FIELD OF THE INVENTION The present invention relates generally to a method for the detection of genetic expression in cells. More particularly, the present invention is directed to a method of monitoring the transcriptional activity of genetic elements including genes in a cell and more particularly to a method of determining at a quantitative, semi-quantitative or qualitative level the transcriptional activity of selected genetic elements in a cell. The present invention is further directed to a method for analyzing run-on transcription in cells and cellular organelles such as nuclei, mitochondria and/or chloroplasts. The present invention further contemplates the use of real-time detection analysis in an amplification assay for the determination of run-on transcription in a cell and/or cellular organelles such as nuclei, mitochondria and/or chloroplasts. The present invention further provides a kit including components of or for a kit, preferably packaged for sale with instructions for use, in the determination of the level of run-on transcription in a cell or cellular organelles such as nuclei, mitochondria and/or chloroplasts. The method of the present invention provides, therefore, a sensitive method for the determination of genetic expression in a cell which is rapid and cost effective.

BACKGROUND OF THE INVENTION Bibliographic details of references provided in the subject specification are listed at the end of the specification.

Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country.

The physiological state of a cell, tissue or organism is characterized in part by the expression status of transcriptional units in the cell's genomic material. Generally, the

transcriptional units are in the form of genes. The degree of transcriptional activation of all genes or particular groups of genes provides a fingerprint of genetic activity which alters due to a range of inter alia internal and external stimuli, physiological conditions and developmental states. The ability to regulate the process of transcription provides the molecular basis for numerous biological processes which result in or require an alteration in gene expression. Changes in a physiological state, such as during cellular differentiation or tissue specific gene expression, is frequently the result of coordinated transcriptional activation or inactivation of particular genes or groups of genes in a cell, organ or organism. Characterization of this expression status is of key importance for answering many biological questions. From a practical viewpoint, such an understanding of expression status is becoming fundamental to functional genomics and proteomics. A change in gene expression in response to a stimulus, a developmental stage, a pathological state or a physiological state, for example, is important in determining the nature and mechanism of the change in screening for agents capable of reversing a pathological condition. Patterns of gene expression are also expected to be useful in the diagnosis of pathological conditions and, for example, may provide a basis for the sub-classification of functionally different subtypes of disease conditions.

The measurement of the rate of transcription in cells requires a determination of the amount of RNA generated as a transcript. A major difficulty with such assays is distinguishing between newly transcribed or nascent RNA and accumulated (mature) RNA. Generally, an RNA molecule is stable for a much longer period of time compared to the time taken for an RNA polymerase to enzymatically synthesize the same transcript. Furthermore, different RNA species have different half lives in cells; thus, the steady-state level of an RNA species in a cell does not provide information about the transcriptional activity of a given gene. Thus, the signal arising from a Northern hybridization, for example, reflects the amount of accumulated RNA and does not generally provide a measurement of the transcriptional activity of the gene.

Several methods have been developed to determine the rate at which nascent RNA is generated. Generally, these methods are referred to as nuclear run-on transcription assays.

Because purified RNA polymerase (RNAP) will not accurately initiate transcription in vitro, run-on transcription assays in higher eukaryotes require the use of cell extracts or intact cellular organelles such as nuclei, to provide the components necessary for transcription. Cell extracts and organelles such as nuclei can be isolated in such a way that transcription of nascent RNA transcripts by RNAP is temporarily"frozen-in-time". This is achieved by cooling intact viable cells on ice, lysing the cells and extracting the nuclei from the cellular debris. The isolated nuclei can then be resuspended in a reaction buffer containing labeled ribonucleotides. Alternatively, living cells or tissue samples are set in soft agar and nuclei are"isolated"from other cellular components in situ. The transcription of nascent RNA transcripts is then allowed to continue by warming the nuclei to room temperature. Only those transcripts being synthesized at the time of cooling will be extended. The rate of transcription can be measured by substituting a standard ribonucleotide with a labeled ribonucleotide, typically 32P-UTP. The newly synthesized RNA transcripts are detected by hybridization to complementary sequences present on nylon membranes or alternatively in a ribonuclease protection assay. These types of sample detection methods have a limited sensitivity and can result in the production of high background levels which can potentially result in a large signal to noise ratio which prevents the accurate measurement of the rates of transcription.

Nuclear run-on assays detect only a very few RNA transcripts present in each nucleus and thus in order to detect run-on transcription a large number of nuclei must be used. In many circumstances, the preparation of significant quantities of nuclei may be a major limitation to the utility of a nuclear run-on assay. Furthermore, such assays require very large quantities of labeled ribonucleotides with exceedingly high specific activity. Thus, nuclear run-on experiments of this type are potentially hazardous and can render laboratory equipment highly radioactive and unusable until the decay of the isotope reduces radioactivity to safe levels.

There is a need, therefore, for alternative methods for the detection of nascent RNA produced by the transcription of genes. There is also a need for highly sensitive quantitative methods to determine and analyze transcription of specific nucleic acid

sequences. Thus, there is a need for methods to determine the level of expression of the same gene under different conditions and to provide a fingerprint of genetic expression and transcriptional activity in a cell.

The present inventors have now developed a modified nuclear run-on assay which addresses these needs for the measurement of nascent RNA transcripts resulting from transcription of specific genes. In particular, in one embodiment, the subject inventors have combined real-time technology with-amplification technology to produce a nuclear run-on assay which accurately determines the level of transcriptional activity within a cell.

SUMMARY OF THE INVENTION Throughout this specification, unless the context requires otherwise, the word"comprise", or variations such as"comprises"or"comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1 (SEQ ID NO : 1), <400>2 (SEQ ID NO : 2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims.

The present invention is predicated in part on the use of real-time protocols in combination with amplification technology to measure the level of nascent RNA associated with a transcriptional unit. In essence, the assay is a nuclear run-on assay which has been modified to measure RNA transcribed in vitro from preparations of cellular or viral nucleic acid or organelles such as nuclei, mitochondria or chloroplasts by protocols involving measurement of the rate of accumulation of product. Preferably, this is conducted by real- time reverse transcriptase (RT) -PCR. The modified method permits a genetic fingerprint of expression status to be formulated for a cell by determining transcriptional activity. The modified assay is useful inter alia in screening the effects of genetic and small molecule agents on gene expression and monitoring changes in gene expression in response to internal and external stimuli, pathological conditions or changes in developmental stages.

Accordingly, one aspect of the present invention contemplates a method for determining the activity of a transcriptional unit or a plurality of transcriptional units in a cell, said method comprising obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto from said cell under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts

comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and optionally including amplification means to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

Another aspect of the present invention provides a method for determining changes in activity of a transcriptional unit or plurality of transcriptional units in a cell or cell linage, said method comprising obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto before or after exposure of said cell to internal or external stimulus or at different developmental stages of said cell or cell lineages under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and optionally including amplification means to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

A further aspect of the present invention contemplates an assay device in the form of a kit useful in determining the activity of a transcriptional unit or plurality of transcriptional units in a cell, said kit comprising in compartmental form multiple compartments each adapted to comprise one or more of buffers, diluents and enzymes in single or multiple components which are required to be admixed prior to use, said kit further comprising instructions for use wherein the method is conducted by obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto from said cell under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and optionally including amplification means to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

Another aspect of the present invention contemplates an assay device in the form of a kit useful in determining the activity of a transcriptional unit or plurality of transcriptional units in a cell, said kit comprising in compartmental form multiple compartments each adapted to comprise one or more of buffers, diluents and enzymes in single or multiple components which are required to be admixed prior to use, said kit further comprising instructions for use wherein the method is conducted by obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto from said cell under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a

population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and amplification means via real-time PCR to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

A further aspect of the present invention contemplates an assay device in the form of a kit useful in determining the activity of a transcriptional unit or plurality of transcriptional units in a cell, said kit comprising in compartmental form multiple compartments each adapted to comprise one or more of buffers, diluents and enzymes in single or multiple components which are required to be admixed prior to use, said kit further comprising instructions for use wherein the method is conducted by obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto from said cell under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means via binding of a biotin label on the RNA transcripts to an immobilized molecule capable of binding to biotin to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and optionally including amplification means to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

BRIEF DESCRIPTION OF THE FIGURES Figure 1A is a graphical and tabular representation of amplification plots and quantitation data for human BRN2 (duplexed with human GAPDH-Figure 1B).

Figure 1B is a graphical and tabular representation of amplification plots and quantitation data for human GAPDH (duplexed with human BRN2-Figure 1A).

Figure 2A is a graphical and tabular representation of amplification plots and quantitation data for murine B16 tyrosinase (duplexed with murine GAPDH-Figure 2B).

Figure 2B is a graphical and tabular representation of amplification plots and quantitation data for GAPDH (duplexed with murine B16 tyrosinase-Figure 2A).

Figure 3A is a graphical and tabular representation of amplification plots and quantitation data for EGFP (duplexed with murine GAPDH-Figure 3B).

Figure 3B is a graphical and tabular representation of amplification plots and quantitation data for murine GAPDH (duplexed with EGFP-Figure 3A).

Figure 4A is a graphical and tabular representation of amplification plots and quantitation data for EGFP (duplexed with human GAPDH-Figure 4B).

Figure 4B is a graphical and tabular representation of amplification plots and quantitation data for human GAPDH (duplexed with EGFP-Figure 4A).

Figure 5A is a graphical and tabular representation of amplification plots and quantitation data for human endogenous HER2 (duplexed with human GAPDH-Figure 5B).

Figure 5B is a graphical and tabular representation of amplification plots and quantitation data for human GAPDH (duplexed with human endogenous HER2-Figure 5A).

Figure 6A is a graphical and tabular representation of amplification plots and quantitation data for HER-2 exogenous assay (duplexed with human GAPDH-Figure 6B) which exemplifies the linearity of the standard curves of the duplexed real-time RT-PCR method on a DNA template.

Figure 6B is a graphical and tabular representation of amplification plots and quantitation data for human GAPDH (duplexed with HER-2 exogenous assay-Figure 6A) which exemplifies the linearity of the standard curves of the duplexed real-time RT-PCR method on a DNA template.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention is predicated in part on the finding that nascent RNA transcripts extended in the presence of a labeled ribonucleotide have utility as efficient templates for amplification reactions. This provides a fingerprint of genetic activity in a cell such as in response to internal or external stimuli as well as resulting from different physiological or developmental states. Consequently, this finding leads to an improved method for the quantitative or qualitative detection of transcriptional activity in cells by combining amplification methodologies with real-time analysis techniques. The subject method enables the determination of transcriptional activity in a cell not possible through sampling techniques which can only determine a level of transcription at a static point in time.

Transcription will be understood as the process by which an RNA molecule is produced from a nucleic acid template. A nucleic acid template may be RNA or DNA. An RNA transcript is regarded as any RNA molecule which is synthesized by an enzymatic process and/or a series of chemical reactions. A"nascent RNA molecule"should be understood as the portion of an RNA transcript associated with a transcriptional unit or gene. The term "nascent"is used to highlight the juvenile nature of the transcript relative to a complete or mature transcript. However, the term"mRNA"or"transcript"is to be understood as encompassing a nascent RNA molecule. A nascent transcript is generally one which is capable of extension in a run-on transcription.

Accordingly, the present invention contemplates a method for determining the activity of a transcriptional unit or a plurality of transcriptional units in a cell, said method comprising obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto from said cell under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means to generate a purified

population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and optionally including amplification means to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

Reference to"determining the activity"includes a quantitative or qualitative determination as to the level of nascent RNA associated with a transcriptional unit. The higher the activity, the more transcription of a particular transcriptional unit was taking place at the time of generation of the preparation.

A"transcriptional unit"refers to genetic material which, in a cell, is capable of acting as a template for generating a transcript through the process of transcription. A transcriptional unit may be naturally occurring or generated by, for example, recombinant means. A gene is regarded as an example of a transcriptional unit.

The cell may be a prokaryotic or eukaryotic cell. As prokaryotes do not have nuclei as such, a preparation comprising chromosomal material including nascent RNAs is prepared.

The present method further enables the detection of viral RNA transcripts in a cell.

A prokaryotic microorganism includes bacteria such as Gram positive, Gram negative and Gram variable bacteria and intracellular bacteria. Examples of bacteria contemplated herein include the species of the genera Treponema, Borrelia, Neisseria, Legionella, Bordetella, Escherichia, Salmonella, Shigella, Klebsiella, Yericia, Vibrio, Hemophilus, Rickettsia, Chlamydia, Mycoplasma, Staphylococcus, Streptococcus, Bacillus, Clostridium, Corynebacterium, Pseudomonas, Proprionibacterium, Mycobacterzuyn, Ureaplasma and Listeria.

Particularly preferred species include Escherichia coli, Treponema pallidum, Borrelia

burgdorferi, Neisseria gonorrhea, Neisseria meraihgitidis, Legionella pneumophila, Bordetella pertussis, Escherichia coli, Salmonella typhi, Salmonella typhimurium, Shigella dysenteriae, Klebsiella pneumoniae, Yersinia pestis, TTibrio cholerae, Hemophilus influenzae, Rickettsia rickettsii, Chlamydia trachomatis, Mycoplasma pneumoniae, Staphylococcus aureus, Streptococcus pneufnoniae, Streptococcus pyogenes, Bacillus anthracis, Clostridium botulinum, Clostridium tetani, Clostridium peYf3"Zingens, Corynebacterium dipAtheriae, Proprionibacterium acnes, Mycobacterium tuberculosis, Mycobacterium leprae,-Listeria monocytogenes, Pseudomonas aeruginosa and Pseudomonas putida.

A eukaryotic cell includes a yeast or fungus such as but not limited to Microsporidium, Pneumocystis carinii, Candida albicans, Aspergillus, Histoplasma capsulatum, Blastomyces dermatitidis, Cryptococcus neoformans, Trichophyton and Microsporum. The cells may also be from worms, insects, arachnids, nematodes, amoebae, Entamoeba histolytica, Giardia lamblia, Trichomonas vaginalis, Trypanosoma brucei gambiense, Trypanosoma cruzi, Balantidium coli, Toxoplasma gondii, Cryptosporidium or Leishmania. The eukaryotic cells may also be from mammals such as humans, primates, livestock animals, companion animals and laboratory test animals.

Viruses contemplated herein include HIV, hepatitis virus (e. g. Hep A, Hep B, Hep C and non-A, non-B Hep virus), adenoviruses, papovaviruses, herpes viruses: simplex, varicella- zoster, Epstein-Barr, CMV, pox viruses: smallpox, vaccinia, rhinoviruses, polio virus, rubella virus, arboviruses, rabies virus, foot and mouth disease virus, swine fever virus, Newcastle disease virus, respiratory viruses that cause the common cold, influenza viruses A and B, measles virus, mumps virus and HTLV I and II.

A'plurality of transcriptional units"may comprise a group of separately transcribable units or may comprise multiple genes transcribed as a single polycistronic message.

"Conditions sufficient to temporarily inhibit or substantially reduce continued transcription"means any chemical or physical intervention which inhibits transcription of

a transcriptional unit. Such conditions include temperature and chemical inhibitors. The use of chemical inhibitors requires that the inhibition be reversible. The use of temperature is preferred such as placing the preparation on ice or under conditions to rapidly reduce the temperature to a level to inhibit or otherwise reduce transcription of the transcriptional units. Preferred temperature conditions for blocking transcription including from about 0°C to about 10°C and more preferably from about 0°C to about 4°C.

