resulted in a done with higher expression of the Thermomyces lanuginosus Iipase variant. This clone was designated Saccharomyces cerevisiae M B 1681. Saccharomyces cerevisiae MB1681 cei! materia! from a SC-agar plate (grown 5 days at 30 ⁰ C) was used to inoculate 10 ml of SC ura minus medium in a 50 ml shake

flask and incubated overnight at 3O ⁰ C, 250 rpm. From this culture 2 mi of culture broth was used in a pSasmid preparation using a QIAPREP® Spin Miniprep Kit for yeast piasmid preparation The pun ^' fϊed piasmid was transformed into E cols TopiϋF' (invitrogen, Carlsbad. CA ₁ USA) according to manufacturer's instructions. Transformed E coii ceiis were plated onto LB plates supplemented with 100 μg of ampicϋn per ml. A single colony was isolated, restreaked, inoculated into LB medium, and incubated overnight at 30 ⁰ C. One ml of the overnight culture was used for piasmid preparation using a QiAPREP® Spin Miniprep Kit. Finally, the isolated piasmid was used as template for DNA sequencing, verifying the sequence of the vaήanf signai sequence (SEQ ID NO; 3) and the Thermornyces ianuginosus lipase variant coding region (SEQ ID NO: 9 with the deduced amino acid sequence of SEQ ID NO: 10), The resuiting piasmid was designated pMB1682 (Figure 10). PSasmid pMB1682 comprised the TP! promoter and the Thermornyces lanuginosus lipase variant coding region (without SPIRR with a R2K change).

Example 10: Construction of pJLin195

Piasmid pJLin195 was constructed to contain the Thermomyces lanuginosus iipase variant (with signal sequence containing a R2K change and without SPIRR) expression vector utilizing the Saccharomycøs cβrevisiaβ CUP1 promoter. The Hind IIWVcte I fragment of pMB1682 was cloned into pBM143b digested with

Hind H! and Nύe i, replacing the coding sequence of the second amino acid Arg (AGG) with the coding sequence of Lys (AAG). Both p!VIB1682 and pBM143b were digested with Hind ill and Nde I. and a 1 Kb fragment from pMB1682 and a 5 kb fragment from pBlv1143b were gel extracted with a QIAQUICK® Gel Extraction column. The fragments were ligated together in a molar ratio of vector to insert at 1 :2. 1 :1 , and 3:1 with a vector amount of 50 ng using a Rapid DNA Ligation Kit according to the manufacturer's instructions. The resulting piasmid, confirmed by DNA sequencing, was designated pJϋn 195 (Figure 1 1).

Example I t : Transformation of Saccharαmyc&s c&r&vi$ia& with pJLin195 and ρBM143b

Piasmid ρBM143b and pJLin195 were separately transformed into

Saccharomyces cβrβvisiae strain JG189 as described in Example 7, except YPD medium was used in place of YPD PLUS™ Liquid Medium, Also, after washing with 0.9% NaCL 200 μ! of the cell suspension in ura minus medium was plated directly to yeast ura selection plates. Colonies were streaked onto yeast ura selection plates, and

two colonies for each iransformani were grown and broths were used to determine lipase activities.

Purified $accharotnyc®$ cwevisiae JG169 transfαrmants containing pBM143b or pJUn195 (at least 10 for each construct) were inoculated in duplicate into 180 μl of υra selection medium in 96 weli piates and incubated at 3O ⁰ C, 250 rpm overnight. The overnight cultures were then diluted 100-fold in 180 μ! of CUP minus ura medium and grown for 5 days at 30°C _; 250 rpm. Sacchaωmyces cerevssiae JG189, grown in the same medium except in the presence of 10 mlVS undine, was included as a negative control. Lipase activities were determined as described in Example 8. The relative average lipase activities for pBM143b and pJLin195 transformants were 51 and 100, respectively (Figure 12). The West showed that activities of the ρJLin195 transformants were significantly different from the pBM143b transformants. The results suggested that the R2K signal sequence improved the yield of the Thβrmomyces lanuginosus lipase variant 2, 1-foid.

