Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
METHODS FOR REDUCING INTRAOCULAR PRESSURE USING A3-ADENOSINE ANTAGONISTS
Document Type and Number:
WIPO Patent Application WO/2000/003741
Kind Code:
A2
Abstract:
A method for decreasing intraocular pressure by administering an A¿3? subtype adenosine receptor antagonist, a calmodulin antagonist or an antiestrogen such as tamoxifen. These agents, by inhibiting influx or promoting efflux of aqueous humor, can be used to treat glaucoma.

Inventors:
CIVAN MORTIMER M (US)
STONE RICHARD A (US)
MITCHELL CLAIRE H (US)
JACOBSON KENNETH A (US)
Application Number:
PCT/US1999/016211
Publication Date:
January 27, 2000
Filing Date:
July 15, 1999
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
UNIV PENNSYLVANIA (US)
US HEALTH (US)
CIVAN MORTIMER M (US)
STONE RICHARD A (US)
MITCHELL CLAIRE H (US)
JACOBSON KENNETH A (US)
International Classes:
A61K9/10; A61K9/08; A61K31/00; A61K31/135; A61K31/138; A61K31/435; A61K31/4422; A61K31/4425; A61K31/455; A61K31/498; A61K31/517; A61K31/519; A61K31/5415; A61K45/00; A61P27/06; (IPC1-7): A61K31/00
Domestic Patent References:
WO1997027177A21997-07-31
Other References:
MITCHELL, CLAIRE H. ET AL: "A3 adenosine receptors regulate Cl- channels of nonpigmented ciliary epithelial cells" AM. J. PHYSIOL. (1999), 276(3, PT. 1), C659-C666, XP000884326
JACOBSON, KENNETH A. ET AL: "Pharmacological characterization of novel A3 adenosine receptor-selective antagonists" NEUROPHARMACOLOGY (1997), 36(9), 1157-1165, XP000884327
CARRÉ: "adenosine stimulates..." AM J. PHYSIOL., vol. 273, no. 4, 1997, pages c1354-c1361, XP000884715
JACOBSON K A ET AL: "A3-ADENOSINE RECEPTORS: DESIGN OF SELECTIVE LIGANDS AND THERAPEUTIC PROSPECTS" DRUGS OF THE FUTURE,ES,BARCELONA, vol. 20, no. 7, 1995, pages 689-699, XP002911460 ISSN: 0377-8282
CROSSON: "characterization of ocular hypertension..." INVEST. OPHTHALMOL. VIS. SCI., vol. 37, no. 9, 1996, XP000884746
Attorney, Agent or Firm:
Altman, Daniel E. (Martens Olson & Bear 16th floor 620 Newport Center Drive Newport Beach, CA, US)
Download PDF:
Claims:
CLAIMS:
1. A method for reducing intraocular pressure in an individual with an ocular disorder, comprising the step of administering to said individual an effective intraocular pressurereducing amount of a pharmaceutical composition comprising an A3 subtype adenosine receptor antagonist.
2. The method of Claim 1, wherein said A3 subtype receptor antagonist is a dihydropyridine, pyridine, pyridinium salt or triazoloquinazoline.
3. The method of Claim 1, wherein said A3 subtype receptor antagonist is selected from the group consisting of MRS1097, MRS 1191, MRS 1220, MRS 1523 and MRS1649.
4. The method of Claim 1, wherein said pharmaceutical composition is administered topically, systemically or orally.
5. The method of Claim 1, wherein said pharmaceutical composition is an ointment, gel or eye drops.
6. The method of Claim 1, wherein said ocular disorder is glaucoma.
7. A method for reducing intraocular pressure in an individual with an ocular disorder, comprising the step of administering to said individual an effective intraocular pressurereducing amount of a pharmaceutical composition comprising an antiestrogen.
8. The method of Claim 7, wherein said antiestrogen is tamoxifen.
9. The method of Claim 7, wherein said pharmaceutical composition is administered topically, systemically or orally.
10. The method of Claim 7, wherein said pharmaceutical composition is ointment, gel or eye drops.
11. The method of Claim 7, wherein said ocular disorder is glaucoma.
12. A method for reducing intraocular pressure in an individual with an ocular disorder, comprising the step of administering to said individual an effective intraocular pressurereducing amount of a pharmaceutical composition comprising a calmodulin antagonist.
13. The method of Claim 12, wherein said calmodulin antagonist is trifluoperazine.
14. The method of Claim 12, wherein said pharmaceutical composition is administered topically, systemically or orally.
15. The method of Claim 12, wherein said pharmaceutical composition is ointment, gel or eye drops.
16. The method of Claim 12, wherein said ocular disorder is glaucoma.
17. A method for reducing intraocular pressure in an individual with an ocular disorder, comprising the step of administering to said individual an effective intraocular pressurereducing amount of a pharmaceutical composition comprising a prodrug which is converted into a A3 subtype adenosine receptor antagonist after said administering step.
18. An A3 subtype adenosine receptor antagonist for use in reduction of intraocular pressure.
19. The A3 subtype adenosine receptor antagonist of Claim 18, wherein said receptor antagonist is selected from the group consisting of MRS1097, MRS1191, MRS1523 and MRS1649.
20. Use of an antiestrogen in the preparation of a medicament for the reduction of intraocular pressure.
21. The use of claim 20, wherein said antiestrogen is tamoxifen.
22. A calmodulin antagonist for use in reduction of intraocular pressure.
23. The calmodulin antagonist of claim 22, wherein said calmodulin antagonist is trifluoperazine.
24. A prodrug which is converted into an A3 receptor antagonist in vivo for use in reduction of intraocular pressure.
Description:
METHODS FOR REDUCING INTRAOCULAR PRESSURE Field of the Invention The present invention relates to the use of A3 subtype adenosine receptor antagonists, calmodulin antagonists and antiestrogens for reduction of intraocular pressure.

Background of the invention The aqueous humor of the eye is formed by the ciliary epithelium, which comprises two cell layers: the outer pigmented epithelial (PE) cells facing the stroma and the inner nonpigmented epithelial (NPE) cells in contact with the aqueous humor. Secretion is generally thought to reflect a primary transfer of solute, largely NaCI, from the stroma to the aqueous humour, providing an osmotic driving force for the secondary osmotic transfer of water down its chemical gradient (Cole,. Exp. Eye Res. 25 (Suppl.), 161-176, 1977), although a more direct coupling between water and solute may also proceed across epithelia (Meinild et al. J. Physiol. 508: 15-21, 1998). One major factor governing the rate of secretion is the rate of chloride ion (Cl) release from the NPE cells into the aqueous humor (Civan, News Physiol. Sci. 12: 158-162, 1997). The activity of Cl channels is likely to be a rate-limiting factor in aqueous humour secretion, given the low baseline level of channel activity and the predominance of the chloride anion in the fluid transferred (Coca-Prados et al., Am. J. Physiol. 268: C572-C579, 1995). The secretion of aqueous humor into the eye is believed to result as a consequence of two opposing physiological processes: fluid secretion into the eye by the NPE cells and fluid reabsorption (secretion out of the eye) by the PE cells. Thus, both release of Cl by the nonpigmented ciliary epithelial (NPE) cells into the adjacent aqueous humour would enhance secretion, and Cl release by the pigmented ciliary epithelial (PE) cells into the neighboring stroma would reduce net secretion (Civan, Current Topics in Membranes 45 : 1-24, 1998) .

Recently, adenosine has been found to activate NPE Cl channels which subserve this release (Carre et al., Am.

J. Physiol. (Cell Physiol. 42) 273:C1354-C1361, 1997). Purines, a class of chemical compounds which includes adenosine, ATP and related compounds, may regulate aqueous humour secretion, in part through modifying Cl channe activity. Both NPE and PE cells have been reported to release ATP to the extracellular surface, where ATP can be metabolized to adenosine by ecto-enzymes (Mitchell et al. Proc. Natl. Acad. Sci U. S. A. 95: 7174-7178, 1998), and <BR> <BR> <BR> <BR> <BR> both cell types possess adenosine receptors (Wax et al., Exp. Eye Res. 57: 89-95, 1993; Wax et al, Invest. Ophthalmol.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P> Vis. Sci., 35: 3057-3063, 1994; Kvanta et al., Exp. Eye Res. 65: 595-602,1997) and ATP receptors (Wax et al., supra., <BR> <BR> <BR> <BR> <BR> <BR> <BR> 1993; Shahidullah et al. , Curr. EyeRes. 16: 1006-1016, 1997). Furthermore, in vitro studies of rabbits have associated A2-adenosine receptors with increased secretion and elevated intraocular pressure (Crosson et al., Invest. Ophthalmol. <BR> <BR> <BR> <BR> <BR> <P> Vis. Sci. 37: 1833-1839, 1996) and A, -adenosine receptors with the converse (Crosson, J. Pharmacol. Exp. Ther.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P> 273: 320-326, 1995). Qualitatively similar associations with intraocular pressure, but not with secretion, have been observed in cynomologus monkeys (Tain et al., Exp. Eye Res., 64: 979-989, 1997). A particular role for Cl channels has been suggested by the observations that adenosine agonists stimulate Cl channels of immortalized human and freshly-dissected bovine NPE cells and of aqueous-oriented Cl channels of the intact rabbit iris-ciliary body (Carre et al.,

supra., 1997). Adenosine triggered isotonic shrinkage of cultured human cells from the HCE cell line. The contribution of Cl channels to this shrinkage was identified by performing the experiments in the presence of the cation ionophore gramicidin. In addition, adenosine produced a Cl dependent increase in short-circuit current across rabbit iris-ciliary body while the non-metabolizable adenosine analogue 2-CI-adenosine was shown to activate Cl currents in HCE cells using the whole cell patch-clamp technique. Although this study clearly established that adenosine could activate Cl channels on NPE cells, the concentrations of agonist used were capable of stimulating all four known adenosine <BR> <BR> <BR> <BR> receptor sub-types : A,, A2A, A2B and A3 (Fredholm et al., Pharmacol. Rev., 46: 143-156, 1994; Fredholm et al., Trends Pharmacol. Sci., 18: 79-82,1997 ; Klotz et al., Naunyn Schmiedebergs Arch. Pharmacol., 357: 1-9., 1998). Ciliary epithelial cells are known to possess A, A2A and A2B adenosine receptors (Kohno et at.. Blood, 88: 3569-3574,1996, <BR> <BR> <BR> <BR> Stambaugh et al., Am. J. Physiol. 273 (Heart Circ. Physiol. 42): H501-H505, 1997; Wax et al., supra., 1994). Although stimulation of these receptors can be associated with specific changes in the levels of second messengers cAMP (Crosson, supra.; Stambaugh et al., supra.; Wax et al., supra., 1994) and Ca2' (Farahbakhsh et al., Exp. Eye Res., 64: 173-179, 1997), the effect of these receptors upon Cl channels of NPE cells was unknown.

Alternatively, the intraocular pressure could be reduced by stimulating reabsorption of aqueous humor. In principle, this could be achieved by activating chloride channels on the basolateral surface of the pigmented cell layer.

This would release chloride back into the stroma. One way to accomplish this with the PE cells has been identified using the antiestrogen tamoxifen. Tamoxifen is known to exert multiple actions on biological cells. However, recently, <BR> <BR> <BR> <BR> Mitchell et al. (Invest Ophthalmol. Vis. Sci. 38 (Suppl.) : S1042, 1997) have noted that the only known action of tamoxifen which could account for the phenomenon is its antiestrogenic activity, probably on the plasma membrane.

Glaucoma is a disorder characterized by increased intraocular pressure that may cause impaired vision, ranging from slight loss to absolute blindness. The increased intraocular pressure is related to an imbalance between production and outflow of the aqueous humor. Current drugs prescribed for glaucoma, in the form of eyedrops, include pilocarpine, timolol, betaxolol, levobunolol, metipranolol, epinephrine, dipivefrin, latanoprost, carbachol, and potent cholinesterase inhibitors such as echothiophate and carbonic anhydrase inhibitors such as dorzolamidet. Many of these effective approches to medical therapy of glaucoma involve a reduction in the rate of flow into the eye. However, none of these drugs are satisfactory, in part due to side effects.

Because of side effects of available agents and inconvenient dosing schedule, there is an ongoing need for compounds capable of reducing intraocular pressure for the treatment of glaucoma with improved efficacy, prolonged action and reduced side effects. The present invention addresses this need.

Summary of the Invention One embodiment of the present invention is a method for reducing intraocular pressure in an individual, comprising the step of administering to the individual an effective intraocular pressure-reducing amount of a pharmaceutical composition comprising an A3 subtype adenosine receptor antagonist. In one aspect of this preferred embodiment, the A3 receptor antagonist is a dihydropyridine, pyridine, pyridinium salt or triazoloquinazoiine. Preferably, the A3 subtype receptor antagonist is selected from the group consisting of MRS-1097, MRS-1191, MRS 1220 and

MRS-1523. Advantageously, the pharmaceutical composition is administered topically, systemically or orally.

Preferably, the pharmaceutical composition is an ointment, gel or eye drops.

Another embodiment of the present invention is a method for reducing intraocular pressure in an individual, comprising the step of administering to the individual an effective intraocular pressure-reducing amount of a pharmaceutical composition comprising an antiestrogen. Preferably, the antiestrogen is tamoxifen. Advantageously, the pharmaceutical composition is administered topically, systemically or orally. Preferably, the pharmaceutical composition is ointment, gel or eye drops.

The present invention also provides a method for reducing intraocular pressure in an individual, comprising the step of administering to the individual an effective intraocular pressure-reducing amount of a pharmaceutical composition comprising a calmodulin antagonist. Preferably, the calmodulin antagonist is trifluoperazine.

Advantageously, the pharmaceutical composition is administered topically, systemically or orally. Preferably, the pharmaceutical composition is ointment, gel or eye drops.

Another embodiment of the present invention is an A3 subtype adenosine receptor antagonist for use in reduction of intraocular pressure. Preferably, the A3 subtype adenosine receptor antagonist is MRS-1097, MRS-1191 or MRS-1523.

The present invention also provides the use of an antiestrogen in the preparation of a medicament for the reduction of intraocular pressure. Preferably, the antiestrogen is tamoxifen.

The present invention also provides a calmodulin antagonist for use in reduction of intraocular pressure.

Preferably, the calmodulin antagonist is trifluoperazine Brief Description of the Figures Figure 1 is a schematic diagram showing the ocular nonpigmented epithelial (NPE) and pigmented epithelial (PE) cells, and the effects of ATP, adenosine (Ado) and tamoxifen (TMX) on the movement of aqueous humor.

Ecto=ecto enzymes ; A3=A3 subtype adenosine receptor.

Figures 2-7 relate to the effects of A3 receptors on NPE cells, while figures 8-17 relate primarily to the actions of ATP on PE cells.

Figures 2A-2D show the concentration-response relationship for the A3-selective agonist N6- (3 iodobenzyl) adenosine5'-Nmethyluronamide (IB-MECA) stimulated isotonic shrinkage of NPE cells in the presence of 5) J. M gramicidin. In Figs. 2-5, solid trajectories are least-square fits with monoexponentials, whereas data sets displaying no significant shrinkage are connected by dotted lines..