The subject method is particularly useful in assessing transcriptional activity in a cell in response to different internal or external stimuli or in different developmental states or stages. For example, transcriptional activity may be determined in the presence or absence of introduced genetic molecules such as co-suppression or antisense molecules or RNAi- inducing molecules or in the presence or absence of introduced proteinaceous or non- proteinaceous molecules. Examples of the latter are DNA/RNA-binding proteins, chemicals from a chemical library or molecules identified from natural product screening such as from coral, sea life associated in the coral, plants, soil or various aqueous environments. Furthermore, the transcriptional activity of cells at various points in their development may also be assessed such as comprising undifferentiated stem cells to differential stem cells or committed lineage cells.

Accordingly, another aspect of the present invention provides a method for determining changes in activity of a transcriptional unit or plurality of transcriptional units in a cell or cell linage, said method comprising obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto before or after exposure of said cell to internal or external stimulus or at different developmental stages of said cell or cell lineages under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts

including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and optionally including amplification means to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

The expression"internal or external stimuli"includes the effects of co-suppression molecules, anti-sense molecules, RNAi-inducing molecules as well as proteinaceous and non-proteinaceous molecules. Preferred antisense molecules are from about 10 base pairs long to about 2000 base pairs long but more preferably from about 12 to about 30 base pairs long such as 13, 18 and 22 base pairs in length.

Preferred co-suppression molecules include double-stranded RNA molecules forming a hairpin with or without single-stranded portions in the form of a"bulge"or"bubble".

The present invention combines detection using real-time analysis and optionally with amplification methodologies. Amplification methodologies contemplated herein include the polymerase chain reaction (PCR) such as disclosed in U. S. Patent Nos. 4,683, 202 and 4,683, 195 (Mullis); the ligase chain reaction (LCR) such as disclosed in European Patent Application No. EP-A-320 308 (Backman et al.) and gap filling LCR (GLCR) or variations thereof such as disclosed in International Patent Publication No. WO 90/01069 (Segev), European Patent Application EP-A-439 182 (Backman et al.), British Patent No. GB 2,225, 112A (Newton et al.) and International Patent Publication No. WO 93/00447 (Birkenmeyer et aL). Other amplification techniques include Qß replicase such as described in the literature ; Strand Displacement Amplification (SDA) such as described in European Patent Application Nos. EP-A-497 272 (Walker) and EP-A-500 224 (Walker et al.) ; Self-Sustained Sequence Replication (3SR) such as described in Fahy et al. (PCR Methods Appl. 1 (1) : 25-33, 1991) and Nucleic Acid Sequence-Based Amplification (NASBA) such as described in the literature.

Some amplification reactions, for example, PCR and LCR, involve cycles of alternately high and low set temperatures, a process known as"thermal cycling". PCR or"polymerase chain reaction"is an amplification reaction in which a polymerase enzyme, usually thermostable, generates multiple copies of the original sequence by extension of primers using the original nucleic acid as a template. PCR is described in more detail in U. S. Patent Nos. 4,683, 202 and 4,683, 195. LCR or"ligase chain reaction"is a nucleic acid amplification reaction in which a ligase enzyme, usually thermostable, generates multiple copies of the original sequence by ligating two or more oligonucleotides while they are hybridized to the target. LCR and its variation, Gap LCR, are described in more detail in European Patent Application Nos. EP-A-320-308 (Backman et al.) and EP-A-439-182 (Backman et al.) and International Patent Publication No. WO 90/100447 (Birkenmeyer et al.) and elsewhere.

The PCR amplification process is the most preferred in practicing the present invention.

Accordingly, another aspect of the present invention contemplates an assay device in the form of a kit useful in determining the activity of a transcriptional unit or plurality of transcriptional units in a cell, said kit comprising in compartmental form multiple compartments each adapted to comprise one or more of buffers, diluents and enzymes in single or multiple components which are required to be admixed prior to use, said kit further comprising instructions for use wherein the method is conducted by obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto from said cell under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and amplification means via real-time PCR to measure the appearance of a

detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

Real-time analysis technologies permit accurate and specific amplification products (e. g.

PCR products) to be quantitatively detected within an amplification vessel during the exponential phase of the amplification process, before reagents are exhausted and the reaction plateaus or non-specific amplification limits the reaction. The particular cycle of amplification at which the detected amplification signal first crosses a set threshold is proportional to the starting copy number of the target molecules.

Instruments capable of measuring real-time include Taq Man 7700 AB (Applied Biosystems), Rotorgene 2000 (Corbett Research), LightCycler (Roche), iCycler (Bio-Rad) and Mx4000 (Stratagene).

The method of the present invention is suitable for use with a number of direct reaction detection technologies and chemistries such as Taq Man (Perkin-Elmer), molecular beacons and the LightCycler (trademark) fluorescent hybridization probe analysis (Roche Molecular Systems).

One useful system for real-time DNA amplification and detection is the LightCycler (trademark) fluorescent hybridization probe analysis. This system involves the use of three essential components: two different oligonucleotides (labeled) and the amplification product. Oligonucleotide 1 carries a fluorescein label at its 3'end whereas oligonucleotide 2 carries another label, LC Red 640 or LC Red 705, at its 5'end. The sequence of the two oligonucleotides are selected such that they hybridize to the amplified DNA fragment in a head to tail arrangement. When the oligonucleotides hybridize in this orientation, the two fluorescent dyes are positioned in close proximity to each other. The first dye (fluorescein) is excited by the LightCycler's LED (Light Emitting Diode) filtered light source and emits green fluorescent light at a slightly longer wavelength. When the two dyes are in close

proximity, the emitted energy excites the LC Red 640 or LC Red 705 attached to the second hybridization probe that subsequently emits red fluorescent light at an even longer wavelength. This energy transfer, referred to as FRET (Forster Resonance Energy Transfer or Fluorescence Resonance Energy Transfer) is highly dependent on the spacing between the two dye molecules. Only if the molecules are in close proximity (a distance between 1- 5 nucleotides) is the energy transferred at high efficiency. Choosing the appropriate detection channel, the intensity of the light emitted by the LC Red 640 or LC Red 705 is filtered and measured by optics in the thermocycler. The increasing amount of measured fluorescence is proportional to the increasing amount of DNA generated during the ongoing PCR process. Since LC Red 604 and LC Red 705 only emit a detectable signal when both oligonucleotides are hybridized, the fluorescence measurement is performed after the annealing step. Using hybridization probes can also be beneficial if samples containing very few template molecules are to be examined. DNA quantification with hybridization probes is not only sensitive but also highly specific. It can be compared with agarose gel electrophoresis combined with Southern blot analysis but without all the time consuming steps which are required for the conventional analysis.

The"Taq Man"fluorescence energy transfer assay uses a nucleic acid probe complementary to an internal segment of the target DNA. The probe is labelled with two fluorescent moieties with the property that the emission spectrum of one overlaps the excitation spectrum of the other; as a result, the emission of the first fluorophore is largely quenched by the second. The probe, if present during PCR and if PCR product is made, becomes susceptible to degradation via a 5'-nuclease activity of Taq polymerase that is specific for DNA hybridized to template. Nucleolytic degradation of the probe allows the two fluorophores to separate in solution which reduces the quenching and increases the intensity of emitted light.

Probes used as molecular beacons are based on the principle of single-stranded nucleic acid molecules that possess a stem-and-loop structure. The loop portion of the molecule is a probe sequence that is complementary to a predetermined sequence in a target nucleic acid. The stem is formed by the annealing of two complementary arm sequences that are

on either side of the probe sequence. The arm sequences are unrelated to the target sequence. A fluorescent moiety is attached to the end of one arm and a non-fluorescent quenching moiety is attached to the end of the other arm. The stem keeps these two moieties in close proximity to each other causing the fluorescence of the fluorophore to be quenched by fluorescence resonance energy transfer. The nature of the fluorophore- quencher pair that is preferred is such that energy received by the fluorophore is transferred to the quencher and dissipated as heat rather than being emitted as light. As a result, the fluorophore is unable to fluoresce. When the probe encounters a target molecule, it forms a hybrid that is longer and more stable than the hybrid formed by the arm sequences. Since nucleic acid double helices are relatively rigid, formation of a probe- target hybrid precludes the simultaneous existence of a hybrid formed by the arm sequences. Thus, the probe undergoes a spontaneous conformational change that forces the arm sequences apart and causes the fluorophore and quencher to move away from each other. Since the fluorophore is no longer in close proximity to the quencher, it fluoresces when illuminated by an appropriate light source. The probes are termed"molecular beacons"because they emit a fluorescent signal only when hybridized to target molecules.

SYBR (registered trademark) is also useful. SYBR is a fluorescent dye which may be used in ABI sequence detection systems such as ABI PRISM 770 (registered trademark), Rotorgene 2000 (Corbett Research), Mx4000 (Stratagene), GeneAmp 5700, LightCycler (registered trademark) and iCycler (trademark).

A number of real-time fluorescent detection thermocyclers are currently available with the chemistries being interchangeable with those discussed above as the final product is emitted fluorescence. Such thermocyclers include the Perkin Elmer Biosystems 7700, Corbett Research's Rotorgene, the Hoffinan La Roche LightCycler, the Stratagene Mx4000 and the Bio-Rad iCycler. It is envisaged that any of the above thermocyclers could be adapted to accommodate the method of the present invention.

Exemplary fluorophores include but are not limited to 4-acetamido-4'- isothiocyanatostilbene-2, 2'disulfonic acid acridine and derivatives including acridine,

acridine isothiocyanate, 5-(2'-aminoethyl) aminonaphthalene-1-sulfonic acid (EDANS), 4- amino-N- [3-vinylsulfonyl)-phenyl] naphthalimide-3,5 disulfonate (Lucifer Yellow VS) anthranilamide, Brilliant Yellow, coumarin and derivatives including coumarin, 7-amino- 4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcoumarin (Coumarin 151), Cy3, Cy5, cyanosine, 4', 6-diaminidino-2-phenylindole (DAPI), 5', 5"- dibromopyrogallol-sulfonaphthalein (Bromopyrogallol Red), 7-diethylamino-3- (4'- isothiocyanatophenyl) -4-methylcoumarin, diethylenetriamine pentaacetate, 4,4'- diisothiocyanatodihydro-stilbene-2, 2'-disulfonic acid, 4, 4'-diisothiocyanatostilbene-2, 2'- disulfonic acid, 5-[dimethylamino] naphthalene-1-sulfonyl chloride (DNS, dansyl chloride), 4- (4'-dimethylaminophenylazo) benzoic acid (DABCYL) 4-dimethylaminophenyl- azophenyl-4'-isothiocyanate (DABITC), eosin and derivatives including eosin, eosin isothiocyanate, erythrosin and derivatives including erythrosin B, erythrosin isothiocyanate, ethidium, fluorescein and derivatives including 5-carboxyfluorescein (FAM), 5- (4, 6-dichlorotriazin-2-yl) aminofluorescein (DTAF), 2'7'-dimethoxy-4'5'- dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate, QFITC (XRITC), fluorescamine, IR144, IR1446, Malachite Green isothiocyanate, 4- methylumbelliferone, ortho-cresolphthalein, nitrotyrosine, pararosaniline, Phenol Red, B- phycoerythrin, o-phthaldialdehyde, pyrene and derivatives including, pyrene, pyrene butyrate, succinimidyl 1-pyrene butyrate, Reactive Red 4 (Cibacron [registered trademark] Brilliant Red 3B-A), rhodamine and derivatives, 6-carboxy-X-rhodamine (ROX), 6- carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 110, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101 (Texas Red), N, N, N'N'-tetramethyl-6-carboxyrhodamine (TAMRA), tetramethyl rhodamine, tetramethyl rhodamine isothiocyanate (TRITC), riboflavin, rosolic acid, terbium chelate derivatives.

The present invention permits the use of a range of capture and immobilization methodologies to capture the nascent RNA transcripts. Dynabead (registered trademark) technology is the most convenient up to the present time. In one example, biotin or a related molecule is incorporated into an RNA molecule and this permits immobilization to

a bead coated with a biotin ligand. Examples of such ligands include streptavidin, avidin and anti-biotin antibodies.

Furthermore, the present invention further proposes to modify Dynabead immobilization to enable labeled transcripts to be cleaved or eluted off the bead by the incorporation of a cleavable or otherwise labile linker between, for example, a UTP and a biotin label or between a Dynabead and streptavidin. One preferred cleavable marker is a disulfide bridge which could be disrupted by dithiothreitol (DTT) or other reducing agent. DTT is particularly useful as it is compatible with Taq Man chemistry. The release of, for example, biotin UTP-labeled transcripts from a streptavidin Dynabead further enables a more homogenous sample and reaction as the dense Dynabeads tend to sink rapidly and form a pellet during the steps of the process which has the potential of causing inaccurate aliquoting of the sample and poor access of RT and PCR reagents to nascent mRNA transcripts and cDNA.

In a second example, a halogenated base such as BrU is incorporated into an RNA molecule and this permits immobilization to a bead coated with a suitable specific binding agent. Examples of such agents include anti-BrU antibodies. Following appropriate washing procedures to remove contaminating materials, BrU-labeled RNA molecules are then removed from the antibody-coated beads by procedures well known to those skilled in the art.

Also included within the scope of the present invention are compounds such as aminoallyl uridine in which the amino group is a reactive moiety for other molecules such as fluorescent dyes, linker arms and biotin and the like.

A"nucleic acid"as used herein, is a covalently linked sequence of nucleotides in which the 3'position of the pentose of one nucleotide is joined by a phosphodiester group to the 5'position of the pentose of the next nucleotide and in which the nucleotide residues (bases) are linked in specific sequence; i. e. a linear order of nucleotides. A "polynucleotide"as used herein, is a nucleic acid containing a sequence that is greater than

about 100 nucleotides in length. An"oligonucleotide"as used herein, is a short polynucleotide or a portion of a polynucleotide. An oligonucleotide typically contains a sequence of about two to about one hundred bases. The word"oligo"is sometimes used in place of the word"oligonucleotide".

"Nucleoside", as used herein, refers to a compound consisting of a purine [guanine (G) or adenine (A) ] or pyrimidine [thymine (T), uridine (U) or cytidine (C) ] base covalently linked to a pentose, whereas"nucleotide"refers to a nucleoside phosphorylated at one of its pentose hydroxyl groups."XTP","XDP"and"XMP"are generic designations for ribonucleotides and deoxyribonucleotides, wherein the"TP"stands for triphosphate,"DP" stands for diphosphate, and"IMP"stands for monophosphate, in conformity with standard usage in the art. Subgeneric designations for ribonucleotides are"NMP","NDP"or "NTP", and subgeneric designations for deoxyribonucleotides are"dNMP","dNMP"or "dNTP". Also included as"nucleoside", as used herein, are materials that are commonly used as substitutes for the nucleosides above such as modified forms of these bases (e. g. methyl guanine) or synthetic materials well known in such uses in the art, such as inosine.

As used herein, the term"nucleic acid probe"refers to an oligonucleotide or polynucleotide that is capable of hybridizing to another nucleic acid of interest under low stringency conditions. A nucleic acid probe may occur naturally as in a purified restriction digest or be produced synthetically, by recombinant means or by PCR amplification. As used herein, the term"nucleic acid probe"refers to the oligonucleotide or polynucleotide used in a method of the present invention. That same oligonucleotide could also be used, for example, in a PCR method as a primer for polymerization, but as used herein, that oligonucleotide would then be referred to as a"primer". In some embodiments herein, oligonucleotides or polynucleotides contain a modified linkage such as a phosphorothioate bond.