Example 12: Evaluating expression of Thermomycm lanuginosαs lipase variant with piasmids pJLmi95 and pBEv1143b in shake flasks

To perform shake flask analysis, representative p8M143ø and pJLin195 transformants were inoculated into 2 ml of ura selection medium and incubated at 3O ⁰ C, 250 rpm overnight. The overnight cultures were then diluted 200-fold in 25 ml of CUP minus ura medium in 125 mi plastic shake flasks and grown for 8 days at 3O ⁰ C, 250 rpm, Sampies were taken at 5 and 6 days and centrifuged at 12,000 x g in a microcentrifuge for 10 seconds. The supernatants were assayed for lipase activity as described in Example 8.

The results showed that lipase activities peaked around days 5 to 6 (Figure 13). Overall lipase activities were higher on day 5 when grown in shake flasks when compared with 96 well samples. On average the Thermomyces lanuginosus lipase variant with the R2K signal sequence showed 2-foSd higher relative lipase activity (wiid- type Thermomyces lanuginosus lipase variant as 1) on day 5. Therefore, 25 ml shake flasks showed similar results as cultures grown in 96 well plates. Thermomyces lanuginosus lipase variant with the R2K signal sequence showed slightly higher activity on day 8 when compared with day 5, so the improvement was even higher on day 6,

To confirm the lipase activity assay results, SDS-PAGE was performed on supernatants from the shake flask cultures as described in Example 8. The SDS-PAGE results showed that the intensities of the Thermomyces lanuginosus lipase variant

bands from representative transformants were consistent with the lipase activity assay results.

Example 13: N-terminal sequence analysis of Thermomyces fanuginosus lipase variant

N-terrnina! sequencing was performed on a Procise cLC Protein Sequencer (Applied Biosystems, Foster City, CA ₁ USA) with on-line capillary HPLC and liquid phase trifiuoroacetic acid (TFA) delivery. Protein sampSes were electrobiotted onto PVDF membranes (invitrogen, San Diego, CA, USA) from SDS-PAGE gels using 10 mM CAPS (S-tcyciohexyiamiπoH-propanesulfonic acid) in 10% methanol. pH 11.0 for 2 hours at 25 voits on a NOVEX® XCeII Il (Invitrogen, San Diego, CA ₁ USA) with eiectrobSotting gel apparatus or 2 hours at 100 volts on a CRiTERSQN® gel apparatus fitted with a TRANS-BLOT® Transfer Ceϊi (Bio-Rad Laboratoήes, Hercuies, CA, USA). PVDF membranes were stained with 0.1% Commassie Biue R-250 in 40% methanol/1 % acetic acid for 20 seconds and de-stained in 50% rnethano! to observe the protein bands. Stained protein bands were excised and sequenced. Detection of phenyithiohydantoin-amino acids was accomplished by on-iine capillary HPLC using 500 m! of Buffer A containing 3,5% tetrahydrofuran in water with 9 ml of the Premixa concentrate (Applied θiosystems, Foster City, CA ₅ USA) containing acetic acid, sodium acetate, and sodium hexanesuifonate and Solvent B2 containing acetoniirϋβ/2-propanoi. Data was collected and anaiyzed on a MACINTOSH© G4 processor using APPLIED BiOSYSTEMS® 810 Data Anaiysis software version 2.1a. Sequence determinations were made by visualizing ehromatograms against a Sight source.

N-terminai sequencing anaiysis showed correct processing for Thermomyces fanuginosus lipase variant carrying the R2K variant signai sequence. The N-terminal sequence determined for transformants of pJLin195 was EVSQDLFNQFN (amino acids 1 to 11 Of SEQ iD NOMO).