Figure 2A : - least-squares fits yielded the following estimated values for data obtained in parallel at <BR> <BR> <BR> <BR> concentrations of 30 nM - 1 t) M IB-MECA (n=4 experiments) : 30 nM [steady-state cell volume (V#)=98.5#0.1%,<BR> <BR> <BR> <BR> <BR> <BR> <BR> i a 3. 5 1. 5 min), and 1 M (°° 95. 90. 3%, T =2. 4t 0. 7 minl. Control and 3 sets of experimental results were<BR> <BR> <BR> <BR> <BR> <BR> <BR> significantly different (P < 0. 01, F-testl. <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P> Figure 2B data obtained over concentration range of 1-10 µM IB-MECA (n ; 4) : 1 wM (Va97. 5t0. 1%,<BR> <BR> <BR> <BR> <BR> <BR> <BR> #=7.2#1.0 min), 3 M (11- 96. 7 t 0. 3%, x-10. 02. 3 min), and 10 µM (V#=97.9#0.2%, #=3.2#1.1 min). Data obtained at 1 pM and 3 M did not significantly deviate from the fit obtained with 10 µM IB-MECA.

Figure 2C shows a Llneweaver-Burk plot generated from nonlinear least-square fits of Figures 1A and 1B.

Change in volume was calculated as (VO Vo°) . Variation with passage number was noted for T and (VO-Vo°) . For this reason, both experimental sets (Fig. 1A and 1B) included measurements with one concentration (1 µM) in common.

Ratio (in VO V) obtained at 1 p. M in B to A was used as a scaling factor to accommodate results obtained in B with 3 and 10 pM. Using this approach, linear least-squares analysis (r²-0.95) led to an estimated value for the apparent Kd of 55#10 nM.

Figure 2D shows isotonic cell shrinkage stimulated by 100 nM CI-IB-MECA. Fits for CI-IB-MECA <BR> <BR> <BR> <BR> (V#=97.9#0.2%, Tu2. 5il. 3 min) and IB-MECA (V°°-96. 80. 4%, #-6.3#2.2 min) are not significantly different<BR> <BR> <BR> <BR> <BR> (P > 0. 05).

Figures 3 A-3B show the effect of A3 antagonists on the IB-MECA-stimulated isotonic shrinkage of NPE cells.

Figure 3A shows that the A3-selective antagonist MRS-1097 (300 nM) prevented shrinkage triggered by IB-MECA <BR> <BR> <BR> (P<0. 01, F-distribution). Figure 3B shows that the A3-selective antagonist MRS-1191 (100 nM) prevented<BR> <BR> <BR> <BR> <BR> characteristic shrinkage triggered by IB-MECA (n°4, P<0. 01 by F-distribution). MRS did not affect cell volume in the absence of IB-MECA, confirming the specificity of the interaction (n-4).

Figures 4A-4C shows the effects of selective A3-receptor antagonists on adenosine-stimulated isotonic shrinkage of NPE cells. Application of 300 nM MRS-1097 (Fig. 3A; n-4), 100 nM MRS-1191 (Fig. 3B; n-3), and 100 nM MRS-1523 (Fig. 3C; n-3) all prevented the characteristic shrinkage triggered by nonselective activation of adenosine receptors with 10 pM adenosine (P < 0. 01, F-distribution).

Figures 5A-5C show the effects of adenosine-receptor agonists on isoosmotic volume of NPE cells. In Fig. 5A, <BR> <BR> <BR> <BR> the A3-selective agonist IB-MECA produced prompt shrinkage at 100 nM (n-4, V#=95.60.2%, #=4.5#0.6 min, P < 0.01 by F-distribution). In contrast, the A, -selective agonist N6-cyclopentyladenosine (CPA) had little effect at 100 nM, and none at all at 3 1M (n-4) . In Fig. 5B, at 100 nM, the A2 selective agonist CGS-21680 exerted no effect, but the A3-selective agonist IB-MECA again produced shrinkage (n=4, P<0.01 by F-distribution). In Fig. 5C, at high concentration (3pu), the A2-selective agonist CGS-21680 also triggered isoosmotic shrinkage. However, preincubation of the cells with the selective A3 receptor antagonist MRS-1191 (100 nM) abolished this effect (n-4, P<0.01, F distribution).

Figure 6 shows the effects of IB-MECA on the level of free intracellular calcium of NPE cells. Concentration of intracellular Ca2+ increased steadily after application of 100 nM IB-MECA and returned to baseline levels once IB- MECA was removed. Data were obtained at a sampling rate of 1 Hz and smoothed by 21 points. The box indicates the duration of the IB-MECA application.

Figure 7 shows the effect of IB-MECA on short-circuit current dsc) across intact rabbit ciliary epithelium. As an initial step in data analysis, 20-min period of baseline current just before addition of any agent was fit by linear least-squares analysis. The line generated by that analysis was extrapolated to a point 45 min beyond introduction of that agent. Each current response was subtracted from its respective extrapolated baseline to yield a common initial baseline approximating constant zero current. All recordings were placed in register relative to time of agent

introduction (time 0). Records of control (solvent), IB-MECA with solvent, and IB-MECA corrected for solvent were separately averaged. IB-MECA was always added in the presence of 5 mM Ba2+ to isolate contribution of Cl to the response.

Figures 2-7 show that A3-selective adenosine receptors increase chloride channel activity of NPE cells, and that blocking of these receptors reduces chloride channel activity and secretion by the NPE cells into the aqueous humor.

Figures 8-17 provide data to support an alternative approach to reducing net aqueous humor secretion and intraocular pressure by enhancing reabsorption by the PE cells.

Figures 8A-8C show the dependence of PE cell volume on ATP concentration. In all figures, the volumes are normalized to the initial values. The nonlinear least square fits are presented as uninterrupted or interrupted curves, and data points displaying no significant shrinkage are connected by dotted lines.

Fig. 8A shows that in -15% of the preparations, a concentration-dependent shrinkage was observed with <BR> <BR> <BR> <BR> ATP alone (N-4, P<0. 01). The values generated by the fits were: Voo = 94. 30. 3% and T = 2.8#0.7min (10µM <BR> <BR> <BR> <BR> <BR> ATP) , and vOO = 94. 30. 3%, # = 2. 80. 7min (100juM ATP) .

Fig. 8B shows the combined effect of tamoxifen (TMX) and ATP on suspensions responding to ATP alone. The presence of 10pM tamoxifen enhanced the response to both 3pM (P < 0.01) and 10µM ATP (P < 0.05). The values of <BR> <BR> <BR> the fits were: v# = 98.0#0.4%, # = 10. 84. 9min alone) ATP alone) 4%, T 4%, T = <BR> <BR> <BR> <BR> <BR> <BR> ATP+ 10pLM TMX) ; v# = 97. 20. 3%, # = 1.6#1.0min (10µM ATP alone) ; v# = 95.7#0.3%, # = 1. 40. 7min (10µM ATP + 10µM TMX).

Fig. 8C shows the dependence of synergistic shrinkage on ATP concentration. Tamaxifen (6pM) was present throughout (N =5). Shrinkage was observed in the simultaneous presence of 10µM or 1 mM ATP (P < 0. 01) , but not at 1 pM ATP. The data obtained at 1 OliM and 1 mM ATP were not significantly different from each another. The fit obtained at IOM ATP was characterized by v# = 95. 70. 7% and T -6. 6+3. 2min.

Figures 9A 9C show the effects of ATP and NPPB on whole-cell currents of PE cells. The solid bars above show the time period of drug application. In Fig. 9A, at a holding potential of -60mV, lmM ATP produced reversible and reproducible increases in inward current in the cultured bovine PE cell of the panel. In Fig. 9B, the negatively-charged chloride-channel blocker NPPB partially inhibited the ATP-stimulated current of the cell of the cell patched, even at - 60mV. In Fig. 9C, in the freshly-dissociated cell of the panel, increasing concentrations of ATP (10µM, 100µM and 1mM) elicited increasing large stimulations, partially reversible at 1mM before losing the seal. These effects of ATP alone were observed only in half of the total cultured and freshly-dissociated cells studied.

Figures 10A-10B. show the synergism between tamoxifen and ATP on isosmotic cell volume of PE cells. In Fig. 10A, neither ATP (lOmM) nor tamoxifen (6pM) separately produced substantial shrinkage, whereas even 10µM ATP added together with 6µM tamoxifen substantially enhanced the baseline shrinkage. The values of the fits were: <BR> <BR> v# = 96.2#0.6%, # = 15. 95. 2min (Control), 97. 70. 2%, # = 2. 20. 8min (lOmM ATP alone) ; v# = 97. 20. 3%, T<BR> <BR> <BR> <BR> <BR> = 1.6#1.0min (10µM ATP alone) ; and v# = 92. 80. 8%, # = 11. 40. 3min (10pM ATP+611M TMX) (N=6,

P<0.01). In contrast, in Fig. 10B, no such synergism was noted between tamoxifen (6 µM) and adenosine (10 µM) (N=4).

Figure 11 shows the effect of tamoxifen on the regulatory volume decrease (RVD) of NPE cells. Gramicidin D (5plu) was present in all suspensions to provide an exit pathway for K*. In the absence of tamoxifen (TMX), the NPE cells displayed a regulatory volume response to hypotonic swelling with a half-time of ~5min (N"5). Adding TMX at the conclusion of the RVD (t= 1 Omin) had no effect on cell volume, adding TMX at t=5min partially inhibited the steady- state response, and adding TMX at the same time as applying the hypotonic stress both slowed the rate of initial slowing and abolished the RVD. This confirms the concept that tamoxifen can inhibit swelling-activated chloride channels of the NPE cells, but selectively enhances the stimulatory effect of ATP on chloride channels by the PE cells.

Figures 12A-12B show the dependence on Cl of the synergistic shrinkage triggered by tamoxifen and ATP in PE cells. Gramicidin D (5µM) was present in all suspensions to provide an exit pathway for K+ As shown in Fig. 12A, the simultaneous application of 6µM tamoxifen and lOiM ATP produced isosmotic shrinkage in the presence of Cl to <BR> <BR> <BR> <BR> a steady-state value (Voo) of 90.6% 1. 1% with a time constant (i) of 13.2 3.2min (N -4, P < 0. 01) , but not in its absence. Fig. 12B, shows the effect of Ex-channe blockers on ATP, tamoxifen-activated shrinkage. In the absence of inhibitors, the shrinkage was fit with v# = 94.2% 0.3% and T = 4.4 + 0. 8min. The Cl channel blockers DIDS (500µM) reduced and NPPB (100µM) each abolished the synergistic shrinkage (N -4, P < 0. 01).

Figures 13A-13C. show the potential roles of histamine and muscarinic receptors in PE cells As shown in Fig.

13A, in the presence of 100µM ATP, either 10pM carbachol or 10 (iM tamoxifen, but not 10pM histamine, enhanced <BR> <BR> <BR> <BR> shrinkage (N=4). The value of the fits were : v# = 94. 91. 0%, T = 45.2#14.0min (100µM ATP alone) ; v# = <BR> <BR> <BR> <BR> <BR> 94. 10. 6%, T = 6. 52. 3min (ATP + 10µM TMX); v# = 97. 40. 5%, # = 21.0#8.0min (ATP + 10µM histamine); Voo<BR> <BR> <BR> <BR> <BR> <BR> - 94. 20. 4%, T = 5. 61. 2min (ATP+iOM carbachol).

In Fig. 13B, carbachol (10µM) produced nearly the same degree of shrinkage in the presence or absence of 100pM ATP (N=3) . This effect was entirely abolished by preincubating for 2min with 10jlM atropine and retaining <BR> <BR> <BR> <BR> atropine in the test suspension. The fits generated the following values: vOO = 87.5#1.8%, # = 45.214.0min (ATP<BR> <BR> <BR> <BR> <BR> alone) ; Voo = 88. 40. 5%, # = 7. 20. 9min (ATP+TMX) ; vOO = 87.4+0.5%, # = 6.3#0.8min (ATP+TMX+atropine);<BR> <BR> <BR> <BR> <BR> <BR> v# = 91. 21. 6%, T = 13. 45. 2min (ATP + atropine).

In Fig. 13C, atropine (10µM) had no significant effect on the volumetric response to the combined application <BR> <BR> <BR> <BR> of 100pM ATP and 10pM tamoxifen (N =4) . The values of the fits were: v# = 93. 91. 7%, i = 34. 813. 8min (ATP<BR> <BR> <BR> <BR> <BR> alone) ; v# = 89. 61. 9%, t = 11. 34. 7min (ATP+TMX) ; and v# = 87. 81. 5%, T = 15. 13. 6min (ATP+TMX+atropine). The cells exposed to ATP and atropine did not display statistically significant shrinkage.

Figures 14A-14B show the potential role of calcium/calmodulin in ATPltamoxifen-mediated cell shrinkage of PE cells. Fig. 14A shows the interactions of the calciumicalmodulin inhibitor trifluoperazine (10µM) with ATP (100pM) and tamoxifen (101lM) on cell volume (N=6) . The presence of trifluoperazine reduced the response to the combined application of ATP and tamoxifen. The trajectories displaying significant shrinkage were fit with: v# = 94. 80. 4%, # = 2. 210. 8min (ATP+TMX) ; v# = 96.2#0.3%, # = 6. 81. 4min (ATP + trifluoperazine) ; Voo -

95.7#0.4%, # = 3. 91. 2min (ATP+TMX+ trifluoperazine). The trifluoperazine enhanced the shrinkage produced by ATP alone (P<0.01), but also significantly reduced the response produced by ATP+TMX (P<0. 05) .

Fig. 14B shows the effects of trifluoperazine (10µM) and ATP (100, uM) on PE cell volume in the absence of tamoxifen (N =5). The shrinkage triggered by trifluoperazine was the same, whether or not ATP was present (P > 0. 05). <BR> <BR> <BR> <BR> <P>The values of the fits were: vox = 99. 50. 002%, T = 0. 50. 06min (Control) ; v# = 96. 80. 5%, T = 8. 33. 7min<BR> <BR> <BR> <BR> <BR> <BR> (ATP alone) ; v# = 96.80.2%, # = 0. 90. 6min (trifluoperazine alone) ; v# = 96. 70. 3%, # = 0. 51. 5min (ATP+ trifluoperazine).

Figure 15 shows the potential role of protein kinase C on ATP and tamoxifen-mediated PE cell shrinkage.

The effect of 2501lM DiC8 and 0.3µM staurosporine with 10µM tamoxifen and 100tM ATP on cell volume (N-4) <BR> <BR> <BR> <BR> was determined. Only the aliquots exposed to tamoxifen and ATP displayed shrinkage (vox = 89.7 6. 1% ; # = 22. 9 19.0 min). The analyses were conducted only with the first 6 time points because of the unusually large shrinkage triggered by ATP+tamoxifen at 30min.

Figures 16A-16B show the potential role of estrogen receptors on tamoxifen and ATP-mediated PE cell shrinkage. Fig. 16A shows the interactions of 17ß-estradiol (100nM) with ATP (100pM) and tamoxifen (10µM) on cell volume (N=4). Estradiol together with ATP initiated a small and slow shrinkage, different from the baseline null response to ATP, itself (P < 0.05). The maximal response obtained with tamoxifen and ATP (Voo = 93. 91. 0%, # = 15. 6S. Omiy was significantly inhibited (P < 0. 05) by adding estradiol 2min before initiating the measurements.

Fig. 16B shows the interactions of estradiol and tamoxifen on PE cell volume. At the same 100-nM concentration, the active (17p-estradiol) and inactive (17α-estradiol) forms of the estrogen exerted very small and opposite effects on the time course of cell shrinkage.