As used herein, the terms"complementary"or"complementarity'are used in reference to nucleic acids (i. e. a sequence of nucleotides) related by the well-known base-pairing rules that A pairs with T and C pairs with G. For example, the sequence 5'-A-G-T-3', is

complementary to the sequence 3'-T-C-A-5'. Complementarity can be"partial"in which only some of the nucleic acid bases are matched according to the base pairing rules. On the other hand, there may be"complete"or"total"complementarity between the nucleic acid strands when all of the bases are matched according to base pairing rules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands as known well in the art. This is of particular importance in detection methods that depend upon binding between nucleic acids, such as those of the invention. The term"substantially complementary"refers to any probe that can hybridize to either or both strands of the target nucleic acid sequence under conditions of low stringency as described below or, preferably, in polymerase reaction buffer (Promega, M195A) heated to 95°C and then cooled to room temperature. As used herein, when the nucleic acid probe is referred to as partially or totally complementary to the target nucleic acid, that refers to the 3'-terminal region of the probe (i. e. within about 10 nucleotides of the 3'-terminal nucleotide position).

Reference herein to a low stringency includes and encompasses from at least about 0 to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions.

Generally, low stringency is at from about 25-30°C to about 42°C. The temperature may be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions. Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0. 15 M salt for washing conditions. In general, washing is carried out Tm = 69.3 + 0.41 (G+C) % (Marmur and Doty, J. Mol. Biol. 5 : 109 1962). However, the Tm of a duplex DNA decreases by 1°C with every increase of 1% in the number of mismatch base pairs (Bonner and Laskey, Eur.

J. Biochem. 46 : 83, 1974). Formamide is optional in these hybridization conditions.

Accordingly, particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1% w/v SDS at 25-42°C ; a moderate stringency is 2 x SSC buffer, 0. 1% w/v SDS at a temperature in the range 20°C to 65°C ; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 65°C.

The present invention also contemplates kits for determining the activity of a transcription unit in a cell. The kits may comprise many different forms but in a preferred embodiment, the kits are designed for analysis by mass spectrometry, fluorescence spectroscopy (e. g.

Syber Green) or absorption spectroscopy.

The kit may also comprise instructions for use.

Accordingly, another aspect of the present invention contemplates an assay device in the form of a kit useful in determining the activity of a transcriptional unit or plurality of transcriptional units in a cell, said kit comprising in compartmental form multiple compartments each adapted to comprise one or more of buffers, diluents and enzymes in single or multiple components which are required to be admixed prior to use, said kit further comprising instructions for use wherein the method is conducted by obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto from said cell under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and optionally including amplification means to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional

unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

A particularly useful kit comprises one or more buffers, diluents and enzymes. Particularly useful buffers are described in the Examples and include storage buffers, cell lysis buffers and buffers for use in amplification reactions. Enzymes include polymerases. The kit may also comprise a series of labeled or unlabeled deoxyribonucleotides and/or ribonucleotides.

Conveniently, the kits are adapted to contain compartments for two or more of the above- listed components. Furthermore, buffers, nucleotides and/or enzymes may be combined into a single compartment.

One form of kit contemplated herein optionally further comprises at least one nucleic acid probe which is complementary to a nucleic acid target sequence and comprising a fluorophore. The nucleic acid probe may also include at least one label. The nucleic acid probe may also comprise a nucleotide analogue.

The Taq polymerase is an example of a suitable DNA polymerase which is thermostable.

The thermostable DNA polymerase is used in an amount sufficient for a hybridized probe to release an identifier nucleotide. This amount may vary with the enzyme used and also with the temperature at which polymerization is carried out. An enzyme of a kit is typically present in an amount sufficient to permit the use of about 0.1 to 100 U/reaction ; in particularly preferred embodiments, the concentration is about 0.5 U/reaction.

As stated above, instructions optionally present in such kits instruct the user on how to use the components of the kit to perform the various methods of the present invention. It is contemplated that these instructions include a description of the detection methods of the subject invention, including detection by mass spectrometry, fluorescence spectroscopy and absorbance spectroscopy.

The present invention further contemplates kits which contain a nucleic acid probe for a nucleic acid target of interest with the nucleic acid probe being complementary to a predetermined nucleic acid target and comprising an identifier nucleotide. In another embodiment, the kit contains multiple probes, each of which contain a different base at an interrogation position or which are designed to interrogate different target DNA sequences.

In a contemplated embodiment, multiple probes are provided for a set of nucleic acid target sequences that give rise to analytical results which are distinguishable for the various probes.

It is contemplated that a kit contains a vessel containing a purified and isolated enzyme whose activity is to release one or more nucleotides from the 3'terminus of a hybridized nucleic acid probe and a vessel containing pyrophosphate. In one embodiment, these items are combined in a single vessel. It is contemplated that the enzyme is either in solution or provided as a solid (e. g. as a lyophilized powder), the same is true for the pyrophosphate. Preferably, the enzyme is provided in solution. Some contemplated kits contain labeled nucleic acid probes. Other contemplated kits further comprise vessels containing labels and vessels containing reagents for attaching the labels. Microtiter trays are particularly useful and these may comprise from two to 100,000 wells or from about six to about 10,000 wells or from about six to about 1,000 wells.

As discussed above, the nucleic acid probe optionally comprises a label, or a nucleotide analog. Thus, in some embodiments of a kit or composition, the identifier nucleotide comprises a fluorescent label and the probe optionally further comprises a fluorescence quencher or enhancer. As mentioned above, exemplary useful fluorophores are Fluorescein, 5-carboxyfluorescein (FAM), 2'7'dimethoxy-4'5'-dichloro-6-carboxy- fluorescein (JOI), rhodamine, 6-carboxyrhodamine (R6G), N, N, N, N-tetramethyl-6- carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4- (4'-dimethylamino- phenylazo) benzoic acid (DABCYL) and 5-(2'-aminoethyl) aminonaphthalene-1-sulfonic acid (EDANS). In other embodiments of a kit or composition, the identifier nucleotide comprises a non-natural nucleotide analog.

"Purification and isolation"when used in relation to a nucleic acid or protein, refers to a process by which a nucleic acid sequence or protein is identified and separated from at least one contaminant (nucleic acid or protein, respectively) with which it is ordinarily associated in its natural source. Isolated nucleic acid or protein is present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids or proteins are found in the state they exist in nature. Methods for the purification of a molecule are well known in the art, and include but are not limited to differential precipitation or differential extraction, chromatography, electrophoresis, HPLC, reverse phase liquid chromatography, immunoadsorbtion and immunoprecipitation, ion exchange chromatography, affinity matrix chromatography and immobilized metal ion affinity chromatography.

The present invention is particularly directed to the purification and isolation of biotin- labeled or BrU-labeled nascent RNA transcripts and further contemplates methods of purifying nascent RNA transcripts containing one or more biotinlabeled or BrU-labeled ribonucleotides.

In one preferred embodiment of the present invention, purification and isolation of the biotin-labeled nascent RNA transcript is achieved by binding to a solid matrix. As used herein, the term"solid matrix"refers to a material in a solid form to which a biotin-labeled nascent transcript can be attached. Examples of a solid matrix include a magnetic particle, a magnetic glass particle, a polymeric microsphere or a filter material and include polymer surfaces such as those on the surface of a micro-titre plate or capillary tube or cylinder. Preferably, the solid matrix is capable of being coated with a compound that is capable of binding biotin. In one aspect of the present invention, the compound that is capable of binding biotin is streptavidin. In a preferred embodiment the solid matrix is coated with streptavidin.

In a particularly preferred embodiment, the solid matrix is a Dynabead.

The streptavidin may be covalently bonded to the solid matrix or may interact with the matrix via electrostatic interactions. Without intending to limit the scope of the invention, it is preferred that the solid matrix is a magnetic particle coated with streptavidin. Although magnetic beads coated with streptavidin are contemplated in the subject invention, the present invention also contemplates the use of solid surfaces such as hereinbefore mentioned, in combination with biotin binding compounds and molecules other than streptavidin that are capable of binding biotin such as avidin or anti-biotin antibodies.

In a second preferred embodiment of the present invention, purification and isolation of the BrU-labeled nascent RNA transcript is achieved by binding to a solid matrix. As used herein, the term"solid matrix"refers to a material in a solid form to which a BrU-labeled nascent transcript can be attached. Examples of a solid matrix include a magnetic particle, a magnetic glass particle, a polymer microsphere or a filter material and include polymer surfaces such as those on the surface of a micro-titre plate or capillary tube or cylinder. Preferably, the solid matrix is capable of being coated with a compound that is capable of binding BrU. In one aspect of the present invention, the compound that is capable of binding biotin is anti-BrU antibodies. In a preferred embodiment the solid matrix is coated with anti-BrU antibodies.

In a particularly preferred embodiment, the solid matrix is a Dynabead.

The anti-BrU antibodies may be covalently bonded to the solid matrix or may interact with the matrix via electrostatic interactions. Without intending to limit the scope of the invention, it is preferred that the solid matrix is a magnetic particle coated with anti-BrU antibodies. Although magnetic beads coated with anti-BrU antibodies are contemplated in the subject invention, the present invention also contemplates the use of solid surfaces such as hereinbefore mentioned, in combination with BrU binding compounds and molecules other than anti-BrU antibodies that are capable of binding BrU.

Accordingly, the present invention further contemplates an assay device in the form of a kit useful in determining the activity of a transcriptional unit or plurality of transcriptional

units in a cell, said kit comprising in compartmental form multiple compartments each adapted to comprise one or more of buffers, diluents and enyzmes in single or multiple components which are required to be admixed prior to use, said kit further comprising instructions for use wherein the method is conducted by obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto from said cell under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means via binding of a biotin label on the RNA transcripts to immobilized streptavidin to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and optionally including amplification means to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

Molecules other than streptavidin that are capable of binding biotin include but are not limited to in vitro evolved molecules such as in vitro evolved DNA and RNA molecules.

Examples of molecules capable of binding biotin other than avidin and antibodies include biotin-binding aptamer molecules such as RNA and DNA aptamer molecules. Such molecules are well known in the art. The biotin-binding molecule may be covalently linked to the solid matrix, or may interact with it via electrostatic interaction. In this embodiment, the nascent transcript comprising a biotin-labeled nucleotide can be bound to the surface of a solid matrix that is coated with in vitro evolved RNA or DNA aptamer molecules. As well as RNA and DNA molecules that bind biotin, proteins other than streptavidin are contemplated by the present invention. Non-streptavidin proteins capable of binding biotin include but are not limited to, biotin carboxyl carrier proteins and its derivatives and

homologues thereof. Biotin binding protein other than streptavidin are well known in the art and the use of all such proteins is contemplated herein.

The present invention further contemplates an assay device in the form of a kit useful in determining the activity of a transcriptional unit or plurality of transcriptional units in a cell, said kit comprising in compartmental form multiple compartments each adapted to comprise one or more of buffers, diluents and enyzmes in single or multiple components which are required to be admixed prior to use, said kit further comprising instructions for use wherein the method is conducted by obtaining a preparation comprising said transcriptional units comprising nascent RNA strands attached thereto from said cell under conditions sufficient to temporarily inhibit or substantially reduce continued transcription and then placing said transcriptional units under conditions to permit transcription in the presence of labeled ribonucleotides to thereby provide a population of transcripts including nascent transcripts comprising one or more of said labeled ribonucleotides and subjecting said population of transcripts including nascent RNA molecules to isolation and purification means via binding of a BrU label on the RNA transcripts to immobilized anti- BrU antibodies to generate a purified population of transcripts and simultaneously or sequentially subjecting said population of transcripts including nascent RNA molecules comprising one or more labeled ribonucleotides to detection and optionally including amplification means to measure the appearance of a detectable product wherein the rate of appearance of product is proportional to the amount of transcript including nascent RNA molecules associated with a particular transcriptional unit isolated from said cell which in turn determines the transcriptional activity of said transcriptional unit or plurality of transcriptional units.

Molecules other than anti-BrU antibodies that are capable of binding BrU include but are not limited to in vitro evolved molecules such as in vitro evolved DNA and RNA molecules. Examples of molecules capable of binding BrU other than antibodies include BrU-binding aptamer molecules such as RNA and DNA aptamer molecules. Such molecules are well known in the art. The BrU-binding molecule may be covalently linked to the solid matrix, or may interact with it via electrostatic interaction. In this embodiment,

the nascent transcript comprising a BrU-labeled nucleotide can be bound to the surface of a solid matrix that is coated with in vitro evolved RNA or DNA aptamer molecules. As well as RNA and DNA molecules that bind BrU, proteins other than anti-BrU antibodies are contemplated by the present invention.

Preferably, the solid matrix used in the methods of the invention permits the sequential application of reagents to a reaction molecule without complicated and time-consuming purification steps :-- In this method, the opposite end of each nucleic acid segment is shared between each of the initial template precursors for a given nucleic acid segment to be detected or analyzed.

Each initial template precursor is attached to a solid matrix. A wide range of methods have been used to bind DNA to a solid matrix. If the template precursor is a PCR product, one primer can contain a moiety that is used to attach the PCR product to a solid matrix. For example, this primer can contain a biotin moiety or another reactive moiety such as an amine group or thiol group, permitting the attachment of the PCR product to a solid matrix (Syvanen et al. Nucleic Acids Research 16 : 11327-11338, 1988 ; Stamm and Brosius, Nucleic Acids Research 19 : 1350, 1991; Lund et al., Nucleic Acid Research 16 : 10861- 10880, 1988 ; Fahy et al., Nucleic Acids Research 21 : 1819-1826, 1993; Kohsaka et al., Nucleic Acids Research 21 : 3469-3472, 1993). The solid matrix can be either immobile or dispersible. For example, for a DNA segment with a biotinylated end, an immobile solid matrix can be an avidin or streptavidin coated microtiter plate (Jeltsch et al., Analytical Biochemistry 209 : 278-283, 1993; Holmstrom et al., AnaL Biochem. 2092) : 278-283, 1993) or manifold support (Lagerkvist et al., Proc. Natl. Acad. Sci, USA 91 : 2245-2249, 1994). The most readily available dispersible solid matrix is beads that can be suspended through shaking. Beads can be designed to be magnetically pelleted (Lund et aL, 1988, supra ; Hultman et al., Nucleic Acids Research 17 : 4937-4946, 1989; Dawson et al., Journal of Biological Chemistry 264 : 12830-12837, 1989) or they can be pelleted through centrifugation (Syvanen et al., 1988, supra ; Stamm and Brosius, 1991, supra). Use of a dispersible solid matrix diminishes steric obstacles in enzymatic reactions, and facilitates removal of a small aliquot to be amplified. An alternative approach that allows a small

aliquot of a reaction to be removed and used as a template for amplification is to use a method of reversible capture. Reversible capture can be accomplished by using a cleavable linkage arm (such as a chemically cleavable linkage arm or a photocleavable linkage arm (Dawson et al."1989, supra ; Olejnik et al., Nucleic Acids Research 24 : 361-366, 1996), by using a primer-encoded DNA binding domain that can be unbound by denaturation (Lew and Kemp, Nucleic Acids Research 17 : 5859, 1989 ; Kemp et al., Proc. Natl. Acad.

Sci. USA 86 : 2423-2427,1989), or by the generation of a single stranded end during PCR, as such an end can reversibly anneal to its complement that is bound to a solid phase (Khudyakov etal., NucleicAcidsRes. 22 (7) : 1320-1321, 1994).

In a particularly preferred embodiment, the kit further comprises an internal control in the form of either or both of an internal positive control and an internal negative control.

Particularly useful controls are exons, introns and 3'and 5'untranslated regions of genes.

The present invention is further described by the following non-limiting Examples.

To demonstrate the utility of the technique, a number of mammalian cell lines were transfected with different plasmid constructs capable of expressing specific mRNAs. The cell lines were then cultured in selectable growth media until stable clones could be isolated. These transgenic cell lines were then grown and used to demonstrate the utility of the technique. Furthermore, in most cases, three transcripts were targeted: (i) the mRNA of a transgene, (ii) the mRNA of the endogenous gene from which the transgene was derived, and (iii) the mRNA of an endogenous'housekeeping'gene. The housekeeping gene was detected as a duplex real-time PCR reaction in combination with the transgene and the endogenous gene, both as the product of a nuclear run-on and from total polyadenylated mRNA. Duplex reactions allow for quantitative, across-sample comparisons.