Example 14: Construction of pJLϊn187 Piasmid ρJϋn187 was constructed by introducing a L26θ! change in the iipase gene from pJLin168, and by subcloning the Iipase fragment into the Aspergillus oryzae expression vector pBM120a. PCR ampliftcation was performed using gene-specific forward anά reverse primers shown below. Forward primer: δ'-ACACAACTGGCCATGAGGAGCTCCCTTGTGCTGTTC-S' (SEQ SD NO: 23) Reverse primer:

S'-AGTCACCTCTAG TTAA 7T)WrTATCAAATACATGTCCCAA-S ¹ (SEQ ID NO; 24) Bold letters represent coding sequence while italicized letters represent the Pac I site added to the 3" end of the Thermomyces lanuginosus lipase variant gene. The underlined AAT in the reverse primer indicates nucleotide changes to obtain L289I in the lipase gene. The remaining sequence is homologous to regions flanking the insertion site of pBS\/l 120a,

PCR amplification was performed using an EXPAND® High Fidelity PCR System according to manufacturer's instructions. Each PCR reaction contained 1 μl of pJϋn168. 200 μM dNTPs, 1 μM toward and reverses primers, I X reaction buffer, and 2,6 units of EXPAND® High Fidelity enzyme mix. The reaction was subjected to amplification using an EPPENDORF® IVS ASTERC YC LER© programmed for 1 cycle at 94 ⁰ C for 2 minutes; 10 cycles each at 94 ⁰ C for 15 seconds, 58,3 ^ϋ C for 30 seconds, and 72 ⁰ C for 1 minute and 15 seconds; 15 cycles each at 94°C for 15 seconds, 58,3 ⁰ C for 30 seconds, and 72 ⁰ C for 1 minute and 15 seconds with 5 seconds cycle elongation for each successive cycle; and 1 cycle at 72 ⁰ C for 7 minutes. A 0.9 kb PCR product was purified using a QIAQUICK® PCR Purification Kit, and then cSoned into pBM120a using an INFUSION® Cloning Kit (BD Biαsciences, Palo Aito, CA, USA). The INFUSION© cloning reaction was composed of IX INFUSION® Buffer (BD Biosciences, Palo Alto. CA, USA), 1X BSA (BD Biosciences, Palo Alto, CA, USA), 1 μ.l of INFUSION® enzyme (diluted 1 :10), 100 ng of pBM120a digested with Nco I and Pac I, and 50 ng of the purified PCR product containing the lipase gene in a total volume of 50 μi. The reaction was incubated at room temperature for 30 minutes.

Two μl of the reaction was used to transform E. coil SOLOPACK® Gold supercompetent ceils (Stratagene, La JoIIa, CA ₁ USA). One of the pBM120a plasmids containing the desired lipase sequence, which was confirmed by restriction digestion and sequencing analysis, was designated pJLin1S7 (Figure 14).

Example 15: Construction of pBf$120 expression vector

Piasmid pBIV512Ga was constructed to obtain a plasmid containing the double NA2 promoter (NA2-NA2-tpi) for driving gene expression in Aspergillus species, and containing the ampicillin resistance gene for selection in E. coii.

Primers were designed to PCR amplify the double NA2 promoter from pJaL721 (WO 03/008575), Restriction enzyme sites Sal I and Nco I (underlined) were added for cloning the double promoter into the Aspergillus expression piasmid pASLol (WO 2005/067531). δ'-GTCGACATGGTGTTTTGATCATTTTA-S' (SEQ ID NO; 25)

S'-CCATGGCCAGTTGTGTATATAGAGGA-S' (SEQ ID NO: 26)