Figures 17A-17B show the effects of tamoxifen and ATP on intracellular Cas'ouf PE cells. In Fig. 17A, 100 P. M ATP or 100 p. M ATP + tamoxifen was applied for 20 sec as indicated by the short black bars. The drugs were washed off for 5 min between applications. Although the response attenuates, the presence of tamoxifen does not alter the magnitude of the response. Tamoxifen alone had no significant effect on Ca2' (not shown) In Fig. 17B, mean results from 7 experiments in which 20-sec applications of 100 µM ATP were alternated with 20-sec applications of 100 gM ATP + 10 1M TMX. In order to adjust for the attenuation, two sets of experiments were performed. In the first set illustrated in A, the order of drugs was 1) ATP + TMX, 2) ATP, 3) ATP + TMX and 4) ATP. In the second type of experiment the order was inverted. The magnitude of the Ca2+ response when the first application was ATP alone (A1) was compared with experiments in which the first application was with ATP + TMX (T1). Trials in which the second application was with ATP (A2) were compared with trials in which the second application was ATP + TMX (T2), and likewise for the third and fourth applications. There was no significant difference between any of the four pairs (p < 0.1, n=3-4) Detailed descriotion of the preferred embodiments The ciliary epithelium of the eye is a bilayer, comprising a deeper layer of pigmented epithelial (PE) cells and a superficial layer of nonpigmented epithelial (NPE) cells (Flg. 1). The proposed mechanism of action of ATP, tamoxifen

(TMX) and A3 receptor agonists, such as adenosine (Ado), in influencing aqueous humor secretion is shown in Fig. 1.

ATP is released from PE andlor NPE cells. ATP is then converted to adenosine by ecto-enzymes (ecto). The adenosine then binds to A3 receptors on NPE cells, resulting in opening of Cl channels. This results in an increase in aqueous humor production and increased intraocular pressure. In addition, simultaneous stimulation by ATP and tamoxifen activates Cl efflux from PE cells, leading to a net decrease in aqueous humour formation. ATP acts on P2 receptors of PE cells, promotes opening of Cl- channels, and a decrease in aqueous humor production resulting in decreased intraocular pressure.

The present invention includes the observation that the A3 subtype adenosine receptor antagonists (referred to herein as A3 antagonists) inhibit shrinkage of NPE cells as determined by measurements of cell volume in isoosmotic solution. This inhibition of cell shrinkage implies a net reduction of secretion of aqueous humor through the NPE cell membrane which would result in a reduction of intraocular pressure (Fig. 11. These A3 receptors are present on human and rabbit NPE cells and underlie the activation of NPE chloride (Cl-) channels by adenosine. In addition, it was found that the antiestrogen tamoxifen, the cafciumlcafmodulin inhibitor trifluoperazine and the muscarinic agonist carbachol all promoted cell shrinkage in PE cells. The shrinkage of PE cells implies a stimulation of a net reabsorption of aqueous humor through the PE cell membrane towards the stroma, which would result in a net reduction in aqueous humor formation and a reduction in intraocular pressure (Fig. 1). Thus, these compounds, or related compounds, can be used to lower intraocular pressure as a treatment for glaucoma and other ocular conditions in which it is desirable to lower intraocular pressure.

Measurements of short-circuit current across intact rabbit ciliary epithelium, of cell volume in suspended cultured human NPE cells, and of whole-cell currents from patch-clamped cultured human and fresh bovine NPE cells have indicated that adenosine-receptor occupancy stimulates Ci secretion in mammalian NPE cells (Carre et al., supra., 1997). As evidenced by the data presented in the examples below, these effects are mediated by A3 receptors. A3 receptors are present in both human HCE cells (a cell line of human NPE cells) and rabbit ciliary body. The A3-selective agonist 1B-MECA increased the short circuit current across rabbit iris-ciliary body in the presence of Ba2', a change consistent with an increased efflux of Cl from NPE cells. In the presence of gramicidin to isolate the Cl- conductance, 1B-MECA caused human HCE cells to shrink in a dose-dependent manner; the Kd of ~55 nM is consistent with a maximal stimulation of A3 receptors in cardiac myocytes at 100 nM 1B-MECA (Shahidullah et al., Curr. Eye Res., 16:1006.1016, 1997). The highly specific A3 agonist CI-IB-MECA also produced shrinkage of HCE cells in the presence of gramicidin. Gramicidin readily partitions into plasma membranes to form a cation-selective pore and is widely used for studying volume regulation (Hoffmann et al., Interaction of Cell Volume and Cell Function, Lang et al., eds., Springer, Heidelberg, Germany, p. 188-248, ACEP Series 14). Under these conditions, release of cell Cl becomes the rate-limiting <BR> <BR> <BR> <BR> factor in both hypo- (Civan et a)., \nvest. Ophthalmol. Vis. Sci., 35: 2876-2886, 1994) and isosmotic cell shrinkage<BR> <BR> <BR> <BR> <BR> <BR> (Carre et al., supra., 1997).

The A3 antagonists MRS 1097 and MRS 1191 were able to prevent the shrinkage induced by IB-MECA at concentrations far below their Kj for A, and A2A receptors. The A, agonist CPA did not have a consistent effect upon cell volume. The A2A agonist CGS-21680 had no effect at low concentrations. The effect of CGS-21680 on shrinkage

was only detected at a concentration 500 fold higher than the K values for the A3 receptor, and this effect was blocked by the A3 antagonist MRS-1191. The A3 antagonists MRS 1097, MRS 1191 and MRS 1523 blocked the shrinkage produced by 10 (J. M adenosine; at the concentrations used, < 20% of the A, and A2A receptors could have been occupied by MRS 1097 and < 1 % of those receptors could have been blocked by MRS 1191 and MRS 1523.

Together, these observations indicate that the adenosine-stimulated activation of Cl release by the HCE line of human NPE cells is primarily mediated by occupancy of an A3 subtype adenosine receptor.

Adenosine but not ATP shrinks nonpigmented ciliary epithelial (NPE) cells by activating Cl channels. Although adenosine had no effect on PE cells, PE cell volume was occasionally reduced by ATP, and was always reduced by simultaneous application of ATP with the antiestrogen tamoxifen. Cultured bovine PE cells were studied volumetrically by electronic cell sorting. ATP alone (> 3pM) shrank -15% of the suspensions, but had littlelno effect in most suspensions. Whole cell patch clamping indicated that this baseline response reflected activation of Cl permeant channels in a heterogeneous population of cells. The antiestrogen tamaxifen (6-10pM) enhanced the ATP-triggered shrinkage, whether or not a baseline response to ATP was detected. This was unexpected since swelling-activated Cl- channels are either blocked (in NPE cells) or unaffected (in PE cells) by tamoxifen. Tamoxifen in itself exerted no consistent effect on PE-cell volume. The tamoxifen, ATP-activated shrinkage required Cl release since the response was blocked by removing Cl and was inhibited by Cl channel blockers (NPPB and DIDS). The modulating effect of tamoxifen could have reflected > 5 actions of tamoxifen. Our data argue against actions of tamoxifen to inhibit PKC or calciumicalmodulin and on histamine or carbachol receptors. The cooperative interaction between tamoxifen and ATP was not mediated by an enhanced rise in Ca2'. The results indicate that tamoxifen interacts synergistically with ATP to activate Cl- release by the PE cells. Tamoxifen may act in part by occupying plasma-membrane estrogen-binding sites.

The present results demonstrate that tamoxifen markedly enhanced the effects of extracellular ATP on the transport properties of cultured bovine pigmented ciliary epithelial cells. The synergism was particularly clear in those preparations with little or no baseline response to ATP alone and was detected at ATP and tamoxifen concentrations likely to be physiologically and clinically relevant. In the presence of tamoxifen, an approximately half-maximal response was elicited by 3pM ATP, a concentration likely reached physiologically by ATP release into the constrained space between the PE cells and the underlying basement membrane (Mitchell et al., supra., 1998). Tamoxifen is used clinically <BR> <BR> as an antiestrogen by occupying nuclear estrogen-receptor sites (Klinge et al. , Oncologv Research, 4, : 145-150, 1992), and the concentrations applied here (6-10pu) also appear to be clinically relevant (Stuart et al., Br. J. Cancer, 66, 833- 839, 1992).

The precise signaling pathway involved in the modulating action of tamoxifen is presently unknown. In addition to binding to nuclear estrogen receptors (Klinge et al., supra.), and blocking plasma-membrane plasma-membrane activated Cl channels (Valverde et al. , Pflügers Archiv. 425 : 552-554,1993 ; Zhang et al., J. Clin. Investi. 94: 1690- 1697,1994 ; Nilius et al. , PflügersArchiv. 428: 364-371,1994 ; Wu et al., J. Physiol., 491.3 : 743-755, 1996), tamoxifen has been observed to affect: histamine receptors (Brandes et al. Biochem. Biophys. Res. Commun., 126: 905-910, 1986), muscarinic receptors (Ben-Baruch et al. Mol. Pharmacol., 21: 287-293, 1981), activation by

calcium (calmodulin (Lam, Biochem. Biophys. Res. Commun. 118: 27-32, 1984), plasma-membrane estrogen receptors (Hardy et al., FASEB J. 8: 760-765. 1994), and protein kinase C activity (O'Brien et al. , CancerRes. 45: 2462-2465, 1985). The current data indicate that four of these five latter effects play no role in the synergism between tamoxifen and ATP: (1) because histamine does not alter the response of cell volume to ATP, histamine receptors appear to be irrelevant in the present context. (2) Although carbachol itself shrinks cell volume, the response is not synergistic with ATP, and atropine does not affect the tamoxifen/ATP synergistic effect. Thus, muscarinic receptors are not involved.

(3) Protein kinase C (PKC) activity cannot be playing a major role since both activation and inhibition of enzymatic activity produced similar small reductions in volume, 1-2 orders of magnitude smaller than that triggered by tamoxifen and ATP together. At the same concentrations used here, the PKC activator Dicte and the PKC inhibitor staurosporine exert large and opposing actions on swelling-activated Cl channels of nonpigmented ciliary epithelial cells (Civan et al., Invest. Ophthalmol. Vis. Sci. 35: 2876-2886, 1994). (4) Finally, calciumicalmodulin antagonism is unlikely to mediate the synergistic effect since the shrinkage produced by another such antagonist (trifluoperazine) was independent of the presence of ATP.

It should be emphasized that although tamoxifen is not acting like carbachol or trifluoperazine, both of these compounds did reduce PE cell volume. Both carbachol and trifluoperazine reduced cell volume on their own, in the absence of ATP. Thus, compounds like trifluoperazine, which inhibit calciumicalmodulin, or substances like carbachol, which stimulate muscarinic receptors, could be used to reduce the production of aqueous humor.

The potential role of binding to plasma-membrane estrogen receptors is less clear. Hardy et al. (supra.) have reported that that tamoxifen activates a large-conductance Cl channel with an ECso~15 RM applied to NIH 3T3 fibroblasts, but only after stable transfection with MDR1 and after growth in colchicine for > 24 hrs. In contrast, no consistent effect of tamoxifen on cell volume was observed in the absence of ATP. Both the active (17-p-estradiol) and inactive (17 (x-estradiol) forms of the estrogen had only slight effects on volume, but 17 ß-estradiol did enhance the ATP-activated shrinkage slightly. Interestingly, the active (but not the inactive) form of the estrogen also reduced the synergistic effect elicited by tamoxifen and ATP. This indicates that tamoxifen and estrogen compete for binding sites and that tamoxifen is more effective than 17-ß-estradiol in activating these sites. Since the response to tamoxifen was relative rapid (within 2mins, it is likely that these receptors are located at the plasma membrane.

ATP produced an elevation in the levels on intracellular Ca2'which attenuated with repeated application, but the response was not affected by the inclusion of tamoxifen. This implies that: 1) the cell shrinkage produced synergistically by ATP and tamoxifen is not mediated by a synergistic elevation in Ca", and 2) the presence of TMX does not affect the attenuation of the Ca2'response to ATP. This attenuation has been reported previously in ciliary epithelial cells, and it has been suggested that the attenuation is mediated by the inhibition of IP3 production by increasingly elevated levels of PKC (Shahidullah et al., 1997). The inability of tamoxifen to modify the rate of attenuation supports the interpretation that tamoxifen does not act by modifying PKC in these cells.

Thus, cells derived from the pigmented ciliary epithelial cell layer can respond to extracellular ATP by releasing Cl, and this release is strongly modulated by tamoxifen. Using the fluorescent probe quinacrine, intracellular stores of ATP have been identified in NPE and PE cells in the intact epithelium and in culture (Mitchell et al., supra,

1998). The ATP can be released by both cell types (Mitchell et al., supra., 1998) and metabolized to adenosine by ectoenzymes (Mitchell et al., supra., 1998). Adenosine is known to activate Cl channels NPE cells (Carre et al., supra., 1997). Taken together with these previous observations, the current information suggests that ATP can enhance fluid movement in both directions across the ciliary epithelium: increasing secretion by stimulating NPE cells (indirectly through adenosine formation) to release Cl into the aqueous humor, and increasing reabsorption by directly stimulating PE cells to release Cl into the stroma of the ciliary processes. It is likely that one or more additional factors is necessary to coordinate these opposing purinergic actions to permit ATP to regulate net aqueous humor formation.

This putative coordination could be provided in at least two ways. In principle, ATP could be released heterogeneously throughout the epithelium. Little information is as yet available on this point, but ATP release triggered by anisosmotic swelling appears to be comparable for NPE and PE cells (Mitchell et al., supra., 1998). An alternative possible mechanism would be for a regulator, like tamoxifen, to modify the effects of purines on Cl- release at the contralateral surfaces of the ciliary epithelium. In the absence of tamoxifen, physiologic concentrations (~3j1M) of adenosine stimulate Cl- release by NPE cells (Carre et al., supra., 1997), whereas even higher concentrations of ATP usually had little effect on release by PE cells. Under these conditions; ATP release would favor secretion. In contrast, <BR> <BR> <BR> <BR> in the presence of 6-lOjlM tamaxifen, at least some of the Cl channels of the NPE cells are blocked (Wu et al., supra. ; Fig. 4), and ATP is far more effective in stimulating Cl release from PE cells. Under these latter conditions, ATP release is expected to favor reabsorption.

The data presented below demonstrates the ability of various agents to block shrinkage of NPE cells and to promote shrinkage of PE cells. The net effect of these agents would be to reduce intraocular pressure in vivo. The use of four chemical classes of A3 receptor antagonists for reduction of intraocular pressure is also contemplated: dihydropyridines, pyridines, pyridinium salts and triazoloquinazolines. These generic compounds are shown in Appendix A, along with the possible substituents at each variable position of the compound. These classes of compounds are also described in PCTIW097127177.

In addition to the particular A3 receptor antagonists discussed in the examples below: MRS-1097 (3-ethyl 5- <BR> <BR> <BR> benzyl-2-methyl-6-phenyl-4-styryl-1, 4-(#)-dihydropyridine-3,5-dicarboxylate), MRS-1191 (3-ethyl 5-benzyl-2-methyl-6- phenyl-4-phenylethynyl-1, 4- () -dihydropyridine-3, 5-dicarboxylate) (Jiang et al., J. Med. Chem. 40: 2596-2608, 1997), and MRS-1523 (Li et al., J. Med. Chem. 42: 706-721, 1999), the use of any A3 receptor antagonist or analog thereof to reduce intraocular pressure is within the scope of the invention. Other A3 receptor antagonists for use in the present <BR> <BR> <BR> invention are described by Jacobson (Trends Pharmacol. Sci. 19: 184-191, 1998) and include MRS133413-ethyl 5-14- nitrobenzyl) 2-methyl-6-phenyl-4-phenylethynyl-1, 4- () -dihydropyridine-3, 5-dicarboxylate)), MRS1067 (3,6-dichloro-2'- <BR> <BR> <BR> (isopropoxy)-4'-methylflavone), MRS-1220 (9-chloro-2-(2-furyl) -5-phenylacetylamino [1, 2,4] triazolo [1, 5-c] quinazoline), L249313 (6-carboxymethyl-5,9-dihydro-9-methyl-2-phenyl-[1,2,4]-triaz olo[5,1-a][2,7]naphthyridine) and L268605 (3- (4- methoxyphenyl) -5-amino-7 oxo-thiazolol3, 2] pyrimidine) , VUF8504 (4-methuxy-N-12 (2-pyridinyl) quinazdin-4 yl] benzamide) and the like.