EXAMPLE 1 Cell lines, transfection and growth conditions Details of the plasmids referred to below are described in International Patent Application Nos. PCT/AU99/00195 and PCT/AU01/00297. Transgenic and parental cell lines were maintained in a range of tissue culture vessels; however, nuclear run-on experiments were routinely performed from T75 vessels. The protocol was then optimized for six-well plates.

EXAMPLE 2 Porcine kidney cells-type PK-1 Transformations were performed in 6-well tissue culture vessels (Nunc). Individual wells were seeded with 1 x 105 PK-1 cells in 2 mL of Dulbecco's Modified Eagle's Medium (DMEM) (GibcoBRL), 10% v/v fetal bovine serum (FBS) (GibcoBRL) and incubated at 37°C, 5% v/v C02 until the monolayer was 60-90% confluent, typically 16-24 hours.

To transform a single plate (6 wells), 12 gg of plasmid DNA (pCMV. EGFP) and 108 uL of GenePORTER 2 (trademark) (Gene Therapy Systems) were diluted into OPTI-MEM I (trademark) reduced serum medium (GibcoBRL) to obtain a final volume of 6 mL and incubated at room temperature for 45 minutes.

The tissue growth medium was removed from each well and the monolayer therein was washed with 1 mL of 1 x phosphate buffer saline (PBS) (Sigma) and the supernatant removed. The monolayers were overlaid with 1 mL of the plasmid DNA/GenePORTER mix for each well and incubated at 37°C, 5% v/v C02 for 4.5 hours.

1 mL of OPTE-ME I supplemented with 20% v/v FBS was added to each well and the vessel incubated for a further 24 hours, at which time the monolayers were washed with 1 x PBS and media was replaced with 2 mL of fresh DMEM including 10% v/v FBS.

Forty-eight hours after transfection, the medium was removed, the cell monolayers were washed with 1 x PBS as above and 4 mL of fresh DMEM containing 10% v/v FBS supplemented with 1.5 mg/mL geneticin (registered trademark) (GibcoBRL) was added to each well. Geneticin was included in the medium to select for stably transformed cell lines.

The DMEM, 10% v/v FBS, 1.5 mg/1 geneticin medium was changed every 48-72 hours.

Cells transformed with the transfection control pCMV. EGFP were examined after 24-48 hours for transient Enhanced Green Fluorescent Protein (EGFP) expression using fluorescence microscopy at a wavelength of 500-550 nm.

EXAMPLE 3 Madin-Darby kidney cells-Type CRIB-1 Transformations were performed in six-well tissue culture vessels. Individual wells were seeded with 2 x 105 CRIB-1 cells in 2 mL of DMEM, 10% v/v donor calf serum (DCS) (Gibco BRL) and incubated at 37°C, 5% v/v CO2 until the monolayer was 60-90% confluent, typically 16-24 hours.

The following solutions were prepared in 10 mL sterile tubes:- Solution A : For each transfection, 1 llg of plasmid DNA (pCMV. BEV2. BGI2. 2VEB, pCMV. BEV2. GFP. 2VEB, pCMV. EGFP) was diluted with 100 fiL of OPTI- MEM I ; and Solution B : For each transfection, 10 pl of LIPOFECTAMINE (trademark) reagent (GibcoBRL) was diluted with 100 uL ofOm-MEM I.

The two solutions were combined, mixed gently and incubated at room temperature for 45 minutes to allow DNA-liposome complexes to form. While the complexes formed, the CRIB-1 cells were rinsed once with 2 mL of OPTI-MEM I.

For each transfection, 0.8 mL of OPTI-MEM I was added to the tube containing the complexes. After gentle mixing, the diluted complex solution was overlaid onto the rinsed CRIB-1 cells. The cells were incubated with the complexes at 37°C, 5% v/v CO2 for 16-24 hours.

The transfection mixture was removed and the CRIB-1 monolayer was overlaid with 2 mL of DMEM, 10% w/v DCS. The cells were incubated at 37°C and 5% v/v C02 for approximately 48 hours. To select for stable transformants, the medium was replaced every 72 hours with 4 mL of DMEM, 10% w/v DCS, 0.6 mg/mL geneticin. Cells transformed with the transfection control pCMV. EGFP were examined after 24-48 hours for transient EGFP expression using fluorescence microscopy at a wavelength of 500-550 nm. After 21 days of selection, transgenically stable CRIB-1 colonies were apparent.

EXAMPLE 4 Murine cells-melanoma type B16 and tratisformedfibroblasts NIHl3T3 Transformations were performed in six-well tissue culture vessels. Individual wells were seeded with 1 x 105 cells in 2 mL of DMEM, 10% v/v FCS and incubated at 37°C, 5% v/v C02 until the monolayer was 60-90% confluent, typically 16-24 hours.

The following solutions were prepared in 10 mL sterile tubes:- Solution A : For each transfection, 1, ug of plasmid DNA (pCMV. EGFP, pCMV. TYR. BGI2. RYT) was diluted with 100 uL of OPTI-MEM I ; and Solution B : For each transfection, 10 µL of LIPOFECTAMINE reagent was diluted with 100 1L of OPTI MEM I.

The two solutions were combined, mixed gently and incubated at room temperature for 45 minutes to allow DNA-liposome complexes to form. While complexes were forming, the cells were rinsed once with 2 mL of OPTI-MEM I.

For each transfection, 0.8 mL of OPTI-MEM I was added to the tube containing the complexes. These were mixed gently and the diluted complex solution was overlaid onto the rinsed cell monolayer. The cells were incubated with the complexes at 37°C, 5% v/v C02 for 3-4 hours.

Transfection mixture was removed and the monolayer was overlaid with 2 mL of DMEM, 10% w/v-FCS The cells were incubated at 37°C, 5% v/v C02 for approximately 48 hours.

To select for stable transformants, the medium was replaced every 72 hours with 4 mL of DMEM, 10% w/v FCS, 1.0 mg/mL geneticin. Cells transformed with the transfection control pCMV. EGFP were examined after 24-48 hours for transient EGFP expression using fluorescence microscopy at a wavelength of 500-550 nm. After 21 days of selection, transgenically stable NIH/3T3 or B16 colonies were apparent.

EXAMPLE 5 Human cells-melanoma type MM96L and breast cancer type MDA-MB-468 Transformations were performed in six-well tissue culture vessels. Individual wells were seeded with 1 x 105 cells (MM96L) or 4 x 105 cells (MDA-MB-468) in 2 mL of RPMI 1640 medium (GibcoBRL), 10% v/v w/v FCS and incubated at 37°C, 5% v/v COx until the monolayer was 60-90% confluent, typically 16-24 hours.

The following solutions were prepared in 10 mL sterile tubes:- Solution A : For each transfection, 1 pg of plasmid DNA (pCMV. EGFP, pCMV. BRN2. BGI2. 2RNB, pCMV. HER2. BGI2. 2REH) was diluted with 100 . L of OPTT-MEM I ; and Solution B : For each transfection, 10 uL of LIPOFECTAMINE reagent was diluted with 100 pL OPTI-MEM I.

The two solutions were combined, mixed gently and incubated at room temperature for 45 minutes to allow DNA-liposome complexes to form. While the complexes were forming, the cells were rinsed once with 2 mL of OPTI-MEM I.

For each transfection, 0.8 mL of OPTI-MEM I was added to the tube containing the complexes. After gentle mixing the diluted complex solution was overlaid onto the rinsed cell monolayer. The cells were incubated with the complexes at 37°C, 5% v/v C02 for 3-4 hours.

The transfection mixture was removed and the monolayer was overlaid with 2 mL of RPMI 1640,10% w/v FCS. The cells were incubated at 37°C, 5% v/v C02 for approximately 48 hours. To select for stable transformants, the medium was replaced every 72 hours with 4 mL of RPMI 1640,10% w/v FCS and 0.6 mg/mL geneticin. Cells transformed with the transfection control pCMV. EGFP were examined after 24-48 hours for transient EGFP expression using fluorescence microscopy at a wavelength of 500-550 nm. After 21 days of selection, transgenically stable MM96L or MDA-MB-468 colonies were apparent.

The two methods outlined in Examples 6 and 7 represent examples of methods for the preparation of large numbers of nuclei.

EXAMPLE 6 Nuclei preparation for adheret cell types from a T75 tissue culture vessel A T75 tissue culture vessel (Nunc) containing 30 mL of growth medium (e. g. DMEM or RPMI 1640, including 10% v/v FBS) was seeded with 4 x 106 cells and incubated at 37°C, 5% v/v C02 until the monolayer was 90% confluent (overnight). The monolayer was chilled by placing the T75 on a bed of ice. The medium was decanted and 8 mL of ice-cold PBS was added to the T75. The tissue monolayer was washed by gently rocking the T75.

The PBS was decanted and washing of the tissue monolayer with lx PBS was repeated.

Lastly, the PBS was decanted.

The tissue monolayer was overlaid with 4 mL of ice-cold Sucrose Buffer 1 and cells were incubated on ice for 2 minutes to lyse. Adherent cells were dislodged using a cell scraper.

A small aliquot of cells was examined by phase contrast microscopy. If the cells had not lysed, they were transferred to an ice-cold Dounce homogenizer (Braun) and the cells were broken apart with 5-10 strokes of a type S pestle; additional strokes were sometimes required. Microscopic examination showed if the nuclei were free of cytoplasmic debris.

A volume of 4 mL of ice-cold sucrose buffer 2 was added to the T75 and the buffers mixed by gentle stirring with the cell scraper.

A volume of 4. 4 mL of ice-cold Sucrose Buffer 2 was added to a polyallomer SW41 tube (9/16 x 3 inch, Beckman) for the SW41 rotor. Sucrose Buffer 2 serves as a'cushion' ; unlysed cells do not sediment through the sucrose cushion. If these conditions did not result in a nuclear pellet, the concentration of sucrose in Sucrose Buffer 2 was adjusted.

The nuclei-containing sucrose buffer was carefully layered onto the sucrose cushion. Ice- cold Sucrose Buffer 1 was used to top off the gradient. No more than 2 x 108 nuclei per tube were centrifuged.

The tube was centrifuged for 45 minutes at 4°C and 30,000 x g (13,300 rpm in SW41 rotor). Supernatant was aspirated away from the nuclei pellet before the tube was returned to the ice bucket. The nuclei generally formed a tight pellet at the bottom of the tube but sometimes debris was caught at the interface between Sucrose Buffers 1 and 2. Nuclei would not pellet if the cells were not lysed during Dounce homogenization. It is important that the majority of the cells are clearly lysed. If the pellet appeared as a gelatinous mass, nuclei had lysed and the pellet was discarded.

The nuclear pellet was loosened by gently vortexing for 5 seconds. A volume of 200 uL of ice-cold glycerol storage buffer per 5 x 107 nuclei was added and nuclei were suspended by trituration. Nuclei were clumped at first but dispersed with continued trituration.

Trituration was done with care to avoid creating air bubbles. An aliquot of 100 I1L (approx 2.5 x 107 nuclei) was transferred into chilled 2 mL microfuge tubes (Eppendorf). The

addition of 40 units of an RNAse inhibitor (e. g. Rnasin, Promega) is beneficial to protect the RNA. The tubes were immediately placed in dry ice. Frozen nuclei were stored at- 70°C or in liquid nitrogen. Frozen nuclei were stable for at least 1 year.

EXAMPLE 7 Improvement to the method of Exasnple 6 A T75 tissue culture vessel containing 30 mL of growth medium (e. g : DMEM-or-RPMI 1640, including 10% v/v FBS) was seeded with sufficient cells (e. g. 107 cells) to grow a 90% confluent monolayer overnight and incubated at 37°C, 5% v/v C02. Before processing, the monolayer was chilled by placing the T75 on a bed of ice. The medium was decanted and 8 mL of ice-cold PBS was added to the T75. The tissue monolayer was washed by gently rocking the T75. The PBS was decanted and washing of the tissue monolayer was repeated with lx PBS. Lastly, the PBS was decanted.

The tissue monolayer was overlaid with 4 mL of ice-cold Sucrose Buffer 1 and the cells were incubated on ice for 2 minutes to lyse. Adherent cells were dislodged using a cell scraper. A small aliquot of cells was examined by phase-contrast microscopy. If the cells had not lysed, they were transferred to an ice-cold Dounce homogenizer (Braun). The cells were broken apart with 5-10 strokes of a type S pestle; additional strokes were sometimes required. Microscopic examination showed if the nuclei were free from cytoplasmic debris.

A volume of 4 mL of ice-cold Sucrose Buffer 2 was added to the T75 and the buffers were mixed by gentle stirring with the cell scraper.

A volume of 4.4 mL ice-cold Sucrose Buffer 2 was added to a polyallomer SW41 tube (9/16 x 3 inch, Beckman) for the SW41 rotor. Sucrose Buffer 2 serves as a'cushion' ; unlysed cells do not sediment through the sucrose cushion. The molarity of sucrose in Sucrose Buffer 2 was adjusted to allow only a clean nuclei pellet to be isolated. The nuclei- containing sucrose buffer was carefully layered onto the sucrose cushion and ice-cold Sucrose Buffer 1 was used to top off the gradient. No more than 2 x 108 nuclei per tube were centrifuged.

The tube was centrifuged for 45 minutes at 4°C and 30,000 x g (13,300 rpm in SW41 rotor). Supernatant was aspirated away from the nuclei pellet before the tube was returned to the ice bucket. Nuclei formed a tight pellet at the bottom of the tube but there may be some debris caught at the interface between Sucrose Buffers 1 and 2. Nuclei would not pellet if the cells were not lysed during Dounce homogenization. It was important that the majority of the cells were clearly lysed. If the pellet appeared as a gelatinous mass, nuclei had lysed and the pellet was discarded.

Ice-cold Glycerol Storage Buffer was added to the nuclei at a rate of 100 RL per 107 cells processed, then nuclei were suspended by trituration. Nuclei were clumped at first but dispersed with continued trituration. Trituration should be steady but should not create air bubbles. Aliquots of 100 gL were pipetted into chilled 2 mL microfuge tubes (Eppendorf).

The addition of 40 units of an RNAse inhibitor (e. g. Rnasin, Promega) was beneficial to protect the RNA. The tubes were placed in dry ice immediately. Frozen nuclei were stored at-70°C or in liquid nitrogen. Frozen nuclei were stable for at least 1 year.

EXAMPLE 8 Nucleipreparation of non-adlierelit cell typesfrom a T75 tissue culture vessel A T75 tissue culture vessel containing 30 mL of growth medium (DMEM or RPMI 1640, including 10% v/v FBS) was seeded with 4 x 106 cells and incubated at 37°C, 5% v/v C02 overnight.

The contents of the T75 were transferred to a 50 mL screw-capped tube (Falcon) and the tube was placed on ice to chill before processing. The tube was centrifuged for 5 minutes at 500 x g and 4°C to pellet the cells. The medium was decanted and 10 mL of ice-cold 1 x PBS was added to the tube. The cells were suspended by gentle trituration. The PBS was decanted and washing of the cells with 1 x PBS repeated. Lastly, the PBS was decanted.

The cells were suspended in 4 mL of ice-cold Sucrose Buffer 1 and incubated on ice for 2 minutes to lyse. A small aliquot of cells was examined by phase-contrast microscopy. If the cells had not lysed, they were transferred to an ice-cold Dounce homogenizer. The cells were broken apart with 5-10 strokes of a type S pestle and then returned to the tube.