The fragment of interest was amplified by PCR using an EXPAND® High Fidelity PCR System. The PCR amplification reaction mixture contained 1 μi of 0,09 μg of pJaL721 per μi, 1 μ! of each of the primers (50 pmol/μl), 5 μl of 1OX PCR buffer with 15 rnM MgCi ₃ , 1 μi of a Q ¹ ATP, ciTTP, dGTP, and dCTP mix (10 rnM each), 37.25 μl of water, and 0.75 μ! of DNA polymerase mix (3.5 U/μS), To amplify the fragment, an EPPENDORF® MASTERCYCLER® was programmed for 1 cycle at 94°C for 2 minutes; 10 cycles each at 94X for 15 seconds, 55 ^J C for 30 seconds, and 72"C for 1.25 minutes; 15 cycles each at 94*C for 15 seconds, 55*C for 30 seconds, and 72*0 for 1.25 minutes plus a 5 second elongation at each successive cycle; 1 cycle at 72"C for 7 minutes: and a 1O ⁰ C hold. Ten microliters of this PCR reaction was mixed with 1 μi of 10X DNA ioading dye (25% giyceroi, 10 mM Tris pH 7.0, 10 mM EDTA, 0.025% bromophenoi blue, 0,025% xylene cyanoi) and run on a 1.0% (w/v) agarose gel using TAE buffer. The 1128 bp PCR product was observed with UV light on a ge! visualization system (Nucleoteeh, San Mateo, CA ₅ USA), The PCR product was directly ligafed into pCR2.1-TOPO® according to the manufacturer's instructions. A 1 μi volume of fresh PCR product, 3 μl of double-distilled wafer, and 1 μi of the TOPO® cloning vector were mixed with a pipette and incubated at room temperature for 5 minutes.

After the incubation, 2 μi of the mixture was used to transform ONESHOT® TOP10 chemically competent E coii cells (Invitrogen Corporation, Carlsbad, CA, USA). A 2 μl volume of the ligation mixture was added to the £ cols cells and incubated on ice for 5 minutes. Subsequently, the cells were heat shocked for 30 seconds at 42 ^C1 C, and then placed on ice for 2 minutes. A 250 μi volume of SOC medium was added to the ceils and the mixture was incubated for 1 hour at 37'C and 250 rpm. After the incubation the colonies were spread on 2X YT plates supplemented with 100 μg of ampiciliin per ml and incubated at 37 ⁰ C overnight for selection of the plasmid. Eight colonies that grew on the plates were picked with sterile toothpicks &nά grown overnight at 37°C, 250 rpm in a 15 ml FALCON® tube containing 3 ml of LB medium supplemented with 100 μg of ampiciliin per mi. The plasmids were isolated using a BioRobot 9600,

Four μ! volumes of the resulting piasmid minipreps were digested with £cø Ri. The digestion reactions were analyzed by agarose gel chromatography and UV analysis as previously described for the PCR reaction. Isolated plasmids containing an insert were sequenced using 1 μi of plasmid template, 1.6 ng of M13 primer (forward or reverse), and water to 6 μi. The resulting piasmid was designated pBM121 b (Figure 15).

A 5 μl volume of p8M121b was digested with Sal I and Nco I. The digestion reactions were analyzed by agarose ge! electrophoresis as described above, and iigated to the vector pAlLol , which had been previously digested with Sal I and Nco I, The resuiting expression piasmid was designated pBM12Qa (Figure 16).

Example 16: Construction of an Aspergillus oryzae vector containing the Thermomyces lanuginosa lipase variant gene

The Thermomyces lanuginosus lipase variant gene was PCR amplified from pJLin187. an Aspergillus expression vector harboring the lipase variant gene. The lipase gene in pJLin187 contained a mutation encoding the amino acid change L269I which was corrected during PCR, The gene was PCR ampiified using an EXPAND® High Fidelity PCR System using gene specific primers shown below. Forward primer: 5'-ACACAACTGGCCATGAGGAGCTCCCTTGTGCTGTTC-3 ¹ (SEQ ID NO: 27) Reverse primer:

5 -AGTCACCTCTAGTTAATTAATTATCAAAOACATGTCCCAATTAACCC-S' (SEQ ID NO: 28)

The bold tetters represent coding sequence, the underlined portion denotes the introduced Pac I site, the lower case letter is the intended change, and the remaining sequences are flanking regions homologous to the point of insertion in pBM120.