In a particularly preferred embodiment, the A3 antagonist 2, 4-diethyl-1-methyl-3- (ethylsulfanylcarbonyl) -5- ethyloxycarbonyl 6 phenylpyridium iodide (MRS 1649, 11) is used to reduce intraocular pressure. The synthesis of this

compound is described in Example 15. This 3, 5-diacyl-1, 2, 4-trialkyl-6-phenylpyridinium derivative displays a uniquely high water solubility (43 mM) and can be extracted readily into ether. In addition, the prodrug form of this compound, the corresponding 1-methyl-1, 4-dihydropyridine, can be oxidized to form compound 11 in vitro in the presence of a tissue <BR> <BR> <BR> homogenate. Thus, it is contemplated that prodrug forms of A3 receptor antagonists (e. g., compounds 24 and 25) can be administered to the eye which will then be converted to the active antagonists which will reduce intraocular pressure.

The determination of whether a compound can act as an A3 receptor antagonist can be determined using standard pharmacological binding assays. Similarly, although the antiestrogen tamoxifen is exemplified herein, other antiestrogens are also contemplated, including, but not limited to, 4-hydroxy tamoxifen, toremifine, icosifene, droloxifene, LY117018, ICI 164, 384, ICI 182, 780, RU 58,668, EM-139, EM-800. EM-652, GW 5638, and the like.

Lowering of intraocular pressure with a combination of an antiestrogen and ATP, or any compound capable of promoting ATP release from NPE cells, is also contemplated. Finally, although the calciumicalmodulin antagonist trifluoperazine is exemplified herein, the use of any calmodulin antagonist for lowering intraocular pressure is also within the scope of the invention including, but not limited to calmidazolium chloride, calmodulin binding domain, chlorpromazine HCI, melittin, phenoxybenzamine HCI, trifluoperazine dimaleate, W-5, W-7, W-12 and W-13. These compounds are available from Calbiochem, San Diego, CA. The use of analogs of the above-identified compounds for the reduction of intraocular pressure is also within the scope of the present invention.

These agents can be used to treat ocular disorders resulting associated with or caused by an increase in intraocular pressure, such as glaucoma. The agents can be processed in accordance with conventional methods to produce medicinal agents for administration to mammals, preferably humans. The agents can be employed in admixture with conventional excipients, i. e. pharmaceutically acceptable organic or inorganic carrier substances suitable for parenteral, enteral (e. g. oral) or topical application which do not deleteriously react with the agents. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, gum arabic, vegetable oils, benzyl alcools, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid monoglycerides and diglycerides, pentaerythritol fatty acid esters, hydroxy methylcellulose, polyvinyl pyrollidone, etc. The pharmaceutical preparations can be sterilized and, if desired, mixed with auxiliary agents, e. g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and/or aromatic substances and the like which do not deleteriously react with the active compounds. They can also be combined where desired with other active agents, e. g., vitamins.

For parenteral application, particularly suitable are injectable, sterile solutions, preferably oily or aqueous solutions, as well as suspensions, emulsions, or implants, including suppositories. Ampules are convenient unit dosages.

For enteral application, particularly suitable are tablets, liquids, drops, suppositories or capsules. A syrup, elixir or the like can be used when a sweetened vehicle is employed. Sustained or directed release compositions can be formulated, e. g. liposomes or those wherein the active compound is protected with differentially degradable coatings, e. g. by

microencapsulation, multiple coatings, etc. It is also possible to lyophilize the agents for use in the preparation of products for injection.

Topical administration is preferred. For topical application, there are employed non-sprayable forms, viscous to semi-solid or solid forms comprising a carrier compatible with topical application and having a dynamic viscosity preferably greater than water. Suitable formulations include, but are not limited to, solutions, suspensions, emulsions, creams, ointments, powders, liniments, salves, aerosols, etc., which are, if desired, sterilized or mixed with auxiliary <BR> <BR> <BR> <BR> agents, e. g., preservatives, stabilizers, wetting agents, buffers or salts for influencing osmotic pressure, ocular permeability, etc. For topical application, also suitable are sprayable aerosol preparations wherein the active ingredient, preferably in combination with a solid or liquid inert carrier material, is packaged in a squeeze bottle or in admixture with a pressurized volatile, normally gaseous propellant, e. g. a freon. In a particularly preferred embodiment, the agent is formulated into a pharmaceutical formulation appropriate for administration to the eye, including eye drops, gels and ointments.

For systemic administration, the dosage of the agents according to this invention generally is between about <BR> <BR> <BR> <BR> 0. 1 pLglkg and 10 mglkg, preferably between about 10pglkg and 1 mglkg. For topical administration, dosages of<BR> <BR> <BR> <BR> <BR> <BR> between about 0. 000001% and 10% of the active ingredient are contemplated., preferably between about 0. 1% and 4%. It will be appreciated that the actual preferred amounts of agent will vary according to the specific agent being used, the severity of the disorder, the particular compositions being formulated, the mode of application and the species being treated. Dosages for a given host can be determined using conventional considerations, e. g., by customary comparison of the differential activities of the subject compounds and of a known agent, e. g. by means of an appropriate, conventional pharmacologic protocol. The agents are administered from less than once per day (e. g., every other day) to four times per day.

Gramicidin, adenosine, 2-chloroadenosine, tamoxifen, ATP, 17cl- and ß estradiol, DiC8, carbachol, atropine, histamine, and trifluoperazine were obtained from the Sigma Chemical Co. (St. Louis, MO). CPA (N6- cyclopentyl-adenosine), CGS-21680, IB-MECA, Cl-IB MECA and MRS-1191 (3 ethyl 5-benzyl 2-methyl-6-phenyl-4- phenylethynyl-1, 4- () -dihydropyridine-3, 5-dicarboxylate) were obtained from Research Biochemicals International (Natick, MA). Fura-2 AM was bought from Molecular Probes (Eugene, OR). MRS 1097, and MRS 1523 were provided by Drs. Kenneth A. Jacobson (National Institutes of Health) and Bruce L. Liang (University of Pennsylvania). The compound Cl-IB-MECA (MH-C-7-08; Lot No. CM-Vill-12) was provided by Research Biochemicals International as part of the Chemical Synthesis Program of the National Institute of Mental Health, Contract N01MH30003. DIDS [4,4'- diisothiocyano-2, 2'-disulfonic acid] and fura-2 AM were obtained from Molecular Probes, Inc. (Eugene, OR).

NPPB [5-nitro-2 (3 phenylpropylamino) benzoatel and staurosporine were obtained from Biomol Research Laboratories, Inc. (Plymouth Meeting, PA).

Values are presented as the means 1 SE. The number of experiments is indicated by the symbol N. The null hypothesis, that the experimental and baseline measurements shared the same mean and distribution, was tested with Student's t-test and by the upper significance limits of the F-distribution, as indicated. The t-test was applied to

compare the significance between single means or single fit parameters. The F-distribution was applied to test whether the time course of volume measurements in different suspensions could reflect a single population of data points.

Example 1 Cell culture The HCE (human ciliary epithelial) cell line (Carre et al., supra.) is an immortalized NPE cell line obtained from primary cultures of adult human epithelium. Cells were grown in Dulbecco's modified Eagle's medium (DMEM, #11965 027, Gibco BRL, Grand Island, NY) with 10% fetal bovine serum (FBS, A-1115-L, HyClone Laboratories, Inc., Logan, UT) and 50 pgiml gentamycin (#15750-011, Gibco BRL) , at 37°C in 5% CO2 (Wax et al., Exp. Eye Res. 57: 3057-3063, 1993). The growth medium had an osmoiality of 328 mOsm. Cells were passaged every 6-7 days and were studied 8- 13 days after passage, after reaching confluence.

For the tamoxifen experiments, The cells used were an immortalized PE-cell line from a primary culture of bovine pigmented ciliary epithelium. Cells were grown in Dulbecco's modified Eagle's medium (DMEM, #11965-027, Gibco BRL, Grand Island, NY; and 51 -43150, JRH Biosciences, Lenexa, KS) with 10% fetal bovine serum (FBS, A 1115- L, HyClone Laboratories, Inc., Logan, UT) and 50 4g/ml gentamycin (#15750-011, Gibco BRL) , at 37°C in 5% C02 <BR> <BR> <BR> (Yantorno et al., Exp. Eye Res. 49: 423-437, 1989). The medium had an osmolality of 328 mOsm. Cells were passaged every 6-7 days and, after reaching confluence, were suspended in solution for study within 6-10 days after passage.

Example 2 Measurement of cell volume in isosmotic solution The volume of NPE cells was measured as the movement of fluid that underlies a change in NPE cell volume, this is thought to be the same as the movement of fluid which underlines the secretion of aqueous humor (Fig. 1).

A 0. 5-ml aliquot of the HCE cell suspension in DMEM was added to 20 ml of each test solution, which contained (in mM) : 110.0 NaCI, 15.0 HEPES [4- (2-hydroxyethyl) -l-piperazineethanesulfanic acid], 2.5 Caca,, 1.2 MgCI2, 4.7 KCI, 1.2 KH2PO4, 30.0 NaHC03, and 10.0 glucose, at a pH of 7.4 and osmoiality of 298-305 mOsm. Parallel aliquots of cells were studied on the same day. One aliquot usually served as a control, and the others were exposed to different experimental conditions at the time of suspension. The same amount of solvent vehicle (dimethylformamide, DMSO or ethanol) was always added to the control and experimental aliquots. The sequence of studying the <BR> <BR> <BR> <BR> suspensions was varied to preclude systematic time-dependent artifacts (Civan et a\., Exp. Eye Res. 54: 181-191, <BR> <BR> <BR> <BR> <BR> 1992).

Cell volumes of isosmotic suspensions were measured with a Coulter Counter (model ZBI-Channelyzer 11), using a 100-, um aperture (Civan et al., supra., 19941. As previously described (Wax et al., supra., 19931, the cell volume (vc) of the suspension was taken as the peak of the distribution function. Cell shrinkage was fit as a function of time (t) to a monoexponential function: Vc - vOO + (vO vOO) [e- (t - t o) lT] where vox ils the steady-state cell volume, vo is the cell volume at the first point (to) of the time course to be fit, and T is the time constant of the shrinkage. For purposes of data reduction, the data were normalized to the first time point,

taken to be 100% isotonic volume. Fits were obtained by nonlinear least-squares regression analysis, permitting both v # and # to be variables.

In previous studies demonstrating that adenosine causes isotonic cell shrinkage by activating CI channels in NPE cells (Carre et al., supra., 1997), the levels of adenosine used were sufficiently high to activate A,, A2A, A2B or A3 adenosine receptor subtypes (Fredholm, et al., Pharmacol. Rev. 46: 143-156,1994, Fredholm et al., Trends Pharmacol.

Sci. 18: 79-82,1997 ; Klotz et ai., Naunyn Schmiedebergs Arch. Pharmacol. 357: 1-9, 1998). In order to differentiate among these receptors, the experiments were repeated in the present study using a series of agonists and antagonists selective for these receptors. As we wished to identify the effects of these receptors specifically on Cl- channels, 5 uM gramicidin D was included in all solutions to eliminate any potential contribution from K'channels. This ionophore readily partitions into plasma membranes to form a cation-selective pore, and is widely used for studying volume regulation (Hoffmann et al., in Interaction of Cell Volume and Cell Function, Lang et al., eds., Springer, Heidelberg, Germany, pp. 188-248, (ACEP Series 14), 1993)). Under these conditions, release of cell Cl- becomes the rate-limiting <BR> <BR> <BR> <BR> factor in both hypo- (Civan et al., Exp. Eye Res. 54: 181-191, 1992) and isoosmotic cell shrinkage (Carre et al., supra.,<BR> <BR> <BR> <BR> <BR> <BR> 1997).

In the presence of gramicidin, the A3 agonist IB-MECA caused the cells to shrink in a concentration-dependent manner (Figures 2A-2B). Least-squares analysis of the linearized Lineweaver-Burk plot generated from monoexponential fits of these data indicates that the apparent Kd for the IB-MECA-induced shrinkage was 55 10 nM (Figure 2C). IB- MECA is a highly selective agonist for the A3 receptor; the Kj for the A3 receptor is 50 times lower than it is for A, or A2A receptor (Gallo-Rodrigez et al, J. Med Chem. 37: 636-646,1994 ; Jacobson et al., supra., 1995; Jacobson et al., fEBSLett. 336:57-60, 1993)). Cl-IB-MECA is even more specific for A3 receptors, with a Kj for A3 receptors 2500 times lower than for A, receptors and 1400 times lower than for A2A receptors. The ability of CI-IB-MECA to induce cell shrinkage (Fig. 2D) further strengthens the hypothesis that stimulation of A3 receptors stimulates Gl channels.

It was also determined whether A3-selective antagonists could prevent the putative A3 mediated shrinkage produced by IB-MECA. Parallel aliquots of suspensions were preincubated with MRS 1097, a selective A3-seiective <BR> <BR> <BR> <BR> antagonist with Kj values for the binding (in nM) to human A, IA21A3 receptors of 5, 93014, 7701108 (Jacobson et al., <BR> <BR> <BR> <BR> <BR> <BR> Neuropharmacol. 36: 1157-1165, 1997). Preincubation for 2 min with 300 nM MRS 1097 blocked the isoomotic shrinkage characteristically triggered by 100 nM IB-MECA (Figure 3A). A second highly selective A3 antagonist, MRS 1191, (Jlang et al., J. Med Chem. 39: 4667-4675, 1996), with K, values for the binding (in nM) to human A,/A2/A3 <BR> <BR> <BR> <BR> receptors of 40,100/> 100, 000131. 4 (Jacobson et al., supra.) was also used. Preincubation for 2 min with 100 nM MRS 1097 also prevented the subsequent response to 100 nM IB-MECA (Figure 3B/. There was an indication in the results of figure 3B that MRS 1191 might actually produce a small amount of cell swelling. This was not a constant finding (Figure 4B), and may have reflected variations in the background level of A3-receptor occupancy.

The physiologic agonist reaching the adenosine receptors is likely to be the nucleoside adenosine itself, arising from release of ATP by the ciliary epithelial cells and ecto-enzyme activity (Mitchell et al., 1998, supra.). Adenosine triggers isoosmotic shrinkage of cultured human NPE cells with an EC50 of 3-10 (J. M (Civan et al., supra., 1997). In this concentration range, adenosine acts as a nonselective agonist of all four subtypes of the adenosine receptor (Fredholm

et al., supra., 1994; Fredholm et al., supra., 1997). As illustrated in Fig. 4, a 2 min preincubation with either 100 nM of the A3-selective antagonist MRS 1191 (Figure 4B) or 300 nM of the A3, selective antagonist MRS 1097 (Figure 4A) blocked the shrinkage characteristically produced by 10 p. M adenosine. MRS 1523, an A3 antagonist with Ksi values for <BR> <BR> <BR> <BR> the binding (in nM) to human A, IA21A3 receptors of 15, 600/2, 050/19 (Li et ai. J. Med. Chem. 41: 3186-3201,1998) also eliminated the actions of adenosine.