Sometimes additional strokes were required. A small aliquot of cells was microscopically examined to see if the nuclei were free of cytoplasmic debris.

A volume of 4 mL of ice-cold sucrose buffer 2 was added to the tube and the buffers were mixed by gentle trituration. The final concentration of sucrose in cell homogenates should be sufficient to prevent a large build up of debris at the interface between homogenate and the sucrose cushion. The amount of sucrose buffer 2 added to cell homogenate was adjusted accordingly.

A volume of 4.4 mL of ice-cold Sucrose Buffer 2 was added to a polyallomer SW41 tube (9/16 x 3 inch, Beckman) for the SW41 rotor. Sucrose Buffer 2 serves as a'cushion'; unlysed cells will not sediment through the sucrose cushion. When these conditions did not result in a nuclear pellet, the concentration of sucrose in Sucrose Buffer 2 was adjusted.

The nuclei-containing sucrose buffer was carefully layered onto the sucrose cushion. Ice- cold Sucrose Buffer 1 was used to top off the gradient. No more than 2 x 10S nuclei were centrifuged per tube. The tube was centrifuged for 45 minutes at 30, 000 x g (13,300 rpm in SW41 rotor) at 4°C. The supernatant was aspirated away from the nuclei pellet and the tube was returned to the ice bucket. Nuclei formed a tight pellet at the bottom of the tube, but occasionally some debris was caught at the interface between Sucrose Buffers 1 and 2.

It was important to be sure that the majority of the cells were clearly lysed. If the pellet appeared as a gelatinous mass, nuclei had lysed and the pellet was discarded.

The nuclear pellet was loosened by gentle vortexing for 5 seconds. A volume of 100 JIL of ice-cold Glycerol Storage Buffer was added per 5 x 107 nuclei and nuclei were suspended by trituration. Nuclei were clumped at first but dispersed with continued trituration.

Trituration should be steady but should not create air bubbles.

Aliquots of 100 gL (approx 1-2.5 x 107 nuclei) were pipetted into chilled 2 mL microcfuge tubes. The addition of 40 units of an RNAse inhibitor was beneficial to protect the RNA.

The tubes were placed on dry ice immediately and then stored at-70°C or in liquid nitrogen. Frozen nuclei were stable for at least 1 year.

EXAMPLE 9 Improvement to the method of Example 8 A T75 tissue culture vessel containing 30 mL of growth medium (DMEM or RPMI 1640, including 10% v/v FBS) was seeded with sufficient cells to grow about 107 cells overnight and incubated at 37°C, 5% v/v CO2.

The contents of the T75 were transferred to a 50 mL screw-capped tube (Falcon) and the tube was placed on ice to chill before processing. The tube was centrifuged for 5 minutes at 500 x g and 4°C to pellet cells. The medium was decanted and 10 mL of ice-cold 1 x PBS was added to the tube. The cells were suspended by gentle trituration. The tube was centrifuged for 5 minutes at 500 x g and 4°C to pellet the cells. The PBS was decanted and washing of the cells with 1 x PBS was repeated. Lastly, the PBS was decanted.

The cells were suspended in 4 mL of ice-cold Sucrose Buffer 1 and incubated on ice for 2 minutes to lyse. A small aliquot of cells was examined by phase-contrast microscopy. If the cells had not lysed, they were transferred to an ice-cold Dounce homogenizer. The cells were broken apart with 5-10 strokes of a type S pestle and returned to the tube; sometimes additional strokes were required. A small aliquot was examined microscopically to see if the nuclei were free of cytoplasmic debris.

A volume of 4 mL of ice-cold sucrose buffer 2 was added to the tube and the buffers were mixed by gentle trituration. The final concentration of sucrose in cell homogenate was sufficient to prevent a large build up of debris at the interface between homogenate and the sucrose cushion..

A volume of 4.4 mL ice-cold Sucrose Buffer 2 was added to a polyallomer SW41 tube (9/16 x 3 inch, Beckman) for the SW41 rotor. Sucrose Buffer 2 served as a'cushion' ; any unlysed cells do not sediment through the sucrose cushion. The molarity of sucrose in Sucrose Buffer 2 was adjusted to allow isolation of a clean nuclei pellet.

The nuclei-containing sucrose buffer was carefully layered onto the sucrose cushion and ice-cold Sucrose Buffer 1 was used to top off the gradient. No more than 2 x 108 nuclei per tube were centrifuged. The gradient was centrifuged for 45 minutes at 30,000 x g (13,300 rpm in SW41 rotor) and 4°C. The supernatant was aspirated away from the nuclei pellet and the tube was returned to the ice bucket. Nuclei formed a tight pellet at the bottom of the tube, but occasionally there was some debris caught at the interface between Sucrose Buffers 1 and 2. Nuclei do not pellet if the cells have not lysed during Dounce homogenization. It was important to be sure that the majority of the cells were clearly lysed. If the pellet appeared as a gelatinous mass, nuclei had lysed and the pellet was discarded.

Ice-cold Glycerol Storage Buffer was added to the nuclei at a rate of 100 L per 107 cells processed and nuclei were suspended by trituration. Nuclei were clumped at first but dispersed with continued trituration. Trituration should be steady but should not create air bubbles.

Aliquots of 100 llL were pipetted into chilled 2 mL microfuge tubes (Eppendor (). The addition of 40 units of an RNAse inhibitor was beneficial to protect the RNA. Tubes were I placed immediately in dry ice. Frozen nuclei were stored at-70°C or in liquid nitrogen.

Frozen nuclei were stable for at least 1 year.

EXAMPLE 10 Nuclei Isolation Buffers Glycerol Storage Buffer : 40% v/v glycerol (Univar) 4% RNAsecure (Ambion) (optional) 50 mM Tris-Cl, pH 8.3 (ICN Biomedicals, Inc) 5 mM-magnesium chloride (BDH) 0.1 mM Ethylenediamine tetraacetic acid (EDTA, Univar) 4 mM phenylmethylsulfonyl fluoride (PMSF, Sigma) from 0.1 M stock in isopropanol Sucrose buffer 1 : The molarity of sucrose required to differentially sediment nuclei was determined empirically for each cell type. The molarity should be sufficient to cause cell debris to remain in suspension whilst nuclei sediment. A layer of cell debris at the buffer-interface will interfere with the proper sedimentation of the nuclei; 0.32 M sucrose works well for most cell types.

0.32 M sucrose (Sigma) 0.1 mM EDTA (Univar) 0.5% Igepal CA-630 (Sigma) 1.0 mM 1,4-Dithiothreitol (DTT, Roche) 10 mM Tris-Cl, pH 8.0 0.1 mM PMSF from 0.1 M stock in isopropanol 1 mM Ethylene glycol-bis [ß-aminoethyl ether] N, N, N'N'-tetraacetic acid (EGTA, Sigma) 1 mM Spermidine (Sigma) Igepal and DTT were added to the buffer just before use, from 1 M stock solutions.

Sucrose Buffer 2 : The molarity of sucrose required to differentially sediment nuclei was determined empirically for each cell type. 1.7 M sucrose works well for most cell types; however, typically the correct molarity occurs in the range of 1.5-2. 2 M sucrose.

1.7 M sucrose 5.0 mM magnesium acetate (Sigma) 0. 1 mM EDTA 1 mM DTT 10 mM Tris-Cl, pH 8. 0 0.1 mM PMSF from 0.1 M stock in isopropanol DTT was added to the buffer just before use, from 1 M stock solution.

EXAMPLE 11 Kit This kit comprises the necessary components for the preparation of a suitable eukaryotic, prokaryotic or virus RNA template from mammalian cells for quantitative real-time PCR.

The kit includes a method for isolation of nuclei from cells grown in a six-well tissue culture plate as either adherent or non-adherent cells. Typically, a confluent well contains approximately 106 cells.

Empirical Determination of the Cell Lysis and Nuclei Wash buffers fo Adlzerent Cell Types The kit includes two sets of solutions (solution A and B; solution C and D) that, when combined in appropriate ratio, form the cell lysis buffer and nuclei wash buffer, respectively. This ratio must be empirically determined only for solutions A and B. The ratio of solutions C and D is the same as that used for solutions A and B.

Two six-well tissue culture plates containing 2 mL of growth medium (e. g. DMEM or RPMI 1640, including 10% v/v FBS) were seeded with 4 x 105 cells and incubated at 37°C and 5% v/v C02 until the monolayer was 90% confluent, generally overnight. The growth medium and cell-seeding rate depended on the cell type grown It was preferred that each well contained 106 cells for processing.

On the following day, aliquots of the cell lysis buffer were prepared as described below. Eleven microfuge tubes were numbered 1 to 11 and into each tube was pipetted an aliquot of the amount of solution A and B as set out in the table below. u-b"e N' f31 v 7i. : ;. y, 1 it I 7 1 0 gel 1000 gL 100FL 900ML 3 200PL 800 FL 300 FL 700ML 400ML 600PL 500RL 500RL 600FL 400PL 8 700FL 300ZL 9800 L200 L 10 900 FL 100ZL 11 1000PL 0 FL

The monolayer of cells was chilled by placing the plates on a bed of ice. The medium was aspirated away and 2 mL of ice-cold 1 x PBS was added to each well. The tissue monolayer was washed by gently rocking the plate. The PBS was aspirated away and washing of the tissue monolayer with 1 x PBS was repeated. Lastly, the PBS was aspirated away.

The tissue monolayer in each of 11 wells was overlaid with 1 mL of the prepared ice-cold cell lysis buffers (microfuge tubes 1 to 11). A twelfth well was overlaid with PBS. The

cells in the twelfth well were used as a representative sample of unlysed cells for comparison with lysed cells. Cells were incubated on ice for 2 minutes to lyse. A cell scraper was used to dislodge the cells and to assist with cell lysis. A small aliquot of cells was examined by phase-contrast microscopy. If the cells had not lysed, the individual wells of cell lysate were transferred to an ice-cold Dounce homogenizer (Braun) and the cells broken apart with 5-10 strokes of a type S pestle; sometimes additional strokes were required. Nuclei were examined microscopically to see if the nuclei were free of cytoplasmic debris. The cell lysate was then transferred to individual ice-cold 2 mL microfuge tubes and centrifuged for 15 minutes at 4°C and 2,500 x g. The lysis buffers (numbered 1 to 11) increase in density. A nuclei/cell debris pellet was apparent in tube number 1 and was absent in tube number 11. The tube containing the largest pellet of relatively clean, intact, nuclei represented the most suitable ratio of solutions (A and B; C and D) for the specific cell type evaluated.

Solution A 1.7 M sucrose 5.0 mM magnesium acetate 0. 1 mM EDTA 0.5% Igepal CA-630 1 mM DTT 10 mM Tris-Cl, pH 8.0 0.1 mM PMSF from 0.1 M stock in isopropanol

Solution B 0.32 M sucrose 0. 1 mM EDTA 0.5% Igepal CA-630 1. 0 mM DTT 10 mM Tris-Cl, pH 8. 0 0.1 mM PMSF from 0.1 M stock in isopropanol I mM EGTA 1 mM Spermidine Solution C 1.7 M sucrose 5.0 mM magnesium acetate 0. 1 mM EDTA 1 mM DTT 10 mM Tris-Cl, pH 8. 0 0.1 mM PMSF from 0.1 M stock in isopropanol Solution D 0.32 M sucrose 0. 1 mM EDTA 1. 0 mM DTT 10 mM Tris-Cl, pH 8. 0 0.1 mM PMSF from 0.1 M stock in isopropanol 1 mM EGTA 1 mM Spermidine <BR> <BR> Empirical Determination of Cell Lysis and Nuclei Wash buffers for Non-adherent Cell Types The kit includes two sets of solutions (solution A and B; solution C and D), that when combined in appropriate ratios, form the cell lysis buffer and nuclei wash buffer,

respectively. This ratio must be empirically determined only for solutions A and B for the cell lysis buffer. The ratio of solutions C and D is the same as that used for solutions A and B.

Two six-well tissue culture plates containing 2 mL of growth media (e. g. DMEM or RPMI 1640, including 10% v/v FBS) were seeded with 4 x 105 cells and incubated at 37°C and 5% v/v C02 overnight. The growth medium and cell-seeding rate depended on the cell type grown.. It was preferred that each well contained 106 cells for processing.

The following day, aliquots of the cell lysis buffer were prepared as described in Example 11. Twelve 2 mL microfuge tubes were numbered 1 to 12 and the contents of each well was transferred to one of the 12 numbered microfuge tubes. The tubes were placed on ice and allowed to chill before further processing. The tubes were centrifuged for 5 minutes at 4°C and 500 x g to pellet cells. The medium was aspirated away and 1.5 mL of ice-cold 1 x PBS was added to each tube. The cells were suspended by gentle trituration. The tubes were centrifuged for 5 minutes at 4°C and 500 x g to pellet cells. The PBS was aspirated away and washing of the cells with 1 x PBS was repeated. Lastly, the PBS was aspirated away.

The cell pellets in tubes 1 to 11 were overlaid with 1 mL of the appropriate ice-cold cell lysis buffers. The pellet in the twelfth tube was overlaid with PBS. The cells in the twelfth tube were used as a representative sample of unlysed cells for comparison with lysed cells. Cells were incubated on ice for 2 minutes to lyse. Gentle trituration resuspended the cells and assisted with cell lysis. A small aliquot of cells was examined by phase-contrast microscopy. If the cells had not lysed, they were transferred to an ice-cold Dounce homogenizer (Braun) and broken apart with 5-10 strokes of a type S pestle; sometimes additional strokes were required. The cell lysates were returned to their respective tubes and the tubes were centrifuged for 15 minutes at 4°C and 2,500 x g. The cell lysis buffers (numbered 1 to 11) increase in density. A nuclei/cell debris pellet was apparent in tube number 1 and was absent in tube number 11. The tube that yielded the greatest number of

relatively clean, intact nuclei represented the ratio of Buffers A and B, and Buffers C and D that was most suitable for the specific cell type evaluated.

EXAMPLE 12 Nuclei preparatiofa of adlzerent cell types frofn a six-well tissue culture plate Each well of a six-well tissue culture plate containing 2 mL of growth medium (e. g.

DMEM or RPMI 1640, including 10% v/v FBS) was seeded with 4-x 105 cells-and incubated at 37°C and 5% v/v C02 until the monolayer was 90% confluent, usually overnight. The growth medium and cell-seeding rate depended on the cell type grown. It was preferred that each well contained 106 cells for processing.

The tissue monolayer was chilled by placing the plate on a bed of ice. The medium was aspirated away and 2 mL of ice-cold lx PBS was added to each well. The tissue monolayer was washed by gently rocking the plate. The PBS was aspirated away and washing of the tissue monolayer with 1 x PBS was repeated. Lastly, the PBS was aspirated away.

The tissue monolayer in each well was overlaid with 1 mL of the appropriate ice-cold cell lysis buffer (as determined empirically) and cells were incubated on ice for 2 minutes to lyse. A cell scraper was used to dislodge the cells and assist with cell lysis. A small aliquot of cells was examined by phase-contrast microscopy. If the cells had not lysed, individual samples were transferred to an ice-cold Dounce homogenizer (Braun) and the cells were broken apart with 5-10 strokes of a type S pestle; additional strokes were sometimes required. Microscopic examination determined if the nuclei were free of cytoplasmic debris. The cell lysate for each sample was transferred to individual ice-cold 2 mL centrifuge tubes and the tubes were centrifuged for 15 minutes at 4°C and 2,500 x g. The supernatant was aspirated away. A volume of 1 mL of the appropriate ice-cold wash buffer (as determined empirically) was added to each tube and the nuclei were resuspended gently. The nuclei suspension was centrifuged for 15 minutes at 4°C and 2,500 x g.