The PCR reaction contained 100 ng of ρJLIn187. 200 μM cSNTP ^' s, 300 nM of esch primer, 1X EXPAND® High Fidelity buffer (with MgCI-) and 2.6 units of EXPAND® High Fidelity Enzyme Mix. An EPPENDORF® M ASTERCYC LER® was used for the amplification programmed for 1 cycle at 94 ^J C for 2 minutes; 10 cycles each at 94"C for 15 seconds, 55 ^r C for 30 seconds, anύ 72°C for 1 minute; and 15 cycles each at 94X ⁾ for 15 seconds, 55 ⁵ C for 30 seconds, and 72 ⁰ C for 1 minute followed by an additional 5 seconds added to the 72X elongation step after each of the 15 cycles.

The PCR reaction mixture was run on a 1% agarose ge! using TAE buffer and a band corresponding to the 913 bp insert was excised. The DNA fragment was extracted from the sample by a MiNELUTE® Agarose Extraction Kit (QiAGEN inc., Valencia, CA, USA) according to the manufacturer ^' s protocol.

An INFUSION® Cloning Kit was used to clone the PCR product directly into expression vector p8lv5120 without the need for restriction digestion and ligation. The INFUSION® cloning reaction was composed of 1X INFUSION® Reaction Buffer, 1X BSA, 100 ng of pBM120 digested with Pac I and λfco I, 108.4 ng of purified PCR insert, and 1 μi of INFUSION® enzyme (diluted 1 : 10). The reaction was incubated at room

temperature for 30 minutes and 1 μi was used to transform SGLOPACK® Gold Supercornpetent CeSSs (Stratagene, La JoSIa, CA. USA) according to the manufacturer's protocol DNA sequencing identified a correct clone resuiting in a Thermomyces lanuginosus lipase variant gene expression vector. The resulting pSasrnid was designated pJMS7 (Figure 17),

Example 17: Construction of an Aspørgiifυs oryzaβ vector with R2K signal peptide and SPIRR deleted

The Thermomyces lanuginosus lipase variant gene with the signal peptide sequence change of R2K and SPiRR deSetion was PCR amplified from pJLin195 harboring the gene for the Thermomyces lanuginosa lipase variant gene. The gene was

PCR amplified using the primers beiow.

Forward primer:

5'-CTCTATATACACAACTGGCCATGAAGAGCTCCCTTGTGCTGTTC-S' (SEQ ID NO: 29}

Reverse primer:

5'-CAGGTGTCAGTCACCTCTAGTTATCAAAGACATGTCCCAATTAACCC-S' (SEQ ID

NO: 30)

The bold sequences correspond to Thermomyces lanuginosa lipase variant coding regions and the remainder sequences are flanking regions homologous to the point of insertion in pB!VI120, The PCR reaction and thermocyciing conditions were identicai to those used for the Thermomyces lanuginosus lipase variant gene in Example 16. The

PCR reaction was run on an 1 % agarose gel using TAE buffer anά the DNA fragment was extracted as described in Example 16. An NFUSION® Cloning Kit was used to clone the PCR product directly into expression vector pSM120. The INFUSiOW® reaction was identicaS to that in Example

16 except 64 ng of the purified PCR insert was used. One μ! of the reaction was used to transform SOLOPACK® GoSd Supercornpetent Ceiis using the manufacturer's suggested protocois. DNA sequencing confirmed that no errors were introduced by PCR. The resulting piasmid was designated pJMSδ (Figure 18).