The ability of specific A3 antagonists to inhibit the response to the non-specific adenosine suggests that the contribution of the other receptors to Cl channel activation was minimal. To test this further, the effect of A, and A2A agonists were tested. CPA is an A, -selective agonist with a Kj for the A, -receptor of 0.6 nM (31). However, CPA produced no significant shrinkage at 30 nM and 1 |M (data not shown, N=3) and 3 uM (Figure 5A) . A small slow effect of uncertain significance was detected at the intermediate concentration of 100 nM (Figure 5A). Some cross- reactivity with A3 receptors might be expected, given the K ; of CPA for the A3-subtype of 43 nM (Klotz et al., supra.).

CGS-21680 is a widely used A2A agonist with an IC50 value of 22 nM for the A2A-receptor (Hutchison et al., J. <BR> <BR> <BR> <BR> <P>Pharmacol. Exp. Ther. 251 : 47-55,1989, Jarvis et al., J. Pharmacol. Exp. Ther. 253: 888-893, 1989). CGS-21680 had no detectable effect at 100-nM concentration (Figure. 5B), but did trigger isoosmotic shrinkage at a 30-fold higher concentration (3 µM) (Figure. 5C). However, the Kj for the CGS-21680 at the A3 receptor is 67 nM (Klotz et al., supra.) and thus CGS-21680 could have been acting though either A2A receptors or A3 receptors at the higher concentration. To distinguish between these possibilities, we preincubated parallel aliquots of suspensions with the antagonist 100 nM MRS 1191. MRS 1191 prevented the shrinkage produced by the high concentration of CGS-21680 (Figure. 5C, P < 0.01, F-test), indicating that the shrinkage observed was mediated by cross-reactivity with A3 receptors. As there are presently no high affinity A2B agonists (Klotz et al., supra.), the contribution of A2B receptor stimulation was not pursued, although the ability of A3 antagonists to inhibit the response to 10 \M adenosine (Figure 5) argues against a role for the A2B receptor. For example, MRS1191 at 10 µM did not displace radioligand binding to recombinant human A2B receptors, thus it is a truly selective A3 antagonist.

Example 3 Effects of IB-MECA on free intracellular calcium levels In other cells, stimulation of the A3-receptor can lead to an elevation of intracellular Ca2+ (Kohno et al., supra.), so intracellular Ca2'was monitored in HCE cells to provide an additional physiologic assay for the presence of A3 receptors. HCE cells grown on coverslips for 24-48 hrs were loaded with 1-5 uM fura-2 AM for 30-45 min at room temperature. The cells were subject to a post-incubation interval of 20-40 minutes at room temperature before recording began. The coverslips were mounted on a Nikon Diaphot microscope and visualized with a x40 oil-immersion fluorescence objective. The emitted fluorescence (510 nm) from 10-12 confluent cells was acquired at a sampling frequency of 1 Hz following excitation at 340 nm and 380 nm, and the ratio was determined with a Delta-Ram system and Felix software (Photon Technology International Inc., Princeton, NJI. Cells were perfused with an isotonic solution consisting of (in mM) 105 NaCI, 6 HEPES (acid), 4 HEPES (Na'), 2 Caca2, 1 MgCI2, 4 KCI, 5 glucose and 90 mannitol, at an osmolality of 327 mOsm, pH 7.4. The ratio of light excited at 380 nm vs. 340 nm was converted into Ca2+ concentration using the following equation (Grynkiewicz et al., J. Biol. Chem. 260: 3440-3550, 1985) :

where R,,,, and Rma, are the ratio of fluorescence at 340nM vs. 380 nM in the absence of Ca2* and in the presence of saturating Cl2*, respectively. R is the ratio measured experimentally. The S2f and S2b are the fluorescence emitted at 380 nM in the Ca2'free and Ca2+ bound states respectively. An in situ K, value for fura-2 of 350 nM was used (32).

Rin was obtained by bathing cells in a Ca2'free isotonic solution containing 10 mM EGTA and 10 (M ionomycin. Rrn. was obtained by bathing the cells in isotonic solution with 10 mM Ca2'and 10 p. M ionomycin. Both calibration solutions were maintained at pH 8.0 to facilitate Ca2'exchange through ionomycin. Background fluorescence obtained from confluent HCE cells in the absence of Fura-2 was subtracted from all traces. Mean values of Rmjn and Rma, were used to obtain the mean responses for a set of experiments. Data were analyzed using a one-sided unpaired t-test.

Superfusion of HCE cells with 100 nM IB-MECA produced a sustained, repeatable and frequently reversible increase in the intracellular Ca2+ concentration (Figure 6). The increase in Ca7'was dependent upon concentration, with 100 nM IB-MECA leading to a mean rise of 17 5 nM Cas'pu < 0.01, N=8) while 1 (J. M IB-MECA increased intracellular Ca2+ by 22 6 nM (p < 0.05, N=31. Although these changes were relatively small, they were sustained, suggesting that these increases in Ca2+ could be responsible for physiologic effects occurring on a time scale of minutes to hours.

Example 4 Reverse Transcrintase (RT) -PCR assays RT-PCR amplifications of RNA from the human and rabbit NPE cells were conducted using primers for the human A3-type adenosine receptor. RNA was isolated from the HCE human NPE cell line using Trizol Reagent (Gibco BRL). Template was synthesized in vitro from the total RNA using an RNA-PCR kit (Gene AMP, Perkin Elmer, Emeryville, CA). The reaction mixture contained MULLA reverse transcriptase, an antisense primer specific for the A3 subtype of adenosine receptor, and 1-5 ng of total RNA. Primers for the human A3 receptor (Accession No. X769811 were selected according to the Primer Select program (DNASTAR Inc., Madison, WII. The forward (sense) primer (nucleotides 914- 937) was: 5'GCGCCATCATCTTGACATCTTTT-3' (SEQ ID NO : 1). The reverse (antisense) primer (nucleotides 1373- 1355) was: 5'-CTTGGCCCAGGCATACAGG-3' (SEQ ID NO : 2). The cDNA was amplified by annealing the set of oligonucleotide primers (0.2 uM) in a final volume reaction of 100 gel in an Omnigene Thermal Cycler (#480, HYBAID, Franklin, MA). The PCR reaction was conducted for 35 cycles, each cycle comprising 1 min at 95°C, 1 min at 55°C, and 1 min at 72°C. The final extension was prolonged by 7 min at 72°C. The PCR product was reamplified using the touchdown PCR method with fresh primers and TAQ polymerase, using an annealing temperature ranging from 58°C to 48°C. The resulting PCR product was size-fractionated by electrophoresis on 1 % agarose gel. To sequence the PCR product, a band of the expected size (462 bp) was extracted from low melting-point agarose gel using a Qiaex II Agarose Gel Extraction kit (Qiaex, CA) . The purified reaction product was directly sequenced on an ABI100 sequencer by the DNA Sequencing Facility at the Cell Center of the University of Pennsylvania and compared with the predicted sequence using a DNASTAR program.

The RT-PCR assay of rabbit A3 message was conducted in the same way with the following changes. RNA was obtained from the tips of New Zealand White rabbit ciliary processes using Trizol Ragent, and was reverse transcribed using 3-6 p. g total RNA, MuLV reverse transcriptase and oligo-dT primers. The reaction was carried out at 42°C for 30 minutes, followed by 5 minutes at 95°C. The PCR reaction and reamplification steps were performed using Amplitaq Gold (Perkin-Elmer, Foster City, CA) and 10% glycerol was included in the reamplification step. Specific primers for the rabbit A3 receptor were selected from the rabbit A3 sequence (Accession No. U90718); the forward primer (nucleotides 147 167) was 5'CAACCCCAGCCTGAAGACCAC -3' (SEQ ID NO : 3) while the reverse primer <BR> <BR> <BR> <BR> (nucleotides 608-587) was 5'TGAGAAGCAGGGGGATGAGAAT-3' (SEQ ID NO : 4). Both PCR amplification and<BR> <BR> <BR> <BR> <BR> <BR> <BR> reamplification were performed for 35 cycles, each cycle consisting of 1 min at 95°C, 1 min at 58. 5°C and 1 min at 72°C : A final extension cycle of 7 minutes at 72°C minutes completed the reaction.

The product of the PCR reamplification of rabbit tissue was cloned into the PCR-TOPO vector using the TOPO TA cloning kit (Invitrogen Corporation, Carlsbad, CA) following the manufacturer's directions. After transformation, plasmids were isolated using the Wizard Plus Miniprep DNA Purification System (Promega Corporation, Madison, WI).

The cloned plasmid was cut with EcoR I restriction nuclease, and a band of approximately the expected size (479 bp) was identified by running the cut product on an agarose gel. The plasmid was sequenced from the Sp6 promoter site 80 base pairs proximal to the PCR product. The sequence was compared to the expected rabbit A3 sequence using a DNASTAR program.

From the RT-PCR amplifications of human NPE cells using primers for the human A3 receptor, a fragment of the expected 462-bp size was obtained, and was enhanced by direct PCR amplification of the product. The sequence obtained from the reamplified product was compared to the sequences of known human adenosine receptors using the DNASTAR program. The results displayed a 97.4% similarity to the published base sequence for the A3 receptor, <BR> <BR> <BR> <BR> whereas the similarity indices for the other known adenosine-receptor subtypes were all < 40% [37. 9% for A, <BR> <BR> <BR> <BR> <BR> <BR> (Accession No. 68485), 35.0% for A2A (Accession No. 68486), and 36. 7% for A2B (Accession No. 68487)]. No product was detected when reverse-transcriptase was excluded from the initial reaction mixture.

RT-PCR amplification was also conducted with rabbit ciliary processes, using primers for the rabbit A3-type adenosine receptor. The RT-PCR product was reamplified, cloned and sequenced. The sequence displayed a 97.4% similarity with the published base sequence for the rabbit A3 receptor There was only 27.9% homology between rabbit A, (Accession No. L01700) and A3 receptors. Sequences are not yet available for the remaining A2A and A2B subtypes of adenosine receptors in the rabbit. Our rabbit product also displayed 75.1 % similarity to the human A3 receptor but only < 30% similarity indices for the other human adenosine-receptor subtypes (28.2% for A,, 27.7% for A2A and 29.5% for A2B). No product was detected when reverse-transcriptase was excluded from the reaction mixture.

Example 5 Transepithelial Measurements Adult male Dutch belted rabbits weighing 1.8-2. 4 kg (Ace Animals, Boyertown, PA) were anesthetized with <BR> <BR> <BR> <BR> pentobarbital and sacrificed (Carre et al., J. Membr. Biol. 146: 293-305, 1995). After enucleation, the iris-ciliary body (I-CB) was isolated as previously described (Carre et al., 1995, supra. ) . The experiments were in accordance with the

Resolution on the Use of Animals in Research of the Association for Research in Vision and Ophthalmology.

The pupil and central iris were occluded with a Lucite disc, and the iris-ciliary body was mounted between the two halves of a Lucite chamber (1). The annulus of exposed tissue provided a projected surface area of 0.93 cm2.

Preparations were continuously bubbled with 95%02-5%C02 for maintenance of pH 7.4 in a Ringer's solution <BR> <BR> <BR> comprising (in mM) : 110.0 NaCI, 10.0 HEPES (acid), 5.0 HEPES (Na'), 30.0 NaHCO3, 2.5 CaClz, 1.2 MgCI2, 5.9 KCI, and 10.0 glucose, at an osmolality of 305 mOsm. Bad, (5 mM) was added to the solution to block K'currents. The transepithelial potential was fixed at 0 mV, corrected for solution series resistance, and the short-circuit current was monitored on a chart recorder. Data were digitally acquired at 10 Hz via a DigiData 1200A converter and AxoScope 1.1 software (Axon Instruments, Foster City, CA). Automatic averaging was performed with a reduction factor of 100 to achieve a final sampling rate of 6/min.

Adenosine in high concentration (100 pM) has been found to increase the short-circuit current across the rabbit ciliary body (Carre et al., supra., 19971. We therefore tested whether a high concentration 130 M) of the A3 agonist IB-MECA also affected short-circuit current. At this concentration, the vehicle (dimethylformamide) itself exerts significant effects (Figure 7, lowest trajectory). We corrected for the solvent effect in the following way. Solvent alone was initially introduced (to 0. 1 %), followed by the same volume of solvent (to 0.2%) containing agonist, and ending with addition of a third identical volume of solvent alone (to a final concentration of 0. 3%). The reduction in short-circuit current following the first addition of solvent was always greater than the third. In each of four experiments, we averaged the time courses of the first and third additions to estimate the effect of raising the solvent concentration without agonist from 0. 1% to 0.2% during the experimental period. Figure 7 presents the mean trajectory for the averaged solvent effect, the uncorrected mean time course following exposure to IB-MECA, and the mean trajectory 1 SE for the solvent-corrected response. The experiments were performed in the presence of 5 mM Ba2'to minimize the contribution of K currents. IB-MECA produced a significant increase in the short-circuit current; an increase in short-circuit current in the presence of Ba2'suggests that the effect is mediated by activating a Cl conductance on the basolateral membrane of the NPE cells. The sustained nature of the stimulation is consistent with the time course of the cell shrinkage in response to A3 stimulation.

Example 6 Volumetric measurements and analysis The volume of PE cells was measured as the movement of fluid that underlies a change in PE cell volume, this is thought to be the same as the movement of fluid which underlies the reabsorption of aqueous humor (Fig. 1).

After harvesting a single T-75 flask by trypsinization (Yantorno et al., supra. l, a 0. 5-ml aliquot of the bovine cell suspension in DMEM (or in Cl fée medium, where appropriate), described in Example 1 was added to 20 ml of each test solution. The standard test solution contained (in mM) 110.0 NaCI, 15.0 HEPES [4- (2-hydroxyethyl) -l - <BR> <BR> <BR> <BR> piperazineethanesulfonic acid], 2.5 CaCI2, 1.2 MgCI2, 4.7 KCI, 1. 2 KH2PO4, 30.0 NaHC03, and 10.0 glucose, at a pH of 7.4 and osmolality af 298-305 mOsm. The CI free solution comprised: 110.0 sodium methanesulfonate, 15.0 HEPES, 2.5 calcium methanesulfonate, 1.2 MgS04, 4.7 potassium methanesulfonate, 1.2 KH2PO4, 30.0 NaHC03, and 10.0 glucose, at a pH of 7.4 and osmolality of 294-304 mOsm. Parallel aliquots of cells were studied on the same day. One

aliquot usually served as a control, and the others were exposed to different experimental conditions at the time of suspension. The same amount of solvent vehicle (dimethylformamide, DMSO or ethanol) was always added to the control and experimental aliquots. The sequence of studying the suspensions was varied to preclude systematic time- dependent artifacts (Civan et al., 1994).

Cell volumes of isoosmotic suspensions were measured with a Coulter Counter (model ZBI-Channelyzer II), using a 100 hum aperture (Civan et al., 1992). As previously described (Yantorno et al. , supra. ) , the cell volume (vc) of the suspension was taken as the peak of the distribution function. Cell shrinkage was fit as a function of time (t) to the simple exponential function: Vc (vO-voo) (e-tll) +Va) (1) where Voo is the steady-state cell volume, vo is cell volume at t=O, and T is the time constant of of the shrinkage. For purposes of data reduction; the data were normalized to the first time point, taken to be 100% isotonic volume. The baseline isotonic value was 2488203 fl (meanSE, N= 15). Fits were obtained by nonlinear least-squares regression analysis, permitting both vOO and T to be variables (Carre et al., supra., 19971.