Supernatant was aspirated away from the nuclei pellets. A volume of 100 I1L ice-cold glycerol storage buffer was added to each tube and the nuclei were suspended by gentle trituration. Nuclei were clumped at first but dispersed with continued trituration.

Trituration was steady but care was taken to avoid creating air bubbles. The addition of 40 units of an RNAse inhibitor was beneficial to protect the RNA. Nuclei were immediately placed in dry ice. Frozen nuclei were stored at-70°C or in liquid nitrogen. Frozen nuclei were stable for at least 1 year.

EXAMPLE 13 Nuclei preparation of non-adhereyit cell types from a six-well tissue culture plate Each well of a six-well tissue culture plate (Nunc) containing 2 mL of growth medium (e. g. DMEM or RPMI 1640, including 10% v/v FBS) was seeded with 4 x 105 cells and incubated overnight at 37°C and 5% v/v CO2. It was preferred that each well contained 106 cells for processing.

The contents of each well were transferred to individual 2 mL microfuge tubes and the tubes were placed on ice to chill before processing. The tubes were centrifuged for 5 minutes at 4°C and 500 x g to pellet cells. The medium was aspirated away and 1.5 mL of ice-cold 1 x PBS was added to each tube. The cells were resuspended by gentle trituration.

The tubes were centrifuged for 5 minutes at 4°C and 500 x g to pellet cells. The PBS was aspirated away and washing of the cells with 1 x PBS was repeated. Lastly, the PBS was aspirated away.

The cells were suspended in 1 mL of the appropriate ice-cold lysis buffer (as determined empirically) and cells were then incubated on ice for 2 minutes to lyse. The cell lysate was gently triturated to assist in disruption of the cells. A small aliquot of cells was examined by phase-contrast microscopy. If the cells had not lysed, each sample was transferred to an ice-cold Dounce homogenizer and the cells broken apart with 5-10 strokes of a type S pestle and the samples were then returned to their respective tubes. Sometimes additional

pestle strokes were required. Microscopic examination determined if the nuclei were free of cytoplasmic debris.

The cell lysate was centrifuged for 15 minutes at 4°C and 2,500 x g. The supernatant was removed. A volume of 1 mL of the appropriate ice-cold wash buffer (as determined empirically) was added and the nuclei were gently suspended. The suspended nuclei were centrifuged for 15 minutes at 4°C and 2,500 x g. The supernatant was aspirated away.

The nuclear pellet was loosened by gentle vortexing for 5 seconds. A volume of 100 ! 1L of ice-cold glycerol storage buffer was added to each tube and the nuclei were resuspended by gentle trituration. Nuclei were clumped at first but dispersed with continued trituration.

Trituration was steady but care was taken to avoid creating air bubbles.

The addition of 40 units of an RNAse inhibitor was beneficial to protect the RNA. Nuclei were immediately place in dry ice. Frozen nuclei were stored at-70°C or in liquid nitrogen.

Frozen nuclei were stable for at least 1 year.

EXAMPLE 14 Standard bioti-16-UTP run-on reaction2 To 100 u. L of nuclei (107 for T75 vessel or 106 for six-well plate) in ice-cold glycerol storage buffer was added100 liL of reaction buffer containing ribonucleoside triphosphates. The mixture was incubated for 20 minutes at 30°C with gentle shaking or slow rotation (6 rpm).

The nuclei were lysed and DNA digestion was initated by adding 20 uL of 20 mM calcium chloride (Sigma) and 10 ttL of 10 mg/mL RNAse-free DNAse I (Roche). The mixture was incubated for 30 minutes at 37°C with gentle shaking or slow rotation.

To this mixture was added 25 gel of 10 X SET and 5 uL of 10 mg/mL carrier RNA (tRNA, Roche). Peptide hydrolysis was initated by adding 2 uL of 10 mg/mL proteinase K

(Roche). The samples were incubated at 37°C for 30 minutes with gentle shaking or slow rotation.

A volume of 1 mL of Trizol (Life Technologies) reagent was added to the samples. The samples were shaken vigorously by hand for 15 seconds and further incubated at 30°C for 3-5 minutes with gentle shaking or slow rotation to denature proteins.

A volume of 200 aL of chloroform was added to the samples. The samples were shaken vigorously for 15 seconds and further incubated at 30°C for 3-5 minutes with gentle shaking or slow rotation.

The samples were centrifuged for 15 minutes at 2-8°C and 12,000 x g, then the aqueous phases were transferred to fresh microfuge tubes. Care was taken to avoid the interface between the aqueous and phenol phases.

A volume of 1 mL of isopropanol was added and the samples were mixed by inversion.

The samples were incubated at 15-30°C for 10 minutes. The samples were then centrifuged for 10 minutes at 12000 x g and 2-8°C. The supernatant was removed from the RNA pellet of each sample and 1 mL of RNAse-free 75% v/v ethanol (BDH) (diluted with Diethyl Pyrocarbonate (DEPC-treated) (Sigma) H20) was added. The pellet was briefly vortexed. The pellet broke apart but remained as small pieces.

Samples were centrifuged for 5 minutes at 7,500 x g to pellet RNA. Supernatants were removed and the pellets were lightly air-dried to remove ethanol. A volume of 20 uL of RNAse-free H20 (DEPC-treated) was added to each to dissolve the RNA pellets. The RNA pellets were stored at-70° until further processing.

2x nuclear run-on reaction buffer 100 mM Tris-Cl, pH 8. 0 50 mM KC1 (Sigma) 600 mM (NH4) 2SO4 (Sigma) 2 mM MgCl2 2 mM MnCl2. 4H20 (Sigma) 2 mM DTT 10 mM Spermidine 0. 2% N-lauroylsarcosine (Sigma) 10% v/v glycerol 4% RNAsecure 1 mM ATP (Roche) 1 mM GTP (Roche) 1 mM CTP (Roche) 150 uM UTP (Roche) 40 uM biotin-16-UTP (Roche) A 2X reaction buffer without the rNTPs but including the 4% RNAsecure was made up, incubated at 60°C for 10 minutes to inactivate RNAse A and then cooled on ice before rNTPs were added.

10x set 5% w/v sodium dodecylsulfate (Sigma) 50 mM EDTA 100 mM Tris-HCl, pH 7.4 EXAMPLE 15 Improvement to tiie method of Example 14 To 100 gL of nuclei (107 for T75 vessel or 106 for 6-well plate) in ice-cold glycerol storage buffer was added 100 p. L of reaction buffer containing ribonucleoside triphosphates. The

mixture was incubated for 20 minutes at 30°C with gentle shaking or slow rotation (6 rpm).

The nuclei were lysed and DNA digestion was initiated by adding 20 I1L of 20 mM calcium chloride (Sigma) and 10 1L of 10 mg/mL RNAse-free DNAse I (Roche). The mixture was incubated for 30 minutes at 37°C with gentle shaking or slow rotation.

A volume of 25 aL of 10 X SET and 5 uL of 10 mg/mL carrier RNA (tRNA, Roche) was added then peptide hydrolysis initiated by adding 2 pL of 10 mg/mL proteinase K (Roche).

The samples were incubated at 37°C for 30 minutes with gentle shaking or slow rotation.

Samples were placed on ice while awaiting RNA purification. RNA purification was achieved by a number of methods such as acid-phenol extraction, Trizol extraction or silica-gel-based microspin technology.

2x nuclear run-on reaction buffer 100 mM Tris-Cl, pH 8. 0 50 mM KC1 (Sigma) 600 mM (NH4) 2SO4 (Sigma) 2 mM MgC12 2 mM Minci2. 4H20 (Sigma) 2 mM DTT 10 mM Spermidine 0.2% N-lauroylsarcosine (Sigma) 20% v/v glycerol (Sigma) 200 mM Sucrose (Sigma) 20 U RNAse Inhibitor (Promega) 1 mM ATP (Roche) 1 mM GTP (Roche) 1 mM CTP (Roche) 40-120 I1M biotin-16-UTP (Roche) 10 mM Phosphocreatine (Research Organics) 100 µg/mL Phosphocreatine kinase (Sigma) EXAMPLE 16 RNA purification by acid phenol method Biotinylated RNA was extracted from the nuclei lysate by adding the following to the sample with mixing after each addition: 550 I1L solution D, 90 RL 2M sodium acetate pH 4.0, 900 J. L water-saturated phenol, 180 pL chloroform : isoamyl alcohol (49: 1). Samples were incubated on ice for at least 15 minutes.

The aqueous and phenol phases were separated by centrifugation at 12,000 x g for 15 minutes at 4°C. The aqueous layer was removed to a fresh tube, taking care to avoid the interphase. An equal volume of isopropanol was added to the aqueous phase to precipitate the RNA. The sample was stored for at least 1 hour at-70°C or overnight at-20°C.

The precipitated RNA was collected by centrifugation at 12,000 x g for 20-30 minutes at 4°C. The RNA pellet was washed twice with 70% v/v ethanol and briefly allowed to air dry. The pellet was resuspended in 300 p. L of solution D. An equal volume of isopropanol was added to the sample to precipitate the RNA. The sample was stored for at least 1 hour at-70°C or overnight at-20°C.

The pellet was washed 2-3 times with 70% v/v ethanol and dried briefly before being dissolved in 30-50 je. L of sterile, RNAse-free water. The RNA was stored at-70° until the biotinylated RNA capture step using streptavidin-coated paramagnetic beads.

Solution D 4 M guanidinium thiocyanate 25 mM sodium citrate pH 7.0 0.5% v/v N-lauroylsarcosine 0.1 M 2-mercaptoethanol (Sigma) EXAMPLE 17 RNA purification by Trizol metAzod A volume of 1 mL of Trizol (Life Technologies) reagent was added to the nuclei lysate and the sample shaken vigorously by hand for 15 seconds. The sample was then incubated at 30°C for 3-5 minutes with gentle shaking or slow rotation to denature proteins.

A volume of 200 pL of chloroform was added to the lysate and the sample was shaken vigorously by hand for 15 seconds. The sample was then incubated at 30°C for 3-5 minutes with gentle shaking or slow rotation.

The sample was then centrifuged for 15 minutes at 2-8°C and 12,000 x g. The aqueous phase was transferred to a fresh microfuge tube. Care was taken to avoid the interface between the aqueous and Trizol phases.

A volume of 1 mL of isopropanol was added to the sample before mixing by inversion.

The sample was incubated at 15-30°C for 10 minutes and then centrifuged for 10 minutes at 12,000 x g and 2-8°C. The supernatant was removed from the RNA pellet before the addition of 1 mL of RNAse-free 75% v/v ethanol (BDH) (diluted with Diethyl Pyrocarbonate (DEPC-treated) (Sigma) H20). The pellet was vortexed briefly. The pellet broke apart but remained as small pieces.

The sample was centrifuged for 5 minutes at 7,500 x g to pellet RNA. The supernatant was removed and the pellet was lightly air-dried to remove ethanol. A volume of 20 uL of RNAse-free water (DEPC-treated) was added to dissolve the RNA pellet. The RNA pellet was stored at-70° until further processing.

EXAMPLE 18 RNA Purification by silica-gel-based microspin technology Total RNA was extracted from the cell lysate by column purification (silica-gel-based microspin technology, e. g. Qiagen, Macherey-Nagel or similar) and eluted in 35 liL of RNase-free water. The following example uses the RNeasy (registered trademark) Kit (Qiagen).

The buffers RLT and RPE were prepared according to the manufacturer's instructions.

A volume of 600 liL of buffer RLT (containing (3-mercaptoethanol) was prepared for each 100 u. L volume of nuclei lysate. The sample was mixed by trituration.

One volume of 70% v/v ethanol was added to the nuclei lysate and mixed well by trituration.

Up to 700 uL of the sample was applied, including any precipitate that may have formed, to the RNeasy mini column placed in a 2 mL collection tube (supplied). The tube was

gently closed and centrifuged for 15 seconds at ! 8, 000 x g. The flow-through was discarded. As the sample volume exceeded 700 µL, additional aliquots were loaded on to the column and centrifuged, discarding the flow-through each time. However, no more then 100 ßg of total RNA was loaded onto the column..

A volume of 700 uL of buffer RW1 was loaded on to the RNeasy column. The tube was gently closed and then centrifuged for 15 seconds at 28, 000 x g. The flow-through and collection tube were discarded. The RNeasy column was transferred into a new 2 ml collection tube (supplied).

A volume of 500 uL of buffer RPE was loaded onto the RNeasy column. The tube was gently closed and centrifuged for 15 seconds at ! 8, 000 x g. The flow-through was discarded. Another volume of 500 uL of buffer RPE was loaded on to the RNeasy column.

The tube was gently closed and centrifuged for 2 minutes at : ? : 8, 000 x g to dry the RNeasy silica-gel membrane. To ensure the column was dry the column was transferred to a new 2 mL collection tube and centrifuged for 1 minute at #8, 000 x g..

The RNeasy column was then transferred to a new 1.5 mL collection tube (supplied). A volume of 30-50 RL of RNase-free water was loaded directly onto the RNeasy silica-gel membrane. The tube was gently closed and centrifuged for 1 minute at >8, 000 x g to elute the RNA. The RNA was stored at-70° until the biotinylated RNA capture step using streptavidin-coated paramagnetic beads.

EXAMPLE 19 Purification ofbiotin-labeled RNA using the Dynal Dyiiabeads kilobaseBINDER (trademark) kit Purification of the biotin-labeled RNA uses the standard protocol for the purification of biotin-labeled nucleic acids as described in the protocol of the Dynabeads kilobaseBINDER (trademark) Kit (Dynal Product Number 601. 01).

The Dynabeads M-280 streptavidin was resuspended by shaking the vial to obtain a homogeneous suspension. A volume of 10 uL (100 g) per sample of the resuspended Dynabeads was transferred to a 1.5 mL microfuge tube. The tube was placed in a Dynal Magnetic Particle Concentrator (MPC) for 1-2 minutes or until the Dynabeads had settled on the tube wall. The supernatant was carefully removed to avoid touching the Dynabead pellet while the tube remained in the Dynal MPC.

The tube was removed from the Dynal MPC. Twice the volume of-wash solution A was added along the inside of the tube where the Dynabeads had collected. The Dynabeads were gently resuspended by pipetting, avoiding foaming. The tube was incubated at room temperature for 2-5 minutes. The tube was then placed in the Dynal MPC and the supernatant aspirated away. The Dynabeads were washed once more with wash solution A and the supernatant removed. The tube was then removed from the Dynal MPC. The beads were washed in an equal volume of wash solution B twice as described above for wash solution A. The tube was then removed from the Dynal MPC.

The Dynabeads were gently resuspended in 20 uL per sample of Binding Solution. The tube was placed in the Dynal MPC and the binding solution removed without touching the Dynabead pellet. The tube was removed from the Dynal MPC. The Dynabeads were then resuspended in 20 RL of Binding Solution per sample.

A volume of 20 uL of biotinylated RNA was added to 20 liL Dynabeads in Binding Solution and mixed carefully to avoid foaming of the mixture. The samples were incubated at room temperature (15-25°C) for 3 hours on a roller to keep the Dynabeads in suspension. The supernatant was aspirated away while the tube remained in the Dynal MPC, being careful to avoid touching the Dynabead pellet.

The Dynabeads/RNA-complex was washed twice in 40 p1L washing solution C and once in RNAse-free water or RNAse-free 10 mM Tris-Cl, pH 8. 0. The Dynabeads/RNA-complex was resuspended in 5 uL of RNAse-free water or RNAse-free 10 mM Tris-Cl, pH 8. 0 per million cells harvested, e. g. 106 cells in 5 uL and 107 cells in 50 I1L.