Example 18: Construction of an Aspergillus oryzae vector with R2K signal peptide mutation

A QUIKCHANGE® Si XL Site-Directed Mutagenesis Kit (Stratagene, La JoIIa, CA, USA) was used to mutate piasmid pJMS7 by changing R to K in the signal peptide sequence of the Thermomyc&s lanuginosus lipase variant gene. The mutagenesis

reaction consisted of three steps: mutant strand synthesis using the mutagenic primers shown below, Dpn I digestion of template, and transformation. Forward primer;

5 -CACAACTGGCCATGaagAGCTCCCTTGTG-3' (SEQ ID NO: 31) Reverse primer:

5'-CACAAGGGAGCTcItCATGGCCAGTTGTG-S' SEQ ID NO: 32}

The Sower case codons indicated the change in the signal sequence. The mutant strand synthesis reaction was composed of 5 μi of 1 OX reaction buffer (Stratagene, La JoIIa, CA, USA), 10 ng of pJfV!S7, 125 ng of each primer, 1 μl of dNTP mix, 3 μi of QUIKSGLUTION® (Stratagene, La JoIIa, CA, USA), and 2.5 units of Pfu Ultra HF DNA polymerase. An EPPENDORF® MASTERCYCLER® was used for the amplification programmed for 1 cycle at 95 ^:; C for 1 minute; 18 cycies each at 95"C for 50 seconds, 60"C for 50 seconds, and 68 ^C C for 7 minutes; and 1 cycie at 68"C for 7 minutes. One μ! of Dpn ! restriction enzyme (10 U/μl) was then added to the reaction, After gentie and thorough mixing, the reaction mixture was centrifuged for 1 minute at 13,000 x g and immediately incubated at 37 ^C "C for an hour to digest the parental sυpercoiled dsDNA, Two μi of the Dpn l-treated sample reaction was transformed into 45 μ! of £ cols XL 10-GoId ultracompetent ceiis (Stratagene, La Jolia, CA. USA) following the manufacturer's instructions. After 16 hours, the colonies were picked and submitted for piasmid preparation and sequence analysis. The sequencing primer, shown beiow, sits in the NA2-tpi promoter region and reads in the forward direction of the Thenriomyces lanuginosus lipase variant gene, S'-ATACTGGCAAGGGATGCCATGCTTGG-S' (SEQ SD NO: 33} Correct clones with the R2K mutation in the signal sequence were identified. The resuiting piasmid was designated piasmid T85,

Example 19; Construction of an Aspergillus oryzae vector with SPIRR deleted

A QUIKCHANGE® i! XL Site-Directed Mutagenesis Kit was used to create T86 from pJMS6 by changing the K to R in the signal sequence region using the mutagenic primers shown below. The mutagenesis procedures were identical to those described in

Exampie 18,

Forward primer:

5 ^! ~CACAACTGGCCATGaggAGCTCCCTTGTG-3' (SEQ ID NO: 34)

Reverse primer: 5'-CACAAGGGAGCTcCtCATGGCCAGTTGTG-S ¹ (SEQ ID NO: 35)

The lower case codons are the intended change.

Correct clones with SPiRR deletion in the propeptide sequence were identified by DNA sequencing using the primer of SEQ !D NO; 33. The resuming plasmid was designated plasmid T86.

5 Example 20: Expression of Thβrmamyc&s lanuginosas lipase variant from pJMS6, pJfV1S7, pJasmid TBS, and plasmid TB6

Protopiast preparation and transformation of Aspergillus oryzae BeCh2 were performed according to standard protocois, e.g., Christensen et aL, 1988, 8io/Technoiogy 6: 1419-1422. About 5 μg of each expression vector was used in each

1.0 transformation reaction. The transformation mixtures were piated onto COVE piates and incubated at 37X for 7 days. Transforrnants were picked and transferred to fresh COVE piates and grown at 34' ⁵ C waiting for spore purification and tributyrin assay.

Tributyrin piates were prepared by pouring a 50 ml mixture of 10% (v/v) tributyrin with VNO ₃ RLMT agar (melted and biended in a steriie biender) into 150 mm round

15 piates and ailowed to dry. A small 1 cm x 1 cm piug of spores was cut out using a steriie toothpick and transferred to a tributyrin plate. Each piate can hold up to 9 plugs. The piates were incubated for 3-4 days at ZA ⁿ C and positive transformants were identified by a haio of clearing around the plugs.