In approximately 15% of the volumetric studies, ATP produced shrinkage of the PE cells in suspension. As shown in Figure 8A, the shrinkage was faster and larger after exposure to 100pM than to lOM ATP. In contrast to the results displayed in Figures 8A and 9A--C, ATP alone exerted very little effect on cell volume in ~85% of the PE cell-suspensions studied over the concentration range 100pM-lOmM (Figs. 10A, 13A, 13C, 14A-C).

The clinically important, nonsteroidal antiestrogen tamoxifen triggered no consistent response in cell volume over a 30-min period of observation (Figs. 10A-B). However, in the presence of tamoxifen, the response to ATP was strongly enhanced. The effect was most striking in those preparations which displayed little or no shrinkage when exposed to 100RM ATP (Figs. 13A, 13C, 14A-C) or to 1 OmM ATP (Fig. 1 ou) . However, the volumetric response to ATP was also enhanced in cell preparations responsive to ATP alone (Fig. 8B). No such interactive response was observed between the corresponding nucleoside adenosine and tamoxifen (Fig. 10B).

At a constant tamoxifen concentration, ATP triggered detectable shrinkage at 10pM, but not at IM (Fig.

1 C). At 3HM ATP, the shrinkage was about half that noted with 10pM ATP (both in the presence of tamoxifen, Fig.

8B1. The effects of ATP were comparable at 10p. M and 1mM (Fig. 8C). A concentration of 100pM ATP was used in all of the subsequent experiments to ensure that the concentration of ATP was not limiting the rate of shrinkage. The choice of a tamoxifen concentration of 6-10pM was based on two considerations: 10M is the concentration used in probing Cl channels in other cells (Wu et al., supra., 1996), and the concentration needed to produce a minimum detectable effect on the response to swelling the current bovine PE cells is > 2pM and < 6jilM (Mitchell et al., Invest.

Ophthalmol. Vis. Sci. 38 (Suppl.) : S1042, 19971.

Several observations suggest that the ATP, tamoxifen-activated shrinkage involved Cl release. First, the synergism occurred even when gramicidin was present to provide a constant pathway for K'release (Civan et al., supra., 1994) (Fig. 11 A), suggesting that the reduction in volume prompted by ATP and tamoxifen was due to the activation of an anionic conductance. Second, removal of Cl from the preincubation and test solutions abolished the

synergistic response (Fig. 11A). Third, the Cl channel blockers NPPB (100pM) (Wangemann et al., supra., 1986) and DIDS (500pM) (Cabantchik et al., Am. J. Physiol., 262: C803-C827,1992) both inhibited the volume reduction (Fig.

11B).

The synergistic stimulatory effect of tamoxifen in shrinking PE cells was unexpected, given its inhibition of swelling-activated CI'channels in many cells (Valverde et al., supra.; Zhang et al., supra.; Nilius et al., supra.), including NPE cells (Wu et al., supra., 1996), and the absence of any effect on swelling activated Cl channels in PE cells (Mitchell et al., supra., 1997). Therefore, we reexamined the effect of tamoxifen on the swelling-activated Cl channels of the immortalized human NPE cells we have previously characterized (Figure 12). After hypotonic swelling, the cell volume spontaneously fell (the regulatory volume decrease, RVD), reflecting the release of KCI and secondarily water (Civan, et al., supra., 1994). Addition of tamoxifen 10 min later, after the conclusion of the RVD, did not affect cell volume, but addition 5min after hypotonic suspension reduced the magnitude of the RVD. Inclusion of tamoxifen at the time of the initial hypotonic suspension completely abolished the RVD, consistent with the earlier report (Wu et al., supra., 1996) that tamoxifen blocks swelling-activated Cl channels of NPE cells. Tamoxifen also markedly slowed the rate of hypotonic swelling (Figure 12), raising the possibility that the antiestrogen also blocks the aquaporin-1 (AQP1) water channels of the NPE cells (Stamer et al.. Invest. Ophthalmol. Ilis. Sci. 35: 3867-3872, 1994; Lee et al., Current Topics in Membranes 45 : 105-134, 1998).

The block of RVD in NPE cells by tamoxifen suggested that tamoxifen would reduce efflux of aqueous humor from NPE cells in addition to its action of stimulating reabsorption from PE cells. Thus, tamoxifen could reduce aqueous humor production by two separate mechanisms.

Example 7 Ruptured-patch whole-cell recordinn Harvested cultured PE cells were resuspended and permitted to settle and attach to glass coverslips, which were then transferred to a perfusion chamber (Carre et al., supra., 1997). Solutions were designed to isolate any Cl' current activated by ATP. Thus both internal and external solutions were devoid of K+, and the cation reversal potential was > 95 mV. The perfusate contained (in mM) : 105.0 NaCI, 6.0 HEPES acid, 4.0 HEPES Na*, 1.3 Caca2, 0.5 MgCIZ and 90.0 mannitol (pH 7.4, 316 mOsm) and the micropipette-filling solution contained (in mM): 40.0 HCI, 135.0 NMDG- OH, 95.0 CH3S04 acid, 2.0 MgATP, 0.05 GTP, 1.1 EGTA and 0.55 CaGI ; (pH 7.2, 275 mOsm). Supplementary experiments were also conducted with freshly-dissected bovine PE cells prepared by the method of Jacob et al. (Am. J.

Ph) /siol. , 261 : C1055-C1062, 1991) , as previously described (Carre et al., supra., 1997). Cells were patched while still round, usually one day after dissociation. The perfusate contained (in mM) : 105.0 NaCI, 6.0 HEPES acid, 4.0 HEPES Na', 1.3 CaCI2, 0.5 MgC12, 8.0 sucrose and 70.0 mannitol (pH 7.4, 305 mOsm) and the micropipette-filling solution contained (in mM) : 105.0 NMDG-CI, 10.0 HEPES acid, 70.0 mannitol, 2.0 MgATP, 0.01 GTP, 1.1 EGTA and 0.55 CaCI2 <BR> <BR> <BR> (pH 7.2, 286 mOsml. Cells were perfused with Na2ATP dissolved directly into isotonic solution (1. 0) or serially diluted (100 tM and 10 HM) , while NPPB was diluted 1000: 1 from a 100 mM stock in DMSO.

Data were acquired at 1 kHz using Axopatch lB eiectronics and associated headstage (Axon Instruments, Foster City, CA) and filtered at 500 Hz with a Bessel filter. The micropipettes were double-pulled from Corning No.

7052 glass, coated with Sylgard and fire polished. The membrane potential was held without series-resistance compensation at 0 mV and stepped to voltages over the range from -100 to + 100mV in 20 mV increments for 200 msec periods. The mean current measured between 150-200 msec was used to obtain the patch-clamp data used here.

The data presented in figure 2 was obtained at -60 mV [the approximate membrane potential (Green et al., Invest.

Ophthalmol. Vis. Sci., 26: 371-381, 1985)] to facilitate comparison with the volumetric data.

ATP increased the current (Figure 9A). The activated currents were likely carried by Cl as solutions were chosen to minimize cationic currents, and the Cl channe blocker NPPB (100 uM) (Wangemann et al., Pflügers Archiv. <BR> <BR> <BR> <P>407 (Suppl. 2) : S128-S141, 1986) reduced the ATP-enhanced currents at -60 mV by 56 11 % (Figure 9B, N-3). The activation of Cl channels was not restricted to the PE cell line, for ATP also stimulated currents in fresh bovine PE cells (Figure 9C) cells. Although current was activated in both fresh and cultured cells, both cell types contained a heterogeneous population with cultured cells responding in 10117 trials and fresh cells activated in 319 trials. Thus, ATP alone can activate Cl- curents directly, but only in half the cells.

Example 8 Measurements of Intracellular Ca2' Bovine PE cells grown on coverslips for 2-4 days were loaded with 5 pM fura-2 AM for 30-45 min at room temperature, and then rinsed and maintained in fura-free solution before beginning data acquisition. The coverslips were mounted on a Nikon Diaphot microscope and visualized with a x40 oil-immersion fluorescence objective. The emitted fluorescence (510 nm) from 10-12 confluent cells was sampled at 1 Hz following excitation at 340 nm and 380 nm, and the ratio determined with a Delta-Ram system and Felix software (Photon Technology International Inc., Princeton, NJ).

The ratio of light excited at 340 nm to that at 380 nm was converted into Ca2'concentration using the method of Grynkiewicz et al. (J. Biol. Chem. 260: 3440-3450, 1985). An in situ Kd value for fura-2 of 350 nM was used (Negulescu et al., Meth. Enzymol. 192: 38-81, 1990). Rmin was obtained by bathing cells in a Cas'fée isotonic solution of pH 8.0 containing 10 mM EGTA and 5 ptM ionomycin. RmaX was obtained by bathing the cells in isotonic solution with 1.3 mM Ca2'and 5 pM ionomycin. Calibration was performed separately for each experiment. Baseline levels from PE cells in the absence of fura-2 were subtracted from records to control for autofluorescence. Experiments were performed predominantly at room temperature, but several trials were performed at 37° C using a temperature control unit from Warner Instrument Corp., iHamden, CT). Cells were perfused with an isotonic solution containing (in mM) 105 NaCI, 6 HEPES (acid), 4 HEPES (Na*), 1.3 CaCI2, 1 MgCI2, 4 KCI, 5 glucose and 90 mannitol, at an osmolarity of 317 mOsm, pH 7.4. Tamoxifen was stored as a 10 mM stock in ethanol for 2 days. In comparing the effects of ATP and of ATP + tamoxifen, 0. 1% ethanol was also added to the solutions containing ATP alone.

Example 9 Interaction with histamine and muscarinic receptors In addition to its actions on nuclear estrogen receptors (Klinge et ai. , supra. ) and swelling-activated Cl channels (Valverde et al., supra.; Zhang et al., supra.; Nilius et al., supra.; Wu et al., supra.), tamoxifen has been reported to produce multiple other effects. Experiments were conducted in order to address the possibility that one or more of the following known actions of tamoxifen may be involved in ATP, tamoxifen-activated shrinkage: interaction

with histamine and muscarinic receptors, antagonism of calciumicalmodulin, inhibition of protein kinase C, and antagonism of plasma- or nuclear membrane estrogen receptors.

The antiestrogens are known to interact with histamine (Brandeset al. , supra. ) and muscarinic receptors (Ben- Baruch et al., supra.) in other preparations. Figure 13A indicates that 10pM histamine did not enhance the volumetric response to 100, uM ATP (N -4) . The nonmetabolizable muscarinic agonist carbachol did trigger a prompt shrinkage in the presence of lOOM ATP (Fig. 13A, N=4) . However, carbachol triggered approximately the same response whether <BR> <BR> <BR> <BR> or not ATP was present, and 10juM atropine abolished that response (Fig. 13B, N-3) . In contrast, tamoxifen had little effect in the absence of ATP (Figs. 8C, 10A and 10C), and 10M atropine did not alter the response to the combined presence of tamoxifen and ATP (Fig. 13C, N=4). Figure 13 indicates that the volumetric actions of tamoxifen cannot be mediated by either histamine or muscarinic receptors.

However, the results do show that carbachol can act alone to reduce PE cell volume. This suggests that carbachol, or similar agents, can stimulate fluid reabsorption by the PE cells and thus reduce the net production of aqueous humor.

Example 10 Antanonism of calciumlcalmodulin Tamoxifen can inhibit calcium/calmodulin at the same concentration (lOjuM) typically used to block Cl channels in NPE cells (Lam, supra.; Wu et al., supra., 1996). In PE cells, trifluoperazine triggered a partial shrinkage of the bovine PE cells in the presence of ATP but this effect was not synergistic as similar effects were observed in the absence of ATP (Figure 14). This suggests that although calcium/calmodulin can modulate cell volume, it does not mediate the synergistic action of tamoxifen. Thus, inhibitors of calciumicalmodulin can provide a separate additional route by which fluid efflux from the PE cells can be stimulated and the net production of aqueous humor reduced.

Example 11 Protein kinase C inhibition Tamoxifen can also inhibit protein kinase C (PKC), with a K, of 5-100 uM depending on the assay system (O'Brien et al., supra.). However, inhibiting PKC activity with the PKC inhibitor staurosporine produced a small, insignificant shrinkage in the presence of lOOM ATP, substantially less that that produced by tamoxifen (Fig. 15).

Activating PKC with Dicte in the presence of 100. M ATP also had no significant effect on cells volume. Thus, the synergistic effect of tamoxifen cannot be mediated by its inhibition of baseline PKC activity.

Example 12 Antanonism of estrogen receptors In the presence of 100nM 17ß-estradiol, the response to the combined application of ATP and tamoxifen was reduced, consistent with the known antiestrogen action of tamoxifen (Fig. 16A, ? 4, P< 0.05, F-distribution). The 17p-estradiol also reduced the synergistic shrinkage produced by ATP and tamoxifen in another series of four experiments (P < 0.01, F-distribution, data not shown), whereas the inactive estrogenic isomer 17a-estradiol had no significant effect (P > 0.05, F-distribution). In the absence of tamoxifen, the 17a- and 17 ß estradiols exerted very

small effects on cell volume (Fig. 16B, N=4) . The data are consistent with the possibility that tamoxifen and estrogen compete for occupancy of the same population of receptors.

Example 13 Potential role of Ca2' Non-pigmented ciliary epithelial cells show a synergistic elevation in free intracellular Ca2'concentration (Ca2') upon simultaneous presentation of certain drug pairs, and this synergism may involve the activation of the GiG- <BR> <BR> <BR> <BR> protein (Farahbakhsh et al., Exp. eye Res. 64: 173-179, 1997). As ATP can activate Gj in a variety of tissues (Murthy et al., J. Biol. Chem. 273:4695-4704, 1998), it was determined whether the signaling cascade for the synergistic shrinkage produced by tamoxifen and ATP could reflect a synergistic change in Ca2'+i. Tamoxifen (10 pu) itself triggered no significant change (A) in Ca2+i(#=7#6nM, N-4). Although Ca increased in response to both ATP and ATP + TMX, the comparison of the response was complicated by the attenuation of the Ca2i spike with repeated exposure, and the variation between preparations. A 3-min application of either 100µM ATP or 100juM ATP + 10 (J. M TMX usually produced an elevation in Ca2', but it was difficult to elicit a response of similar magnitude to a second application 5min later. Elevating the temperature to 37° C did not eliminate the attenuation.

Nevertheless, it did prove possible to compare the magnitudes of successive Ca2t responses when each drug application was limited to periods of 20sec (Fig. 17). Experiments were performed by alternating 20-sec exposures to <BR> <BR> <BR> <BR> 100iM ATP + IO) J. M TMX with 20sec exposures to 100juM ATP alone (including 0. 1% ethanol as a vehicle control for the TMX). Cells were washed in isotonic solution for 5 min between drug applications, and 4-5 applications were possible per trial (Fig. 17A). The order of drug application shown in figure 10A, beginning first with 100 juM ATP + 10pM TMX, is termed the T series. A parallel set of experiments termed the A series was performed which began with the application of ATP alone followed 5min later by ATP + TMX.