Wash solution A DEPC-treated 0.1 M NaOH (Sigma) DEPC-treated 0.05 M NaCl (Sigma) Wash solution B DEPC-treated 0.1 M NaCl Wash solution C RNAse-free 10 mM Tris-Cl, pH 7.5 DEPC-treated 1 mM EDTA DEPC-treated 2.0 M NaCl EXAMPLE 20 Improvement to the method of Example 19 A number of companies supply streptavidin-coated paramagnetic beads. This example demonstrates an improved method of capture of biotinylated RNA using Dynabeads M280 (Dynal).

The Dynabeads M-280 streptavidin were resuspended by shaking the vial to obtain a homogeneous suspension. A volume of 10 uL (100 ug) per sample of the resuspended Dynabeads was transferred to a 1.5 mL microfuge tube. The tube was placed in a Dynal Magnetic Particle Concentrator (MPC) for 1-2 minutes or until the Dynabeads had settled on the tube wall. The supernatant was carefully removed to avoid touching the Dynabead pellet while the tube remained in the Dynal MPC.

The tube was removed from the Dynal MPC. Twice the volume of wash solution A was added along the inside of the tube where the Dynabeads had collected. The Dynabeads were gently resuspended by pipetting, being careful to avoid foaming of the mixture. The mixture was incubated at room temperature for 2-5 minutes. The tube was placed in the

Dynal MPC and the supernatant aspirated away. The Dynabeads were washed once more with wash solution A and the supernatant aspirated away. The tube was removed from the Dynal MPC. The beads were washed in an equal volume of wash solution B twice as described above. The tube was removed from the Dynal MPC.

The Dynabeads were resuspended in 100 gL per sample of blocking solution. by pipetting, being careful to avoid foaming. The Dynabeads were incubated for 1 hour at 37°C with shaking. The tube was placed in the Dynal MPC and the blocking solution removed without touching the Dynabead pellet. The tube was removed from the Dynal MPC.

The Dynabeads were resuspended in 100, uL binding solution per sample. The biotinylated RNA sample was diluted to 100 aL RNAse-free water and 100 u. L Dynabeads in binding solution were added. The solutions were mixed carefully to avoid foaming. The samples were incubated at 37°C for 1 hour on a roller to keep the Dynabeads in suspension. The tube was placed into the Dynal MPC. The supernatant was carefully aspirated away to avoid touching the Dynabead pellet while the tube remained in the Dynal MPC.

The Dynabeads/RNA-complex was washed twice in 500 pL of 2 M NaCl and once in 500 pL RNAse-free 10 mM Tris-Cl, pH 7.4. The Dynabead pellet was resuspended in 45 p1L of RNAse-free 10 mM Tris-Cl, pH 7.4. The purified biotinylated RNA was stored at-70° until analysed by real-time PCR.

Wash solution A DEPC-treated 0.1 M NaOH (Sigma) DEPC-treated 0.05 M NaCl (Sigma) Wash solution B DEPC-treated 0.1 M NaCl

Blocking solution 500 mM sodium chloride (Sigma) 0.1% RNase-free Bovine Serum Albumin (Roche) 10 mM Tris-Cl, pH7.4 Binding solution 1 M sodium chloride 0. 2% RNase-free Bovine Serum Albumin 20 mM Tris-Cl, pH7.4 EXAMPLE 21 Preparation ofpoly (A) RNA for the establishment ofRNA standard curves dT SS RNA (oligo (dT)-purified steady state RNA, i. e. poly (A) RNA) was purified from a transgenic representative of the cell lines of interest and used for the establishment of standard curves and assay optimization.

Poly (A) RNA was purified from 10 fi total SS RNA using the Dynal Dynabeads mRNA Direct (trademark) Micro Kit (Prod # 610.21) and then eluted from the beads in a predetermined volume.

For the purpose of establishing standard curves, mRNA quantities were expressed as total RNA equivalents.

EXAMPLE 22 Preparation of DNA for the establishment of DNA standard curves Genomic DNA was purified from a transgenic representative of the cell lines of interest and used for the establishment of DNA standard curves and assay optimization. Genomic DNA was purified using a Qiagen Genomic-tip 100/G (CAT #10243) as per manufacturer's protocol.

EXAMPLE 23 Quantitative analysis of nascent RNA transcription levels by real-time PCR-target choice Purified biotin-labeled nascent RNA transcripts (Example 19) were quantitatively measured by real-time PCR using AB Applied Biosystems TaqMan PCR reporter chemistry and the Corbett Research Rotorgene 2000 real-time PCR Thermocycler and analysis instrument.

Primers and probes were designed to target coding sequence within a single contiguous exon. To exemplify the protocol, a number of gene transcript targets were chosen across a range of species. Glyceralderhyde phosphate dehydrogenase (GAPDH) and glucose-6- phosphate dehydrogenase (G6PD) were chosen as internal duplexing controls to verify the real-time PCR and to allow for across-sample comparisons of transcription rates. Duplex is a real-time PCR technique wherein two different target molecules are amplified in the same reaction tube: an internal control (GAPDH or G6PD) and the specific endogenous or transgene target. Candidate cell lines were chosen for porcine (Example 2), bovine (Example 3), murine (Example 4) and human (Example 5). The sequences of the primers and probes used in this Example are shown in Table 1.

To exemplify the protocol with respect to gene transcripts from exogenous transgenes, cells were transfected with plasmids containing the exogenous transgene placed operably under the human cytomegalovirus immediate early promoter (CMV) and terminated by the SV40 early mRNA polyadenylation signal (SV40). Stable expression clones were grown and these processed (Example 6, Example 14, Example 19) to produce biotin-labeled RNA and their respective transcription levels quantified. Three plasmid constructs were used:- (1) an inverted repeat of a segment of the bovine enterovirus RNA polymerase gene (BEV) interrupted by the human B-globin gene intron 2 (BGI2), flanked 5'by CMV and 3'by SV40 to produce the plasmid pCMV. BEV. BGI. VEB;

(2) the coding sequence of enhanced green fluorescent protein (EGFP), flanked 5'by CMV and 3'by SV40 to produce the plasmid pCMV. EGFP; and (3) an inverted repeat of a sub-region of the human HER-2 gene interrupted by the human P-globin gene intron 2 (BGI2), flanked 5'by CMV and 3'by SV40 to produce the plasmid pCMV. HER2. BGI. 2REH.

The sequences of the primers and probes used are shown in Table 2.

To exemplify the protocol with respect to gene transcripts from endogenous genes, stable expression clones were grown and these were processed (Example 6, Example 14, Example 19) to produce biotin-labeled RNA and their respective transcription levels were quantified. The endogenous targets that were chosen were the human BRN-2 and HER-2 genes and the murine tyrosinase (TYR) gene.

The sequences of the primers and probes used are shown in Table 3.

EXAMPLE 24 Quantitative analysis of nascent RNA transcription levels by real-time RT-PCR Reverse transcription of RNA : step 1 of two-step real-time RT-PCR 2. 5-5 uL of Dynabead suspension of biotin-labeled and captured nascent RNA template was added to a reverse transcriptase (RT) reaction containing the following: RT buffer mix as described in Table 4, 80 nM of each gene-specific reverse primer, AB (Applied Biosystems) multiscribe reverse transcriptase at 0.5 U/ul (Cat &num 4311235), AB RNase inhibitor at 0.4 U/, ul (Cat #N808-0119), made to a final volume of 15 gL in a 0.1 mL Corbett Research Rotorgene PCR tube.

The samples were incubated as shown in Table 5.

Quantitative PCR : step 2 of two-step real-tioze RT-PCR 35 jj. L ofPCR Mastermix was pipetted into the RT reaction, ensuring the Dynabeads were thoroughly suspended, to give a final reaction volume of 50 gel with a lx concentration of AB 2x Universal PCR Master Mix Cat #4304437 and TaqMan probes and primers as required for each example.

Amplification and quantitative detection was performed on a Corbett Research Rotorgene real-time PCR Thermocycler with the amplification protocol shown in Table 6.

EXAMPLE 25 Modified real-time RT-PCR protocol The process is modified to enable streptavidin-Dynabead-captured biotin-UTP-labeled transcripts to be cleaved or eluted off the Dynabead by incorporation of a cleavable linker between either (a) UTP and the biotin label, or (b) the Dynabead and streptavidin.

The cleavable linker is a disulfide S-S bridge that can be disrupted by DTT (dithiothreiol; Cleland's reagent) which is a reducing reagent. DTT is compatible with TaqMan chemistry up to 10 mM.

The release of the biotin UTP-labeled transcripts from streptavidin-Dynabead helps ensure a more homogenous sample and reaction conditions, as the dense Dynabeads sink rapidly and form a pellet during all steps of the process. This trait has the potential to cause inaccurate aliquoting of the sample and poor access of reverse transcriptase and PCR reagents to the nascent RNA transcripts and cDNA transcripts.

EXAMPLE 26 Results of quantitative real-time RT-PCR Analyses were performed using the Rotorgene real-time analysis software. Genes whose transcription rates have been analysed by real-time RT-PCR of biotin-labeled nuclear-run

(NRO) transcripts are identified in Table 7. Results of the analyses are shown in Figures 1 to 6 and in Table 8.

The data in Figures la and lb exemplify the establishment of a mRNA standard curve (samples Al to A8) for the parental non-transgenic human cell line MM96L. To exemplify quantitation of the template derived from a single NRO procedure, RT-positive reactions (samples D6-D8) were performed in triplicate on an NRO aliquot representative of 106 nuclei per reaction. To determine the purity of NRO captured RNA relative to DNA contamination, an RT-minus reaction (sample B4) was included.

Figures la and lb provide illustration of amplification plots of the included samples (standard curve samples and NRO samples), the standard curve used to calculate mRNA concentrations and a Table summarizing the data output from the Rotorgene instrument.

In this example, relative transcription levels of the human BRN-2 (Figure la) and GAPDH endogenous (Figure lb) genes have been determined from NRO samples. Here, BRN-2 is the target for quantification and GAPDH is the internal duplex control.

Figures 2a and 2b exemplify the establishment of a mRNA standard curve (samples Al to A8) for the parental non-transgenic murine cell line B16. To exemplify quantitation of the template derived from a single NRO procedure, RT-positive reactions (samples C2-C4) were performed in triplicate on an NRO aliquot representative of 106 nuclei per reaction.

To determine the purity of the NRO captured RNA relative to DNA contamination, an RT- minus reaction (sample B2) was included.

Figures 2a and 2b illustrate amplification plots of the included samples (standard curve samples and NRO samples), the standard curve used to calculate mRNA concentrations and a Table summarizing data output from the Rotorgene instrument.

In this example, the relative transcription level of the murine tyrosinase (Figure 2a) and GAPDH endogenous (Figure 2b) genes have been determined from NRO samples. Here,

the tyrosinase gene was the target for quantification and GAPDH was the internal duplex control.

Figures 3a and 3b exemplify the establishment of a mRNA standard curve (samples Al to A8) for the EGFP transgenic murine cell line B16. To exemplify the quantitation of the template derived from a single NRO procedure, RT-positive reactions (samples F2-F4) were performed in triplicate on an NRO aliquot representative of 106 nuclei per reaction.

To determine the purity of the NRO captured RNA relative to DNA contamination, an RT- minus reaction (sample G8) was included.

Figures 3a and 3b illustrate the amplification plot of the included samples (standard curve samples and NRO samples), the standard curve used to calculate mRNA concentrations and a Table summarizing the data output from the Rotorgene instrument.

In this example, the relative transcription level of the exogenous transgene EGFP (Figure 3a) derived from the plasmid pCMV. EGFP and the endogenous GAPDH gene (Figure 3b) have been determined from NRO samples. Here, EGFP was the target for quantification and GAPDH was the internal duplex control.

Figures 4a and 4b exemplify the establishment of a mRNA standard curve (samples Al to A8) for the EGFP transgenic human cell line MM96L. To exemplify the quantitation of the template derived from a single NRO procedure, RT-positive reactions (samples E7-F1) were performed in triplicate on an NRO aliquot representative of 106 nuclei per reaction.

To determine the purity of the NRO captured RNA relative to DNA contamination, an RT- minus reaction (sample G7) was included.

Figures 4a and 4b illustrate the amplification plot of the included samples (standard curve samples and NRO samples), the standard curve used to calculate mRNA concentrations, and a Table summarizing the data output from the Rotorgene instrument.

In this example, the relative transcription level of the exogenous transgene EGFP (Figure 4a) derived from the plasmid pCMV. EGFP and endogenous GAPDH gene (Figure 4b) have been determined from NRO samples. Here, EGFP was the target for quantification and GAPDH was the internal duplex control.

Figure 5a and 5b exemplify the repeatability of the NRO method across two transgenic human cell lines, namely MDA-MB-468 clones #2. 6 (samples Al to A4) and #4. 3 (samples A5 to-A8). These clones were isolated from a culture of MDA-MB-468-- transfected with the plasmid pCMV. HER2. BGI2. 2REH.

RT positive reactions (samples Al to A3 andA5 to A7) were performed in triplicate on the two individual NRO preparations. A single RT-minus reaction was included for each MDA-MB-468 clone (#2. 6 sample A4; # 4.3 sample A8) to determine purity of NRO captured RNA relative to DNA contamination.

In this example, the relative transcription level of the endogenous HER-2 (Figure 5A) and endogenous GAPDH gene (Figure 5B) have been determined from NRO samples. Here, endogenous HER-2 was the target for quantification and GAPDH was the internal duplex control.

Figures 6a and 6b exemplify the linearity of the standard curves of the duplexed real-time PCR method on DNA template using the transgenic human cell line MDA-MB-468 clone #4. 13 (samples B5 to C6).

Genomic DNA was purified as described above and titrated in 1/lo dilution across the range from 750 ng to 0.075 ng. Real-time PCR reactions were performed in duplicate.

In this example, the relative DNA concentration levels of the exogenous transgene HER2. BGI2.2REH (Figure 6a) and endogenous GAPDH gene (Figure 6b) have been determined from NRO samples. Here, HER2. BGI2. 2REH was the target for quantification

and GAPDH was the internal duplex control. This latter experiment shows linearity of standard curves for DNA.

The data of Table 8 exemplify the efficiency of capture of the target biotinylated nascent RNA using streptavidin-coated paramagnetic beads, relative to the background of mature RNA. The data was generated by real-time PCR. Crossover threshold values were determined for biotin-16-UTP labeled (biotin plus) versus UTP-labeled (biotin minus) nascent RNA transcripts.

Isolated nuclei from the human cell line MDA-MB-468 were incubated in the presence of biotin-16-UTP or UTP and the nascent RNA transcripts so labeled. Only those transcripts labeled with biotin-16-UTP were efficiently captured using streptavidin-coated paramagnetic beads.

The nascent transcripts of two genes were analysed by real-time PCR as a duplex reaction (HER-2 and GAPDH). The experiment was conducted in duplicate and the crossover threshold (Ct) values averaged. Note that the values for the biotin minus pre-capture and biotin plus pre-capture (light shade) in each sample pair are almost identical whereas the post-capture samples differ significantly (dark shade). The difference in Ct values (HER-2 8.52 Ct & GAPDH 10.51 Ct) for post-capture samples comparing biotin minus and biotin plus indicates relative efficiency of capture. The'relative noise' (HER-2 0.27% and GAPDH 0.07%) indicates the amount of non-biotinylated RNA contributing to the total Ct value post-capture expressed as a percentage of Ct signal.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

Examples 27 to 29 related to the use of alternative ribonucleotide analogs, i. e. non-isotopic approach. These ribonucleotide analogues have application as alternative substrates for incorporation into nascent RNA. Furthermore, these ribonucleotide analogues present possibilities for analyses of RNA transcription including but not limited to autoradiography, real-time PCR, immunological assays (e. g. ELISA) and microarray assays.