Transformation of Aspergillus oryzae Becn2 with pJMSβ, pJMS7, plasmid T85, 0 and plasmid TB6 yielded many transformants that were positive for iipase activity on the tributyrin piates (see tabie beiow).

Table 1. Number of Transformants Positive for Lipase Activity

5 Positive transformants were streaked onto fresh COVE piates and were grown for 1 to 2 days at 34 ¹⁵ C. Two single spores from each streaked piate were picked and transferred to separate COVE plates. These spores were grown at 34°C for about 7

days. Another tributyrin screening was performed to confirm the lipase activity prior to shake flask analysis.

The spores from positive transformants were collected in approximately 5 ml of

0.01 % Tween-20, Two hundred μf of spore suspensions were then used to inoculate 25

5 mi of MY25 medium in 12S polycarbonate ErSenmeyer flasks. In order to examine the variances between flasks, each spore-purified transformant was inoculated in duplicate.

Cultures were incubated for 5 days at 34"C on a platform shaker at 200 rpm. On day 3,

4, and 5, culture supematants were coiiected by centrifυgation at 13,000 x g for 10 minutes to remove mycelia and stored at -20*C for automated iipase activity assays. 0 To determine iipase activity in the cuSture supematants an automated assay using a θiOMEKφ 3000 (Beckman Coulter. Inc, Fullerton, CA, USA) was used. Culture supematants were diluted appropriately (1/10, 1/50, and/or 1/100) in 0.1 IVS MOPS, 4 miW CaCi: 0,01% Triton X- 100 buffer pH 7.5 (sample buffer) (to prevent proteins sticking to the plate) foliowed with a series dilution from 0-fold to 1/3-fold to 1 /9-fold of the diluted 5 sample. A LIPOLASE™ standard (Novozymes A/S. Bagsvserd, Denmark) was diluted using 2-foid steps starting with a 1.0 LU/mS concentration and ending with a 0.125 LU/ml concentration in the sample buffer, A total of 20 μl of each dilution including standard was transferred to a 96-wel! flat bottom plate. Two hundred microliters of a p- nitrophenyl butyrate substrate solution (ratio of p-nitrophenyi butyrate to DMSO to 0.1 M 0 MOPS pH 7.5 was 1 :99:400) was added to each well and then incubated at ambient temperature for 6,5 minutes. During the incubation the rate of the reaction was measured at 405 nm. Sample concentrations were determined by extrapolation from the generated standard curve.

Compaήson of the yields (relative LU/m!) obtained from transformants containing 5 pMQ7 {Thenvomyces lanuginosus Iipase variant) and pJMSβ (SPIRR minus with R2K change) are shown in Figure 19. The results showed that deletion of SPIRR in combination with the R2K change improved expression compared to the wild-type gene. A t-test of the two populations yielded a p value of less than 0.007.

Comparison of the yields (relative LU/mi) obtained from transformants containing U pJMS7 {Thenvomyces lanuginosus iipase variant), pJIVISδ (SPIRR minus with R2K change), and pSasrnid TB5 (R2K change) are shown in Figure 20. The results showed that the R2K change alone does not result in increased yields relative to the wild-type gene and in fact may lead to a slight decrease. A t-test of the comparing the pJMS7 anά pSasmid TB5 populations yielded a p value of 0.047. 5 Comparison of the yields (relative LU/ml) obtained from transformants containing pJMS7 (Thermomyces lanuginosus iipase variant) and plasmid TB6 (SPIRR minus) are

shown in Figure 21. The results showed that the SPIRR deletion aione gives an increased yieici relative to the wild-type gene, A Mest of the comparing the pJMS7 and piasmid TB6 populations yielded a p value of less than 7,7 X 10" ^' ,

The invention described and claimed herein is not to be limited in scope by the specific aspects herein disclosed, since these aspects are intended as illustrations of severa! aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fail within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.

Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.