To check for synergism while compensating for the attenuation, the responses to each application were compared for those experiments where ATP was first added (A series) with where ATP+TMX was first added (T series). Comparing the responses to successive applications of drugs, it is clear that there was no significant difference between the two series, whether ATP alone or ATP+TMX was added at a given point in time (Figure 17B). The presence of TMX did not affect the size of the Ca2'response to ATP regardless of whether it was included in the first, second, third or fourth application (P > 0.05 for applications 1-4, N=3-4). We conclude that ATP and tamoxifen did not produce a synergistic elevation in the level of intracellular Cl2'.

Example 14 In vivo animal model A rabbit model is used to determine the ability of A3 subtype adenosine receptor antagonists, antiestrogens and calmodulin antagonists to reduce intraocular pressure. Ten normal New Zealand White rabbits are used for the study, sedated, and their intraocular pressure is measured by standard optometric methods for several days at various times of the day to account for normal pressure variations. Once the average baseline pressure of each obtained, five rabbits are assigned to one of two groups. In the first group, one eye is administered vehicle (e. g., corn oil or dimethyl

sulfoxide (OMSO)) in the form of liquid drops and the other eye is left as an untreated control. In the second group, one eye is administered vehicle plus test compound in the form of liquid drops, and the other eye is left as an untreated control. The test compound is administered at a concentration ranging from about 1 nM to 100 mM to see a dose response relationship of intraocular pressure reduction. Intraocular pressure is then measured several hours after the administration to determine reduction of intraocular pressure by the test compound.

Example 15 Svnthesis of MRS-1649 and related A recentor anta4onists Materials. lodomethane was purchased from Fluka (Buchs, Switzerlandl. lodoethane and 1- iodopropane were purchased from Aldrich (Milwaukee, WI). PBS (1 X pH 7.4) was purchased from Biofluids, Inc.

(Rockville, MD). Starting 3,5-diacyl-2, 4-dialkylpyridine and dihydropyridine derivatives were described previously (Li et al., J. Med. Chem. 41: 3186-3201, 1998; Li et al., J. Med Chem. 42: 706-721, 1999). All other materials were obtained from commercial sources.

Proton nuclear magnetic resonance spectroscopy was performed on a Varian GEMINI-300 spectrometer, and all spectra were obtained in CDCI3. Chemical shifts (#) relative to tetramethylsilane are given. Chemical ionization (Cl) mass spectrometry was performed with a Finnigan 4600 mass spectrometer, and electron-impact (El) mass spectrometry with a VG7070F mass spectrometer at 6 kV. Elemental analysis was performed by Galbraith Laboratories, Inc. (Knoxville, TN) and/or Atlantic Microlab, Inc. (Norcross, GA).

General Procedure for Preparation of Pyridinium Salt (10, 11, 14-23) by Quaternary <BR> <BR> <BR> <BR> Amination of 3, 5-Diacyl-2, 4-Dialkylpyridine Derivatives with lodomethane: A mixture of a 3, 5-diacyl- <BR> <BR> <BR> <BR> <BR> 2, 4-dialkylpyridine derivative (14 mg, 0.038 mmol) and iodomethane (59 mg, 0.38 mmol) in 2 mL of anhydrous nitromethane was sealed in a Pyrex tube and was heated at 80 °C for 2 days. After the mixture cooled to room temperature, the solvent and excess Mel were removed under reduced pressure to leave a yellow oil. It was applied to TLC separation (ethyl acetate: petroleum ether = 1 : 4 (vit) for the first development; methanol: chloroform = 1 : 5 (viv) for a second development and ethyl acetate: petroleum ether = 1 : 1 (vit) for a third development] and 9.5 mg of the desired product (Pyridinium Salt, such as MRS 1649,11) was afforded as a yellow solid (yield: 49%). If methanol or acetone was used as the solvent, the yield was much lower than with nitromethane.

HPLC results showed that 11 is free of the starting 2 (2, 4-diethyl-3- (ethylsulfanylcarbonyl) -5- ethyluxy-carbonyl-6 phenylpyridine) . The mobile phase used for the analysis cnnsisted af methanol, acetonitrile and water (45: 45: 10). At a flow rate of 1.0 mL/min with a 4.6x250 mm (internal diameter) reverse-phase 300 A C-18 column operated at ambient temperature, 11 had a retention time of 2.3 min (purity >99%). CHN analysis of 11: Calcd for C22H281NO3S C : 51.47%, H: 5.50%, N: 2.73%. Found: C: 51.42%, H: 5.14%, N: 2.43%. HR-MS (FAB, m-b): Calcd for C22H28NO3S (M+-l) : 386.1790. Found: 386.1776. UV spectra was measured using a Beckman DU 640 Spectrophotometer. In methanol at ambient temperature, 11 had a Xmax ~ 203 nm, Mal = 6.65x104 Imol-1cm-1; #max = 224 nm, £mal = 3.30x104 Imol cm-1; #max = 288 nm, Emax = 9. 9.62x103 Imol-1 cm-1.

The water solubility of 11 was measured by the following method. 100 µL of de-ionized water was saturated with 5 mg 11 with heating. After cooling to room temperature and the disappearance of turbidity, 50/iL of the clear supernatant was withdrawn and lyophilized to give 1.1 mg of 11. The water solubility of 11 was calculated to be 42.8 mM at room temperature.

1-Methyl-2-methyl-4-ethyl-3-(ethylsulfanylcarbonyl)-5-ethylo xycarbonyl-6-phenylpyridinium Iodide (10) 'H-NMR 8 : 0.88 (t, J- 6.9 Hz, 3 H), 1.26 (t, J= 7.5 Hz, 3 H), 1.33 (t, J = 7.5 Hz, 3 H1, 2.69 (s, 3 H), 2.79 (q, J = 7.5 Hz, 2 H), 3.24 (q, J - 7.5 Hz, 2 H), 4.01 (q, J = 6.9 Hz, 2 H), 4.17 (s, 3 H), 7. 49-7. 53 (m, 3 <BR> <BR> <BR> H), 7. 65-7. 68 (m, 2 H). MS (CIINH3) : m/z 500 (MH+) , 358 (MH+-Me-I), 297 (MH'-Me-i-SEt). K, (hA,) -379 nM.

1-methyl-2,4-Diethyl-3-(ethylsulfanylcarbonyl-5-ethyloxycarb onyl-6-phenylpyridinium Iodide (MRS 1649, 11) <BR> <BR> <BR> 1HNMR6 : 0.86 (t, J = 7. 2 Hz, 3 H1, 1.32 (t, J= 7. 8 Hz, 3 N1, 1.41 (t, J- 7. 8 Hz, 3 H), 1. 44 (t, J -. 7.8<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> H), 4.22 (s, 3 H1, 7. 56-7. 62 (m, 3 H), 7.72-7. 75 (m, 2 H). MS (CII : mlz 514 (MD, 372 (MH Me-l) .

Ki(hA3)=219 nM.

1-Methyl-2,4-diethyl-3-(ethylsulfanylcarbonyl)-5-(2-fluoroet hyloxycarbonyl)-6-phenyl pyridinium Iodide (14) <BR> <BR> <BR> ¹H-NMR #: 1.20 (t, J = 7.5 Hz, 3 H1, 1.39 (t, J = 7.5 Hz, 3 H1, 1.46 (t, J ° 7.5 Hz, 3 H1, 2.79 (q, J - 7.5<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 7. 47-7. 50 (m, 3 H), 7. 64-7. 67 (m, 2 H). MS (CIINH3) : m/z 390 (MH+Me-I). Ki(hA3)-364 nM.

1-Methyl-2-ethyl-4-ethyl-3-(ethylsulfanylcarbonyl)-5-propylo xycarbonyl-6-phenylpyridinium Iodide (15) <BR> <BR> <BR> ¹H NMR #: 0.68 (t, J - 7.8 Hz, 3 H), 1.25 (t, J = 7.8 Hz, 3 H), 1.39 (m, 2 H), 1.49 (t, J = 7.8 Hz, 3 H),<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> (t, J - 6.9 Hz, 2 H), 4.21 (s, 3 H), 7.69-7. 76 (m, 5 H). MS (CIINH3) : m/z 386 (MH+-Me-I). Ki(hA3)= 483 nM.

1 Methyl-2-ethyl-4-propyl-3-(ethylsulfanylcarbonyl)-5-propylox ycarbonyl-6-phenylpyridinium Iodide (16) <BR> <BR> <BR> ¹H NMR # : 0.67 (t, J - 7.8 Hz, 3 H), 1. 04 (t, J - 7.8 Hz, 3 H), 1. 40 (m, 2 H), 1.48 (t, J = 7.8 Hz, 3 H), <BR> <BR> <BR> <BR> 1. 55 (t, J = 7.8 Hz, 3 H1, 1.74 (m, 2 H1, 2.87 (t, J = 7.8 Hz, 2 H1, 3.27 (q, J = 7.8 Hz, 2 H1, 3.42 (q, J - 7.8<BR> <BR> <BR> <BR> Hz, 2 H), 4.05 (t, J = 7.8 Hz, 2 H), 4. 20 (s, 3 H1, 7. 62-7. 74 (m, 5 H). MS (CIINH3) : miz 558 (M++NH4), 525<BR> <BR> <BR> <BR> (M+-1-Me), 414 (M+-1), 369 (M+-1-1-Me-Et). Ki(hA3)=2.02 µM.

1-Methyl-2-ethyl-4 propyl-3-(3-fluorpropylsulfanylcarbonyl)-5-propyloxycarbonyl -6-phenylpyridinium Iodide <BR> <BR> <BR> (17) <BR> <BR> <BR> <BR> ¹H-NMR #: 0.68 (t, J = 7.8 Hz, 3 H), 1.04 (t, J = 7.8 Hz, 3 H), 1.41 (m, 2 H), 1.55 (t, J = 7.8 Hz, 3 H), <BR> <BR> <BR> <BR> 1.73 (m, 2 H1, 2.16 (m, 2 H1, 2.88 (m, 2 H1, 3.35 (q, J = 7. 8 Hz, 2 H), 3.41 (t, J = 6.9 Hz, 2 H), 4.06 (t, J - 6.9 Hz, 2 H1, 4.22 (s, 3 H), 4.55 (t, J = 6.0 Hz, 1 H1, 4.71 (t, J = 6.0 Hz, 1 H), 7.68-7. 75 (m, 5 H). MS (CIINH3) : miz 432 (MH+-Me-I). Ki(hA3) =465 nM.

1-Methyl-2-ethyl-4-(2-acetylthioethyl)-3-(ethylsulfanylcarbo nyl)-5-propyloxycarbonyl-6-phenylpyridinium Iodide(18)

'H-NMR 8 : 0. 66 (t, J = 7.5 Hz, 3 H1, 1.37 (m, 2 H), 1.39 (t, J = 7.8 Hz, 3 H), 1.45 (t, J - 7.2 Hz, 3 H1, <BR> <BR> <BR> <BR> <BR> <BR> 2.35(s, 3H), 2.89-3.02 (m, 4 H), 3.11 (m, 2 H), 3.28 (q, J = 7. 2 Hz, 2 H), 4.00 (t, J = 6. 9Hz, 2H1, 4.23 (s, 3<BR> <BR> <BR> <BR> <BR> <BR> H), 7.53-7. 55 (m, 3 H), 7.67-7. 70 (m, 2 H). MS (CIINH3) : m/z 460 (MH+-Me-I). Ki(hA3)=538 nM.

1-Methyl-2-ethyl-4-(2-phthalimidoethyl)-3-(ethylsulfanylcarb onyl)-5-ethyloxycarbonyl 6-phenylpyridinium lodide (19) <BR> <BR> <BR> <BR> 'H-NMR 8 : 0. 94 (t, J » 6.9 Hz, 3 H), 1. 34 (t, J = 7.2 Hz, 3 H), 1.48 (t, J - 7.2 Hz, 3 H), 2.94 (q, J - 6.9<BR> <BR> <BR> <BR> <BR> <BR> <BR> Hz, 2 H), 3. 15 (t, J = 7. 8 Hz, 2 H), 3. 24 (q, J = 7. 2 Hz, 2 H), 4. 01 (t, J = 7. 8 Hz, 2 H), 4. 21 (s, 3 H), 4.25 (q, J<BR> <BR> <BR> <BR> <BR> <BR> - 7.2 Hz, 2 H), 7.51 (m, 3 H/, 7.65 (m, 2 H), 7.78 (m, 2 H), 7.89 (m, 2 H). MS (CIINH3) : m/z 517 (MH+ -Me-I).

Ki(hA3)= 1.25 µM.

1-Methyl-2-butyl-4-ethyl-3-(ethylsulfanylcarbonyl)-5-ethylox ycarbonyl-6-phenylpyridinium Iodide (20) <BR> <BR> <BR> <BR> ¹H-NMR #: 0.90 (t, J = 7.5 Hz, 3 H), 1.04 (t, J = 7.5 Hz, 3 H), 1.29 (t, J = 7.5 Hz, 3 H), 1. 34-1. 43 (m, 2<BR> <BR> <BR> <BR> <BR> <BR> <BR> H), 1.46 (t, J = 7.5 Hz, 3 H), 1.84 (m, 2 H), 2.76 (q, J = 7.5 Hz, 2 H1, 2.88 (t, J = 7.5 Hz, 2 H), 3. 16 (q, J =<BR> <BR> <BR> <BR> <BR> <BR> 7.5 Hz, 2 H), 4.05 (q, J = 7.5 Hz, 2 H), 4.26 (s, 3 H), 7.52-7. 55 (m, 3 H1, 7.69-7. 72 (m, 2 H). MS (CIINH3) : m/z 400(MH+-Me-I). Ki(hA3)=436nM.

1-Methyl-2-cyclobutyl-4-ethyl-3-(ethylsulfanylcarbonyl)-5-et hyloxycarbonyl-6-phenyl pyridinium Iodide (21) <BR> <BR> <BR> <BR> 'H-NMR 5 : 0.99 (t, J = 7.5 Hz, 3 H), 1.29 (t, J = 7.5 Hz, 3 H), 1. 45 (t, J = 7.5 Hz, 3 H), 1.88-1. 97 (m, 1<BR> <BR> <BR> <BR> <BR> <BR> <BR> H), 1.97-2. 07 (m, 1 H), 2. 18-2. 32 (m, Z HI, 2. 53-2. 65 (m, 2 H), 2.71 (q, J - 7.5 Hz, 2 H1, 3.13 (q, J = 7.5 Hz, 2 H), 3.81 (m, 1 H), 4.01 (q, J = 7.5 Hz, 2 H), 4.23 (s, 3 H), 7.54-7. 56 (m, 3 H), 7.73-7. 75 (m, 2 H).

MStCW : m/z 398 (MH+-Me-I). Ki(hA3)= 1.41 µM.

1-Methyl-2-(2-benzyloxylethyl)4-propyl-3-(ethylsulfanylcarbo nyl)-5-propyloxycarbonyl-6-phenylpyridinium lodide (22) <BR> <BR> <BR> <BR> ¹H-NMR #: 0.69 (t, J = 7.2 Hz, 3 H/, 1.02 (t, J = 7.2 Hz, 3 H1, 1.44 (t, J = 7.2 Hz, 3 H), 1.45 (m, 2 H), <BR> <BR> <BR> <BR> <BR> <BR> <BR> 1.68 (m, 2 H1, 2.71 (m, 2 H1, 3.17 (q, J = 7.2 Hz, 2 H), 3.24 (t, J = 7. 2 Hz, 2 H), 3. 99 (t, J = 7.2 Hz, 2 H), 4.02 (q, J = 7.2 Hz, 2 H1, 4.25 (s, 3 H), 4.58 (s, 2 H), 7.29-7. 35 (m, 5 H), 7.53-7. 56 (m, 3 H), 7.68-7. 71 (m, 2 H). MS (CIINH3) : m/z 648 (MD, 506 (MH+ -Me-1), 445(MH+Me-l-SEt). Ki(hA3)= 348 nM.