EXAMPLE 27 Directly labeledfluorescent ribonucleotides Fluorescent dyes are used replacing either P32-UTP and Biotin-16-UTP in nascent transcripts. Examples of these include fluorescein-12-UTP, tetramethylrhodamine-6-UTP, Texas Red (registered trademark) -5-UTP, BODIPY (registered trademark) FL-14-UTP, BODIPY (registered trademark) TMR-14-UTP, BODIPY (registered trademark) TR-14- UTP, Rhodamine Green (trademark) 5-UTP, Alexa Fluor (registered trademark) 488-5- UTP, Alexa Fluor (registered trademark) 546-14-UTP amongst many others. The incorporation of these analogs follows the standard protocol as outlined herein, up to and including the nuclear run-on steps, but excluding the biotin extraction step. The fluorescently labeled RNA is used in microarray analysis. This aspect is of great value for high throughput analyses. This allows the monitoring of nascent RNA transcription in real- time and on a large scale. This eliminates the problems associated with the uneven rate of RNA turnover for genes in the current systems of microarray analysis. This also allows for the analysis of non-polyadenylated RNA transcripts from those mRNAs that cannot be isolated via oligo (dT) isolation and RT-PCR, and cDNA.

EXAMPLE 28 Halogenated uridine-S'-triplzosplzate This example describes, but is not limited to, the use of the halogenated uridine 5'- triphosphate-bromouridine (BrU) in place of biotinylated uridine 5'-triphosphate as

described in Examples 14 to 25. All procedures are as described in Examples 14 to 25 with the exception of the following.

(i) Preparation of anti-BrdUmouse antibody-coatedparamagnetic beads Fifty jjL aliquots of goat antimouse IgG-coated paramagnetic beads (Dynal) are used to immunoprecipitate each RNA sample. The beads are washed three times in PBS containing 0.1% w/v BSA. The bead pellet is suspended in 200 pL of PBS containing 0. 1% w/v BSA.

1.5 p. g ofanti-BrdU MoAb (mouse antibody: Medical & Biological Laboratories) from a stock solution (100 p, g/pL) is added to the bead suspension and incubated at room temperature for 1 hour, with shaking. The beads are washed three times in PBS containing 0.1% w/v BSA. The bead pellet in resuspended in 100 pL of 2 x PBS containing 0.2% w/v BSA and 0.6 M uridine.

(ii) Capture and waslaing of BrU-labeled RNA with anti-BrdU MoAB-labeled paramagnetic beads 100 je. L aliquots of the suspended beads are combined with 100 ! 1L of the BrU-labeled RNA and then incubated at room temperature for 1 hour. The beads are washed three times in PBS containing 0.1% w/v BSA. The beads are suspended in 20 I1L of RNAse-free water and are then incubated at 80°C for 10 minutes to release the BrU-labeled RNA from the beads. The beads are centrifuged at 10,000 x g for 1 minute and the supernatant containing BrU-labeled RNA is removed.

(iii) BrU-RNA detected byReal-Time RT-PCR BrU-labeled RNA purified as described herein is analyzed by real-time RT-PCR as described in Examples 24 and 25.

(iv) BrU-RNA detected by ELISA As an alternative to the use of real-time RT-PCR for quantification, the BrU-labeled RNA is analysed by immunological techniques (e. g. ELISA assay). A 96-well format plate called CovaLink (trademark) NH Secondary Amine (Nunc) is particularly useful. Plates may also be antibody coated. The experimental protocol is as follows: (1) BrU is incorporated into nascent RNA as-described-herein ; (2) Total RNA is isolated as described herein; (3) The BrU-labeled nascent RNA is isolated either on IgG-coated paramagnetic beads or ELISA plates; (4) The BrU-RNA-antibody conjugate is heat-treated at 80°C for 10 minutes to degrade antibodies and release BrU-labelled RNA; (5) Oligonucleotides specific for the genes of interest are attached to CovaLink (trademark) plates; (6) The BrU-labeled RNA is transferred to the oligonucleotide-labeled CovaLink plate and the BrU-RNA is annealed to oligonucleotides in a sequence-specific manner; (7) The plate is washed; (8) The BrU-RNA is detected with an ELISA assay, e. g. anti-BrU conjugated to an akaline-phosphotase reporter system or similar; and (9) The amount of BrU-labeled RNA present in the nuclei is determined by semi- quantitative measurement against a standard.

EXAMPLE 29 Aminoallyl uridine Aminoallyl uridine [5- (3-aminoallyl) uridine 5'-triphosphate] is a ribonucleotide analog which has a similar structure to bromouridine except the bromo-group is replaced by an amino-reactive-group. Consequently, many amino reactive chemicals including biomolecules react to form covalent links with aminoallyl uridine. For example : fluorescent dyes, linker arms, biotin conjugates etc.

It is contemplated that aminoallyl uridine is incorporated in the manner, but not limited to that described herein, for the incorporation of biotinylated uridine-5'-triphosphate and halogenated uridine-5'-triphosphate.

The applications of this approach are varied, but not limited to the examples provided. For example, aminoallyl-labeled RNA can be conjugated to a biotin/cleavable linker arm. The biotin-labeled RNA is captured with, but not limited to, streptavidin as described herein..

The biotin-labeled RNA is cleaved from the biotin and quantified by real-time PCR.

Alternatively, the aminoallyl-labeled RNA is conjugated to a fluorescent dye and this fluorescently labeled RNA is quantified by microarray analysis. Alternatively, the aminoallyl-labeled RNA is conjugated to an antibody and the RNA is quantified by immunological assay (e. g. ELISA assay).

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

TABLE 1 in Mme : o-f GAPDH Univ Fwd CAAGGCTGTGGGCAAGGT [SEQ ID NO : 1] GAPDH Univ Rev GGAAGGCCATGCCAGTGA [SEQ ID NO : 2] GAPDH Univ VIC ATCCCTGAGCTGAACGG [SEQ ID (homosapien, (homosapien, Nô : 8] murine, porcine, porcine, bovine) bovine) GAPDH Univ Fwd #4 CAAGGCTGTGGGCAAGG [SEQ ID NO : 3] GAPDH Univ Rev #5 CGGAAGGCCATGCCAGTGA [SEQ ID NO : 4] GAPDH murine VIC ATCCCAGAGCTGAACGG [SEQ ID (homosapien (murine) N0 : 9] murine, porcine, bovine) G6PD-1 Fwd GCCTTCTGCCCGAAAACAC [SEQ ID NO : 5] (homosapien) G6PD-1 VIC TGGGCTATGCCCGTTCCCGC [SEQ G6PD-1 Rev TGCGGATGTCAGCCACTGT [SEQ ID NO : 6] (human) ID NO : 10] (homosapien/bovine) G6PD-1 Fwd TGGGCTATGCCCGCTCCCGC [SEQ GCCTTTTGCCCGAAGACAC [SEQ ID NO : 7] G6PD-1 VIC (Bovine/Porcine) ID NO : 11] TABLE 2 .. ;..-.. ;. =.-_ : _,.. :.. :,.. ;, _....--. , >v.--.-r : _-. _ :'_P BES-_.. : _, ;.- _. _--y - :.-_....-..,-,. _ e en Exo SV40 Univ Fwd GCCGCGACTCTAGATCATAATCA [SEQ ID NO : 12] u ce : 5-3-- . __ : _ :. :..,. Se uence S. 3. _ : _. _. _.... :. _ . . q :. _. : : _ _. _. ; Exo SV4O. Univ Fwd GCCGCGACTCTAGATCATAATCA [SEQ ID N0 : 12] TGTGGGAGGTTTTTTAAAGCAAGT [SEQ ID NO : 13] Exo SV40 Univ Rev AAACCTCTACAAATGTGGTA [SEQ ID SV40 Univ Rev FAM Nô : 17] BEV Exo Fwd GTACTCGATTTGTCCTGCCATTG [SEQ ID NO : 14] EGFP Exo Fwd GGCATGGACGAGCTGTACAAG [SEQ ID NO : 15] (171 bp) HER2 Exo Fwd GTAGAGGTGGCGGAGCATGT [SEQ ID NO : 16] TABLE 3 '"PROBES -, rimez ..-. _ : _ _. rimers, _ _....-..-_.. = _.. _ :. : _ :. = _. =.. : . _. : _. :. _ _. : _. P _--., _. :, =,... r.. _ __ __-= : _ _ :.,. _ :--. _ __- : _-_. :- : = _.-, __.,.. .. : _., _. _ _ __-_.. _ , _ e uenc _ lTame... q- BRN-2 Endo 3'Fwd GGCTCTGGGCACCCTGTAT [SEQ ID NO : 18] (5'mRNA) BRN-2 3'Endo CAACGTGTTCTCGCAGACCACCATCT BRN-2 Endo 3'Rev CAGCTGCAGGGCCTCAAA [SEQ ID NO : 19] 6FAM [SEQ ID NO : 24] (5'mRNA) TYR Endo 3"Fwd AACTGTGACATTTGCACAGATGAGT ESEQ ID NO : 20] (5'mRNA) TTGGGAGGTCGTCACCCTGAAAATCC TYR3'Endo 6FAM TYR 3'Endo Rev [SEQ ID NO : 25] GAAGGATGCTGGGCTGAGTAAGT [SEQ ID NO : 21] (5'MrNA) HER-2 Endo 5'Fwd GGACCTAGTCTCTGCCTTCTACTCTCTA [SEQ ID NO : 22] HER-2 Endo 5'CTGGCCCCCCTCAGCCCTACAA [SEQ HER-2 Endo 5'Rev GCCCCTCCCCACACTGA [SEQ ID NO : 23] FAM ID NO : 26] TABLE 4 = : x b ffe--x.,- : _. ; r =, :----. r ;... _ .--v : _.. :.,-. :- ;. :.. :- : : _,.. = :.. _ . _RT FyaI. concentration_ ;.- : __-- _ : = _ = _ :.. n : ;,.. :. :. _ :.-_. ^ _ _.-.-.,.. 1 _.,., ^,.. : : _.-_ _- . Coni one ts lox __ Catalogue.. #,. Vol. Per. Reaction : 15 : 1, _.. _ _ _- :....-- : :.... _. _ :. w : :- :.. : : _ ..--_... w 1 Ox Concentration AB Gold PCR BufferAB#43068941. 0 L0. 67x concentration 25 mM MgC12 AB #N808-0010 1. 05 pL 1. 75 mM 100 mM dATP's 0. 03 fol 0. 2 mM 100 mM dCTP's 0. 03 I1L 0. 2 mM Roche # 1969064 100 mM dGTP's 0. 03 gL 0. 2 mM 100 mM dTTP's 0. 03 gel 0. 2 mM I, OOOmM DTT 0. 15 I1L 10. 0 mM StH20/Balance 0. 68 gel TOTAL RT Buffer Mix 3. 0 IlL TABLE 5 =v. _ an Ste :-.. : ; 'Tem"'-=-°-= _'-.-. °-,. .- :., = = °. :, = ;.-__ : :-_ :.-.. _,- Cycle Revers e Traiis-- e e o _. : _ .-P. _, P.-. :-P. :. _.. _ _. Time, _ #. C cles :. _. _ : __.. _.. _ _. _ _ :.- : :.... Y :. _- _., :.. Method :, _ Cycle 1 Step 1 250C 10 min 1 cycle Manual heat block Step 2 46°C 20 min Step 3 94°C 5 min Step 4 25°C 5 min TABLE 6 --- _ : :-. _ ;. w. :--.-a,, __.. : =-..., _ _..-_ Cycle 1 Step 1 50°C 2 mìn 1 Cycle R stem exil) rye .- : _ _... P :.... : = : .,.... _ ; : __. ___ -..... _. _ .. __. Cycle 2 Step 1 95°C 10 min I Cycle Cycle 3 Step 1 95°C 15 sec 55 Cycles Step 2 60°C 45 sec TABLE 7 s :... e.. e ; _ En'o d enou- s Tar et e . Tar et- S c s. =w Cell lin n Of Interes : : . rnal coritr '-... _ g __ g. ; P t.. Du lexed with, Iinte Human MM96L G6PD Not Duplexed Human MM96L BRN 2 GAPDH Mouse B16 Tyrosinase GAPDH Human MDA-MB 468 HER 2 GAPDH S'ci-. gen 'Tra nsen T s e es ., : C g_. __ t. Du l-_ ell Li e : n Tar et-G n :' e e. of Intees P-_ exed v% ith_Int' _ g. _. _ _-ernal control----- Mouse B 16 EGFP Exo GA. PDH Human MM96L EGFP Exo GAPDH Bovine CRIB BEV Exo G6PD TABLE 8 a - N me. D t'o e ec. t n C=value Av . era e C-=-= C- :'difference.- : elative-_ .- : _ :- : : :.. :.. _. :. _. g _ .--. _. _, _ =- r et. erie _-_ ene, t t -valiie of : = -t u. Life : re lications- :-. rio, tiu=minus :. _.-n Before RNA Sample 1 Her-2 Gene 19. 1 Biotin minus capture Sample 2 Her-2 Gene 19. 85 control After RNA Sample 1 Her-2 Gene capture Sample 2 ene Her-2 G 0. 27% 8 : 0. 27% Before RNA Sample 3 Her-2 Gene Biotin plus capture Sample 4 Her-2 Gene test After RNA Sample 3 Her-2 Gene capture Sample 4 Her-2 Gene 2, k. =-t'. Before RNA Sample 1 GAPDH Biotin minus Sample 2 GAPDH Y u fx control After RNA Sample 1 GAPDH 30 5 capture Sample 2 GAPDH =r : 1 0. 07% Before RNA Sample 3 GAPDH 16 08-- Biotin plus capture Sample 4 GAPDH test After RNA Sample 3 GAPDH capture Sample 4 GAP BIBLIOGRAPHY Bassler et al., 1995, App. Environ. Microbiol. 61 : 3724-3728.

Belgrader et al., 1999, Science 284 : 449-450.

Bonner and Laskey, 1974, Eur. J. BIochem. 46: 83.

Dawson et al., 1989, Journal of Biological Chemistry 264 : 12830-12837.

Fahy et al., PCR Methods Appl. 1(1): 25-33,1991.

Fahy. et al., 1993, Nucleic Acids Research 21: 1819-1826.

Holmstrom et al., Anal. Biochem. 209(2): 278-283, 1993.

Hultman et al., 1989, Nucleic Acids Research 17 : 4937-4946.

Jeltsch et al., 1993, Analytical Biochemistry 209 : 278-283.

Kemp, D. J, 1992, Methods in Enzymology 216: 116-126.

Kemp et al., 1989, Proc. Natl. Acad. Sci. USA 86 : 2423-2427.

Kohsaka et al., 1993, Nucleic Acids Research 21: 3469-3472.

Khudyakov et al., Nucleic Acids Res. 22(7): 1320-1321,1994.

Lagerkvist et al., 1994, Proc. Natl. Acad. Sci. USA 91 : 2245-2249.

Lee et al., 1993, Nucleic Acids Res. 21: 3761-3766.

Lew, A. M and Kemp, 1989, D. J, Nucleic Acids Research 17 : 5859.

Livak et al., 1995a, PCR Methods Applic. 4 : 357-362.

Livak et al., 1995b, Nature Genet. 9 : 341-342.

Lund et al., 1988, Nucleic Acids Research 16: 10861-10880.

Marmur and Doty, 1962, J. MoL BioL 5 : 109.

Olejnik et al., 1996, Nucleic Acids Research 24 : 361-366.

Stamm, S. and Brosius, J. , 1991, Nucleic Acids Research 19 : 1350.

Syvanen et al., 1988, Nucleic Acids Research 16 : 11327-11338.