1-Methyl-2,4-diethyl-3-(ethylsulfanylcarbonyl)-5-ethyloxycar bonyl-6-cyclopentylpyridinium Iodide (23) <BR> <BR> <BR> <BR> ¹H-NMR # : 1.10 (t, J = 7.5 Hz, 3 H), 1.32 (t, J = 7. 5 Hz, 3 HI, 1.41 (t, J = 7. 5 Hz, 3 Hl, 1.44 (t, J = 7.5 Hz, 3<BR> <BR> <BR> <BR> <BR> <BR> <BR> H1, 1.66 (m, 2 H), 1.95 (m, 7 H), 2.62 (q, J = 7. 5 Hz, 2 H), 2. 811q, J=7. 5Hz, 2H1, 3.97 (q, J = 7. 5 Hz, 2 H),<BR> <BR> <BR> <BR> <BR> <BR> 4.28 (s, 3 H), 4. 40 (q, J = 7.5 Hz, 2 H). MS (Cl/NH3): m/z 364 (MH+-Me-I). Ki(hA3)=695 nM.

1-Ethyl-2,4-diethvl-3-(ethylsulfanylcarbonyl)-5-ethyloxycarb onyl-6-phenylpyridinium Iodide(12) <BR> <BR> <BR> <BR> 'H-NMR 5 : 0.89 (t, J = 7.5 Hz, 3 H), 1.28 (t, J = 7.5 Hz, 3 H1, 1.39 (t, J = 7.5 Hz, 3 H), 1.44 (t, J = 7.2<BR> <BR> <BR> <BR> <BR> <BR> <BR> Hz, 3 H), 2.79 (q, J= 7. 5 Hz, 2 H), 2. 94 (t, J= 7. 5 Hz, 3 H), 3. 11 (q, J = 7. 5 Hz, 2 H1, 3.34 (q, J= 7.5 Hz, 2<BR> <BR> <BR> <BR> <BR> <BR> H), 4.02 (q, J = 7. 2 Hz, 2 H), 5.20 (q, J = 7.5 Hz, 2 H1, 7. 52-7. 58 (m, 3 H), 7.68-7. 71 (m, 2 H). MS (CIINH3) : miz 372 (MH+.Et-I). Ki(hA3)= 577 nM.

1-Propyl-2,4-diethyl-3-(ethylsulfanylcarbonyl)5-ethyloxycarb onyl-6-phenylpyridinium Iodide (13)

4.01 (q, J = 7.2 Hz, 2 H), 4.29 (q, J = 7.2 Hz, 2 H), 5.22 (q, J = 7.2 Hz, 2 H), 7.51-7. 54 (m, 3 H), 7. 68-7. 71<BR> <BR> <BR> <BR> (m, 2 H). MS (CIINH3) : miz 372 (MH+-Pr-I). Ki(hA3)= 1.35 µM. <BR> <BR> <BR> <BR> <P> General Procedure for Preparation of 1-Methyl Dihydropyridines {24 and 25) by Alkylation of 3, 5-<BR> <BR> <BR> <BR> Diacyl-2, 4-Dialkyl-1, 4-Dihydropyridine Derivatives with lodomethane (Scheme 1): A solution of the<BR> <BR> <BR> <BR> appropriate DHP (2, 4-diethyl-3- (ethylsulfanylcarbonyl) -5-ethyloxycarbonyl-6-phenyl-1, 4-dihydropyridine, 15 mg, 0.04 mmol) in 2 mL of anhydrous THF was treated with NaH (60%, 2 mg, 0.08 mmol) at room temperature under stirring for 5 min. Then iodomethane (28 mg, 0.2 mmol) was added, and the reaction mixture was stirred for another 10 min (monitor by TLC). At completion the reaction mixture was applied to TLC separation (ethyl acetate: petroleum ether - 1: 19 vit), and 11 mg of 24 was obtained (yield: 71 %).

1-Methyl-2,4-diethyl-3-(ethylsulfanylcarbonyl)-5-ethyloxycar bonyl-6-phenyl-1,4-dihydropyridine (24) <BR> <BR> <BR> 1H NMR a : 0.85 (t, J = 7.2 Hz, 3 H), 0.93 (t, J = 7.2 Hz, 3 H), 1. 20 (t, J = 7.2 Hz, 3 H), 1.29 (t, J = 7.2<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> J = 7.2 Hz, 2 H), 4.02 (t, J = 7.2 Hz, 1 H), 7.20 (m, 2 H/, 7.38-7. 41 (m, 3 H). MS (CIINH3) : mlz 388 (MH').

1-Methyl-2,4-diethyl-3-(ethylsulfanylcarbonyl)-5-ethyloxycar bonyl-6-cyclopentyl-1,4-dihydropyridine (25) <BR> <BR> <BR> 'H-NMR 5 : 0.78 (t, J = 7.8 Hz, 3 H), 1.11 (t, J - 7. 8 Hz, 3 H), 1.28 (t, J - 7. 8 Hz, 3 H), 1.32 (t, J - 7.8<BR> <BR> <BR> <BR> Hz, 3 H), 1. 46 (m, 2H), 1.60-1. 78 (m, 7H), 2.10 (m, 2 H), 2.60-2. 67 (m, 1 H), 2.89 (q, J = 7.8 Hz, 2 H), 3. 01- <BR> <BR> <BR> <BR> 3.13 (m, 1 H), 3.15 (s, 3 H), 4.10 (t, J = 6.0 Hz, 1 H), 4.13-4. 26 (m, 2 H). MS (CIINH3) : m/z 380 (MH'), 318 (M+-SEt, base).

Chemical Transformation of 24 to 11 through Oxidation with Iodine (Scheme 1) : A solution of 24 (5 mg, 0.013 mmol) in 0.5 mL of dry nitromethane was treated with iodine (10 mg, 0.040 mmol) at room temperature with stirring for 1 day (monitor by TLC). At completion the reaction mixture was applied to TLC separation (ethyl acetate: petroleum ether = 1 : 4 viv for the first development then 1: 1 for a second development), and 2 mg of a yellow solid was obtained (yield: 30%), with'H-NMR and MS data consistent with those of compound 11.

Oxidation of a 1-Methyl-1, 4-Dihydropyridine Derivative (24) in the Presence of Rat Brain Homogenate (Bodor et al., J. Med. Chem. 26: 528-534, 1983; Wu et al., J. Med Chem. 32: 1782-1788, 1999).

The rat brain homogenate was prepared by the following method. One rat (1 kg) was killed and the brain (weighing 2.26 g) was removed, and homogenized in 12 mL PBS (Biofluids, Inc., 1X pH 7. 4). The homogenate was centrifuged at 12. 000X rpm, and the supernatant was used. 5 mg of 24 dissolved in 0.2 mL of DMSO was mixed with 10 mL of brain homogenate (initial concentration of 1.27 mM), which was previously equilibrated to 37 °C in a water bath incubator, and shaking was continued at that temperature. Aliquots of 500, uL were withdrawn at 2,4, 8,16, 32,64, 128,256, 768 min (2X each) from the test medium, added immediately to 3 mL of ice-cold ethyl ether, shaken vigorously, and placed in a freezer. When all samples had

been collecte, and the ether layer of each sample was separated. After evaporation of the ether, each residue was dissolved in 200, uL methanol, filtered through Whatman 1 filter paper and analyzed hy HPLC.

Pyridinium salt 11 could be generated through oxidation of the corresponding reduced precursor, 1- methyl-2, 4-diethyl-3- (ethylsuifanylcarbonyl) -5-ethyloxycarbonyl-6-phenyl-1, 4-dihydropyridine, 24. The conversion of 24 to 11 by chemical means (iodine in nitromethane) and during incubation at 37 C with rat brain membranes, to simulate in vivo conditions, was studied. The chemical conversion occurred readily, and the time course of the biochemical oxidation was recorded. At regular time points, aliquots were removed from the incubation mixture, extracted with ether, and both the precursor and the pyridinium salt were assayed in the evaporated organic phase using HPLC. The oxidation occurred cleanly with a t112 of approximately 47 min.

The 1-methyl dihydropyridine 24 (precursor of MRS 1649) was found to bind selectively to human A3 adenosine receptors. At human A3 receptors, the Kj value was 379 122 nM (n - 4) . The Kj value at rat A <BR> <BR> <BR> receptors was 28.4 2. 5, uM (n = 3). At rat A2A receptors, the percent displacement of specific radioligand binding was 48 7% at 100 nom. Therefore to demonstrate the prodrug principle, i. e. an inactive prodrug that could be converted to a selective adenosine antagonist, the corresponding 6-cyclopentyl dihydropyridine 25 was <BR> <BR> <BR> prepared. The 6-cyclopentyl analogue, 1-methyl- 2, 4-diethyl-3 (ethylsulfanyicarbonyl) -5-ethylaxyzarbonyl 6 cyclopentyl-1, 4-dihydro pyridine (25), was shown to increase affinity at human A3 receptors upon oxidation to the corresponding pyridinium salt (23). Compound 25 had a Kj value at human A3 receptors of 6.40 0.78 //M, while 23 was an order of magnitude more potent (Kj of 695 nM), suggesting a prodrug scheme. At rat A, receptors, both the precursor, compound 25 (34 1 % displacement at 100, uM) and the oxidized product, 23 (Kj value 11. 5, uM) bound only weakly.

Thus, in the present study, one reduced precursor, 25, was found to be clearly less potent than the corresponding pyridinium salt, 23, in binding to adenosine receptors, especially the A3 subtype, and another precursor, 24, was found to have the identical human A3 receptor affinity before and after oxidation. Thus, depending on the structure of the pyridine substitutents, one can determine the degree to which the antagonist requires pre-activation of a prodrug form in order to acheive antagonism of A3 receptors.

Example 16 Pharmacolonv Adenylate cyclase assay. Adenylate cyclase assays were performed with membranes prepared from Chinese hamster ovary (CHO) cells stably expressing either the human A1 receptor or human A3 receptor by the method of Salomon et al.., (Anal. Biochem. 58: 541-548,1974) as described previously with the following <BR> <BR> <BR> modifications (Jacobson et al., Neuropharmacol., 36: 1157-1165, 1997). 4- (3-Butoxy-4-methoxybenzyl) -2- imidazolidinone (Ro 20-1724, 20, uM, Calbiochem, San Diego, CA) was employed to inhibit phosphodiesterases rather than papaverine, and the NaCI concentration in the assay was 25 mM. Membranes were pretreated

with 2 units/mL adenosine deaminase, and the antagonist 11 (10, uM) at 30 C for 5 min prior to initiation of the adenylate cyclase assay. Adenylate cyclase was stimulated with forskolin (1 µM). Concentration- response data for the inhibition of adenylate cyclase activity by IB-MECA (human A3 receptor) were obtained.

Maximal inhibition of adenylate cyclase by IB-MECA at the human A3 receptor correlated to @60% of total stimulation, respectively. IC50 values were calculated using InPlot (GraphPad, San Diego, CAI. Kg values were calculated as described. (Alunlakshana et al., Brit. J. Pharmacol. Chemother. 14: 48, 1959).

Responses for agonist alone (0) or in combination with the A3 adenosine antagonist 11 (10 µM) were measured. IC50 values were 41.4 14.9 nM (IB-MECA alone), 1.08 0. 19 µM (+ 11). Compound 11 effectively antagonized the effects of an agonist in a functional A3 receptor assay, i. e. inhibition of adenylate cyclase in CHO cells expressing cloned human A3 receptors. 8,14 In this functional assay, IB-MECA inhibited adenylate cyclase via human A3 receptors with an IC50 of 41.4 14.9 nM (n = 3). In the presence of 10 µM of 11, the concentration response curve was shifted 26-fold to the right, with an IC50 of 1.08 # 0.19 µM (n = 3). From a Schild analysis (Alunlakshana et al., supra.), a KB value obtained for antagonism by 11 was 399 nM, i. e. approximately 1. 8-times the Ki value obtained in binding to human A3 receptors. <BR> <BR> <BR> <BR> <P> Radioligand binding studies. Binding of [³H]R-N6-phenylisopropyladenosine ( [³H] R-PIA) to A, receptors from rat cerebral cortex membranes and of f 3 HI-2- [4- [ (2-carboxyethyl) phenyllethylaminol-5'-N- ethylcarbamoyladenosine (HjCGS 21680) to A2A receptors from rat striatal membranes was performed as <BR> <BR> <BR> <BR> described previously (Schwabe et al., Naunyn Schmiedeberg Arch. Pharmacol. 313: 179-187, 1980; Jarvis et al., J. Pharmacol. Exp. Ther. 251: 888-893,1989) Adenosine deaminase (3 units/mL) was present during the preparation of the brain membranes, in a pre-incubation of 30 min at 30 °C, and during the incubation with the radioiigands. Nonspecific binding was determined in the presence of 10 µM (A1 receptors) or 20 |M (A receptors) 2-chloroadenosine.

Binding of [125 IIN6- (4-amino-3-iodabenzyl) -5'-N-methylcarbamoyladenosine ( [125 IIAB-MECA) 24 t0 membranes prepared from human embryonic kidney (HEK-293) cells stably expressing the human A3 receptor <BR> <BR> <BR> <BR> (Salvatore et al. , Proc.//atl. Acad. Sci. U.S.A. 90: 10365-10369, 1993), clone HS-21a (Receptor Biology, Inc., Beltsville, MD) or to membranes prepared from Chinese hamster ovary (CHO) cells stably expressing the rat A3 receptor (Zhou et al., Proc. Natl. Acad Sci. U. S. A. 89: 7432-7436,1992) was performed as described at 4°C <BR> <BR> <BR> <BR> (Olah et al., Mol. Pharmacol. i 45 : 978-982, 1994). The assay medium consisted of a buffer containing 10 mM Mg2+, 50 mM Tris, 3 units/mL adenosine deaminase, and 1 mM EDTA, at pH 8.0 (4 C). The glass incubation tubes contained 100 4L of the membrane suspension (0.3 mg protein/mL, stored at -80 °C in the same buffer), 50 |nL of [HAB-MECA (final concentration 0.3 nM), and 50 pL of a solution of the proposed antagonist.

Nonspecific binding was determined in the presence of 100 µM N6-phenylisopropyladenosine (NECA).

All non-radioactive compounds were initially dissolved in DMSO, and diluted with buffer to the final concentration, where the amount of DMSO never exceeded 1 %. Incubations were terminated by rapid filtration over Whatman GF/B filters, using a Brandell cell harvester (Brandell, Gaithersburg, MD). The tubes were rinsed three times with 3 mL buffer each.

At least five different concentrations of competitor, spanning 3 orders of magnitude adjusted appropriately for the IC50 of each compound, were used. lCso vaiues, calculated with the nonlinear regression method implemented in the InPlot program (Graph-PAD, San Diego, CA), were converted to apparent Kj values using the Cheng-Prusoff equation (Cheng et al., Biochem. Pharmacol. 22: 3099-3108,1973) and Kd values of <BR> <BR> <BR> <BR> 1.0 nM ( [3HIR-PIA) ; 15.5 nM ( [³H]CGS 21680); 0.59 nM and 1.46 nM ( [125 IIAB-MECA at human and rat A3 receptors, respectively).